KR102577332B1 - Composition for diagnosing latent tuberculosis comprising antigen with improved antigenicity and stability - Google Patents

Abstract

The present invention relates to a composition for diagnosing latent tuberculosis containing an antigen with improved antigenicity and stability. In the case of the QuantiFERON-TB test, which is a currently actively used latent tuberculosis diagnostic kit, the antigen is fixed in a tube and reacted. If the titer is improved, a sufficient immune response can be induced even with a small amount. In the case of the antigen of the present invention, accurate results can be obtained because stability is guaranteed for about 4 days even at 37°C, which is the reaction temperature with blood. The mutant antigen obtained by the present invention had a two-fold improvement in antigen titer compared to the existing wild type, and improved stability for about 10 days at 4°C and 4 days at 37°C were confirmed.

Description

Composition for diagnosing latent tuberculosis comprising antigen with improved antigenicity and stability}

The present invention relates to a composition for diagnosing latent tuberculosis containing an antigen with improved antigenicity and stability.

Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis and is a major cause of death worldwide. It is one of the world's three major diseases, and approximately 2 billion people, or about a third of the world's population, are infected with tuberculosis. there is. In Korea, the tuberculosis incidence rate and death rate due to tuberculosis are the highest among OECD countries, with approximately 35,000 new patients and approximately 2,300 deaths reported annually.

Currently, the widely used method of diagnosing tuberculosis is to clinically isolate and confirm the tuberculosis bacilli by staining or culturing the tuberculosis bacilli. The smear staining has the advantage of quickly detecting tuberculosis bacteria and quickly selecting highly contagious patients. However, compared to culture tests, the smear staining has a low sensitivity of about 20-80%, so it can be used in patients with weak immune systems, such as children, the elderly, or patients with acquired immune deficiency. Failure rates are high in impaired patients. As the frequency of isolation of non-tuberculous mycobacteria is increasing in Korea, smear tests alone are insufficient to diagnose active tuberculosis. In addition, even in cases of nontuberculous mycobacteria lung disease, the sputum smear test is positive, so it is difficult to diagnose active tuberculosis through a smear test alone.

Another method used is to detect latent tuberculosis using immunological methods such as the tuberculin skin test and IGRA (IFN-γ release assay). The tuberculin test can detect latent tuberculosis, but it does not distinguish between cases of BCG vaccination or NTM disease, and additional tests such as radiography, sputum, and culture are required to confirm latent tuberculosis. The QuantiFERON-TB test, known as IGRA, is an in vitro latent tuberculosis test that measures interferon gamma secreted by immune cells through antigen stimulation of the patient's peripheral blood cells. If the titer is improved, a sufficient immune response can be induced even with a small amount, so it is important to improve the titer and stability of the antigen.

Korean Patent Publication No. 10-2021-0057315 (published on May 21, 2021)

The purpose of the present invention is to provide a composition for diagnosing latent tuberculosis containing ESAT6-CFP10 recombinant antigen as an active ingredient and a kit for diagnosing latent tuberculosis containing the same.

In addition, another object of the present invention is to provide a method of providing information necessary for diagnosing latent tuberculosis, including the step of reacting the composition with a sample isolated from a patient and analyzing latent tuberculosis infection.

In order to achieve the above object, the present invention provides a composition for diagnosing latent tuberculosis comprising the ESAT6-CFP10 recombinant antigen consisting of the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 as an active ingredient.

Additionally, the present invention provides a kit for diagnosing latent tuberculosis comprising the composition.

Additionally, the present invention provides a method of providing information necessary for diagnosing latent tuberculosis, which includes reacting the composition with a sample isolated from a patient to analyze whether latent tuberculosis infection exists.

The present invention relates to a composition for diagnosing latent tuberculosis containing an antigen with improved antigenicity and stability. In the case of the QuantiFERON-TB test, which is a currently actively used latent tuberculosis diagnostic kit, the antigen is fixed in a tube and reacted. If the titer is improved, a sufficient immune response can be induced even with a small amount. In the case of the antigen of the present invention, accurate results can be obtained because stability is guaranteed for about 4 days even at 37°C, which is the reaction temperature with blood. The mutant antigen obtained by the present invention had a two-fold improvement in antigen titer compared to the existing wild type, and improved stability for about 10 days at 4°C and 4 days at 37°C were confirmed.

Figure 1 shows the results of antigenicity evaluation of recombinant ESAT6-CFP10 protein.
Figure 2 shows the results of stability evaluation of recombinant ESAT6-CFP10 protein.
Figure 3 shows the results of mutant production to improve the stability of ESAT6-CFP10 protein.
Figure 4 shows the results of mutant stability tests using SDS-PAGE & RP-HPLC.
Figure 5 shows the results of antigenicity evaluation of three mutants with improved stability (DG, 120Q, and 89R).

The present invention provides a composition for diagnosing latent tuberculosis comprising the ESAT6-CFP10 recombinant antigen consisting of the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 as an active ingredient.

In detail, the composition has improved antigenicity and stability, and the antigen titer is doubled compared to the existing subtype, and the effect of improved stability for about 10 days at 4℃ and 4 days at 37℃ was confirmed. did.

In the present invention, “diagnosis” means confirming the presence or characteristics of a pathological condition. In the present invention, diagnosis may mean confirming whether there is a risk of latent tuberculosis or whether latent tuberculosis has developed, or further, whether latent tuberculosis has progressed or worsened.

In the present invention, the ESAT6-CFP10 recombinant antigen consisting of the amino acid sequence shown in SEQ ID NO: 1 is described as 120G/204G or DG, and the ESAT6-CFP10 recombinant antigen consisting of the amino acid sequence shown in SEQ ID NO: 2 is described as 120Q, The ESAT6-CFP10 recombinant antigen consisting of the amino acid sequence shown in SEQ ID NO: 3 was designated as 89R.

Meanwhile, the wild-type ESAT6-CFP10 recombinant antigen was listed as SEQ ID NO: 4.

Additionally, the present invention provides a kit for diagnosing latent tuberculosis comprising the composition.

In the present invention, the kit may include not only the ESAT6-CFP10 recombinant antigen, but also a composition, solution, or device suitable for diagnosing latent tuberculosis.

Additionally, the present invention provides a method of providing information necessary for diagnosing latent tuberculosis, which includes reacting the composition with a sample isolated from a patient to analyze whether latent tuberculosis infection exists.

Preferably, the step of analyzing latent tuberculosis infection may be performed through an interferon-γ release assay (IGRA), but is not limited thereto.

The term “sample isolated from a patient” as used herein refers to all biological materials, including blood, etc., and biological samples that can be used to diagnose latent tuberculosis of the present invention include tissues, cells, hair, oral tissue, oral cells, This includes, but is not limited to, blood, lymph, bone marrow fluid, saliva, milk, urine, feces, eye fluid, semen, brain extract, spinal fluid, joint fluid, ascites, amniotic fluid, or tissue fluid. In the present invention, preferably the sample may be blood.

Below, the present invention will be described in detail according to examples that do not limit the present invention. Of course, the following examples of the present invention are only intended to embody the present invention and do not limit or limit the scope of the present invention. Accordingly, what can be easily inferred by an expert in the technical field to which the present invention belongs from the detailed description and examples of the present invention is interpreted to fall within the scope of the rights of the present invention.

< Experiment example >

The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

1. Recombinant antigen ESAT6 - CFP10's produce( cloning and tablets)

A gene was synthesized to insert three G4S linkers (GGGGS) between ESAT6 and CFP10, and the synthesized gene was cloned into pGEX4T-1 with BamHI/EcoRI. ESAT6/CFP10 mutations designed to increase stability were gene replaced using site-directed mutagenesis, and the primers used for mutagenesis are listed in Table 1.

Primer name order ESAT_S89R_F ATTAGCGAAGCCGGTCAGGCAATGGCTCGTACCGAAGGCAACGTTACCGGCATGTT ESAT_S89R_R AACATGCCGGTAACGTTGCCTTCGGTACGAGCCATTGCCTGACCGGCTTCGCTAAT ESAT_S89L_F ATTAGCGAAGCCGGTCAGGCAATGGCTCTTACCGAAGGCAACGTTACCGGCATGTT ESAT_S89L_R AACATGCCGGTAACGTTGCCTTCGGTAAGAGCCATTGCCTGACCGGCTTCGCTAAT CFP_K120Q_F GAGGTGGAAGCATGGCAGAAATGCAGACGGATGCGGCAACCCTGGCAC CFP_K120Q_R GTGCCAGGGTTGCCGCATCCGTCTGCATTTCTGCCATGCTTCCACCTCC CFP_K120G_F GAGGTGGAAGCATGGCAGAAATGGGGACGGATGCGGCAACCCTGGCAC CFP_K120G_R GTGCCAGGGTTGCCGCATCCGTCCCCATTTCTGCCATGCTTCCACCTC CFP_E204G_F CAGTATAGCCGTGCCGACGAGGGGCAGCAGCAGGCGCTGTCTAGC CFP_E204G_R GCTAGACAGCGCCTGCTGCTGCCCCTCGTCGGCACGGCTATACTG

Each mutant generated a PCR product using WT DNA as a template, treated with DpnI at 50°C for 1 hour to digest the plasmid template, and then transformed. The base substitution of the transformant was confirmed through sequencing.

ESAT6/CFP10 WT and mutants were expressed in E. coli strain BL21[DE3]. Protein expression was cultured in LB medium containing 100 mg/mL of ampicillin, and expressed under 0.5 mM IPTG, 18°C, 16 hr. E. coli cells were disrupted by sonication in PBS, centrifuged, and the supernatant was taken and purified. ESAT6/CFP10 WT and mutants containing GST were attached to GST resin and treated with 1 unit of thrombin per 1 mg of protein, and ESAT6/CFP10 WT and mutants separated from GST were recovered by flow-through. .

2. Antigenicity evaluation

To evaluate the antigenicity of recombinant proteins, the IFN-γ secreted by human primary T cells activated by the antigen was quantified using the V-PLEX Human IFN-γ kit (Meso Scale Discovery).

Human peripheral blood cells (PBMCs) used to confirm the presence or absence of endotoxin in recombinant proteins (antigens) were purchased from Lonza. Human peripheral blood cells to check for antigenicity were collected from healthy adults with and without previous experience of tuberculosis, and the human peripheral blood cells were separated using Histopaque-1119 (Sigma). Separated human peripheral blood cells were spread on a 96-well plate (2 × ¹⁰⁵ ) and then treated with antigen proteins and recombinant purified protein derivative (PPD) as a positive control for 24 to 72 hours at given concentrations. After that, the cell culture medium was recovered. The amount of IFN-γ in the recovered cell culture medium was quantified using the V-PLEX Human IFN-γ kit.

The experiment process is as follows.

1) Wash the plate in the kit 3 times with 150㎕ of wash buffer (0.05% PBST).

2) Add 50㎕ of the recovered cell culture medium to the well.

3) Seal the plate containing the cell culture medium with adhesive film and leave it on a shaker at 200 rpm for 2 hours at room temperature.

4) Wash the plate 3 times with 150㎕ of wash buffer.

5) Add 25㎕ of detection antibody (anti-IFN-γ-SULFO TAG) to each well.

6) After sealing the plate with adhesive film, leave it on a shaker at 200 rpm for 2 hours at room temperature.

7) Wash the plate 3 times with 150㎕ of wash buffer.

8) Add 150㎕ of 2× Read Buffer T to each well.

9) The amount of IFN-γ in each well is measured using MESO SECTOR S 600 (Meso Scale Discovery) equipment.

* Commercial antigen: Mycobacterium tuberculosis CFP10: ESAT6 chimera Recombinant protein, Catalog: MBS313439 (MyBioSource.com)

3. SDS-PAGE & CE-SDS analysis

1) Protease inhibitor effect

Purified ESAT6/CFP10 was sampled with or without protease inhibitors. 5 μg of each protein was mixed with 5×Laemmli sample buffer, boiled at 100°C for 10 minutes, cooled, and separated using a 4-12% SDS-polyacrylamide gel. The gel was stained with Coomassie blue to compare the patterns of protein fragments.

2) CE-SDS sample preparation

CE-SDS (Maurice, ProteinSimple) analysis was performed to evaluate the purity and impurity content of the sample. There are two types of samples analyzed: ESAT6·CFP10 and ESAT6·CFP10 treated with protease inhibitor (ESAT6·CFP10+Inhibitor). Samples were analyzed under reducing conditions and were performed using β-mercaptoethanol. Samples for analysis are prepared by mixing as shown in Table 2. Afterwards, the sample was maintained at 70°C for 10 minutes for reduction. The heated sample was left at room temperature for 5 minutes and then centrifuged at 13,000 g for 5 minutes. After centrifugation was completed, the supernatant was taken and used for analysis. Along with the sample, the CE-SDS MW marker is also prepared and analyzed in the same manner. Internal standard (IS) 10kDa is analyzed together with the sample, and the sample size and relative migration time are calculated based on this.

The relative occupancy rate of the peak of each sample was calculated from the area value corresponding to the intensity measured by the UV detector.

Once the sample is ready, analysis begins using the Maurice system. Prepare the analysis equipment by turning it on for at least 30 minutes before starting. The analysis begins by placing the reagents and samples used for analysis in the corresponding locations and inserting the cartridges (Muarice CE-SDS cartridges, ProteinSimple) into the equipment. The analysis conditions for the samples are shown in Table 3. The reagents and materials used in the experiment are detailed in Table 4.

Reagent Reduced sample IgG STDs Sample 45.5 μL 1 tube Sample buffer (1×) 50 μL 50 μL 10kDa 25× internal standard 2 μL 2 μL 14.2 M ß-mercaptoethanol 2.5 μL 2.5 μL

Reducing conditions Step Volage Time Injection 4600V 20 seconds Separation 5750V 25min

Reagent and material names manufacturing company Cat. No. Maurice CE-SDS molecular weight ProteinSimple 046-432 Maurice sample vial ProteinSimple 046-083 ß-mercaptoethanol Sigma M6250 CE-SDS size application kit ProteinSimple PSMAK02-S Muarice CE-SDS cartridges Maurice CE-SES cartridge cleaning vials Maurice clear screw cap Maurice glass reagent vials Maurice 96 well plate Maurice CE-SDS separation matrix Maurice CE-SDS running buffer-top Maurice CE-SDS running-bottom Maurice CE-SDS 1× sample buffer Maurice CE-SDS wash solution Maurice CE-SDS conditioning solution 1 Maurice CE-SDS conditioning solution 2 Maurice CE-SDS 25× internal standard

4. LC-MS analysis of in gel digestion

The staining reagent was removed from the band containing the protein separated from the SDS-polyacrylamide gel with a washing solution (25mM NH ₄ HCO ₃ in 50% acetonitrile). The gel whose buffer was completely replaced with acetonitrile was reacted with 10mM DTT at 56°C for 1 hour, the remaining solution was removed, and then treated with 55mM iodoacetamide and washed. The gel whose buffer was completely replaced with acetonitrile was mixed with 10 ng/μL enzyme (Trypsin/Lys-C mix) and reacted at 37°C for 16 hours, and the peptide was lysed with NH ₄ HCO ₃ and acetonitrile. It was recovered and dried.

Proteomic analysis was performed using a Q-exactive hybrid quadrupole orbitrap mass spectrometer connected to Easy-nano LC. The dried peptide dissolved in 0.1% formic acid was injected into the nano LC system. Peptide separation was performed using an Easy-spray C18 column (100 Å, 5 μm, 300 μm i.d. × 50 cm; Thermo Fisher Scientific), solution A (0.1% formic acid in water) and solution B (0.1% formic acid in water). acetonitrile) was separated in a gradual concentration gradient (5 - 80%) at a flow rate of 300 nL/min for 40 minutes. The obtained data were subjected to a database search using Proteome Discoverer software (version 2.4, Thermo Fisher Scientific) through the Homo sapiens (Human) database.

5. Tertiary structure modelling and stabilizing mutation calculations.

The ESAT6/CFP10 model structure with G4S linker connected was used in Discovery studio 2021 (version 2021, BIOVIA). To create the model, the X-ray structure of ESAT6/CFP10 (PDB:3FAV) was used as a model template, and the model in the lowest energy state was created using the Build and Edit Protein and Minimize and Refine Protein tools. The created model calculated the amino acids that affect stabilization due to mutations in SER89 and LYS120 through Calculate Mutation Energy in the Design Protein tool.

6. SDS-PAGE and RP- for stability evaluation HPLC analyze

1) SDS-PAGE

ESAT6/CFP10 WT and mutants were stored at 4 and 37°C for 0, 4, 7, and 10 days, respectively, and then sampled. 5 μg of each protein was mixed with 5× Laemmli sample buffer, boiled at 100°C for 10 minutes, cooled, and separated using a 4-12% SDS-polyacrylamide gel. The gel was stained with Coomassie blue to compare the patterns of protein fragments.

2) RP-HPLC

Reverse phase HPLC analysis was performed using a 1260 Infinity LC system (Agilent, USA). 10 μg of protein was injected onto an Solution B was separated with a gradual concentration gradient (20 - 50%) for 20 minutes, brought to 100% for 3 minutes, and then solution A was adjusted to 80% for 9 minutes and separated at 1.44 mL/min for 32 minutes. The detector's UV wavelength ranged from 190 to 400 nm, and UV absorption wavelengths of 220 nm and 280 nm were used.

< Example 1> Antigenicity and stability evaluation

To evaluate antigenicity, an experiment was performed to confirm the release of IFN-γ (IGRA) from PBMCs after treatment with ESAT6-CFP10 protein. PPD was used as a positive control. Both the control commercial CFP10 chimera and recombinant ESAT6-CFP10 were found to increase the release level of IFN-γ in a concentration-dependent manner in PBMCs of patients with positive latent tuberculosis. The recombinant ESAT6/CFP10 protein showed at least two times higher antigen reactivity compared to the control group at a concentration of 10 μg/mL (Figure 1). The results of the IFN-γ release assay (IGRA) showed that the higher antigen reactivity of recombinant ESAT6/CFP10 was not caused by endotoxin.

The recombinant antigen ESAT6-CFP10, with improved antigenicity, was degraded over time. However, the stability of the recombinant protein was maintained by adding a protease inhibitor, and the inhibition of protease activity corresponding to impurities during the purification process was confirmed through SDS-PAGE and CE-SDS (Figure 2A). CE-SDS experiments show that only 24% of the antigen remained intact in the absence of protease inhibitors, whereas 94% of the antigen remained intact in the presence of such inhibitors (Figure 2B).

< Example 2> Manipulation to improve antigen stability

To improve the stability of the antigen ESAT6-CFP10 without adding protease inhibitors, LC-MS based on in gel digestion was performed to obtain information about weak sites cleaved by proteases. We selected and excised three different fragment bands (A, B, C) from SDS-PAGE. After treatment with three different proteases (Trypsin, chymotrypsin, and Glu-C), the peptide sequence identified in the LC-MS experiment of each band was matched to the target protein. The sequence identified in the 13kDa (A) band is amino acids 121 to 204 and corresponds to CFP10. In the 12 kDa (B) band, both ESAT6 and CFP10 sequences were confirmed, and some fragmented CFP10 and ESAT6 were predicted to have amino acid sequences from 17 to 82 and were not completely separated on the SDS-PAGE gel. The 5 kDa(C) band was primarily identified as ESAT6 (1–82) (Figure 3A). All peptides identified in the gel bands contained both helix-turn-helix of ESAT6 and CFP10 and the Glu16, Glu82, Lys120 and Glu204 amino acids were strongly observed as a result of cleavage. This means that the antiparallel helical structures of ESAT6 and CFP10 remain relatively stable from proteases. The three amino acids are considered the positions of the final product and not the start site of cleavage. Therefore, engineering for antigen stabilization focused on the linker regions of ESAT6 and CFP10. In particular, ESAT6 and CFP10 were linked to select amino acids where mutations should be introduced based on the tertiary structure of the short α-helix (88-92) protein and LC-MS results. Ser89, Lys120, and Glu204 were the most likely candidates, and the mutant with the lowest mutation energy without affecting structural change was finally selected using Discovery studio 2021 (Figure 3B). Some mutants increase structural instability, but structural stability increased when Ser89 was mutated to Leu or Arg. Mutation of Lys120 to Gln also increased the mutation energy. Glu204, which exists in a region without secondary structure, was replaced with glycine to prevent it from being affected by protease.

< Example 3> SDS-PAGE & RP-HPLC Mutational stability test using

Seven types of mutants were created through combinations of selected mutants. The stability of the antigen over temperature and time was compared with WT. First, changes in the main band of the antigen expressed and purified under the same conditions were observed for 0, 4, 7, and 10 days at 4°C without protease inhibitor using SDS-PAGE method (Figure 4A). WT and 204G mutant began to degrade at similar rates after 4 days. However, the stability of the remaining six mutants was maintained even after 10 days. Stability at 37°C was different from stability at 4°C and almost all mutants were degraded. After 4 days, the only mutants with major bands remaining were DG (120G and 204G), 120Q, and 89R mutants. Moreover, their degradation pattern was different from that at 4°C (Figure 4A). When WT, 204G, and three mutants (DG, 120Q, and 89R) were quantified using RP-HPLC (Figure 4B), similar results were obtained as SDS-PAGE.

< Example 4> Maintenance of antigenicity of mutations

Antigenicity evaluation of three mutants (DG, 120Q, and 89R) with improved stability compared to WT was performed using peripheral blood cells (PBMC). The results of antigenicity evaluation from peripheral blood cells of two patients with latent tuberculosis and two normal people showed that three mutants, including WT, showed increased secretion of IFN-γ (IGRA) only in patients with latent tuberculosis. The degree was similar compared to WT. It is judged that the introduced mutation did not affect antigenicity (Figure 5).

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. something to do. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Osong Medical Innovation Foundation <120> Composition for diagnosing latent tuberculosis comprising antigen with improved antigenicity and stability <130> ADP-2021-0886 <160> 4 <170>CopatentIn 2.0 <210> 1 <211> 225 <212> PRT <213> Artificial Sequence <220> <223> recombinant antigen ESAT6-CFP10 120G/204G <400> 1 Gly Ser Leu Gln Met Thr Glu Gln Gln Trp Asn Phe Ala Gly Ile Glu 1 5 10 15 Ala Ala Ala Ser Ala Ile Gln Gly Asn Val Thr Ser Ile His Ser Leu 20 25 30 Leu Asp Glu Gly Lys Gln Ser Leu Thr Lys Leu Ala Ala Ala Trp Gly 35 40 45 Gly Ser Gly Ser Glu Ala Tyr Gln Gly Val Gln Gln Lys Trp Asp Ala 50 55 60 Thr Ala Thr Glu Leu Asn Asn Ala Leu Gln Asn Leu Ala Arg Thr Ile 65 70 75 80 Ser Glu Ala Gly Gln Ala Met Ala Ser Thr Glu Gly Asn Val Thr Gly 85 90 95 Met Phe Leu Gln Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 100 105 110 Gly Gly Ser Met Ala Glu Met Gly Thr Asp Ala Ala Thr Leu Ala Gln 115 120 125 Glu Ala Gly Asn Phe Glu Arg Ile Ser Gly Asp Leu Lys Thr Gln Ile 130 135 140 Asp Gln Val Glu Ser Thr Ala Gly Ser Leu Gln Gly Gln Trp Arg Gly 145 150 155 160 Ala Ala Gly Thr Ala Ala Gln Ala Ala Val Val Arg Phe Gln Glu Ala 165 170 175 Ala Asn Lys Gln Asn Gln Glu Leu Asp Glu Leu Ser Thr Asn Ile Arg 180 185 190 Gln Ala Gly Val Gln Tyr Ser Arg Ala Asp Glu Gly Gln Gln Gln Ala 195 200 205 Leu Ser Ser Gln Met Glu Phe Pro Gly Arg Leu Glu Arg Pro His Arg 210 215 220 Asp 225 <210> 2 <211> 225 <212> PRT <213> Artificial Sequence <220> <223> recombinant antigen ESAT6-CFP10 120Q <400> 2 Gly Ser Leu Gln Met Thr Glu Gln Gln Trp Asn Phe Ala Gly Ile Glu 1 5 10 15 Ala Ala Ala Ser Ala Ile Gln Gly Asn Val Thr Ser Ile His Ser Leu 20 25 30 Leu Asp Glu Gly Lys Gln Ser Leu Thr Lys Leu Ala Ala Ala Trp Gly 35 40 45 Gly Ser Gly Ser Glu Ala Tyr Gln Gly Val Gln Gln Lys Trp Asp Ala 50 55 60 Thr Ala Thr Glu Leu Asn Asn Ala Leu Gln Asn Leu Ala Arg Thr Ile 65 70 75 80 Ser Glu Ala Gly Gln Ala Met Ala Ser Thr Glu Gly Asn Val Thr Gly 85 90 95 Met Phe Leu Gln Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 100 105 110 Gly Gly Ser Met Ala Glu Met Gln Thr Asp Ala Ala Thr Leu Ala Gln 115 120 125 Glu Ala Gly Asn Phe Glu Arg Ile Ser Gly Asp Leu Lys Thr Gln Ile 130 135 140 Asp Gln Val Glu Ser Thr Ala Gly Ser Leu Gln Gly Gln Trp Arg Gly 145 150 155 160 Ala Ala Gly Thr Ala Ala Gln Ala Ala Val Val Arg Phe Gln Glu Ala 165 170 175 Ala Asn Lys Gln Asn Gln Glu Leu Asp Glu Leu Ser Thr Asn Ile Arg 180 185 190 Gln Ala Gly Val Gln Tyr Ser Arg Ala Asp Glu Glu Gln Gln Gln Ala 195 200 205 Leu Ser Ser Gln Met Glu Phe Pro Gly Arg Leu Glu Arg Pro His Arg 210 215 220 Asp 225 <210> 3 <211> 225 <212> PRT <213> Artificial Sequence <220> <223> recombinant antigen ESAT6-CFP10 89R <400> 3 Gly Ser Leu Gln Met Thr Glu Gln Gln Trp Asn Phe Ala Gly Ile Glu 1 5 10 15 Ala Ala Ala Ser Ala Ile Gln Gly Asn Val Thr Ser Ile His Ser Leu 20 25 30 Leu Asp Glu Gly Lys Gln Ser Leu Thr Lys Leu Ala Ala Ala Trp Gly 35 40 45 Gly Ser Gly Ser Glu Ala Tyr Gln Gly Val Gln Gln Lys Trp Asp Ala 50 55 60 Thr Ala Thr Glu Leu Asn Asn Ala Leu Gln Asn Leu Ala Arg Thr Ile 65 70 75 80 Ser Glu Ala Gly Gln Ala Met Ala Arg Thr Glu Gly Asn Val Thr Gly 85 90 95 Met Phe Leu Gln Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 100 105 110 Gly Gly Ser Met Ala Glu Met Lys Thr Asp Ala Ala Thr Leu Ala Gln 115 120 125 Glu Ala Gly Asn Phe Glu Arg Ile Ser Gly Asp Leu Lys Thr Gln Ile 130 135 140 Asp Gln Val Glu Ser Thr Ala Gly Ser Leu Gln Gly Gln Trp Arg Gly 145 150 155 160 Ala Ala Gly Thr Ala Ala Gln Ala Ala Val Val Arg Phe Gln Glu Ala 165 170 175 Ala Asn Lys Gln Asn Gln Glu Leu Asp Glu Leu Ser Thr Asn Ile Arg 180 185 190 Gln Ala Gly Val Gln Tyr Ser Arg Ala Asp Glu Glu Gln Gln Gln Ala 195 200 205 Leu Ser Ser Gln Met Glu Phe Pro Gly Arg Leu Glu Arg Pro His Arg 210 215 220 Asp 225 <210> 4 <211> 225 <212> PRT <213> Artificial Sequence <220> <223> recombinant antigen ESAT6-CFP10 wild type <400> 4 Gly Ser Leu Gln Met Thr Glu Gln Gln Trp Asn Phe Ala Gly Ile Glu 1 5 10 15 Ala Ala Ala Ser Ala Ile Gln Gly Asn Val Thr Ser Ile His Ser Leu 20 25 30 Leu Asp Glu Gly Lys Gln Ser Leu Thr Lys Leu Ala Ala Ala Trp Gly 35 40 45 Gly Ser Gly Ser Glu Ala Tyr Gln Gly Val Gln Gln Lys Trp Asp Ala 50 55 60 Thr Ala Thr Glu Leu Asn Asn Ala Leu Gln Asn Leu Ala Arg Thr Ile 65 70 75 80 Ser Glu Ala Gly Gln Ala Met Ala Ser Thr Glu Gly Asn Val Thr Gly 85 90 95 Met Phe Leu Gln Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 100 105 110 Gly Gly Ser Met Ala Glu Met Lys Thr Asp Ala Ala Thr Leu Ala Gln 115 120 125 Glu Ala Gly Asn Phe Glu Arg Ile Ser Gly Asp Leu Lys Thr Gln Ile 130 135 140 Asp Gln Val Glu Ser Thr Ala Gly Ser Leu Gln Gly Gln Trp Arg Gly 145 150 155 160 Ala Ala Gly Thr Ala Ala Gln Ala Ala Val Val Arg Phe Gln Glu Ala 165 170 175 Ala Asn Lys Gln Asn Gln Glu Leu Asp Glu Leu Ser Thr Asn Ile Arg 180 185 190 Gln Ala Gly Val Gln Tyr Ser Arg Ala Asp Glu Glu Gln Gln Gln Ala 195 200 205 Leu Ser Ser Gln Met Glu Phe Pro Gly Arg Leu Glu Arg Pro His Arg 210 215 220 Asp 225

Claims (6)

A composition for diagnosing latent tuberculosis comprising ESAT6-CFP10 recombinant antigen consisting of the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 as an active ingredient. The composition for diagnosing latent tuberculosis according to claim 1, wherein the composition has improved antigenicity and stability. A kit for diagnosing latent tuberculosis comprising the composition of claim 1 or 2. A method of providing information necessary for diagnosing latent tuberculosis, comprising reacting the composition of claim 1 or 2 with a sample isolated from a patient and analyzing whether latent tuberculosis infection exists. The method of claim 4, wherein the sample is blood. The method of claim 4, wherein the step of analyzing latent tuberculosis infection is performed using an interferon-γ release assay (IGRA).