KR102578389B1 - Novel Lactobacillus reuteri strain capable of improving fatty liver and use thereof - Google Patents

Abstract

An example of the present invention provides Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) and its use. Lactobacillus reuteri MJM60668 strain (Accession number: KACC 81231BP) according to the present invention is safe for the human body and has probiotic properties. In addition, Lactobacillus reuteri MJM60668 strain (Accession number: KACC 81231BP) or dead cells thereof according to the present invention inhibits fat accumulation in hepatocytes, reduces the expression of genes related to fat synthesis, increases the expression of genes related to fat metabolism, and increases blood flow. It has various functionalities such as reducing the content of inflammatory cytokines and improving the intestinal microbial flora, and reduces blood ALT, AST, TG, and TCHO, which are indicators of liver damage. Therefore, the Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) or its dead cell according to the present invention can be used as a useful material for medicines or health functional foods for preventing, improving, or treating fatty liver.

Description

Novel Lactobacillus reuteri strain capable of improving fatty liver and use thereof}

The present invention relates to a new strain, etc., and more specifically, to a new Lactobacillus reuteri strain capable of improving fatty liver and its use.

Fatty liver refers to a condition in which neutral fat accumulates abnormally within liver cells, causing enlargement of the liver. Fatty liver disease includes alcoholic fatty liver disease caused by excessive drinking and non-alcoholic fatty liver disease caused by metabolic dysregulation. Non-alcoholic fatty liver disease (NAFLD) includes everything from simple nonalcoholic fatty liver (NAFL) to non-alcoholic steatohepatitis (NASH), a more advanced form accompanied by inflammation and fibrosis. It is a disease that has a wide spectrum.

Clinical demand for treatments for non-alcoholic fatty liver disease is very high and many pharmaceutical companies are conducting research and development, but the development of sufficiently effective drugs is still insufficient.

Meanwhile, the recent development of knowledge about lactic acid bacteria present in fermented foods or lactic acid bacteria present in the human intestinal microflora and technology to use them has changed the existing perspective on human diseases and treatment. The human gut microbiome is a complex ecosystem composed of diverse bacteria with a total mass of approximately 1-2 kg. Intestinal microorganisms maintain a close relationship with the host and play important roles in vitamin production, the mucosal immune system, and bacterial translocation. The intestine is directly connected to the liver through the hepatic portal vein, and the liver is the main metabolic organ for gut products consisting of important dietary nutrients and microorganism-related components, also called the gut-liver axis. Disruption of the gut microbiome can lead to liver disease, including NAFLD. Existing treatments for NAFLD are often ineffective due to low compliance, lack of efficacy, or changes in diet and lifestyle. In theory, modulation of gut microbiota through the administration of probiotics could be effective, and recent studies have shown some promise to support this theory.

Regarding the technology for improving fatty liver using lactic acid bacteria, Republic of Korea Patent Publication No. 10-1955276 discloses genes related to fat synthesis: FAS (fatty acid synthase), SREBP-1 (sterol regulatory element binding protein-1), and SREBP-2 (sterol). Lactobacillus casei HY7207 (Accession number: KCTC13691BP) is disclosed, which is characterized by its efficacy in improving non-alcoholic fatty liver disease by suppressing the expression of regulatory element binding protein-2) and HM GCR (hydroxymethylglutaryl-CoA reductase) genes. It is done. In addition, Republic of Korea Patent Publication No. 10-2279283 discloses a treatment for non-alcoholic steatosis or non-alcoholic steatohepatitis containing Lactobacillus helveticus CKDB001 strain, accession number KCTC 13670BP, as an active ingredient. Pharmaceutical compositions for prevention or treatment are disclosed. In addition, in Republic of Korea Patent Publication No. 10-2128098, Lactobacillus delbrücki subsp. with accession number KCTC 14149BP. A pharmaceutical composition for preventing or treating non-alcoholic fatty liver disease comprising Lactobacillus delbrueckii subsp. lactis CKDB001 strain as an active ingredient is disclosed. In addition, Republic of Korea Patent Publication No. 10-2043740 discloses a food composition for improving alcoholic fatty liver disease containing Lactobacillus paracasei HY7014 (Accession number: KCTC 13689BP) as an active ingredient. In addition, Republic of Korea Patent Publication No. 10-2022-0057323 discloses a pharmaceutical composition for preventing or treating non-alcoholic fatty liver disease containing Lactobacillus mudanjiangensis CKDB001 strain, accession number KCTC 14323BP, as an active ingredient. It is done.

The present invention was derived from the conventional technical background, and the purpose of the present invention is to provide a new Lactobacillus reuteri strain that can improve fatty liver and its use.

The present invention is a novel Lactobacillus reuteri that is safer than synthetic chemicals and can be used to improve or treat fatty liver disease, has excellent efficacy in inhibiting fat accumulation in liver cells from human feces, and is non-toxic to liver cells. After screening the strain, it was found that the new Lactobacillus reuteri strain is food-safe and has the necessary activity as a probiotic, and at the same time has various functionalities such as inhibition of fat synthesis, promotion of lipolysis, anti-inflammatory activity, and change in intestinal microbial flora. It was confirmed that fatty liver disease can be effectively improved through this method, and the present invention was completed.

In order to achieve the above object, an example of the present invention provides Lactobacillus reuteri strain MJM60668 (accession number: KACC 81231BP).

In order to achieve the above object, an example of the present invention includes as an active ingredient at least one selected from Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP), its culture, its lysate, or its extract. Provided is a composition for preventing, improving or treating fatty liver disease.

In order to achieve the above object, an example of the present invention provides a composition for preventing, improving or treating fatty liver comprising dead cells of Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) as an active ingredient.

Lactobacillus reuteri MJM60668 strain (Accession number: KACC 81231BP) according to the present invention is safe for the human body and has probiotic properties. In addition, Lactobacillus reuteri MJM60668 strain (Accession number: KACC 81231BP) or dead cells thereof according to the present invention inhibits fat accumulation in hepatocytes, reduces the expression of genes related to fat synthesis, increases the expression of genes related to fat metabolism, and increases blood flow. It has various functionalities such as reducing the content of inflammatory cytokines and improving the intestinal microbial flora, and reduces blood ALT, AST, TG, and TCHO, which are indicators of liver damage. Therefore, the Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) or its dead cell according to the present invention can be used as a useful material for medicines or health functional foods for preventing, improving, or treating fatty liver.

Figure 1 shows the results of observing the effect of Lactobacillus reuteri MJM60668 strain on HepG2 cells.
Figure 2 is an evolutionary relationship tree showing the results of comparative phylogenetic analysis of Lactobacillus reuteri MJM60668 strain.
Figure 3 shows the effect of Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet by measuring the body weight and organs (liver, around the epididymis) of the experimental animals after 12 weeks of treatment. It is expressed as the result of measuring the weight of fat).
Figure 4 shows the effects of Lactobacillus reuteri MJM60668 strain on experimental animals in which non-alcoholic fatty liver disease was induced by a high-fat diet, as a result of analysis of blood biochemical indicators, etc.
Figure 5 shows the effect of Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet as a result of histopathological observation of liver sections stained with H&E.
Figure 6 shows the effect of Lactobacillus reuteri MJM60668 strain on experimental animals in which non-alcoholic fatty liver disease was induced by a high-fat diet as a result of analysis of the cecal microbiota composition.
Figure 7 shows the effect of Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet as a result of analysis of the expression levels of genes related to fat synthesis and genes related to fat metabolism in liver tissue. .
Figure 8 shows the effect of Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet as a result of analysis of the expression levels of fat synthesis proteins and fat metabolism-related proteins in liver tissue.
Figure 9 shows the effects of dead cells of the Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet, including body weight (A), mesentery weight (B), liver weight (C), and This is the result of analysis of the liver-to-body weight ratio (D), body weight gain (E), and fat weight around the epididymis (F).
Figure 10 shows the effect of dead cells of Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet by measuring ALT (aspartate aminotransferase) content (A) and AST (aspartate aminotransferase) at the serum level. ) content (B), triglyceride (TG) content (C), and total cholesterol (TCHO) content (D) analysis results.

Hereinafter, the terms used in the present invention will be explained.

The term “culture” used in the present invention refers to a product obtained by culturing microorganisms in a known liquid medium or solid medium, and includes cultured microorganisms. Specifically, the culture may be a microbial culture medium or a solid state obtained by solidifying the microbial culture medium.

The term “composition” used in the present invention refers to a material in which two or more components are uniformly mixed, and is a concept that includes not only finished products but also intermediate materials for manufacturing finished products.

As used in the present invention, the terms “pharmaceutically acceptable” and “foodologically acceptable” mean that the substance does not significantly stimulate the organism and does not inhibit the biological activity and properties of the administered active substance.

The term “prevention” used in the present invention refers to all actions that suppress the symptoms or delay the progression of a specific disease by administering the composition of the present invention.

The term “treatment” used in the present invention refers to any action that improves or beneficially changes the symptoms of a specific disease by administering the composition of the present invention.

As used herein, the term “improvement” refers to any action that at least reduces or alleviates the severity of the parameters associated with the condition being treated, such as symptoms.

As used herein, the term “administration” means providing a given composition of the invention to a subject by any suitable method. At this time, the subject refers to any animal, such as a human, monkey, dog, goat, pig, or rat, that has a disease whose symptoms can be improved by administering the composition of the present invention.

In the present invention, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit or risk ratio applicable to medical treatment, which refers to the type, severity, activity of the drug, and It can be determined based on factors including sensitivity, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the field of medicine.

Hereinafter, the present invention will be described in detail.

One aspect of the present invention relates to a new lactic acid bacteria that has the necessary properties as probiotics and has various functionalities beneficial to the human body, such as the effect of improving fatty liver disease, and is food-safe.

The new lactic acid bacterium according to an example of the present invention is Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP). The Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) has a 16S rDNA consisting of the base sequence of SEQ ID NO: 1. In addition, the Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) or its dead cells inhibits fat accumulation in hepatocytes, reduces the expression of genes related to fat synthesis, increases the expression of genes related to fat metabolism, and increases inflammatory cytokines in the blood. It has various functionalities such as reducing the content of , improving the intestinal microbial flora, etc. Specifically, the Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) or its dead cell reduces the expression of FAS (fatty acid synthase) and ACC (acetyl-CoA carboxylase) genes, which are genes related to fat synthesis. , increases the expression of fat metabolism-related genes, PPARα (peroxisome proliferator-activated receptor alpha) and CPT1A (carnitine palmitoyltransferase 1a) genes. In addition, the Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) or dead cells thereof contain fatty acid synthase (FAS) and sterol regulatory element-binding protein 1 (SREBP-1) proteins, which are fat synthesis-related proteins. It reduces the expression of PPARα (peroxisome proliferator-activated receptor alpha) protein, a fat metabolism-related protein. In addition, the Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) or its dead cell reduces the blood concentration of inflammatory cytokines such as IL-1β. In addition, the Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) or its dead cells reduces bacteria belonging to the Firmicutes phylum among the intestinal microbial community, increases bacteria belonging to the Venrrucomicrobia phylum, and normalizes the intestinal microbial flora. It can be restored. When the Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) or dead cells thereof are administered to experimental animals with fatty liver induced by a high-fat diet, blood ALT, AST, TG, TCHO, etc., which are indicators of liver damage, It can reduce and improve fatty liver disease, especially non-alcoholic fatty liver disease.

Another aspect of the present invention relates to the use of Lactobacillus reuteri MJM60668 strain (Accession number: KACC 81231BP), a new lactic acid bacterium.

An example of the present invention is the prevention, improvement or treatment of fatty liver comprising at least one selected from Lactobacillus reuteri MJM60668 strain (Accession number: KACC 81231BP), its culture, its lysate, or its extract as an active ingredient. Provides a composition for In addition, an example of the present invention provides a composition for preventing, improving or treating fatty liver comprising dead cells of Lactobacillus reuteri strain MJM60668 (accession number: KACC 81231BP) as an active ingredient.

The fatty liver may be selected from alcoholic fatty liver, non-alcoholic fatty liver, etc., and is preferably non-alcoholic fatty liver.

In the present invention, the culture is a product obtained by culturing microorganisms in a medium, and the medium may be selected from a known liquid medium or solid medium, for example, MRS liquid medium, MRS agar medium, BL agar medium, etc. there is.

In the present invention, dead cells are bacteria that have been killed by heat treatment of lactic acid bacteria, and are reported to have higher safety than live bacteria and similar or higher efficacy to live bacteria.

In addition, in the present invention, the composition may be specified as a pharmaceutical composition, health functional food composition, etc. depending on the purpose or aspect of use, and the content of a specific Lactobacillus genus strain, which is an active ingredient, in the composition may also be determined by the specific form of the composition and the purpose of use. It can be adjusted in various ranges depending on the aspect.

In the pharmaceutical composition according to the present invention, the content of the active ingredient novel lactic acid bacteria, its culture, its lysate, its extract, or its dead cell is not greatly limited, for example, 0.01 to 99% by weight, preferably 0.01 to 99% by weight, based on the total weight of the composition. May be 0.5 to 50% by weight, more preferably 1 to 30% by weight. In addition, the pharmaceutical composition according to the present invention may further include additives such as pharmaceutically acceptable carriers, excipients, or diluents in addition to the active ingredients. Carriers, excipients and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate. , cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, the pharmaceutical composition of the present invention may further contain one or more known active ingredients that have a preventive or therapeutic effect on fatty liver in addition to the new lactic acid bacteria, its culture, its lysate, its extract, or its dead cell body. The pharmaceutical composition of the present invention can be formulated into a formulation for oral administration or a formulation for parenteral administration by conventional methods, and when formulated, commonly used fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. It can be prepared using diluents or excipients. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain the active ingredient and at least one excipient, such as starch, calcium carbonate, and sucrose. ), it can be prepared by mixing lactose or gelatin. Additionally, in addition to simple excipients, lubricants such as magnesium styrate talc may also be used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Preparations for parenteral administration may include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used. Furthermore, it can be preferably formulated according to each disease or ingredient using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (latest edition), Mack Publishing Company, Easton PA. The pharmaceutical composition of the present invention can be administered orally or parenterally to mammals, including humans, depending on the desired method. Parenteral administration methods include external dermal application, intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, and intramuscular injection. There are injection methods such as intrathoracic injection or intrathoracic injection. The dosage of the pharmaceutical composition of the present invention is not greatly limited as long as it is a pharmaceutically effective amount, and the range varies depending on the patient's weight, age, gender, health condition, diet, administration time, administration method, excretion rate, and severity of the disease. Varies. The typical daily dosage of the pharmaceutical composition of the present invention is not greatly limited, but is preferably 0.01 to 3000 mg/kg BW, more preferably 0.1 to 2000 mg/kg BW, based on the active ingredient, per day. It can be administered once or in divided doses. A typical daily dosage of the pharmaceutical composition of the present invention is 1×10 ⁶ CFU/kg BW to 1×10 based on Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) or dead cells thereof. ¹⁵ CFU/kg BW and preferably 1×10 ⁸ CFU/kg BW to 1×10 ¹² CFU/kg BW.

In addition, in the health functional food composition according to the present invention, the content of novel lactic acid bacteria, its culture, its lysate, its extract, or its dead cell as an active ingredient is 0.01 to 50% by weight, preferably 0.1 to 0.1% by weight, based on the total weight of the composition. 25% by weight, more preferably 0.5 to 10% by weight, but is not limited thereto. The health functional food composition of the present invention includes the form of pills, powders, granules, infusions, tablets, capsules, or liquids. Specific examples of foods include meat, sausages, bread, chocolate, candies, snacks, confectionery, pizza, Ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, functional water, drinks, alcoholic beverages and vitamin complexes, etc. In addition to health functional foods in the usual sense, these products include: Includes both dietary supplements and food supplements with similar concepts. The health functional food composition of the present invention may further include food auxiliary additives that are foodologically acceptable in addition to the active ingredients, and the auxiliary additives include commonly used appropriate carriers, excipients, or diluents. The health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients in addition to the active ingredients. In addition, the food composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, and alcohol. , may contain carbonating agents used in carbonated beverages, etc. In addition, the health functional food composition of the present invention may contain pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks. These ingredients can be used independently or in combination. The above-mentioned natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As a flavoring agent, natural flavoring agents such as thaumatin and stevia extract or synthetic flavoring agents such as saccharin and aspartame can be used.

Hereinafter, the present invention will be described in more detail through examples. However, the following examples are only intended to clearly illustrate the technical features of the present invention and do not limit the scope of protection of the present invention.

1. Screening of lactic acid bacteria that inhibit fat accumulation using liver cells

(1) Test to confirm the effectiveness of inhibiting fat accumulation of lactic acid bacteria isolated from human feces or human oral cavity

To confirm the effectiveness of 11 stored lactic acid bacteria in inhibiting fat accumulation, they were isolated from human feces or oral cavity, and the species was identified. To confirm the effectiveness of inhibiting fat accumulation, the 11 stored lactic acid bacteria were co-cultured with hepatocytes and fat accumulation in hepatocytes was observed. HepG2 cells purchased from the Korean Cell Line Bank were used as liver cells. HepG2 cells were inoculated into a 6-well plate at ⁵ Cultured in medium at a temperature of 37°C and 5% CO ₂ for 24 hr. Afterwards, the medium was replaced with DMEM medium without fetal bovine serum (FBS) and starvated overnight. Afterwards, lactic acid bacteria were suspended at a concentration of 10 ⁸ and 10 ⁹ CFU/mL in DMEM medium without antibiotics and supplemented with 1 nM oleic acid and 7.5 ㎍/mL cholesterol as fat components, and the lactic acid bacteria suspension was transferred to a transwell. After inoculation on a transwell membrane insert, the cells were co-cultured with HepG2 cells for about 6 hr. Afterwards, the Transwell membrane insert was removed, the HepG2 cells were washed with PBS buffer, fixed with 10% formaldehyde for about 5 minutes, stained with Oil Red O reagent, and fat cells were analyzed under a microscope. Accumulation was observed. To quantify the fat accumulated in HepG2 cells, the stained HepG2 cells were washed with PBS buffer, 100% isopropanol was added to dissolve the stained fat droplets, and the absorbance at 510 nm was measured using an ELISA reader. .

Table 1 below summarizes the results of experiments confirming the efficacy of 11 lactic acid bacteria in inhibiting hepatocyte fat accumulation.

processing material Fat accumulation (percentage compared to Control) Fat storage reduction rate (compared to OA-C) Control (normal group) 100 - OA-C (negative control) 173.76 - Simvastatin (1μM, positive control) 136.87 21.23 Lactobacillus gasseri MJM61024 122.59 Lactobacillus rhamnosus GG 151.53 Streptococcus salivarius MJM165323 157.33 Lactobacillus gasseri MJM165324 142.25 Lactobacillus salivarius MJM165329 158.27 Lactobacillus fermentum MJM160430 172.69 Lactobacillus helveticus MJM165928 152.72 Lactobacillus reuteri MJM1653332 145.53 Lactobacillus reuteri MJM165330 139.46 Lactobacillus reuteri MJM60668 92.49 Lactobacillus galinarum MJM168993 160.42

* Lactic acid bacteria treatment concentration: 10 ⁹ CFU/mL

* Control (normal group): Experimental group in which HepG2 cells were not treated with anything.

* OA-C (negative control): Experimental group in which HepG2 cells were treated with 1 nM Oleic acid and 7.5 ㎍/㎖ cholesterol

* Simvastatin (1μM, positive control): Experimental group in which HepG2 cells were treated with 1 nM oleic acid, 7.5 μg/ml cholesterol, and 1μM simvastatin

As shown in Table 1 below, most lactic acid bacteria showed effectiveness in inhibiting fat accumulation in hepatocytes where fat accumulation was induced by fatty acids and cholesterol, and in particular, Lactobacillus reuteri MJM60668 strain isolated from human feces inhibited fat accumulation. The efficacy was found to be significantly high.

(2) Confirmation of cytotoxicity of Lactobacillus reuteri MJM60668 strain

In order to confirm the cytotoxicity of the Lactobacillus reuteri MJM60668 strain, the Lactobacillus reuteri MJM60668 strain was co-cultured with HepG2 cells under the same conditions as the test for confirming the efficacy of inhibiting fat accumulation, and then cultured on a Transwell membrane insert (Transwell). membrane insert) was removed, and HepG2 cells were treated with 20 ㎕ of MTT solution at a concentration of 5 mg/mL for 4 hr. Afterwards, the supernatant was removed, the HepG2 cells were treated with 200 μl of dimethyl sulfoxide (DMSO) to dissolve the formazan crystals, and the absorbance at 570 nm was measured using a microplate reader. Cytotoxicity was determined by comparison to the untreated group. As a result, it was confirmed that Lactobacillus reuteri MJM60668 strain was not cytotoxic.

Figure 1 shows the results of observing the effect of Lactobacillus reuteri MJM60668 strain on HepG2 cells. In Figure 1, MJM60668 represents Lactobacillus reuteri MJM60668 strain. Figure 1 (a) shows the results of measuring the survival rate of HepG2 cells using MTT assay after co-culturing the Lactobacillus reuteri MJM60668 strain with HepG2 cells, and Figure 1 (b) shows the results of Lactobacillus reuteri MJM60668 strain. ( Lactobacillus reuteri ) This is the result of quantifying fat accumulation within HepG2 cells after co-culturing the MJM60668 strain with HepG2 cells.

(3) Identification results of strain MJM60668

Among lactic acid bacteria isolated from human feces or oral cavity, strain MJM60668, which had the highest efficacy in inhibiting fat accumulation in hepatocytes, was identified using molecular biological methods. Genomic DNA was isolated from strain MJM60668 using a genomic DNA isolation kit, and PCR was performed using this as a template to amplify 16S ribosomal DNA. At this time, the universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GTTACCTTGTTACGACTT-3') were used as PCR primers. As a result of cloning the amplified DNA and analyzing the base sequence, it was found that the 16S rDNA of strain MJM60668 had the base sequence of SEQ ID NO: 1. The 16S rDNA of strain MJM60668 was compared with the 16S rDNA of standard strains in the Ezbiocloud database (ChunLab Inc., Seoul, South Korea) to search for similarity, and related sequences of multiple strains were placed using Clustral After conducting comparative phylogenetic analysis using software, an evolutionary relationship tree with neighboring species was created. As a result, the species of strain MJM60668 was determined to be Lactobacillus reuteri . Figure 2 is an evolutionary relationship tree showing the results of comparative phylogenetic analysis of Lactobacillus reuteri MJM60668 strain.

(4) Deposit information of Lactobacillus reuteri MJM60668 strain

The inventors of the present invention transferred Lactobacillus reuteri MJM60668 strain to the National Academy of Agricultural Culture Microorganism Bank (Korean Agricultural Culture Collection, KACC; Address: 166, Nongsaengmyeong-ro, Iseo-myeon, Toyongu-gun, Jeollabuk-do, Korea) on October 11, 2022. An international patent deposit was made in accordance with the Budapest Treaty, and the accession number KACC 81231BP was granted. The Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP) can be distributed to third parties within the procedures stipulated in the Budapest Treaty.

2. Lactobacillus reuteri ( Lactobacillus reuteri ) Stability and probiotic characterization of strain MJM60668

(1) Antibiotic susceptibility evaluation

The antibiotic susceptibility of Lactobacillus reuteri MJM60668 strain was evaluated using the standards of the European Food Safety Authority (EFSA, 2012). The verified antibiotics are Chloramphenicol, Ampicillin, Tetracycline, Gentamycin, Kanamycin, Streptomycin, Erythromycin, Clindamycin, and Vancomycin.

Lactic acid bacteria were cultured in MRS medium and then suspended in MRS medium using MacFarland 0.5 to prepare a lactic acid bacteria suspension. An antibiotic dilution solution was prepared by diluting 512 ㎍/mL antibiotics in a 2-fold dilution format until the antibiotic concentration was 0.25. Afterwards, 100 ㎕ of antibiotic dilution and 100 ㎕ of lactic acid bacteria suspension were mixed in a 96-well plate and cultured at 37°C for 24 hr. Afterwards, the growth of lactic acid bacteria was confirmed with the naked eye, and the highest concentration at which lactic acid bacteria did not grow was set as the minimum inhibitory concentration (MIC). As a result, the minimum inhibitory concentration for Lactobacillus reuteri MJM60668 strain was recommended by EFSA. It was found to be below the minimum inhibitory concentration, and Lactobacillus reuteri MJM60668 strain was confirmed to have antibiotic sensitivity.

(2) Evaluation of hemolytic activity

If the strain has hemolytic activity, it destroys the host's red blood cells, so lactic acid bacteria used as probiotics should not have hemolytic activity.

The strain was spread on TSA blood agar and cultured at 37°C for 24 hours, and the hemolysis reaction was confirmed using transmitted light. Blood agar medium (TSA blood agar) was prepared by sterilizing the TSA agar medium, cooling it to 40-50°C, and adding 5% of sterilized sheep blood. Lactobacillus reuteri MJM60668 strain was confirmed to have no hemolytic activity.

(3) Evaluation of biogenic amine production

Decarboxylase medium supplemented with amino acids such as L-tyrosine, L-histidine, L-ornithine, L-phenylalanine, and L-lysine (Tryptone: 0.5 wt%; yeast extract: 0.5 wt%; beef extract: 0.5 wt%; sodium) chloride: 0.25 wt%; glucose: 0.05 wt%; tween 80: 0.1 wt%; MgSO ₄ : 0.02 wt%; MnSO ₄ : 0.005 wt%; FeSO4: 0.004 wt%; Ammonium citrate: 0.2 wt%; Thiamine: 0.001 wt %; dipotassium phosphate: 0.2 wt%; calcium carbonate: 0.01 wt%; pyridoxal 5-phosphate: 0.005 wt%; Amino acid (one of the amino acid listed above): 1 wt%; bromocresol purple: 0.006 wt%; agar 2 wt%; pH: 5.3) and cultured at 37°C for 16 to 24 hr. Then, the production of biogenic amines was confirmed by the presence or absence of purple pigment around the colonies. It was confirmed that Lactobacillus reuteri MJM60668 strain does not produce biogenic amines.

(4) Whether D-Lactate is produced or not

The human body can metabolize L-lactate, but cannot metabolize D-lactate, an isomer of L-lactate. In the case of lactic acid bacteria, it has DL-lactate recamase, an enzyme that converts L-lactate to D-lactate, and if the DL-lactate recamase activity of lactic acid bacteria is strong, it can be used as D for newborns, young children, and patients with congenital short bowel syndrome who consume lactic acid bacteria. -Lactate may accumulate and cause acidosis.

After culturing the test strain at 37°C for 24 hr, the supernatant was collected, and the D-lactate content was measured using a D-lactate enzyme test kit (Megazyme, Ireland). Lactobacillus reuteri MJM60668 strain is safe. It was confirmed that D-lactate productivity was not higher than LGG (Lactobacillus rhamnosus GG) lactic acid bacteria, which are known to have high D-lactate productivity.

(5) Evaluation of bile salt deconjugation

Bile salt emulsifies fat and promotes the action of lipase, helping to decompose fatty acids. Bile salt hydrolase present in probiotics protects probiotics from bile salts and increases intestinal settlement, but also deconjugates bile salts to emulsify bile salts into fat. Because it eliminates its function, it makes it difficult to decompose fatty acids. Additionally, the decomposed bile acids are converted into toxic secondary metabolites through metabolism by other intestinal microorganisms, which can be potentially dangerous.

The test strain was plated on MRS agar medium supplemented with 0.5% TDCA (taurodeoxycholic acid), cultured under anaerobic conditions and at 37°C for 48 hr, and the formation of opaque white colonies around the colonies was observed. If white colonies are formed, it is judged positive. Lactobacillus reuteri MJM60668 strain did not form white colonies and was judged negative.

(6) Evaluation of mucin resolution

Mucin decomposition of the test strain was confirmed using agar medium supplemented with 0.3% porcine gastric mucin. The test strain was plated on the medium and cultured under anaerobic conditions and at 37°C for 48 hr. Afterwards, the culture plate was stained with a staining agent (3.5 M acetic acid containing 0.1% Amido black) for 30 minutes and washed with 1.2 M acetic acid until a mucin lysis zone appeared around the colonies. Mucin decomposition activity is defined as the size of the mucin decomposition area, and whether the test strain decomposes mucin was determined by comparing it with the positive control. It was confirmed that Lactobacillus reuteri MJM60668 strain does not decompose mucin.

(7) Evaluation of adhesion ability to human epithelial tissue-like cell lines

The HT-29 cell line, a human epithelial tissue-like cell line, was purchased from the Microbial Resource Center (KCTC) and used to test epithelial cell adhesion ability, and the experiment was performed by referring to the method described in [Tuo et al., 2013].

First, HT-29 cells were inoculated into DMEM medium supplemented with 20% (v/v) inactivated fetal bovine serum (FBS), 100 U/ml of penicillin, and 100 mg/ml of streptomycin antibiotics, and incubated at a temperature of 37°C. and cultured in an incubator with a 5% CO ₂ concentration environment. Afterwards, well-differentiated HT-29 cells were dispensed into 12-well plates at an amount of 2×10 ⁵ cells per well and cultured for 24 hr while changing the medium every day to form an 80% filled monolayer. formed. Afterwards, the HT-29 cell monolayer was washed three times with PBS and exchanged with DMEM medium without antibiotics, and the test strain was inoculated to a final concentration of 1 × 10 ⁸ CFU/mL, at a temperature of 37°C and 5% CO. Cultured for 2 hr in a CO ₂ concentration environment. Afterwards, the cell monolayer was washed three times with PBS to remove unattached test strains, and 200 ㎕ of 1% Triton-X 100 solution was added to disrupt the cell monolayer to which the test strains were attached. Afterwards, 1 ml of the lysate was applied to the MRS agar medium using the continuous dilution method and cultured at 37°C for 48 hr to confirm the number of bacteria. The attachment ability of the test strain was evaluated by calculating the colony forming units (CFU) of the attached test strain. The % attachment of the test strain to the HT-29 cell line was calculated using the formula below.

Lactobacillus reuteri MJM60668 strain showed an adhesion ability of about 5.1% to HT-29 cells, and was confirmed to have superior adhesion ability to intestinal epithelial cells than LGG (Lactobacillus rhamnosus GG) lactic acid bacteria.

Table 2 below summarizes the safety evaluation results among the probiotic characteristics of Lactobacillus reuteri MJM60668 strain and LGG (Lactobacillus rhamnosus GG) lactic acid bacteria used as a control.

Safety evaluation items Lactobacillus reuteri MJM60668 LGG Antibiotics Ampicillin One One Vancomycin 512 512 (NR) Gentamicin 8 32(R) Kanamycin R R Streptomycin 128(R) 32(R) Tetracycline 16 One Clindamycin One One Erythromycin One One Chloramphenicol 4 4 D-lactate production - - Bile salt deconjugation - - Bioamine production L-Histidine - - L-Tyrosine - - L-phenylalanine - - Arginine - - Tryptophan - - L-ornithine - - Mucin degradation - - Hemolytic activity - - Adhesion to HT-29 (%) 5.1 3.1

* NR: not required; R : resistant

(8) Tolerance evaluation under oral-gastrointestinal transit conditions

An oral-gastrointestinal transit tolerance assay was performed on the Lactobacillus reuteri MJM60668 strain as follows.

First, to provide oral passage stress, an electrolyte solution containing 150 mg/l of lysozyme (NaCl, 6.2 g/l; KCl, 2.2 g/l; CaCl ₂ , 0.22 g/l; NaHCO ₃ , 1.2 g/l), the test strain was inoculated at an amount of 1×10 ⁹ CFU/ml and incubated at 37°C for 10 minutes. Afterwards, the bacteria cultured under oral transit stress conditions were separated from the oral stress solution by centrifugation (1,800 After inoculation into the 3-phosphorus electrolyte solution, the cells were incubated at 37°C for 1 hr. Afterwards, the bacteria cultured under gastric transit stress conditions were separated from the gastric stress solution by centrifugation (1,800 It was inoculated into an electrolyte solution containing salt (bile oxgall) and having a pH of 7 (NaCl, 5 g/l; KCl, 0.6 g/l; CaCl ₂ , 0.25 g/l) and incubated at 37°C for 2 hr.

After the culture was completed under each stress condition, the culture was sampled and the sampled strain culture was diluted to an appropriate multiple to prepare a suspension. The strain suspension was applied to MRS agar medium and cultured at 37°C for 48 hr to form colony units. (colony forming units, CFU) were calculated. The number of strains surviving after each stress treatment was expressed on a scale of Log ₁₀ CFU, and the results are summarized in Table 3 below.

OGI transit Stressed or not? Strain survival count (Log ₁₀ CFU/mL) Lactobacillus reuteri MJM60668 LGG Initial 9.20 9.12 Oral stress - 9.19 9.09 + 9.09 9.00 Gastric stress (pH3) - 9.16 9.07 + 9.06 8.84 Gastric stress (pH2) - 9.18 9.05 + 8.97 8.74 Intestinal stress - 9.15 9.08 + 8.68 7.79

As shown in Table 3 , Lactobacillus reuteri MJM60668 strain was confirmed to have a higher level of resistance to oral-gastrointestinal transit condition stress than LGG (Lactobacillus rhamnosus GG) lactic acid bacteria used as a control.

(9) Evaluation of antibacterial activity

The antibacterial activity of Lactobacillus reuteri MJM60668 strain was measured by agar well diffusion assay. The test strain was inoculated into MRS liquid medium and cultured for 24 hr, and then the supernatant was recovered. Afterwards, the supernatant was sterilized using a filter, and 100 μl of the supernatant was loaded onto the plate containing pathogens using a well. Then, after culturing at 37°C, the diameter of the growth inhibition zone of the pathogen was measured. Table 4 below summarizes the antibacterial activity evaluation results of Lactobacillus reuteri MJM60668 strain.

pathogen Diameter of Zone Inhibition (mm) Lactobacillus reuteri MJM60668 LGG Salmonella gallinarum KCTC 2931 10 10 Escherichia coli K99 8 8 Escherichia coli O1 KCTC 2441 10 8 Escherichia coli 0138 6 6 Escherichia coli ATCC25922 8 8 Salmonella choleraesuis KCTC 2932 10 8 Salmonella typhi KCTC 2514 8 8 Pseudomonas aeruginosa KCCM 11802 10

As shown in Table 4 , Lactobacillus reuteri MJM60668 strain showed antibacterial activity against various intestinal pathogens.

3. Lactobacillus reuteri using an animal model in which non-alcoholic fatty liver disease was induced by a high-fat diet ( Lactobacillus reuteri ) Verification of fatty liver improvement efficacy of strain MJM60668

(1) Laboratory animals and feeding management

7-week-old C57BL/6 female mice were used in this experiment after undergoing an adaptation period for 7 days. Four experimental animals were housed in mouse cages and reared in a breeding room with a temperature of 22 ± 2°C, humidity of 55 ± 5%, and a light-dark cycle controlled every 12 hours. During the adaptation period, all experimental animals were fed rodent pellet food and water ad libitum.

(2) Separation of experimental group and drug administration

After the adaptation period had elapsed, the experimental animals were divided into five groups with 12 animals per group, and the experimental animals in each group were treated under pre-designed conditions for 12 weeks. On the first day of administration, feed was restricted for 12 hours to reduce body weight due to feed intake, and water was provided ad libitum. Experimental animals in the control group were fed normal diets. Non-alcoholic fatty liver disease was induced by feeding high-fat diets (HFD) to experimental animals in the high-fat diet group (HFD Group). High-fat diets (HFD) are composed of 45% fat, 35% carbohydrates, and 20% protein. Experimental animals in the Silymarin Group were fed high-fat diets (HFD) to induce non-alcoholic fatty liver disease, and at the same time, Silymarin was orally administered once a day at a dose of 50 mg/kg BW. did. Experimental animals in the MJM60958 low-dose feeding group [MJM60668 (10 ⁸ ) Group] were fed high-fat diets (HFD) to induce non-alcoholic fatty liver disease, and at the same time , Lactobacillus reuteri MJM60668 strain was fed at 1×10 ⁸ . It was administered orally once a day at a dose of CFUs/mice. Experimental animals in the MJM60668 high-dose feeding group [MJM60668 (10 ⁹ ) Group] were fed high-fat diets (HFD) to induce non-alcoholic fatty liver disease, and at the same time , Lactobacillus reuteri MJM60668 strain was fed at 1×10 ⁹ It was administered orally once a day at a dose of CFUs/mice. Lactobacillus reuteri ( Lactobacillus reuteri ) MJM60668 strain was cultured in MRS medium for 24 hr, the cells were recovered, washed twice with PBS, suspended in physiological saline (0.85% NaCl), prepared freshly every day, and orally administered to experimental animals. . Experimental animals in the normal group (Control Group) and the high-fat diet group (HFD Group) were orally administered saline solution used as a vehicle instead of Lactobacillus reuteri MJM60668 strain. After 12 weeks of treatment, the experimental animals were anesthetized with 3% isoflurane solution, blood was collected, and sacrificed by cervical dislocation. Liver, kidney, and epididymal fat were extracted from the sacrificed experimental animals. Required organs were fixed in 10% formalin or rapidly frozen in liquid nitrogen and stored in a low-temperature refrigerator at -80°C for future analysis.

(3) Changes in body weight and organ weight

Figure 3 shows the effect of Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet by measuring the body weight and organs (liver, around the epididymis) of the experimental animals after 12 weeks of treatment. It is expressed as the result of measuring the weight of fat). As shown in Figure 3, in the experimental group administered Lactobacillus reuteri MJM60668 strain, the body weight and liver weight of the experimental animals were significantly reduced compared to the negative control group, the high-fat feed group (HFD Group). In addition, the experimental animals in the high-fat feed group (HFD Group) had white livers, typical of fatty liver, but the experimental animals in the experimental group administered Lactobacillus reuteri MJM60668 strain had normal liver colors ( It recovered to a level similar to that of the experimental animals in the Control Group).

(4) Analysis of blood biochemical indicators and measurement of blood Leptin, Adiponectin, and IL-1β contents

Blood collected from experimental animals was centrifuged for 10 minutes at 2000 , TCHO), triglyceride (TG), and high-density cholesterol (HDL-C) content were analyzed. Additionally, the contents of Leptin, Adiponectin, and IL-1β were measured at the serum level using an ELISA kit.

Figure 4 shows the effects of Lactobacillus reuteri MJM60668 strain on experimental animals in which non-alcoholic fatty liver disease was induced by a high-fat diet, as a result of analysis of blood biochemical indicators, etc. As shown in Figure 4, in the experimental group administered Lactobacillus reuteri MJM60668 strain, liver damage indicators ALT, AST, TG, and TCHO were significantly decreased compared to the high-fat feed group (HFD Group), which was the negative control group. . In addition, in the experimental group administered Lactobacillus reuteri MJM60668 strain, leptin content significantly decreased and adiponectin content increased compared to the negative control group, the high-fat feed group (HFD Group). In addition, in the experimental group administered Lactobacillus reuteri MJM60668 strain, the content of IL-1β, an inflammatory cytokine, decreased compared to the negative control group, the high-fat feed group (HFD Group). Lactobacillus reuteri MJM60668 strain was found to change fat metabolism regulators and alleviate inflammation in experimental animals with induced non-alcoholic fatty liver disease.

(5) Histopathological observation

After measuring the organ weight, the lateral left lobe of the liver was fixed with 4% paraformaldehyde, then embedded in paraffin, and serial sections with a thickness of 5 ㎛ were prepared. Afterwards, serial sections were stained with hematoxylin-eosin (H&E), magnified 400 times and analyzed using a computer image analysis system (CaseViewer by 3DHITECH, Budapest, Hungary). For the analyzed images, steatosis grades were graded into four levels as follows based on the proportion of fat vesicles within the liver cells.

* level 0 (normal, <5%); level 1 (mild, 5 - 33%); level 2 (medium, 34 - 66%); level 3 (severe, > 66%)

Figure 5 shows the effect of Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet as a result of histopathological observation of liver sections stained with H&E. Figure 5(a) shows the steatosis grade, and Figure 5(b) shows an image of hepatocytes stained with hematoxylin-eosin (H&E). As shown in Figure 5, in the experimental group administered Lactobacillus reuteri MJM60668 strain, the number of fat-accumulated liver cells was significantly reduced compared to the negative control group, high-fat feed group (HFD Group), and the steatosis grade, which is a quantitative result, was significantly reduced. This decreased significantly.

(6) Analysis of stool samples

After sacrificing the experimental animals, the cecum was immediately removed, feces were collected, and stored at -80°C. To conduct metagenomic analysis, DNA was extracted from the collected stool using the ExgeneTM Stool DNA mini kit. Afterwards, the V3-V4 section of the bacterial 16S rRNA gene was amplified using barcoded universal primers 341F and 805R, and the microbial community was analyzed.

Figure 6 shows the effect of Lactobacillus reuteri MJM60668 strain on experimental animals in which non-alcoholic fatty liver disease was induced by a high-fat diet as a result of analysis of the cecal microbiota composition. In Figure 6, MJM60668 represents the MJM60668 high-dose feeding group [MJM60668 (10 ⁹ ) Group]. As shown in Figure 6, in the experimental group administered Lactobacillus reuteri MJM60668 strain, the Firmicutes ratio was reduced and the Venrrucomicrobia ratio increased at the phylum level compared to the negative control group, the high-fat feed group (HFD Group). It was confirmed that intestinal microbial diversity was restored. In addition, in the experimental group administered Lactobacillus reuteri MJM60668 strain, the abundance of Akkermansiaceae increased at the family level compared to the negative control group, the high-fat feed group (HFD Group). In addition, in the experimental group administered Lactobacillus reuteri MJM60668 strain, the ratio of Akkermansia and Lachnospiraceae NK4A136 group was increased at the genus level compared to the negative control group, high-fat feed group (HFD Group). Akkermansiaceae is a strain associated with mucin reproduction, and its decline is known to be associated with the onset of metabolic diseases such as diabetes. The increase in Akkermansiaceae due to administration of lactic acid bacteria suggests that lactic acid bacteria contribute to barrier recovery. In addition, there are reports that as the content of Lachnospiraceae NK4A136 group strains in the intestinal microbial flora increases, the neutral fat content in the host's blood decreases. It is believed that administration of Lactobacillus reuteri MJM60668 strain increases the content of the Lachnospiraceae NK4A136 group in the intestinal microbial flora and contributes to the control of neutral fat in the host. Feeding high-fat feed worsened the blood biochemical indicators of experimental animals and caused non-alcoholic fatty liver disease. However, administration of Lactobacillus reuteri MJM60668 strain changed the intestinal microbial flora of the experimental animals, recovered blood biochemical indicators, and recovered non-alcoholic fatty liver disease. It is believed that alcoholic fatty liver disease is improved.

(7) RNA extraction and RT-qPCR (Reverse Transcription-Quantitative Polymerase Chain Reaction) analysis

The expression levels of genes related to fat synthesis and fat metabolism in liver tissue were confirmed using RT-qPCR analysis. RNA was extracted from liver tissue using Trizol reagent, reverse transcription was performed using TaKaRa Kit, and cDNA was synthesized using Primescript 1st Strand cDNA Synthesis Kit. qPCR was performed using SYBR Green Master Mix, and the reaction program for amplification of the target gene was stage 1: 94°C (10 minutes); stage 2: 94°C (15 seconds), repeated 45 times, then 60°C (1 minute); Stage 3: 95℃ (10 seconds), 65℃ (60 seconds), 97℃ (1 second). Primer information for amplification of target genes is summarized in Table 5 below.

target gene Primer type Primer base sequence (5'→3') FAS forward AGGGGTCGACCTGGTCCTCA reverse GCCATGCCCAGAGGGTGGTT ACC forward AACATCCCGCACCTTCTTCTAC reverse CTTCCACAAAACCAGCGTCTC PPARα forward AGAGCCCCATCTGTCCTCTC reverse ACTGGTAGTTCTGCAAAACCAAA CPT1A forward TGGCATCATCACTGGTGTGTT reverse GTCTAGGGTCCGATTGATCTTTG IL-6 forward ACAACCACGGGCCTTCCCTACTT reverse CACGATTTCCCAGAGAACATGTG β-actin forward ACAACCACGGGCCTTCCCTACTT reverse CACGATTTCCCAGAGAACATGTG

Figure 7 shows the effect of Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet as a result of analysis of the expression levels of genes related to fat synthesis and genes related to fat metabolism in liver tissue. . In Figure 7, MJM60668 represents the MJM60668 high-dose feeding group [MJM60668 (10 ⁹ ) Group]. As shown in Figure 7, in the experimental group administered Lactobacillus reuteri MJM60668 strain, the expression of FAS and ACC genes, genes related to fat synthesis, decreased in liver tissue compared to the high-fat feed group (HFD Group), which is a negative control group. The expression of fat metabolism-related genes PPARα and CPT1A increased.

(8) Analysis of protein expression level in liver tissue

Western blot was performed to analyze protein expression levels in liver tissue. After pulverizing the liver tissue into powder using liquid nitrogen, proteins were extracted from the liver tissue using RIPA lysis buffer. The amount of extracted protein was quantified using the BCA protein assay kit. Afterwards, 40 μg of protein was loaded on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and transferred to a polyvinylidene difluoride (PVDF) membrane. Afterwards, the membrane was blocked with Tris-buffered saline (TBS) buffer containing 3% BSA at 4°C for 1 hr, then the target protein was detected using various antibodies, and the protein expression level was quantified using the ImageJ program. To detect the target protein, FAS antibody (1:200), SCREBP-1 antibody (1:1000), PPARα antibody (1:1000), and β-actin antibody (1:1000) were used, and horseradish antibody (1:1000) was used as the secondary antibody. peroxidase (HRP)-conjugated secondary antibody (1:10,000) was used.

Figure 8 shows the effect of Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet as a result of analysis of the expression levels of fat synthesis proteins and fat metabolism-related proteins in liver tissue. In Figure 8, MJM60668 represents the MJM60668 high-dose feeding group [MJM60668 (10 ⁹ ) Group]. As shown in Figure 8, in the experimental group administered Lactobacillus reuteri MJM60668 strain, the expression of FAS and SREBP-1, proteins related to fat synthesis, decreased in liver tissue compared to the high-fat feed group (HFD Group), which is a negative control group. And the expression of PPARα, a protein related to fat metabolism, increased.

4. Lactobacillus reuteri using an animal model in which non-alcoholic fatty liver disease was induced by a high-fat diet ( Lactobacillus reuteri ) Verification of fatty liver improvement efficacy of dead cells of MJM60668 strain

(1) Production of dead cells of Lactobacillus reuteri MJM60668 strain

Lactobacillus reuteri MJM60668 strain was inoculated into MRS medium, cultured, and centrifuged to recover the cells. Thereafter, the recovered cells were washed with PBS buffer, heated at 65°C for 1 hr, and the cycle of cooling at room temperature was repeated three times to prepare dead cells of Lactobacillus reuteri MJM60668 strain. The prepared dead cells were applied to MRS agar medium and cultured, and then the death of the strain was confirmed.

(2) Laboratory animals and feeding management

7-week-old C57BL/6 female mice were used in this experiment after undergoing an adaptation period for 7 days. Four experimental animals were housed in mouse cages and reared in a breeding room with a temperature of 22 ± 2°C, humidity of 55 ± 5%, and a light-dark cycle controlled every 12 hours. During the adaptation period, all experimental animals were fed rodent pellet food and water ad libitum.

(3) Separation of experimental group and drug administration

After the adaptation period, the experimental animals were divided into 6 groups with 12 animals per group, and the experimental animals in each group were treated under pre-designed conditions for 16 weeks. On the first day of administration, feed was restricted for 12 hours to reduce body weight due to feed intake, and water was provided ad libitum. Experimental animals in the Control Group were fed normal diets for 16 weeks. Experimental animals in the high-fat diet group (HFD Group) were fed high-fat diets (HFD) for 16 weeks to induce non-alcoholic fatty liver disease. High-fat diets (HFD) are composed of 45% fat, 35% carbohydrates, and 20% protein. Experimental animals in the Silymarin Group were fed high-fat diets (HFD) for 8 weeks to induce non-alcoholic fatty liver disease, and then fed high-fat diets (HFD) for the remaining 8 weeks. Simultaneously with feeding, Silymarin was administered orally once a day at a dose of 50 mg/kg BW. Experimental animals in the BNR17 Group were fed high-fat diets (HFD) for 8 weeks to induce non-alcoholic fatty liver disease, and then fed high-fat diets (HFD) for the remaining 8 weeks. At the same time as feeding, BNR17 lactic acid bacteria, a commercially available anti-obesity lactic acid bacteria product, was orally administered once a day at a dose of 1×10 ⁹ CFUs/mice. Experimental animals in the MJM60668 Live MJM60668 Group were fed high-fat diets (HFD) for 8 weeks to induce non-alcoholic fatty liver disease, and then fed high-fat diets (HFD) for the remaining 8 weeks. ) At the same time as feeding , Lactobacillus reuteri MJM60668 strain was orally administered once a day at a dose of 1×10 ⁹ CFUs/mice. Lactobacillus reuteri ( Lactobacillus reuteri ) MJM60668 strain was cultured in MRS medium for 24 hr, the cells were recovered, washed twice with PBS, suspended in physiological saline (0.85% NaCl), prepared freshly every day, and orally administered to experimental animals. . Experimental animals in the MJM60668 dead cell feeding group (HK MJM60668 Group) were fed high-fat diets (HFD) for 8 weeks to induce non-alcoholic fatty liver disease, and then fed high-fat diets (high-fat diets) for the remaining 8 weeks. Simultaneously with the feeding of HFD), dead cells of Lactobacillus reuteri MJM60668 strain were orally administered once a day at a dose of 1×10 ⁹ CFUs/mice. Experimental animals in the normal group (Control Group) and the high-fat diet group (HFD Group) were orally administered saline solution used as a vehicle instead of Lactobacillus reuteri MJM60668 strain for 8 weeks. After 16 weeks of treatment, the experimental animals were anesthetized with 3% isoflurane solution, blood was collected, and sacrificed by cervical dislocation. Liver, kidney, and epididymal fat were extracted from the sacrificed experimental animals. Required organs were fixed in 10% formalin or rapidly frozen in liquid nitrogen and stored in a low-temperature refrigerator at -80°C for future analysis.

(4) Changes in body weight and organ weight, etc.

Figure 9 shows the effects of dead cells of the Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet, including body weight (A), mesentery weight (B), liver weight (C), and This is the result of analysis of the liver-to-body weight ratio (D), body weight gain (E), and fat weight around the epididymis (F). As shown in Figure 9, in the experimental group (HK MJM60668) in which dead cells of the Lactobacillus reuteri MJM60668 strain were administered to experimental animals in which non-alcoholic fatty liver disease was induced by a high-fat diet, the high-fat feed group (HFD), which was the negative control group, was administered. ), body weight (A), mesentery weight (B), liver weight (C), liver-to-body weight ratio (D), body weight gain (E), and fat weight around the epididymis (F) decreased, and the decrease was due to Lactobacillus reuteri ( Lactobacillus reuteri ) was found to be similar to or larger than that of the MJM60668 live bacteria-fed group (Live MJM60668) administered with the MJM60668 strain.

(5) Analysis of blood biochemical indicators

Figure 10 shows the effect of dead cells of Lactobacillus reuteri MJM60668 strain on experimental animals with non-alcoholic fatty liver disease induced by a high-fat diet by measuring ALT (aspartate aminotransferase) content (A) and AST (aspartate aminotransferase) at the serum level. ) content (B), triglyceride (TG) content (C), and total cholesterol (TCHO) content (D) analysis results. As shown in Figure 10, in the experimental group (HK MJM60668) in which dead cells of the Lactobacillus reuteri MJM60668 strain were administered to experimental animals in which nonalcoholic fatty liver disease was induced by a high-fat diet, the high-fat feed group (HFD), which was the negative control group, was administered. ), the ALT content and AST content, which are indicators of liver damage in the blood, decreased, and the decrease was found to be greater than that of the MJM60668 live bacteria-fed group (Live MJM60668) administered Lactobacillus reuteri MJM60668 strain.

As described above, the present invention has been described through the above-mentioned embodiments, but the present invention is not necessarily limited thereto, and various modifications can be made without departing from the scope and spirit of the present invention. Accordingly, the scope of protection of the present invention should be interpreted to include all embodiments falling within the scope of the patent claims attached to the present invention.

Rural Development Administration National Academy of Agricultural Sciences Microbial Bank (KACC) KACC81231BP 20221011

Claims (13)

As a strain with fatty liver improvement efficacy,
The strain has decreased expression of fat synthesis-related genes FAS (fatty acid synthase) and ACC (acetyl-CoA carboxylase) genes, and fat metabolism-related genes PPARα (peroxisome proliferator-activated receptor alpha) and CPT1A (carnitine palmitoyltransferase 1a) genes. Increased expression, decreased expression of fat synthesis-related proteins FAS (fatty acid synthase) and SREBP-1 (sterol regulatory element-binding protein 1), or PPARα (peroxisome proliferator-activated receptor alpha) protein, a fat metabolism-related protein. Characterized by improving fatty liver by increasing,
Lactobacillus reuteri MJM60668 strain (accession number: KACC 81231BP).
delete delete delete delete A pharmaceutical composition for preventing or treating fatty liver comprising at least one selected from Lactobacillus reuteri MJM60668 strain (Accession number: KACC 81231BP), its culture, its lysate, or its extract as an active ingredient.
The pharmaceutical composition for preventing or treating fatty liver according to claim 6, wherein the fatty liver is non-alcoholic fatty liver.
A health functional food composition for preventing or improving fatty liver comprising at least one selected from Lactobacillus reuteri MJM60668 strain (Accession number: KACC 81231BP), its culture, its lysate, or its extract as an active ingredient.
The health functional food composition for preventing or improving fatty liver according to claim 8, wherein the fatty liver is non-alcoholic fatty liver.
A pharmaceutical composition for preventing or treating fatty liver comprising dead cells of Lactobacillus reuteri strain MJM60668 (accession number: KACC 81231BP) as an active ingredient.
The pharmaceutical composition for preventing or treating fatty liver according to claim 10, wherein the fatty liver is non-alcoholic fatty liver.
A health functional food composition for preventing or improving fatty liver comprising dead cells of Lactobacillus reuteri strain MJM60668 (accession number: KACC 81231BP) as an active ingredient.
The health functional food composition for preventing or improving fatty liver according to claim 12, wherein the fatty liver is non-alcoholic fatty liver.