KR102593230B1 - Composition for enhancing maturation of kidney organoid comprising TWIST1 inhibitor as an active ingredient - Google Patents

Composition for enhancing maturation of kidney organoid comprising TWIST1 inhibitor as an active ingredient Download PDF

Info

Publication number
KR102593230B1
KR102593230B1 KR1020220013653A KR20220013653A KR102593230B1 KR 102593230 B1 KR102593230 B1 KR 102593230B1 KR 1020220013653 A KR1020220013653 A KR 1020220013653A KR 20220013653 A KR20220013653 A KR 20220013653A KR 102593230 B1 KR102593230 B1 KR 102593230B1
Authority
KR
South Korea
Prior art keywords
cells
maturity
composition
twist1
kidney
Prior art date
Application number
KR1020220013653A
Other languages
Korean (ko)
Other versions
KR20230116568A (en
Inventor
김용균
박지환
남선아
이자운
김진원
이종영
Original Assignee
가톨릭대학교 산학협력단
광주과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 가톨릭대학교 산학협력단, 광주과학기술원 filed Critical 가톨릭대학교 산학협력단
Priority to KR1020220013653A priority Critical patent/KR102593230B1/en
Priority to PCT/KR2023/001181 priority patent/WO2023146292A1/en
Publication of KR20230116568A publication Critical patent/KR20230116568A/en
Application granted granted Critical
Publication of KR102593230B1 publication Critical patent/KR102593230B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0684—Cells of the urinary tract or kidneys
    • C12N5/0686—Kidney cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0697—Artificial constructs associating cells of different lineages, e.g. tissue equivalents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60—Transcription factors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 TWIST1 억제제를 유효성분으로 포함하는 신장 오가노이드 성숙도 향상용 조성물 등에 관한 것이다. 본 발명자들은 신경 세포와 신경교세포에서 특이적으로 발현되는 TWIST1이 적절한 신장 오가노이드 분화를 억제한다는 것을 확인하였고, TWIST1 억제제가 신장 오가노이드에서 총 족세포 수 및 관 형태의 변경 없이 비 표적세포를 감소시켰음을 확인하였을 뿐만 아니라, 비 표적세포 마커의 발현을 감소시키는 것을 확인하였다. 따라서, 본 발명에 따른 조성물을 활용하여 성숙도가 향상된 신장 오가노이드를 제조함으로써 질환 모델링, 약물 스크리닝, 및 재생의료 등에 유용하게 활용할 수 있을 것으로 기대된다.The present invention relates to a composition for improving kidney organoid maturity comprising a TWIST1 inhibitor as an active ingredient. The present inventors confirmed that TWIST1, which is specifically expressed in neurons and glial cells, inhibits appropriate kidney organoid differentiation, and that the TWIST1 inhibitor reduces non-target cells in kidney organoids without altering the total number of podocytes and tubular morphology. Not only was it confirmed that this was done, but it was also confirmed that the expression of non-target cell markers was reduced. Therefore, it is expected that the composition according to the present invention can be used to produce kidney organoids with improved maturity, which can be useful for disease modeling, drug screening, and regenerative medicine.

Description

TWIST1 억제제를 유효성분으로 포함하는 신장 오가노이드 성숙도 향상용 조성물{Composition for enhancing maturation of kidney organoid comprising TWIST1 inhibitor as an active ingredient}Composition for enhancing maturation of kidney organoid comprising TWIST1 inhibitor as an active ingredient}

본 발명은 TWIST1 억제제를 유효성분으로 포함하는 신장 오가노이드 성숙도 향상용 조성물 등에 관한 것이다.The present invention relates to a composition for improving kidney organoid maturity comprising a TWIST1 inhibitor as an active ingredient.

최근 줄기 세포 생물학의 발전은 인간 만능 줄기 세포(hPSC)에서 신장 오가노이드를 생성하기 위한 여러 프로토콜을 확립하였다. hPSC 유래 신장 오가노이드는 네프론과 유사한 구조를 가지고 있으며 실제 인간의 신장과 유사한 족세포, 근위 세뇨관, 및 원위 세뇨관을 갖는 분절된 구조를 포함한다. 최근 연구로 hPSC-신장 오가노이드는 인간 신장의 발달을 재현할 수 있으며 다양한 신장 질환을 모사할 수 있다는 것이 밝혀졌다. 향후 hPSC-신장 오가노이드는 신장 조직 재생 및 복구를 위한 유망한 세포 공급원이며, 다양한 신장 질환 모델에서 치료 도구로 적용될 수 있을 것으로 기대된다. 하지만 최근 기술의 발전에도 불구하고, hPSC에서 분화된 신장 오가노이드의 임상 적용에는 신장 오가노이드의 안전성, 미성숙, 및 제한된 혈관화 등의 극복해야 할 문제가 있다. 즉, 기존 프로토콜은 신장의 복잡한 구조와 기능을 완전히 재현하는 신장 오가노이드를 생성할 수 없어 신장 질환 모델링 및 재생 의학 모두에 적용이 제한된다. Recent advances in stem cell biology have established several protocols for generating kidney organoids from human pluripotent stem cells (hPSCs). hPSC-derived renal organoids have a nephron-like structure and contain segmented structures with podocytes, proximal tubules, and distal tubules, similar to real human kidneys. Recent studies have shown that hPSC-kidney organoids can replicate human kidney development and mimic various kidney diseases. In the future, hPSC-kidney organoids are a promising cell source for kidney tissue regeneration and repair and are expected to be applied as a therapeutic tool in various kidney disease models. However, despite recent technological advances, the clinical application of kidney organoids differentiated from hPSCs has challenges to overcome, such as safety, immaturity, and limited vascularization of kidney organoids. In other words, existing protocols cannot generate kidney organoids that fully recapitulate the complex structure and function of the kidney, limiting their application in both kidney disease modeling and regenerative medicine.

종래 연구에서, 단일 세포 RNA 시퀀싱(scRNAseq) 분석을 통해, 오가노이드 유래 세포 유형이 미성숙하다는 점, Morizane 프로토콜 및 Taksato 프로토콜에 따른 hPSC 유래 신장 오가노이드의 세포의 10%-20%가 비 신장세포(비 표적세포)라는 점이 밝혀졌다. 또한, 비 표적세포의 집단 중 주로 신경 세포가 상기 두 프로토콜에 따른 신장 오가노이드에 존재한다고 보고되고 있다. 신장 오가노이드의 임상적 사용을 위해서, 비 표적세포의 감소를 통한 신장 오가노이드의 제한된 미성숙을 극복하는 것이 필수적인 실정이다.In previous studies, single-cell RNA sequencing (scRNAseq) analysis showed that organoid-derived cell types were immature, and that 10%-20% of cells in hPSC-derived kidney organoids according to the Morizane protocol and Taksato protocol were non-renal cells ( It was revealed that it was a non-target cell. In addition, it has been reported that among the non-target cell populations, mainly nerve cells are present in kidney organoids according to the above two protocols. For clinical use of kidney organoids, it is essential to overcome the limited immaturity of kidney organoids through reduction of non-target cells.

본 발명자들은 본 발명의 TWIST1 억제제를 신장 오가노이드에 처리하여 총 족세포 수 및 관 형태의 변경 없이 비 표적세포가 감소되었음을 확인하였는바, 신장 오가노이드 성숙도 향상용 조성물 발명을 완성하였다. 따라서, 본 발명자들이 개발한 조성물을 활용하여 성숙도가 향상된 신장 오가노이드를 제조함으로써 재생 의학, 신장 약물 독성 검사, 난치성 신장 질환 신약 개발 등에 유용하게 사용될 것으로 기대된다. The present inventors confirmed that by treating kidney organoids with the TWIST1 inhibitor of the present invention, non-target cells were reduced without changing the total number of podocytes and tubular shape, and thus completed the invention of a composition for improving kidney organoid maturity. Therefore, it is expected that the composition developed by the present inventors will be used to produce kidney organoids with improved maturity, which will be useful in regenerative medicine, kidney drug toxicity testing, and new drug development for intractable kidney diseases.

한국공개특허 제10-2017-0110579호Korean Patent Publication No. 10-2017-0110579

이에, 본 발명자들은 신장 오가노이드 성숙도를 향상시키는 조성물을 발명하기 위해 예의 노력한 결과, TWIST1을 유효성분으로 포함하는 신장 오가노이드 성숙도 향상용 조성물을 개발하여 본 발명을 완성하였다.Accordingly, the present inventors made diligent efforts to invent a composition for improving kidney organoid maturity, and completed the present invention by developing a composition for improving kidney organoid maturity containing TWIST1 as an active ingredient.

이에 본 발명의 목적은 TWIST1(Twist Family BHLH Transcription Factor 1) 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물을 제공하는 것이다.Accordingly, the purpose of the present invention is to provide a composition for improving kidney organoid maturity, comprising a TWIST1 (Twist Family BHLH Transcription Factor 1) inhibitor as an active ingredient.

본 발명의 다른 목적은 본 발명의 조성물, 및 지시서를 포함하는 신장 오가노이드 성숙도 향상용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for improving kidney organoid maturity comprising the composition of the present invention and instructions.

본 발명의 또 다른 목적은 TWIST1 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물을 사용하여 제조되고, 하기 특징을 하나 이상 만족하는, 성숙도가 향상된 오가노이드를 제공하는 것이다.Another object of the present invention is to provide organoids with improved maturity, which are manufactured using a composition for improving kidney organoid maturity containing a TWIST1 inhibitor as an active ingredient, and which satisfy one or more of the following characteristics.

(a) 비 표적세포로 분화 감소;(a) Reduced differentiation into non-target cells;

(b) 비 표적세포 마커의 발현 감소;(b) decreased expression of non-target cell markers;

(c) 신경 세포의 감소;(c) reduction of nerve cells;

(d) 총 족세포(podocyte) 수의 유지; 및(d) maintenance of total podocyte number; and

(e) 관 형태(tubular morphology)의 유지.(e) Maintenance of tubular morphology.

본 발명의 또 다른 목적은 TWIST1 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물을 신장 오가노이드에 처리하는 단계를 포함하는, 신장 오가노이드 성숙도 향상 방법을 제공하는 것이다.Another object of the present invention is to provide a method for improving kidney organoid maturity, comprising treating kidney organoids with a composition for improving kidney organoid maturity, which includes a TWIST1 inhibitor as an active ingredient.

그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

상기 본 발명의 목적을 달성하기 위하여, 본 발명은 TWIST1(Twist Family BHLH Transcription Factor 1) 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물을 제공한다.In order to achieve the object of the present invention, the present invention provides a composition for improving kidney organoid maturity, comprising a TWIST1 (Twist Family BHLH Transcription Factor 1) inhibitor as an active ingredient.

또한, 본 발명은 본 발명의 조성물, 및 지시서를 포함하는 신장 오가노이드 성숙도 향상용 키트를 제공한다.Additionally, the present invention provides a kit for improving kidney organoid maturity comprising the composition of the present invention and instructions.

또한, 본 발명은 TWIST1 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물을 사용하여 제조되고, 하기 특징을 하나 이상 만족하는, 성숙도가 향상된 오가노이드를 제공한다:In addition, the present invention provides organoids with improved maturity, which are manufactured using a composition for improving kidney organoid maturity containing a TWIST1 inhibitor as an active ingredient, and which satisfy one or more of the following characteristics:

(a) 비 표적세포로 분화 감소;(a) Reduced differentiation into non-target cells;

(b) 비 표적세포 마커의 발현 감소;(b) decreased expression of non-target cell markers;

(c) 신경 세포의 감소;(c) reduction of nerve cells;

(d) 총 족세포(podocyte) 수의 유지; 및(d) maintenance of total podocyte number; and

(e) 관 형태(tubular morphology)의 유지.(e) Maintenance of tubular morphology.

또한, 본 발명은 TWIST1 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물을 신장 오가노이드에 처리하는 단계를 포함하는, 신장 오가노이드 성숙도 향상 방법을 제공한다.In addition, the present invention provides a method for improving kidney organoid maturity, comprising treating kidney organoids with a composition for improving kidney organoid maturity, which includes a TWIST1 inhibitor as an active ingredient.

본 발명의 일 구현예에서 상기 TWIST1 억제제는In one embodiment of the present invention, the TWIST1 inhibitor is

Harmine(7-methoxy-1-methyl-9H-pyrido[3,4-b]indole);Harmine (7-methoxy-1-methyl-9H-pyrido[3,4-b]indole);

Nifurtimox((E)-N-(3-methyl-1,1-dioxo-1,4-thiazinan-4-yl)-1-(5-nitrofuran-2-yl)methanimine); Nifurtimox ((E)-N-(3-methyl-1,1-dioxo-1,4-thiazinan-4-yl)-1-(5-nitrofuran-2-yl)methanimine);

Genistein(5,7-dihydroxy-3-(4-hydroxyphenyl)chromen-4-one);Genistein (5,7-dihydroxy-3-(4-hydroxyphenyl)chromen-4-one);

Vinblastine(methyl(1R,9R,10S,11R,12R,19R)-11-acetyloxy-12-ethyl-4-[(13S,15R,17S)-17-ethyl-17-hydroxy-13-methoxycarbonyl-1,11-diazatetracyclo[13.3.1.04,12.05,10]nonadeca-4(12),5,7,9-tetraen-13-yl]-10-hydroxy-5-methoxy-8-methyl-8,16-diazapentacyclo[10.6.1.01,9.02,7.016,19]nonadeca-2,4,6,13-tetraene-10-carboxylate); Vinblastine(methyl(1R,9R,10S,11R,12R,19R)-11-acetyloxy-12-ethyl-4-[(13S,15R,17S)-17-ethyl-17-hydroxy-13-methoxycarbonyl-1, 11-diazatetracyclo[13.3.1.0 4,12.0 5,10 ]nonadeca-4(12),5,7,9-tetraen-13-yl]-10-hydroxy-5-methoxy-8-methyl-8, 16-diazapentacyclo[10.6.1.0 1,9 .0 2,7 .0 16,19 ]nonadeca-2,4,6,13-tetraene-10-carboxylate);

Rifampicin([(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12,14,16,18,22-heptamethyl-26-[(E)-(4-methylpiperazin-1-yl)iminomethyl]-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta-1(29),2,4,9,19,21,25,27-octaen-13-yl] acetate); 및Rifampicin([(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12 ,14,16,18,22-heptamethyl-26-[(E)-(4-methylpiperazin-1-yl)iminomethyl]-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.1 4 ,7 .0 5,28 ]triaconta-1(29),2,4,9,19,21,25,27-octaen-13-yl] acetate); and

Meteneprost((Z)-7-[(1R,2R,3R)-3-hydroxy-2-[(E,3R)-3-hydroxy-4,4-dimethyloct-1-enyl]-5-methylidenecyclopentyl]hept-5-enoic acid)로 이루어지는 군으로부터 선택된 하나 이상인 것을 특징으로 할 수 있으나, 이에 제한되지 않는다.Meteneprost ((Z)-7-[(1R,2R,3R)-3-hydroxy-2-[(E,3R)-3-hydroxy-4,4-dimethyloct-1-enyl]-5-methylidenecyclopentyl]hept -5-enoic acid), but is not limited thereto.

본 발명의 다른 구현예에서 상기 신장 오가노이드는 하기 특징 중에 하나 이상을 만족하는 것을 특징으로 할 수 있으나, 이에 제한되지 않는다:In another embodiment of the present invention, the kidney organoid may be characterized as satisfying one or more of the following characteristics, but is not limited thereto:

(a) 비 표적세포로 분화 감소;(a) Reduced differentiation into non-target cells;

(b) 비 표적세포 마커의 발현 감소;(b) decreased expression of non-target cell markers;

(c) 신경 세포의 감소;(c) reduction of nerve cells;

(d) 총 족세포(podocyte) 수의 유지; 및(d) maintenance of total podocyte number; and

(e) 관 형태(tubular morphology)의 유지.(e) Maintenance of tubular morphology.

본 발명의 또 다른 구현예에서 상기 비 표적세포는 신경 세포, 신경교세포, 및 멜라닌 세포로 이루어지는 군으로부터 선택된 하나 이상인 것을 특징으로 할 수 있으나, 이에 제한되지 않는다.In another embodiment of the present invention, the non-target cells may be characterized as one or more selected from the group consisting of nerve cells, glial cells, and melanocytes, but are not limited thereto.

본 발명의 또 다른 구현예에서 상기 비 표적세포 마커는 MAP2(Microtubule-associated protein 2), CRABP1(Cellular Retinoic Acid Binding Protein 1), 및 MYLPF(Myosin Light Chain, Phosphorylatable, Fast Skeletal Muscle)로 이루어지는 군으로부터 선택된 하나 이상의 유전자인 것을 특징으로 할 수 있으나, 이에 제한되지 않는다.In another embodiment of the present invention, the non-target cell marker is from the group consisting of MAP2 (Microtubule-associated protein 2), CRABP1 (Cellular Retinoic Acid Binding Protein 1), and MYLPF (Myosin Light Chain, Phosphorylatable, Fast Skeletal Muscle). It may be characterized as one or more selected genes, but is not limited thereto.

본 발명의 또 다른 구현예에서 상기 TWIST1 억제제는 전체 조성물 대비 1 내지 250μM의 농도인 것을 특징으로 할 수 있으나, 이에 제한되지 않는다.In another embodiment of the present invention, the TWIST1 inhibitor may be present at a concentration of 1 to 250 μM relative to the total composition, but is not limited thereto.

본 발명자들은 신경 세포와 신경교세포에서 특이적으로 발현되는 TWIST1이 적절한 신장 오가노이드 분화를 억제한다는 것을 확인하였고, TWIST1 억제제가 신장 오가노이드에서 총 족세포 수 및 관 형태의 변경 없이 비 표적세포를 감소시켰음을 확인하였을 뿐만 아니라, 비 표적세포 마커의 발현을 감소시키는 것을 확인하였다. 따라서, 본 발명에 따른 조성물을 활용하여 성숙도가 향상된 신장 오가노이드를 제조함으로써 질환 모델링, 약물 스크리닝, 및 재생의료 등에 유용하게 활용할 수 있을 것으로 기대된다.The present inventors confirmed that TWIST1, which is specifically expressed in neurons and glial cells, inhibits appropriate kidney organoid differentiation, and that the TWIST1 inhibitor reduces non-target cells in kidney organoids without altering the total number of podocytes and tubular morphology. Not only was it confirmed that this was done, but it was also confirmed that the expression of non-target cell markers was reduced. Therefore, it is expected that the composition according to the present invention can be used to produce kidney organoids with improved maturity, which can be useful for disease modeling, drug screening, and regenerative medicine.

도 1은 네프론 유사 구조를 가진 iPSC 유래 신장 오가노이드에서 NPHS1, PECAM1, LTL, WT1, 및 Collagen Ⅳ의 면역형광염색의 이미지를 확인한 결과를 나타낸 것이다(스케일 바 = 50 μm).
도 2a는 UMAP(Uniform Manifold Approximation and Projection)를 사용하여, 신장 오가노이드의 12,482개의 세포에서 분석된 단일 세포 전사체를 시각화한 결과를 나타낸 것이다(NP, nephron progenitor; P.prolif, Podocyte proliferate; TP, tubule progenitor; PT, proximal tubule; LOH, loop of Henle; T.prolif, tubule proliferate; Mesen, mesenchyme; Endo, Endothelium; T.LOH, Thick ascending limb of Loop of Henle; CT, connecting tubule; Fibro, Fibroblast; G.EC, glomerular endothelium; A.EC, ascending casa recta endothelium; D.EC, descending vasa recta endothelium; PRV, proximal renal vesicle; DRV, distal renal vesicle; PSB, proximal S-shaped body; MSB, medial S-shaped body; DSB, distal S-shaped body; SP, stroma progenitor).
도 2b는 각 세포 유형에 특이적인 유전자의 발현을 도트 플롯으로 나타낸 것이다.
도 2c는 마트리젤 기반 프로토콜, 프로토콜 A, 및 프로토콜 B에 의해 배양된 신장 오가노이드의 세포 유형 구성을 나타낸 것이다. 각 열은 단일 데이터 세트에 해당한다.
도 2d는 PAGA 초기화 ForceAtlas2를 통해 신장 오가노이드 단일 세포 전사체의 토폴로지 트리 그래프를 나타낸 것이다.
도 3a는 SCENIC(single-cell regulatory network inference and clustering)를 사용하여 비 표적세포 유형의 유전자 조절 네트워크를 분석한 히트맵을 나타낸 것이다(적색, 마트리젤 기반 프로토콜, 프로토콜 A, 및 B에 의해 활성화 됨; 녹색, 마트리젤 기반 프로토콜, 프로토콜 A, 및 B에 의해 비활성화 됨).
도 3b는 SCENIC를 사용하여 네프론 세포 유형의 유전자 조절 네트워크를 분석한 히트맵을 나타낸 것이다(적색, 마트리젤 기반 프로토콜, 프로토콜 A, 및 B에 의해 활성화 됨; 녹색, 마트리젤 기반 프로토콜, 프로토콜 A, 및 B에 의해 비활성화 됨).
도 4a는 프로토콜 A 및 B로 배양된 신장 오가노이드의 신경 세포에서 BMP 상호작용을 보여주는 버블 플롯을 나타낸 것이다.
도 4b는 프로토콜 A 및 B로 배양된 신장 오가노이드의 신경교세포에서 BMP 상호작용을 보여주는 버블 플롯을 나타낸 것이다.
도 4c는 신경 세포에서 TWIST1 레귤론의 발현 수준을 보여주는 버블 플롯을 나타낸 것이다.
도 4d는 신경교세포에서 TWIST1 레귤론의 발현 수준을 보여주는 버블 플롯을 나타낸 것이다.
도 4e는 마트리젤 기반 프로토콜로 배양된 신장 오가노이드에서, TWIST1 억제제 처리 유무에 따른 MAP2, NPHS1, 및 LTL의 면역형광염색의 이미지를 나타낸 것이다.
도 4f는 MAP2, CRABP1 및 MYLPF의 qRT-PCR 분석 결과를 나타낸 것이다(수치는 평균 ± SEM; NS, 유의성 없음; ***, p<0.001; ****, p<0.0001).Figure 1 shows the results of immunofluorescence staining images of NPHS1, PECAM1, LTL, WT1, and Collagen IV in iPSC-derived kidney organoids with nephron-like structures (scale bar = 50 μm).
Figure 2a shows the results of visualizing the single cell transcriptome analyzed in 12,482 cells of kidney organoids using Uniform Manifold Approximation and Projection (UMAP) (NP, nephron progenitor; P.prolif, Podocyte proliferate; TP , tubule progenitor; PT, proximal tubule; LOH, loop of Henle; T.prolif, tubule proliferate; Mesen, mesenchyme; Endo, Endothelium; T.LOH, Thick ascending limb of Loop of Henle; CT, connecting tubule; Fibro, Fibroblast ; G.EC, glomerular endothelium; A.EC, ascending casa recta endothelium; D.EC, descending vasa recta endothelium; PRV, proximal renal vesicle; DRV, distal renal vesicle; PSB, proximal S-shaped body; MSB, medial S -shaped body; DSB, distal S-shaped body; SP, stroma progenitor).
Figure 2b shows the expression of genes specific to each cell type as a dot plot.
Figure 2C shows the cell type composition of kidney organoids cultured by the Matrigel-based protocol, Protocol A, and Protocol B. Each column corresponds to a single data set.
Figure 2d shows a topological tree graph of the kidney organoid single cell transcriptome via PAGA-initialized ForceAtlas2.
Figure 3A shows a heatmap analyzing the gene regulatory network of non-target cell types using single-cell regulatory network inference and clustering (SCENIC) (red, Matrigel-based protocol, activated by protocols A and B). ; green, disabled by Matrigel-based protocols, protocols A, and B).
Figure 3b shows a heatmap analyzing the gene regulatory network of nephron cell types using SCENIC (red, activated by Matrigel-based protocol, Protocol A, and B; green, Matrigel-based protocol, Protocol A, and disabled by B).
Figure 4A shows a bubble plot showing BMP interaction in neurons of kidney organoids cultured with protocols A and B.
Figure 4B shows a bubble plot showing BMP interaction in glial cells of kidney organoids cultured with protocols A and B.
Figure 4c shows a bubble plot showing the expression level of the TWIST1 regulon in neurons.
Figure 4d shows a bubble plot showing the expression level of the TWIST1 regulon in glial cells.
Figure 4e shows images of immunofluorescence staining of MAP2, NPHS1, and LTL with or without TWIST1 inhibitor treatment in kidney organoids cultured using Matrigel-based protocol.
Figure 4f shows the results of qRT-PCR analysis of MAP2, CRABP1, and MYLPF (values are mean ± SEM; NS, not significant; ***, p <0.001; ****, p < 0.0001).

본 발명의 일 실시예에서는 scRNAseq(Single-cell RNA sequencing)을 통해 신장 오가노이드의 세포 유형 및 세포 분화를 확인하여 신장 세포뿐만 아니라 비 표적세포로 분화될 수 있음을 확인하였다(실시예 1 참조).In one embodiment of the present invention, the cell type and cell differentiation of kidney organoids were confirmed through scRNAseq (Single-cell RNA sequencing), and it was confirmed that they can be differentiated into not only kidney cells but also non-target cells (see Example 1). .

본 발명의 일 실시예에서는 SCENIC(single-cell regulatory network inference and clustering)을 통해 비 표적세포 및 네프론 세포의 유전자 조절 네트워크를 분석하여, TWIST1이 적절한 신장 오가노이드 분화를 억제하는 것을 확인하였다(실시예 2 참조).In one example of the present invention, the gene regulatory network of non-target cells and nephron cells was analyzed through SCENIC (single-cell regulatory network inference and clustering), and it was confirmed that TWIST1 inhibits appropriate kidney organoid differentiation (Example 2).

본 발명의 일 실시예에서는 hPSC 유래 신장 오가노이드에서 총 족세포 수 및 관 형태 변경 없는 TWIST1 억제제의 비 표적세포 감소 효과를 확인하였고, 비 표적세포 마커(MAP2, CRABP1, MYLPF)의 유전자 발현이 감소하는 것을 확인하였다(실시예 3 참조). In one embodiment of the present invention, the effect of TWIST1 inhibitor on reducing non-target cells was confirmed in hPSC-derived kidney organoids without changing the total number of podocytes and tubular shape, and the gene expression of non-target cell markers (MAP2, CRABP1, MYLPF) was reduced. This was confirmed (see Example 3).

따라서, 본 발명자들은 본 발명의 조성물이 신장 오가노이드의 성숙도를 향상시켜, 질병 모델링, 약물 스크리닝, 및 재생의료 등에 유용하게 활용할 수 있음을 확인하였다.Therefore, the present inventors confirmed that the composition of the present invention can be usefully used in disease modeling, drug screening, and regenerative medicine by improving the maturity of kidney organoids.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

TWIST1(Twist Family BHLH Transcription Factor 1) 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물을 제공한다.Provided is a composition for improving kidney organoid maturity, comprising a TWIST1 (Twist Family BHLH Transcription Factor 1) inhibitor as an active ingredient.

본 발명에 있어서, TWIST1(Twist Family BHLH Transcription Factor 1)은 세포 계통 결정 및 분화에 관련 있는 유전자이다. 이는 신장 오가노이드에서 신경 세포 및 신경교세포에서 특이적으로 발현하고, 신장 오가노이드의 분화를 억제할 수 있으나, 이에 제한되지 않는다.In the present invention, TWIST1 (Twist Family BHLH Transcription Factor 1) is a gene related to cell lineage determination and differentiation. It is specifically expressed in neurons and glial cells in kidney organoids and can inhibit differentiation of kidney organoids, but is not limited thereto.

본 발명에 있어서, 상기 TWIST1 억제제는 Harmine(7-methoxy-1-methyl-9H-pyrido[3,4-b]indole);In the present invention, the TWIST1 inhibitor is Harmine (7-methoxy-1-methyl-9H-pyrido[3,4-b]indole);

Nifurtimox((E)-N-(3-methyl-1,1-dioxo-1,4-thiazinan-4-yl)-1-(5-nitrofuran-2-yl)methanimine);Nifurtimox ((E)-N-(3-methyl-1,1-dioxo-1,4-thiazinan-4-yl)-1-(5-nitrofuran-2-yl)methanimine);

Genistein(5,7-dihydroxy-3-(4-hydroxyphenyl)chromen-4-one);Genistein (5,7-dihydroxy-3-(4-hydroxyphenyl)chromen-4-one);

Vinblastine(methyl(1R,9R,10S,11R,12R,19R)-11-acetyloxy-12-ethyl-4-[(13S,15R,17S)-17-ethyl-17-hydroxy-13-methoxycarbonyl-1,11-diazatetracyclo[13.3.1.04,12.05,10]nonadeca-4(12),5,7,9-tetraen-13-yl]-10-hydroxy-5-methoxy-8-methyl-8,16-diazapentacyclo[10.6.1.01,9.02,7.016,19]nonadeca-2,4,6,13-tetraene-10-carboxylate); Vinblastine(methyl(1R,9R,10S,11R,12R,19R)-11-acetyloxy-12-ethyl-4-[(13S,15R,17S)-17-ethyl-17-hydroxy-13-methoxycarbonyl-1, 11-diazatetracyclo[13.3.1.0 4,12.0 5,10 ]nonadeca-4(12),5,7,9-tetraen-13-yl]-10-hydroxy-5-methoxy-8-methyl-8, 16-diazapentacyclo[10.6.1.0 1,9 .0 2,7 .0 16,19 ]nonadeca-2,4,6,13-tetraene-10-carboxylate);

Rifampicin([(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12,14,16,18,22-heptamethyl-26-[(E)-(4-methylpiperazin-1-yl)iminomethyl]-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta-1(29),2,4,9,19,21,25,27-octaen-13-yl] acetate); 및Rifampicin([(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12 ,14,16,18,22-heptamethyl-26-[(E)-(4-methylpiperazin-1-yl)iminomethyl]-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.1 4 ,7 .0 5,28 ]triaconta-1(29),2,4,9,19,21,25,27-octaen-13-yl] acetate); and

Meteneprost((Z)-7-[(1R,2R,3R)-3-hydroxy-2-[(E,3R)-3-hydroxy-4,4-dimethyloct-1-enyl]-5-methylidenecyclopentyl]hept-5-enoic acid)로 이루어지는 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다.Meteneprost ((Z)-7-[(1R,2R,3R)-3-hydroxy-2-[(E,3R)-3-hydroxy-4,4-dimethyloct-1-enyl]-5-methylidenecyclopentyl]hept -5-enoic acid), but is not limited thereto.

본 발명에 있어서, 상기 화합물의 획득 방법은 본 발명이 속한 분야에서 공지된 방법으로 화학적으로 합성하거나, 시판되는 물질을 사용할 수 있으나, 이에 제한되지 않는다.In the present invention, the method of obtaining the compound may be chemically synthesized by a method known in the field to which the present invention pertains, or a commercially available material may be used, but is not limited thereto.

본 발명에 있어서, 상기 TWIST1 억제제는 전체 조성물 대비 1 내지 250μM, 1 내지 200μM, 1 내지 150μM, 1 내지 100μM, 1 내지 50μM, 5 내지 250μM, 5 내지 200μM, 5 내지 150μM, 5 내지 100μM, 5 내지 50μM, 10 내지 250μM, 10 내지 200μM, 10 내지 150μM, 10 내지 100μM, 10 내지 50μM, 15 내지 250μM, 15 내지 200μM, 15 내지 150μM, 15 내지 100μM, 15 내지 50μM, 20 내지 250μM, 20 내지 200μM, 20 내지 150μM, 20 내지 100μM, 20 내지 50μM, 또는 20 내지 30μM의 농도일 수 있으며, 일 실시예에 따르면 25μM의 농도일 수 있으나, 이에 제한되지 않는다.In the present invention, the TWIST1 inhibitor is 1 to 250 μM, 1 to 200 μM, 1 to 150 μM, 1 to 100 μM, 1 to 50 μM, 5 to 250 μM, 5 to 200 μM, 5 to 150 μM, 5 to 100 μM, 5 to 10 μM, compared to the total composition. 50 μM, 10 to 250 μM, 10 to 200 μM, 10 to 150 μM, 10 to 100 μM, 10 to 50 μM, 15 to 250 μM, 15 to 200 μM, 15 to 150 μM, 15 to 100 μM, 15 to 50 μM, 20 to 250 μM μM, 20 to 200 μM, The concentration may be 20 to 150 μM, 20 to 100 μM, 20 to 50 μM, or 20 to 30 μM, and according to one embodiment, it may be 25 μM, but is not limited thereto.

본 발명에 있어서, 상기 신장 오가노이드는 하기 특징 중에 하나 이상을 만족할 수 있으나, 이에 제한되지 않는다:In the present invention, the kidney organoid may satisfy one or more of the following characteristics, but is not limited thereto:

(a) 비 표적세포로 분화 감소;(a) Reduced differentiation into non-target cells;

(b) 비 표적세포 마커의 발현 감소;(b) decreased expression of non-target cell markers;

(c) 신경 세포의 감소;(c) reduction of nerve cells;

(d) 총 족세포(podocyte) 수의 유지; 및(d) maintenance of total podocyte number; and

(e) 관 형태(tubular morphology)의 유지.(e) Maintenance of tubular morphology.

본 발명에 있어서, 상기 비 표적세포는 신경 세포, 신경교세포, 및 멜라닌 세포로 이루어지는 군으로부터 선택된 하나 이상일 수 있으나, 이제 제한되지 않는다.In the present invention, the non-target cells may be one or more selected from the group consisting of nerve cells, glial cells, and melanocytes, but are not limited thereto.

본 발명에 있어서, 상기 비 표적세포로 분화 감소는 총 족세포(podocyte) 수, 또는 관 형태(tubular morphology)의 변경이 없는 것을 특징으로 할 수 있으나, 이에 제한되지 않는다. In the present invention, the reduction in differentiation into non-target cells may be characterized by no change in the total number of podocytes or tubular morphology, but is not limited thereto.

본 발명에 있어서, 상기 총 족세포 수, 또는 관 형태의 유지는 신장 오가노이드가 네프론 세포로 분화하는데 영향을 주지 않으면서, 비 표적세포로의 분화를 억제시켰다는 의미일 수 있으나, 이에 제한되지 않는다.In the present invention, the maintenance of the total number of podocytes or the tubular shape may mean that differentiation into non-target cells is suppressed without affecting the differentiation of kidney organoids into nephron cells, but is not limited thereto. .

본 발명에 있어서, 상기 비 표적세포 마커는 MAP2(Microtubule-associated protein 2), CRABP1(Cellular Retinoic Acid Binding Protein 1), 및 MYLPF(Myosin Light Chain, Phosphorylatable, Fast Skeletal Muscle)로 이루어지는 군으로부터 선택된 하나 이상의 유전자일 수 있으나, 이에 제한되지 않는다.In the present invention, the non-target cell marker is one or more selected from the group consisting of MAP2 (Microtubule-associated protein 2), CRABP1 (Cellular Retinoic Acid Binding Protein 1), and MYLPF (Myosin Light Chain, Phosphorylatable, Fast Skeletal Muscle). It may be a gene, but is not limited thereto.

본 발명에 있어서, 상기 신장 오가노이드 성숙도 향상은 신장 오가노이드에서 비 표적세포(신경 세포, 신경교세포, 멜라닌 세포 등)가 아닌 네프론 세포로 분화가 촉진되는 것을 의미할 수 있으나, 이에 제한되지 않는다.In the present invention, improving kidney organoid maturity may mean promoting differentiation of kidney organoids into nephron cells rather than non-target cells (neurons, glial cells, melanocytes, etc.), but is not limited thereto.

또한, 상기 신장 오가노이드 성숙도 향상은 신장 오가노이드가 비 표적세포로 분화 감소; 비 표적세포 마커의 발현 감소; 신경 세포의 감소; 총 족세포(podocyte) 수의 유지; 및 관 형태(tubular morphology)의 유지의 특징 중 하나 이상을 만족하는 것을 의미할 수 있으나, 이에 제한되지 않는다.In addition, the improvement in kidney organoid maturation reduces the differentiation of kidney organoids into non-target cells; Reduced expression of non-target cell markers; Decrease in nerve cells; maintenance of total podocyte number; It may mean satisfying one or more of the characteristics of maintaining tubular morphology, but is not limited thereto.

본 발명은 본 발명의 조성물 및 지시서를 포함하는 신장 오가노이드 성숙도 향상용 키트를 제공한다.The present invention provides a kit for improving kidney organoid maturity comprising the composition and instructions of the present invention.

본 발명에 있어서, 상기 지시서는 신장 오가노이드에 TWIST1 억제제를 유효성분으로 포함하는 조성물을 처리하는 단계를 포함할 수 있으나, 이에 제한되지 않는다.In the present invention, the instructions may include, but are not limited to, the step of treating kidney organoids with a composition containing a TWIST1 inhibitor as an active ingredient.

본 발명에 있어서, 상기 TWIST1 억제제는 신장 오가노이드 배양 1 내지 50일째, 1 내지 40일째, 1 내지 30일째, 1 내지 20일째, 5 내지 50일째, 5 내지 40일째, 5 내지 30일째, 5 내지 20일째, 10 내지 50일째, 10 내지 40일째, 10 내지 30일째, 또는 10 내지 20일째에 투여될 수 있으며, 일 실시예에 따르면 신장 오가노이드 배양 15일째에 투여될 수 있으나, 이에 제한되지 않는다.In the present invention, the TWIST1 inhibitor is used for kidney organoid culture on days 1 to 50, days 1 to 40, days 1 to 30, days 1 to 20, days 5 to 50, days 5 to 40, days 5 to 30, and days 5 to 30. It may be administered on the 20th day, 10 to 50 days, 10 to 40 days, 10 to 30 days, or 10 to 20 days, and according to one embodiment, it may be administered on the 15th day of kidney organoid culture, but is not limited thereto. .

본 발명에 있어서, 상기 오가노이드는 마트리젤 기반 프로토콜, 프로토콜 A, 또는 프로토콜 B을 통해 배양될 수 있으나, 이에 제한되지 않는다. 상기 프로토콜 A, 또는 B는 탈세포화된 신장 세포외기질로 배양용기를 코팅하는 단계; 상기 코팅된 배양접시에 줄기세포를 배치하는 단계; 마트리젤을 추가하는 단계; 및 오가노이드 분화용 조성물을 사용하여 신장 오가노이드로 분화시키는 단계를 포함할 수 있으나, 이에 제한되지 않는다.In the present invention, the organoids may be cultured through Matrigel-based protocol, Protocol A, or Protocol B, but are not limited thereto. Protocol A or B includes coating a culture vessel with decellularized kidney extracellular matrix; Placing stem cells on the coated culture dish; Adding Matrigel; And it may include, but is not limited to, differentiating into kidney organoids using a composition for organoid differentiation.

또한, 본 발명은 TWIST1 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물을 사용하여 제조되고, 하기 특징을 하나 이상 만족하는, 성숙도가 향상된 오가노이드를 제공한다:In addition, the present invention provides organoids with improved maturity, which are manufactured using a composition for improving kidney organoid maturity containing a TWIST1 inhibitor as an active ingredient, and which satisfy one or more of the following characteristics:

(a) 비 표적세포로 분화 감소;(a) Reduced differentiation into non-target cells;

(b) 비 표적세포 마커의 발현 감소;(b) decreased expression of non-target cell markers;

(c) 신경 세포의 감소;(c) reduction of nerve cells;

(d) 총 족세포(podocyte) 수의 유지; 및(d) maintenance of total podocyte number; and

(e) 관 형태(tubular morphology)의 유지.(e) Maintenance of tubular morphology.

본 발명에 있어서, 상기 비 표적세포는 신경 세포, 신경교세포, 및 멜라닌 세포로 이루어지는 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다.In the present invention, the non-target cells may be one or more selected from the group consisting of nerve cells, glial cells, and melanocytes, but are not limited thereto.

본 발명에 있어서, “오가노이드(Organoid)”는 줄기세포나 장기 기원세포로부터 분리한 세포를 3차원 배양법으로 다시 응집·재조합하여 만든 장기 특이적 세포집합체를 의미하는 것으로서, 생체 내 상태와 유사한 방식으로 세포 분류와 공간적으로 제한된 계통 예정(lineage commitment)을 통해 자가-조직화(또는 자가-패턴화)하는 장기 특이적인 세포 유형의 장기 유사체이다. 따라서, 오가노이드는 세포의 본래 생리학을 나타내며, 세포 혼합물(한정된 세포 유형뿐만 아니라 잔존 줄기세포, 근접 생리학적 니치(physiological niche)를 모두 포함) 본래의 상태를 모방하는 해부학적 구조를 가진다. 줄기세포는 조직 또는 오가노이드 단편으로부터 분리될 수 있다. 오가노이드가 생성된 세포는 생체 내(in vivo)에서 장기와 매우 유사한 구조를 형성하도록 자가-조직화된 다중 세포 유형을 나타내는 장기-유사 조직을 형성하도록 분화한다. 따라서, 오가노이드는 생체 내 발달과 매우 유사한 시스템에서의 인간 장기와 인간 장기 발달을 연구하기 위한 훌륭한 모델이다. In the present invention, “organoid” refers to an organ-specific cell aggregate made by aggregating and recombining cells isolated from stem cells or organ origin cells using a three-dimensional culture method, in a manner similar to the in vivo state. It is an organ analog of an organ-specific cell type that self-organizes (or self-patterns) through cell sorting and spatially restricted lineage commitment. Thus, organoids represent the native physiology of the cells and have anatomical structures that mimic the native state of the cell mixture (including both defined cell types as well as residual stem cells and proximate physiological niches). Stem cells can be isolated from tissue or organoid fragments. The cells from which organoids are generated differentiate to form organ-like tissues that exhibit multiple cell types that self-organize to form structures very similar to organs in vivo. Therefore, organoids are an excellent model for studying human organs and human organ development in a system that closely resembles in vivo development.

본 발명에 있어서, 상기 신장 오가노이드를 질환 모델링, 생체 장기 모사 모델, 또는 약물 스크리닝에 사용할 수 있으나, 이에 제한되는 것은 아니다. 상기 약물 스크리닝은 환자 개인의 질환 특성에 맞는 약물을 스크리닝 하는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the kidney organoids can be used for disease modeling, biological organ simulation models, or drug screening, but are not limited thereto. The drug screening may be screening for a drug suited to the patient's individual disease characteristics, but is not limited thereto.

본 발명은 TWIST1 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물을 신장 오가노이드에 처리하는 단계를 포함하는, 신장 오가노이드 성숙도 향상 방법을 제공한다.The present invention provides a method for improving kidney organoid maturity, comprising treating kidney organoids with a composition for improving kidney organoid maturity, which includes a TWIST1 inhibitor as an active ingredient.

본 발명에서 사용되는 용어는 본 발명에서의 기능을 고려하면서 가능한 현재 널리 사용되는 일반적인 용어들을 선택하였으나, 이는 당 분야에 종사하는 기술자의 의도 또는 판례, 새로운 기술의 출현 등에 따라 달라질 수 있다. 또한, 특정한 경우는 출원인이 임의로 선정한 용어도 있으며, 이 경우 해당되는 발명의 설명 부분에서 상세히 그 의미를 기재할 것이다. 따라서 본 발명에서 사용되는 용어는 단순한 용어의 명칭이 아닌, 그 용어가 가지는 의미와 본 발명의 전반에 걸친 내용을 토대로 정의되어야 한다.The terms used in the present invention are general terms that are currently widely used as much as possible while considering the function in the present invention, but this may vary depending on the intention or precedent of a person working in the art, the emergence of new technology, etc. In addition, in certain cases, there are terms arbitrarily selected by the applicant, and in this case, the meaning will be described in detail in the description of the relevant invention. Therefore, the terms used in the present invention should be defined based on the meaning of the term and the overall content of the present invention, rather than simply the name of the term.

본 발명의 명세서 전체에서, 어떤 부분이 어떤 구성 요소를 "포함" 한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성 요소를 제외하는 것이 아니라 다른 구성 요소를 더 포함할 수 있는 것을 의미한다. 본 발명의 명세서 전체에서 사용되는 정도의 용어 "약", "실질적으로" 등은 언급된 의미에 고유한 제조 및 물질 허용오차가 제시될 때 그 수치에서 또는 그 수치에 근접한 의미로 사용되고, 본 발명의 이해를 돕기 위해 정확하거나 절대적인 수치가 언급된 개시 내용을 비양심적인 침해자가 부당하게 이용하는 것을 방지하기 위해 사용된다. Throughout the specification of the present invention, when a part is said to “include” a certain component, this means that it may further include other components rather than excluding other components unless specifically stated to the contrary. The terms "about", "substantially", etc. used throughout the specification of the present invention are used to mean at or close to that value when manufacturing and material tolerances inherent in the stated meaning are presented, and the present invention Precise or absolute figures are used to aid understanding and to prevent unscrupulous infringers from taking unfair advantage of the disclosure.

이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Below, preferred embodiments are presented to aid understanding of the present invention. However, the following examples are provided only to make the present invention easier to understand, and the content of the present invention is not limited by the following examples.

[실험예][Experimental example]

실험예 1. 신장의 탈세포화Experimental Example 1. Decellularization of kidney

신선한 돼지 신장은 신피막(renal capsule)과 신장 주변의 지방을 제거하여 준비하였다. 신장의 시상절편은 신장 내 지방과 신수질을 제거하여 준비하였다. 남아있는 신장 피질 조직을 냉동하고, 0.1 내지 0.3mm 두께로 슬라이스하여, 증류수로 30분 동안 3회 세척하였다. 다음으로, 상기 슬라이스를 1M NaCl(Samchun Pure Chemicals)에 용해된 0.5% Triton X-100(Sigma-Aldrich)으로 16시간 동안 처리하였다. 그런 다음, 1시간 동안 3번 더 세척하였다. 남아 있는 세포 성분을 제거하기 위하여 DNase를 37℃에서 6-7시간 동안 투여하였다. DNase가 처리된 조직 절편을 PBS로 12시간 동안 세척한 후, 0.1% 과아세트산(peracetic acid) 용액으로 1시간 동안 멸균하고, 증류수로 다시 세척하였다. 탈세포화된 조직을 -80℃에서 동결 건조시킨 후, 생화학적 특성화 및 신장 dECM 하이드로겔 제조에 사용하였다.Fresh pig kidney was prepared by removing the renal capsule and fat around the kidney. Sagittal sections of the kidney were prepared by removing intrarenal fat and renal medulla. The remaining renal cortical tissue was frozen, sliced to a thickness of 0.1 to 0.3 mm, and washed three times for 30 minutes with distilled water. Next, the slices were treated with 0.5% Triton X-100 (Sigma-Aldrich) dissolved in 1M NaCl (Samchun Pure Chemicals) for 16 hours. Then, it was washed three more times for 1 hour. To remove remaining cellular components, DNase was administered at 37°C for 6-7 hours. The DNase-treated tissue sections were washed with PBS for 12 hours, sterilized with 0.1% peracetic acid solution for 1 hour, and washed again with distilled water. The decellularized tissue was freeze-dried at -80°C and then used for biochemical characterization and preparation of kidney dECM hydrogel.

실험예 2. 신장 dECM 용액의 제조Experimental Example 2. Preparation of kidney dECM solution

신장 dECM 용액을 제조하기 위해, 동결건조된 탈세포화된 신장 조직 10mg을 0.5M 아세트산(acetic acid) 용액 1ml에 용해시켰다. 그런 다음, 소화(digestion)를 위하여 동결건조된 신장 조직 10mg마다 1mg의 펩신(Sigma-Aldrich)을 처리하였다. 혼합물을 50ml의 원뿔형 튜브에 담고, 자석이 포함된 교반기 플레이트에서 24시간 동안 교반하였다. 이는 dECM 용액이 완전히 용해되는 데 필요한 예상 시간이다.To prepare kidney dECM solution, 10 mg of lyophilized decellularized kidney tissue was dissolved in 1 ml of 0.5 M acetic acid solution. Then, for digestion, 1 mg of pepsin (Sigma-Aldrich) was treated for every 10 mg of freeze-dried kidney tissue. The mixture was placed in a 50 ml conical tube and stirred for 24 hours on a stirrer plate containing a magnet. This is the estimated time required for the dECM solution to completely dissolve.

실험예 3. 신장 오가노이드 분화Experimental Example 3. Kidney organoid differentiation

WTC11 및 CMC11 iPSC 세포주는 가톨릭대학교(남성 기증자)로부터 입수하였다. 계대수 30에서 60 사이의 세포를 사용하였으며, 신장 dECM이 없는 신장 오가노이드 분화는 이전에 설명한 대로 수행하였다. 간단히 말해서, hPSC는 0.1% GelTrex(Thermo Fisher Scientific)로 코팅된 24-웰 유리 플레이트(LabTek)에 mTeSR1 배지(Stem Cell Technologies) + 10μM Y27632(LC Laboratories)와 함께 5,000 세포/웰의 밀도로 플레이팅 하였다(1일차). 배지를 각각 2일차에는 1.5% GelTrex를 포함하는 mTeSR1로, 3일차에는 mTeSR1로 교환하였고, 4일차에는 RPMI(Thermo Fisher Scientific) + 11 μM CHIR99021(Tocris)로 교환하였으며, 5일차에는 RPMI + B27 보충제(Thermo Fisher Scientific)로 교환하였다. 그리고 이후에는 신장 오가노이드의 분화를 촉진시키기 위해 2-3일마다 B27 보충제가 함유된 RPMI(Thermo Fisher Scientific) 배지를 공급하였다.WTC11 and CMC11 iPSC cell lines were obtained from Catholic University of Korea (male donor). Cells at passage numbers between 30 and 60 were used, and renal organoid differentiation without renal dECM was performed as previously described. Briefly, hPSCs were plated at a density of 5,000 cells/well in 24-well glass plates (LabTek) coated with 0.1% GelTrex (Thermo Fisher Scientific) with mTeSR1 medium (Stem Cell Technologies) + 10 μM Y27632 (LC Laboratories). (Day 1). The medium was changed to mTeSR1 with 1.5% GelTrex on day 2, mTeSR1 on day 3, RPMI (Thermo Fisher Scientific) + 11 μM CHIR99021 (Tocris) on day 4, and RPMI + B27 supplement on day 5. (Thermo Fisher Scientific). Afterwards, RPMI (Thermo Fisher Scientific) medium containing B27 supplement was supplied every 2-3 days to promote differentiation of kidney organoids.

신장 dECM을 기반으로 한 신장 오가노이드 분화를 위해, 두 가지 프로토콜을 개발하였다. 두 가지 프로토콜은 Freedman의 프로토콜(Nature communications 2015, 6 (1), 1.)을 전반적으로 따랐으나, 다음과 같이 수정하였다.For kidney organoid differentiation based on kidney dECM, two protocols were developed. The two protocols generally followed Freedman's protocol (Nature communications 2015, 6 (1), 1.), but were modified as follows.

프로토콜 A에서, 24-웰 플레이트의 각 웰을 희석된 신장 dECM(0.1%)으로 코팅한 다음, 해리되고 미분화된 인간 iPSC를 균일하게 배치하였다. 24시간 후, 1.5% 마트리젤을 첨가함으로써, 인간 iPSC를 신장 dECM의 하부 층과 마트리젤의 상부 층 사이에 끼웠다. 4일째에, 신장 오가노이드 분화를 촉진하기 위해 CHIR을 처리하였다. 그 후, 2-3일마다 B27 보충제가 함유된 RPMI(Thermo Fisher Scientific) 배지를 공급하였다.In Protocol A, each well of a 24-well plate was coated with diluted kidney dECM (0.1%), and then dissociated and undifferentiated human iPSCs were evenly placed. After 24 hours, human iPSCs were sandwiched between the lower layer of kidney dECM and the upper layer of Matrigel by adding 1.5% Matrigel. On day 4, CHIR was treated to promote kidney organoid differentiation. Afterwards, RPMI (Thermo Fisher Scientific) medium containing B27 supplement was supplied every 2-3 days.

프로토콜 B는 프로토콜 A와 전반적으로 비슷하지만, 혈관 네트워크를 강화하기 위해 6, 9, 12, 및 14일에 VEGF를 처리하고, 족세포 분화를 강화하기 위해 12일에 SB-431542를 처리하였다.Protocol B was broadly similar to Protocol A, but treated with VEGF on days 6, 9, 12, and 14 to enhance the vascular network and with SB-431542 on day 12 to enhance podocyte differentiation.

실험예 4. 면역형광분석(Immunofluorescent analyses)Experimental Example 4. Immunofluorescent analyzes

면역형광법 분석을 위해, 달리 언급되지 않는 한, 오가노이드는 18일째 되는 날에 고정하였다. 구체적으로, 고정을 위해 동일한 부피의 PBS(Thermo Fisher Scientific) 및 8% 파라포름알데히드(Electron Microscopy Sciences)를 배지에 15분 동안 첨가한 후, 샘플을 PBS로 3회 세척하였다. 그 후, 고정된 오가노이드 배양물을 5% 당나귀 혈청(donkey serum, Millipore) + 0.3% Triton-X-100/PBS으로 블로킹(blocking)하였다. 그런 다음. 3% 소 혈청 알부민(bovine serum albumin, Sigma) + 1차 항체[항-콜라겐 IV(Southern Biotech 1340-01, 1:300), 항-LTL(Vector Labs FL-1321, 1:200 희석), 항-MAP2(Sigma-Aldrich M4403, 1: 200), anti-NPHS1(R&D AF4269, 1:200), anti-Pecam1(Abcam ab9498, 1:200) 및 anti-WT1(Abcam ab89901, 1:200)]가 포함된 PBS에서 밤새 인큐베이션한 후 세척하고, AlexaFluor 2차 항체(Invitrogen)와 인큐베이션하였다. 그 후, 세척하여 DAPI로 염색하거나 Vectashield H-1000를 이용하여 마운트(mount)하였다. Zeiss LSM 700 공초점 현미경(Carl Zeiss, Germany) 및 ZEN 3.1 소프트웨어를 사용하여 이미지를 획득하였다.For immunofluorescence analysis, organoids were fixed on day 18, unless otherwise noted. Specifically, for fixation, equal volumes of PBS (Thermo Fisher Scientific) and 8% paraformaldehyde (Electron Microscopy Sciences) were added to the medium for 15 minutes, and then the samples were washed three times with PBS. Afterwards, the fixed organoid culture was blocked with 5% donkey serum (Millipore) + 0.3% Triton-X-100/PBS. after that. 3% bovine serum albumin (Sigma) + primary antibodies [anti-Collagen IV (Southern Biotech 1340-01, 1:300), anti-LTL (Vector Labs FL-1321, 1:200 dilution), anti -MAP2 (Sigma-Aldrich M4403, 1: 200), anti-NPHS1 (R&D AF4269, 1:200), anti-Pecam1 (Abcam ab9498, 1:200) and anti-WT1 (Abcam ab89901, 1:200)] After incubation in the included PBS overnight, the cells were washed and incubated with AlexaFluor secondary antibody (Invitrogen). Afterwards, it was washed and stained with DAPI or mounted using Vectashield H-1000. Images were acquired using a Zeiss LSM 700 confocal microscope (Carl Zeiss, Germany) and ZEN 3.1 software.

실험예 5. 실시간 정량 중합효소 연쇄반응 분석(Real-time quantitative PCR analysis)Experimental Example 5. Real-time quantitative PCR analysis

신장 오가노이드 샘플을 채취하고 RNAiso Plus 키트(Takara, Japan)를 사용하여 제조사의 지침에 따라 각 샘플로부터 총 RNA를 분리하였다. RT-qPCR용 Maxima First Strand cDNA 합성 키트(Thermo Fisher Scientific, USA)를 사용하여 상보적 DNA를 합성하였다. 유전자 발현은 실시간 PCR(Applied Biosystems, Foster City, CA)을 사용하여 Power SYBR Green PCR Master Mix(Applied Biosystems, USA)로 분석하였다. 실험에 사용된 프라이머 서열은 하기 표 1에 나타내었다. 모든 qRT-PCR은 3회 수행되었고, 상대적 mRNA 발현 수준은 2-ΔΔCt 방법을 사용하여 결정하였다.Kidney organoid samples were collected, and total RNA was isolated from each sample using the RNAiso Plus kit (Takara, Japan) according to the manufacturer's instructions. Complementary DNA was synthesized using the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo Fisher Scientific, USA). Gene expression was analyzed with Power SYBR Green PCR Master Mix (Applied Biosystems, USA) using real-time PCR (Applied Biosystems, Foster City, CA). Primer sequences used in the experiment are shown in Table 1 below. All qRT-PCRs were performed in triplicate, and relative mRNA expression levels were determined using the 2 -ΔΔCt method.

유전자명gene name 정방향/역방향Forward/reverse 서열번호sequence number MAP2MAP2 F-5’ CTCAGCACCGCTAACAGAGGF-5’ CTCAGCACCGCTAACAGAGG 1One R-5’ CATTGGCGCTTCGGACAAGR-5’ CATTGGCGCTTCGGACAAG 22 CRABP1CRABP1 F-5’ GCAGCAGCGAGAATTTCGACF-5’ GCAGCAGCGAGAATTTCGAC 33 R-5’ CGTGGTGGATGTCTTGATGTAGAR-5’ CGTGGTGGATGTCTTGATGTAGA 44 MYLPFMYLPF F-5’ GAAGGACAGTAGAGGGCGGAAF-5’ GAAGGACAGTAGAGGGCGGAA 55 R-5’ TCTGGTCGATCACAGTGAAGGR-5’ TCTGGTCGATCACAGTGAAGG 66

실험예 6. 단일 세포 RNA seq의 처리 및 분석Experimental Example 6. Processing and analysis of single cell RNA seq

세포 및 유전자의 품질 제어 필터링은 800개 이상의 검출된 전사체를 갖는 세포만을 사용하여 수행하였다. 0개 및 15개 이상의 mtDNA 판독 횟수를 갖는 세포는 제외하였다. 잠재적인 이중체를 제거하기 위해, 5,000개 이상의 유전자가 검출된 단일 세포를 필터링하였다. 마지막으로, 12,482개의 단일 세포가 남았고, Seurat R 패키지(v.3.2.3)로 처리하였다. 배치 효과(batch effect)를 피하기 위해 fast MNN 방법을 사용하여 서로 다른 배치에 있는 세포의 MNN(Mutual Nearest Neighbors)을 감지하였다.Quality control filtering of cells and genes was performed using only cells with more than 800 detected transcripts. Cells with mtDNA read counts of 0 and more than 15 were excluded. To remove potential doublets, single cells in which more than 5,000 genes were detected were filtered. Finally, 12,482 single cells remained, which were processed with the Seurat R package (v.3.2.3). To avoid batch effect, the fast MNN method was used to detect MNN (Mutual Nearest Neighbors) of cells in different batches.

총 신장 오가노이드 세포는 30개의 별개의 클러스터로 분류되었고, 차등적으로 발현된 유전자(10<DEGs)를 기반으로 병합하였다. 다음으로, 세포 유형을 알려진 생물학적 유형으로 분류하는 데 사용되는 기존 마커를 기반으로 18개의 클러스터에 주석을 달았다. 기존 마커는 하기 표 2에 나타내었다. Seurat R 패키지를 사용하여, 원치 않는 세포는 미토콘드리아 유전자 표현과 고유한 유전자 수의 차이에 따라 걸러졌다. UMAP 차원 축소 후 Seurat 패키지를 사용하여 다운스트림 분석을 수행하였다. 단일 세포은 Seurat(v.3.2.3) 패키지의 FindNeighbors(차원 축소를 위해 30개의 PC 사용) 및 FindClusters function(해상도=1)을 사용하여 클러스터링하였다.Total kidney organoid cells were sorted into 30 distinct clusters and merged based on differentially expressed genes (10<DEGs). Next, we annotated 18 clusters based on existing markers used to classify cell types into known biological types. Existing markers are shown in Table 2 below. Using the Seurat R package, unwanted cells were filtered out based on differences in mitochondrial gene expression and unique gene count. After UMAP dimensionality reduction, downstream analysis was performed using the Seurat package. Single cells were clustered using the FindNeighbors (30 PCs used for dimensionality reduction) and FindClusters functions (resolution = 1) of the Seurat (v.3.2.3) package.

세포종류Cell type 약자abbreviation 기존 마커 리스트List of existing markers Nephron progenitorsNephron progenitors NPCNPC SIX1, SIX2, CITED1, SALL1, OSR1SIX1, SIX2, CITED1, SALL1, OSR1 Pretubular aggregatePretubular aggregate PTAPTA LHX1, WNT4, CCND1LHX1, WNT4, CCND1 Renal vesicle & comma-shaped bodyRenal vesicle & comma-shaped body RVCSBa/bRVCSBa/b LHX1, PAX8, JAG1, PAX2, SFRP2LHX1, PAX8, JAG1, PAX2, SFRP2 S-shaped body, medial and distal segmentsS-shaped body, medial and distal segments SSBm/dSSBm/d HNF1B, POU3F3, SIM2, SOX9, IRX2HNF1B, POU3F3, SIM2, SOX9, IRX2 S-shaped body, proximal segmentS-shaped body, proximal segment SSBprSSBpr CDH6, HNF1A, AMNCDH6, HNF1A, AMN S-shaped body, proximal segment (podocyte precursor cells)S-shaped body, proximal segment (podocyte precursor cells) SSBpodSSBpod FOXC2, MAFB, OLFM3, WT1FOXC2, MAFB, OLFM3, WT1 PodocytesPodocytes PodPod NPHS1, NPHS2, PODXL, PTPRONPHS1, NPHS2, PODXL, PTPRO Distal tubule & loop of HenleDistal tubule & loop of Henle DTLHDTLH SLC12A3, SLC12A1, UMOD, PAPPA2, MALSLC12A3, SLC12A1, UMOD, PAPPA2, MAL Early proximal tubuleEarly proximal tubule ErPrTErPrT SLC34A1, SLC13A1, CLDN1, CUBN, LRP2SLC34A1, SLC13A1, CLDN1, CUBN, LRP2 Connecting tubule Connecting tubule CnTCnT ALDH1A1, TACSTD2, CDH1ALDH1A1, TACSTD2, CDH1 Interstitial progenitor cellsInterstitial progenitor cells IPCIPC GDNF, FOXD1GDNF, FOXD1 Interstitial cells (a & b)Interstitial cells (a & b) ICa & bICa&b COL3A1, COL1A1, DCN, LEF1, DESCOL3A1, COL1A1, DCN, LEF1, DES Mesangial cellsMesangial cells MesMes ACTA2, PDGFRB, TPM2, CD248, MCAMACTA2, PDGFRB, TPM2, CD248, MCAM Collecting duct & Ureteric BudCollecting duct & Ureteric Bud UBCDUBCD AQP2, KRT18, RET, CLDN7, GATA2AQP2, KRT18, RET, CLDN7, GATA2 Endothelial cellsEndothelial cells EndEnd KDR, FLT1, CDH5, PECAM1, TEKKDR, FLT1, CDH5, PECAM1, TEK LeukocytesLeukocytes LeuLeu CD37, CD48, ITGB2, IFI30, IL1BCD37, CD48, ITGB2, IFI30, IL1B

실험예 7. 세포간 통신 분석Experimental Example 7. Intercellular communication analysis

Roser Vento-Tormo이 개발한 파이썬 기반 컴퓨터 분석 도구인 Cellphone DB를 이용하여, 분자 수준에서 세포 간 통신(cell-cell communication)을 분석하였다. PDGF, NOTCH, WNT, TGFB, VEGF 및 BMP 패밀리인 상호작용 쌍을 선택하여 세포 유형 간의 관계를 평가하였다. ktplots 패키지(https://github.com/zktuong/ktplots)의 'plot_cpdb' 함수를 사용하여 도트 플롯을 시각화하였다.Cellphone DB, a Python-based computer analysis tool developed by Roser Vento-Tormo, was used to analyze cell-cell communication at the molecular level. Interacting pairs, namely PDGF, NOTCH, WNT, TGFB, VEGF and BMP families, were selected to evaluate the relationship between cell types. Dot plots were visualized using the 'plot_cpdb' function of the ktplots package (https://github.com/zktuong/ktplots).

실험예 8. 단일 세포 조절 네트워크 분석Experimental Example 8. Single cell regulatory network analysis

SCENIC(single-cell regulatory network inference and clustering)은 조절 네트워크를 구성하고 다양한 세포 상태를 식별하는 데 사용되는 계산 방법이다. 이를 이용해 분석하기 위해, SCENIC 패키지에 제공된 hg19 모티브 순위 데이터베이스를 사용하여 잠재적 레귤론(regulon)을 점수화하였다. 전사 인자에 따른 세포 유형의 차이를 분석하기 위해, Limma 패키지는 우선적으로 발현되는 레귤론을 계산하였다.SCENIC (single-cell regulatory network inference and clustering) is a computational method used to construct regulatory networks and identify various cellular states. To analyze this, potential regulons were scored using the hg19 motif ranking database provided in the SCENIC package. To analyze cell type differences according to transcription factors, the Limma package calculated preferentially expressed regulons.

실험예 9. TWISTI1 억제제 처리Experimental Example 9. TWISTI1 inhibitor treatment

마트리젤 기반 프로토콜을 이용하여 15일째 배양된 신장 오가노이드에 24시간 동안 TWIST1 억제제인 25μM 하르민(Harmine, Sigma-Aldrich, 286044)을 처리하였다.Using the Matrigel-based protocol, kidney organoids cultured on day 15 were treated with 25 μM Harmine (Harmine, Sigma-Aldrich, 286044), a TWIST1 inhibitor, for 24 hours.

실험예 10. 통계 분석Experimental Example 10. Statistical Analysis

모든 정량적 측정의 경우, 전체 모집단을 통계적 유의성을 계산에 사용하였고, n값이 3인 평균값은 표준오차(standard error) 및 그래픽 신뢰구간(graphical confidence intervals)을 계산하는데 사용하였다. 그런 다음 Mann-Whitney 검정 또는 Kruskal-Wallis 검정을 사용하여 데이터를 분석하여 그룹 간의 유의성을 결정하였다. 각 그래프에서 오차 막대는 95% 신뢰 구간인 -2 SEM(평균의 표준오차)을 나타낸다. p<0.05에는 1개의 별표가, p<0.01에는 2개의 별표가, p<0.001에는 3개의 별표가 사용되었다.For all quantitative measurements, the entire population was used to calculate statistical significance, and the mean value with an n value of 3 was used to calculate standard errors and graphical confidence intervals. Data were then analyzed using the Mann-Whitney test or Kruskal-Wallis test to determine significance between groups. In each graph, error bars represent -2 SEM (standard error of the mean), which is a 95% confidence interval. One asterisk was used for p<0.05, two asterisks were used for p<0.01, and three asterisks were used for p<0.001.

[실시예][Example]

실시예 1. scRNAseq(Single-cell RNA sequencing)을 통해 신장 오가노이드의 세포 구성 및 성숙도 확인Example 1. Confirmation of cell composition and maturity of kidney organoids through scRNAseq (Single-cell RNA sequencing)

iPSC 유래 신장 오가노이드를 사용하여 신장 오가노이드를 생성하기 위해, 부착 배양 분화 프로토콜(adherent culture differentiation protocol)을 사용하였다. 그 결과는 도 1에 나타내었다. To generate kidney organoids using iPSC-derived kidney organoids, an adherent culture differentiation protocol was used. The results are shown in Figure 1.

도 1에 나타난 바와 같이, iPSC-신장 오가노이드는 분리된 네프론 유사 구조를 가지고 있었다.As shown in Figure 1, iPSC-kidney organoids had isolated nephron-like structures.

단일 세포 분해능에 의해 세포 구성 및 성숙도를 확인하기 위해, 신장 오가노이드 세포에 대해 scRNAseq(Single-cell RNA sequencing)를 수행하였다. 품질 관리를 통해 세포를 필터링하고 배치 효과를 수정한 후, UMAP(Uniform Manifold Approximation and Projection)을 사용하여 12,482개의 세포를 시각화하였다. 그 결과는 도 2a에 나타내었다.To confirm cell composition and maturity by single-cell resolution, single-cell RNA sequencing (scRNAseq) was performed on kidney organoid cells. After filtering cells through quality control and correcting for batch effects, 12,482 cells were visualized using Uniform Manifold Approximation and Projection (UMAP). The results are shown in Figure 2a.

도 2a에 나타난 바와 같이, 모든 세포는 30개의 개별 클러스터로 분류되었으며, 고유한 전사 표현을 기반으로 18개 세포 유형에 주석을 달았다.As shown in Figure 2A, all cells were sorted into 30 distinct clusters, and 18 cell types were annotated based on their unique transcript expression.

상기 클러스터에 걸친 마커 유전자의 발현을 도트 플롯으로 확인하였다. 그 결과는 도 2b에 나타내었다.Expression of marker genes across the clusters was confirmed by dot plot. The results are shown in Figure 2b.

도 2b에 나타난 바와 같이, 네프론 세포[족세포(NPHS1+, PODXL+), 근위세뇨관(HPN+, SPP1+) 및 헨레 고리(WFDC2+, MAL+)]를 식별하였다. 또한, 전구체 마커인 IGFBP7을 높은 수준으로 발현하는 네프론 전구체 클러스터, SPP1 및 WFDC2를 발현하는 세관 전구체 클러스터, 및 세관 마커도 식별하였다. 이에 더하여, 간엽(COL1A1+), 내피(SOX18+, KDR+), 증식 세포(TOP2A+, MKI67+), 및 일부 표적 외 세포[신경교세포(MSX1+, SOX2+), 멜라닌 세포(PMEL+, PLP1+) 및 신경 세포(DLL3, HES6)]를 식별하였다. 또한, 내피 세포의 두 가지 별개의 하위 클러스터를 발견하였다: 내피1(SOX18+, ECSCR+) 및 내피2(CD34+, KDR+). 이와 더불어, 다른 세포 유형으로 분화할 수 있는 것으로 보이는 전구체 세포(MTRNR2L 12+) 및 CTNNB1이 풍부한 세포를 발견하였다.As shown in Figure 2B, nephron cells [podocytes (NPHS1+, PODXL+), proximal tubules (HPN+, SPP1+), and loop of Henle (WFDC2+, MAL+)] were identified. Additionally, a nephron progenitor cluster expressing high levels of the progenitor marker IGFBP7, a tubule progenitor cluster expressing SPP1 and WFDC2, and a tubule marker were also identified. In addition, mesenchymal (COL1A1+), endothelial (SOX18+, KDR+), proliferative cells (TOP2A+, MKI67+), and some extra-target cells [glial cells (MSX1+, SOX2+), melanocytes (PMEL+, PLP1+), and neurons (DLL3, HES6)] was identified. Additionally, we found two distinct subclusters of endothelial cells: endothelial1 (SOX18+, ECSCR+) and endothelial2 (CD34+, KDR+). In addition, we discovered precursor cells (MTRNR2L 12+) and CTNNB1-enriched cells that appear to be capable of differentiating into other cell types.

각 오가노이드에서 세포 유형 비율을 확인하여, 신장 dECM이 신장 오가노이드가 네프론 세포로 분화하는 데 미치는 영향을 분석하였다. 그 결과는 도 2c에 나타내었다. By determining the cell type ratio in each organoid, we analyzed the effect of kidney dECM on the differentiation of kidney organoids into nephron cells. The results are shown in Figure 2c.

도 2c에 나타난 바와 같이, 족세포가 오가노이드의 21.2%만을 구성하였고, 오가노이드 세포의 2.23%만이 관형 상피 세포로 분화하였다. 또한, 비 표적세포의 비율은 7.75%; 증식 세포는 17.38%; 및 전구체 세포 및 CTNNB1+ 세포는 30.18%였다. 신장 오가노이드를 대표하는 신장 세포는 아직 미성숙하고 증식 및 분화 과정에 남아있었다.As shown in Figure 2C, podocytes constituted only 21.2% of the organoids, and only 2.23% of the organoid cells differentiated into tubular epithelial cells. Additionally, the percentage of non-target cells was 7.75%; Proliferating cells were 17.38%; and precursor cells and CTNNB1+ cells were 30.18%. Kidney cells, representing kidney organoids, were still immature and remained in the process of proliferation and differentiation.

다음으로, 총 오가노이드 세포에서 세포 분화 및 발달 관계를 분석하였다. 힘 방향 그래프 그리기 알고리즘(force-directed graph drawing algorithm)인 ForceAtlas2를 사용하여 오가노이드 세포의 분화 궤적을 확인하였다. 주석이 달린 세포 유형의 PAGA(partition-based approximate graph abstraction) 좌표를 사용하여, ForceAtlas2 레이아웃을 초기화하였다. CTNNB1+ 및 전구체 세포에서 다른 모든 세포 유형에 대한 독립적인 분화 분기로 분기 이벤트(branching event)를 보여주는 토폴로지 트리 그래프(topology tree graph)를 얻었다. 그 결과는 도 2d에 나타내었다.Next, cell differentiation and developmental relationships were analyzed in total organoid cells. The differentiation trajectory of organoid cells was confirmed using ForceAtlas2, a force-directed graph drawing algorithm. The ForceAtlas2 layout was initialized using the partition-based approximate graph abstraction (PAGA) coordinates of the annotated cell types. A topology tree graph was obtained showing branching events from CTNNB1+ and progenitor cells to independent differentiation branches for all other cell types. The results are shown in Figure 2d.

도 2d에 나타난 바와 같이, 토폴로지 트리 그래프는 CTNNB1+ 및 전구체 세포가 신장 세포뿐만 아니라 신경교세포, 신경 세포, 및 멜라닌 세포를 포함한 비 표적세포에 대해 독립적인 분화 가지를 가지고 있다는 것을 확인하였다.As shown in Figure 2D, the topological tree graph confirmed that CTNNB1+ and progenitor cells have independent differentiation branches to renal cells as well as non-target cells, including glial cells, neurons, and melanocytes.

실시예 2. 비 표적세포 및 네프론 세포에서 유전자 조절 네트워크 분석 결과 확인Example 2. Confirmation of gene regulatory network analysis results in non-target cells and nephron cells

어떤 전사 인자가 비 표적세포 유형에 결정적으로 영향을 미칠 수 있는지 확인하기 위해, 배양 중에 전사 인자를 억제하면 비 표적세포의 수를 효과적으로 줄일 수 있다고 가정하였다. SCENIC를 사용하여 비 표적세포 유형의 유전자 조절 네트워크를 분석하였고, 후보 목록에서 제거하기 위해 네프론 세포 유형에 필수적인 전사 인자를 분석하였다. 그 결과는 도 3a 및 3b에 나타내었다.To determine which transcription factors can critically affect non-target cell types, we hypothesized that inhibiting transcription factors during culture could effectively reduce the number of non-target cells. SCENIC was used to analyze the gene regulatory networks of non-target cell types, and transcription factors essential for nephron cell types were analyzed to remove them from the candidate list. The results are shown in Figures 3a and 3b.

도 3a 및 3b에 나타난 바와 같이, 신경 세포는 신장 오가노이드 세포에서 0.16%의 비율로 나타났다. 또한, 신경교세포는 2.8%, 멜라닌 세포는 3.3%로 나타났다. 또한, 오가노이드가 분화하는 동안 비 표적세포를 유도할 수 있는, 비 표적세포에 특이적인 여러 전사 인자를 발견하였다. 예를 들어, HDAC2, HOXB9, UNCX, 및 POU3F1의 레귤론 활성은 신경 세포에 특이적인 반면, TWIST1, RFX4 및 JUN의 레굴론 활성은 신경교세포에 특이적이었다.As shown in Figures 3A and 3B, neurons appeared at a proportion of 0.16% in kidney organoid cells. Additionally, glial cells were 2.8% and melanocytes were 3.3%. Additionally, we discovered several transcription factors specific to non-target cells that can induce non-target cells during organoid differentiation. For example, the regulon activities of HDAC2, HOXB9, UNCX, and POU3F1 were specific to neurons, whereas the regulon activities of TWIST1, RFX4, and JUN were specific to glial cells.

이는 TWIST1이 적절한 신장 오가노이드 분화를 억제한다는 것을 의미한다.This means that TWIST1 suppresses proper kidney organoid differentiation.

실시예 3. hPSC(human pluripotent stem cell) 유래 신장 오가노이드에서 TWIST1 억제제의 비 표적세포 감소 효과 확인Example 3. Confirmation of non-target cell reduction effect of TWIST1 inhibitor in hPSC (human pluripotent stem cell)-derived kidney organoids

실시예 2에서 신경 세포와 신경교세포에서 특이적으로 발현되는 TWIST1와 같이, 여러 성장 인자가 적절한 신장 오가노이드 분화를 억제한다는 것을 확인하였는바, 잠재적으로 TWIST1을 향상시키는 상호 작용을 추가로 분석하였다. TWIST1의 상류 조절자 역할을 하는 BMP 신호 전달 경로가 신경 세포와 신경교세포에서 증가한다는 것을 확인하였다. 그 결과는 도 4a 및 4b에 나타내었다.In Example 2, it was confirmed that several growth factors inhibit appropriate kidney organoid differentiation, such as TWIST1, which is specifically expressed in neurons and glial cells. Therefore, interactions that potentially enhance TWIST1 were further analyzed. It was confirmed that the BMP signaling pathway, which acts as an upstream regulator of TWIST1, is increased in neurons and glial cells. The results are shown in Figures 4a and 4b.

도 4a 및 4b에 나타난 바와 같이, 상기 메커니즘은 신경 세포와 신경교세포의 수용체가 인접 세포(다른 세포 유형)에서 분비되는 BMP 리간드에 의해 크게 영향을 받기 때문에, 세포 자율적이지 않은 방식(non-cell-autonomous fashion)으로 발생한다.As shown in Figures 4a and 4b, the mechanism operates in a non-cell-autonomous manner, since receptors on neurons and glial cells are greatly influenced by BMP ligands secreted by neighboring cells (other cell types). It occurs in an autonomous fashion.

또한, 신경 세포 및 신경교세포에서 TWIST1 레귤론의 발현 수준을 확인하였다. 그 결과는 도 4c 및 4d에 나타내었다.Additionally, the expression level of the TWIST1 regulon was confirmed in neurons and glial cells. The results are shown in Figures 4c and 4d.

도 4c 및 4d에 나타난 바와 같이, 프로토콜 A와 B를 사용하여 성장한 신경 세포에서, AXIN2와 같은 일부 신경 세포 발달 관련 유전자가 증가한다는 것을 확인하였다. As shown in Figures 4C and 4D, it was confirmed that some neuronal development-related genes, such as AXIN2, were increased in neurons grown using protocols A and B.

그런 다음, TWIST1 억제가 신경 세포, 비 표적세포, 및 신장 오가노이드 분화 억제에 영향을 미치는지 여부를 추가로 확인하였다. 구체적으로, 마트리젤 기반 프로토콜을 통해 15일째 배양된 신장 오가노이드에 24시간 동안 TWIST1 억제제인 25μM 하르민(Harmine, Sigma-Aldrich, 286044)을 투여하였다. 또한, 통계 분석은 Sidak의 다중 비교 테스트를 사용하여 이원 분산 분석(Two-way ANOVA)으로 분석하였다. 그 결과는 도 4e 및 4f에 나타내었다.Then, we further confirmed whether TWIST1 inhibition affects the inhibition of neuronal, non-target cell, and kidney organoid differentiation. Specifically, 25 μM Harmine (Harmine, Sigma-Aldrich, 286044), a TWIST1 inhibitor, was administered to kidney organoids cultured on day 15 through a Matrigel-based protocol for 24 hours. Additionally, statistical analysis was performed by two-way ANOVA using Sidak's multiple comparison test. The results are shown in Figures 4e and 4f.

도 4e 및 4f에 나타난 바와 같이, 독립 배치의 면역형광 분석을 통해, 총 족세포 및 관 형태의 변경 없이, 신경 세포가 감소하였다. 또한, qPCR 데이터를 통해, 비 표적세포 마커(MAP2, CRABP1, MYLPF)의 발현이 감소하는 것을 확인하였다.As shown in Figures 4E and 4F, immunofluorescence analysis of independent batches showed a decrease in neurons, without changes in total podocyte and tubular morphology. Additionally, through qPCR data, it was confirmed that the expression of non-target cell markers (MAP2, CRABP1, MYLPF) was decreased.

이는 TWIST1 억제제가 hPSC 유래 신장 오가노이드에서 비 표적세포를 감소시키는 효과가 우수하다는 것을 의미한다.This means that the TWIST1 inhibitor is effective in reducing non-target cells in hPSC-derived kidney organoids.

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다. The description of the present invention described above is for illustrative purposes, and those skilled in the art will understand that the present invention can be easily modified into other specific forms without changing the technical idea or essential features of the present invention. will be. Therefore, the embodiments described above should be understood in all respects as illustrative and not restrictive.

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION Gwangju Institute of Science and Technology <120> Composition for enhancing maturation of kidney organoid comprising TWIST1 inhibitor as an active ingredient <130> MP22-003 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MAP2_F <400> 1 ctcagcaccg ctaacagagg 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MAP2_R <400> 2 cattggcgct tcggacaag 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CRABP1_F <400> 3 gcagcagcga gaatttcgac 20 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CRABP1_R <400> 4 cgtggtggat gtcttgatgt aga 23 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYLPF_F <400> 5 gaaggacagt agagggcgga a 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYLPF_R <400> 6 tctggtcgat cacagtgaag g 21 <110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION Gwangju Institute of Science and Technology <120> Composition for enhancing maturation of kidney organoid comprising TWIST1 inhibitor as an active ingredient <130> MP22-003 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MAP2_F <400> 1 ctcagcaccg ctaacagagg 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MAP2_R <400> 2 cattggcgct tcggacaag 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CRABP1_F <400> 3 gcagcagcga gaatttcgac 20 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CRABP1_R <400> 4 cgtggtggat gtcttgatgt aga 23 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYLPF_F <400> 5 gaagggacagt agagggcgga a 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYLPF_R <400> 6 tctggtcgat cacagtgaag g 21

Claims (10)

TWIST1(Twist Family BHLH Transcription Factor 1) 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물.
A composition for improving kidney organoid maturity, comprising a TWIST1 (Twist Family BHLH Transcription Factor 1) inhibitor as an active ingredient.
 제1항에 있어서,
상기 TWIST1 억제제는
Harmine(7-methoxy-1-methyl-9H-pyrido[3,4-b]indole);
Nifurtimox((E)-N-(3-methyl-1,1-dioxo-1,4-thiazinan-4-yl)-1-(5-nitrofuran-2-yl)methanimine);
Genistein(5,7-dihydroxy-3-(4-hydroxyphenyl)chromen-4-one);
Vinblastine(methyl(1R,9R,10S,11R,12R,19R)-11-acetyloxy-12-ethyl-4-[(13S,15R,17S)-17-ethyl-17-hydroxy-13-methoxycarbonyl-1,11-diazatetracyclo[13.3.1.04,12.05,10]nonadeca-4(12),5,7,9-tetraen-13-yl]-10-hydroxy-5-methoxy-8-methyl-8,16-diazapentacyclo[10.6.1.01,9.02,7.016,19]nonadeca-2,4,6,13-tetraene-10-carboxylate);
Rifampicin([(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12,14,16,18,22-heptamethyl-26-[(E)-(4-methylpiperazin-1-yl)iminomethyl]-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta-1(29),2,4,9,19,21,25,27-octaen-13-yl] acetate); 및
Meteneprost((Z)-7-[(1R,2R,3R)-3-hydroxy-2-[(E,3R)-3-hydroxy-4,4-dimethyloct-1-enyl]-5-methylidenecyclopentyl]hept-5-enoic acid)로 이루어지는 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 신장 오가노이드 성숙도 향상용 조성물.
According to paragraph 1,
The TWIST1 inhibitor is
Harmine (7-methoxy-1-methyl-9H-pyrido[3,4-b]indole);
Nifurtimox ((E)-N-(3-methyl-1,1-dioxo-1,4-thiazinan-4-yl)-1-(5-nitrofuran-2-yl)methanimine);
Genistein (5,7-dihydroxy-3-(4-hydroxyphenyl)chromen-4-one);
Vinblastine(methyl(1R,9R,10S,11R,12R,19R)-11-acetyloxy-12-ethyl-4-[(13S,15R,17S)-17-ethyl-17-hydroxy-13-methoxycarbonyl-1, 11-diazatetracyclo[13.3.1.0 4,12.0 5,10 ]nonadeca-4(12),5,7,9-tetraen-13-yl]-10-hydroxy-5-methoxy-8-methyl-8, 16-diazapentacyclo[10.6.1.0 1,9 .0 2,7 .0 16,19 ]nonadeca-2,4,6,13-tetraene-10-carboxylate);
Rifampicin([(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12 ,14,16,18,22-heptamethyl-26-[(E)-(4-methylpiperazin-1-yl)iminomethyl]-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.1 4 ,7 .0 5,28 ]triaconta-1(29),2,4,9,19,21,25,27-octaen-13-yl] acetate); and
Meteneprost ((Z)-7-[(1R,2R,3R)-3-hydroxy-2-[(E,3R)-3-hydroxy-4,4-dimethyloct-1-enyl]-5-methylidenecyclopentyl]hept A composition for improving kidney organoid maturity, characterized in that it is at least one selected from the group consisting of -5-enoic acid).
 제1항에 있어서,
상기 신장 오가노이드는 하기 특징 중에 하나 이상을 만족하는 것을 특징으로하는, 신장 오가노이드 성숙도 향상용 조성물:
(a) 비 표적세포로 분화 감소;
(b) 비 표적세포 마커의 발현 감소;
(c) 신경 세포의 감소;
(d) 총 족세포(podocyte) 수의 유지; 및
(e) 관 형태(tubular morphology)의 유지.
According to paragraph 1,
A composition for improving kidney organoid maturity, wherein the kidney organoid satisfies one or more of the following characteristics:
(a) Reduced differentiation into non-target cells;
(b) decreased expression of non-target cell markers;
(c) reduction of nerve cells;
(d) maintenance of total podocyte number; and
(e) Maintenance of tubular morphology.
 제3항에 있어서,
상기 비 표적세포는 신경 세포, 신경교세포, 및 멜라닌 세포로 이루어지는 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 신장 오가노이드 성숙도 향상용 조성물.
According to paragraph 3,
A composition for improving kidney organoid maturity, wherein the non-target cells are one or more selected from the group consisting of nerve cells, glial cells, and melanocytes.
 제3항에 있어서,
상기 비 표적세포 마커는 MAP2(Microtubule-associated protein 2), CRABP1(Cellular Retinoic Acid Binding Protein 1), 및 MYLPF(Myosin Light Chain, Phosphorylatable, Fast Skeletal Muscle)로 이루어지는 군으로부터 선택된 하나 이상의 유전자인 것을 특징으로 하는, 신장 오가노이드 성숙도 향상용 조성물.
According to paragraph 3,
The non-target cell marker is characterized in that it is one or more genes selected from the group consisting of MAP2 (Microtubule-associated protein 2), CRABP1 (Cellular Retinoic Acid Binding Protein 1), and MYLPF (Myosin Light Chain, Phosphorylatable, Fast Skeletal Muscle) A composition for improving kidney organoid maturity.
 제1항에 있어서,
상기 TWIST1 억제제는 전체 조성물 대비 1 내지 250μM의 농도인 것을 특징으로 하는, 신장 오가노이드 성숙도 향상용 조성물.
According to paragraph 1,
A composition for improving kidney organoid maturity, characterized in that the TWIST1 inhibitor is at a concentration of 1 to 250 μM compared to the entire composition.
 제1항의 조성물, 및 지시서를 포함하는 신장 오가노이드 성숙도 향상용 키트.
A kit for improving kidney organoid maturity comprising the composition of claim 1 and instructions.
 TWIST1 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물을 사용하여 제조되고,
하기 특징을 하나 이상 만족하는, 성숙도가 향상된 오가노이드:
(a) 비 표적세포로 분화 감소;
(b) 비 표적세포 마커의 발현 감소;
(c) 신경 세포의 감소;
(d) 총 족세포(podocyte) 수의 유지; 및
(e) 관 형태(tubular morphology)의 유지.
Manufactured using a composition for improving kidney organoid maturity containing a TWIST1 inhibitor as an active ingredient,
Organoids of increased maturity that meet one or more of the following characteristics:
(a) Reduced differentiation into non-target cells;
(b) decreased expression of non-target cell markers;
(c) reduction of nerve cells;
(d) maintenance of total podocyte number; and
(e) Maintenance of tubular morphology.
 제8항에 있어서,
상기 비 표적세포는 신경 세포, 신경교세포, 및 멜라닌 세포로 이루어지는 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 오가노이드.
According to clause 8,
An organoid, wherein the non-target cells are one or more selected from the group consisting of nerve cells, glial cells, and melanocytes.
 TWIST1 억제제를 유효성분으로 포함하는, 신장 오가노이드 성숙도 향상용 조성물을 신장 오가노이드에 처리하는 단계를 포함하는, 신장 오가노이드 성숙도 향상 방법.A method for improving kidney organoid maturity, comprising treating kidney organoids with a composition for improving kidney organoid maturity, comprising a TWIST1 inhibitor as an active ingredient.
KR1020220013653A 2022-01-28 2022-01-28 Composition for enhancing maturation of kidney organoid comprising TWIST1 inhibitor as an active ingredient KR102593230B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020220013653A KR102593230B1 (en) 2022-01-28 2022-01-28 Composition for enhancing maturation of kidney organoid comprising TWIST1 inhibitor as an active ingredient
PCT/KR2023/001181 WO2023146292A1 (en) 2022-01-28 2023-01-26 Composition for improving maturity of renal organoid comprising twist1 inhibitor as active ingredient

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020220013653A KR102593230B1 (en) 2022-01-28 2022-01-28 Composition for enhancing maturation of kidney organoid comprising TWIST1 inhibitor as an active ingredient

Publications (2)

Publication Number Publication Date
KR20230116568A KR20230116568A (en) 2023-08-04
KR102593230B1 true KR102593230B1 (en) 2023-10-25

Family

ID=87471956

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020220013653A KR102593230B1 (en) 2022-01-28 2022-01-28 Composition for enhancing maturation of kidney organoid comprising TWIST1 inhibitor as an active ingredient

Country Status (2)

Country Link
KR (1) KR102593230B1 (en)
WO (1) WO2023146292A1 (en)

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2014277667B2 (en) 2014-12-15 2022-07-14 The University Of Queensland Differentiation of pluripotent stem cells to form renal organoids
KR20200086665A (en) * 2017-10-31 2020-07-17 머독 칠드런스 리서치 인스티튜트 Composition and method
KR102094929B1 (en) * 2018-07-06 2020-03-30 한국생명공학연구원 kidney spheroid and method of preparing the same
KR102285598B1 (en) * 2020-04-01 2021-08-05 가톨릭대학교 산학협력단 Kidney Organoids Having a Nephron-like Structure and Methods of Preparing the Same
CN113943695A (en) * 2021-10-29 2022-01-18 山西医科大学 Method for establishing kidney organoid by stem cell induced differentiation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
International Journal of Preventive Medicine, vol.10(97), pp.1~7(2019)*

Also Published As

Publication number Publication date
KR20230116568A (en) 2023-08-04
WO2023146292A1 (en) 2023-08-03

Similar Documents

Publication Publication Date Title
Peh et al. Propagation of human corneal endothelial cells: a novel dual media approach
JP6821908B2 (en) Compositions and Methods for Induced Tissue Regeneration in Mammalian Species
EP2468849B1 (en) Process for production of bioartificial organ
US20030194802A1 (en) Novel methods for the in-vitro identification, isolation and differentiation of vasculogenic progenitor cells
US20230174929A1 (en) Method for generating mesoderm and/or endothelial colony forming cell-like cells having in vivo blood vessel forming capacity
JPH07504323A (en) Methods and compositions for isolating and growing renal tubular stem cells, in vitro renal tubule formation and in vitro renal tubule construction
CN111643671B (en) Composition for promoting hair cell regeneration and hearing recovery and application thereof
CA3066959A1 (en) Blood vessel organoid, methods of producing and using said organoids
CN106459904A (en) Method for generating endothelial colony forming cell-like cells
Yoshimura et al. Podocyte development, disease, and stem cell research
Schachterle et al. Sox17 drives functional engraftment of endothelium converted from non-vascular cells
Rizki-Safitri et al. Bioengineered kidney models: Methods and functional assessments
Kharitonov et al. Possibilities for using pluripotent stem cells for restoring damaged eye retinal pigment epithelium
KR102593230B1 (en) Composition for enhancing maturation of kidney organoid comprising TWIST1 inhibitor as an active ingredient
WO2018144725A1 (en) Engineering blood vessel cells for transplantation
US20200360563A1 (en) Methods for Vascular Construction and Products Therefrom
CN107206028A (en) Eye disorders are treated using progenitor cells
JP2011519580A (en) Multipotent stem cell culture
Singh et al. Recent and evolving therapies in the management of endothelial diseases
Zand et al. Successful 3D culture and transplantation of mouse isolated preantral follicles in hydrogel of bioengineered Wharton’s jelly
US20220025325A1 (en) Generation and cryopreservation of pluripotent stem cell-derived clinical grade corneal endothelial cells
Al Abdulsalam et al. Cultivation of corneal endothelial cells from sheep
Fortuna et al. Three-dimensional Collagen Scaffolds in Cultures of Olfactory Ensheathing Cells Used for Severed Spinal Cord Regeneration
Fang Development of collagen-based scaffolds for differentiation of induced pluripotent stem cells
Schena A Mechanism for Cortical Bone Stem Cell-Derived Exosomes’ Therapeutic Effect on Post-myocardial Infarction Reperfusion Injury and Cardiac Remodeling

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right