KR102574193B1 - UTR sequence for controlling protein expression and protein localization, and mRNA sequence comprising the same - Google Patents

Abstract

The present invention relates to mRNA containing the UTR of polymorphic β-catenin. When using an mRNA molecule, nucleic acid molecule, expression construct, and/or expression vector of the present invention, the expression efficiency of the target protein can be effectively improved, and the expression site of the target protein can be expanded to the cytoplasm to stably secrete the target protein to the extracellular region. In addition, it can be used as an mRNA vaccine in the future by controlling the expression level of imported mRNA.

Description

A UTR sequence for controlling protein expression and localization and an mRNA sequence containing the UTR sequence {UTR sequence for controlling protein expression and protein localization, and mRNA sequence comprising the same}

The present invention relates to a UTR sequence for protein expression and position control and an mRNA sequence including the UTR sequence.

mRNA (messenger RNA) serves as a 'blueprint' for RNA molecules to produce proteins. mRNA is transcribed from the original DNA and essentially includes a coding region encoding a protein to be synthesized, and may include an untranslated region (UTR). The untranslated region is a region located upstream of the start codon and downstream of the stop codon of mRNA and refers to a sequence that is not translated into protein. Common eukaryotic mRNAs have UTRs at the 5' and 3' ends. UTR controls the degradation or translation of mRNA, has an important effect on the stability and expression of mRNA, and ultimately plays an important role in regulating the amount of protein. In particular, the 3'UTR contributes not only to the regulation of mRNA expression and mRNA stability, but also to the intracellular localization of mRNA. Although various types of 3'UTR isoforms can be generated from one gene by alternative splicing, the number of genes corresponding to this group is very small. No study has been reported on the effect of each multi-UTR isoform produced from one gene on the improvement of expression efficiency.

On the other hand, many studies have revealed the components and signal transduction process of the Wnt signaling pathway (Bryan T. MacDonald, 2009). Dr. Hubrecht Institute, who plays a leading role in Wnt signaling, With the publication of the canonical Wnt pathway by Hans Clevers' research team, the key regulator, β-catenin, has received more attention. β-catenin is a multi-functional molecule that performs various functions in cells and is a protein expressed from the human CTNNB1 gene (Tomas Valenta and Basler, 2012). β-catenin can have three 3'UTRs with different lengths. There has been no previous study on the change in protein expression pattern and expression location according to the 3'UTR isoform of β-catenin mRNA.

As such, the present inventors conducted studies on protein expression efficiency and protein expression location for each UTR type of β-catenin mRNA, which have not been previously studied. Furthermore, the 3'UTR isoform of β-catenin mRNA was fragmented, and among the 3'UTR isoforms, a study was conducted to identify factors that have an important effect on expression efficiency and expression position control. Through this, the present inventors intend to propose an mRNA platform system that enhances the expression efficiency of the target protein and promotes the movement of the target protein to the cytoplasm or cell membrane, so that the target protein can be stably secreted to the outside of the cell. .

Republic of Korea Patent Registration No. 10-1769231 (2017.08.10. Registration)

The present inventors have developed an mRNA platform that enhances the expression efficiency of a target protein by increasing the translation efficiency of mRNA and promotes the movement of the target protein to the cytoplasm or cell membrane so that the target protein can be stably secreted to the outside of the cell. Efforts were made to develop the system. As a result, in the case of mRNA sequences containing the 5'UTR and predetermined 3'UTR fragments of β-catenin mRNA, the translation efficiency is significantly improved, and the ratio of protein expression to the cytoplasm or cell membrane is increased, thereby revealing the present invention has completed

Accordingly, an object of the present invention is to provide an mRNA molecule in which the expression efficiency of a target protein is enhanced and the movement of the target protein into the cytoplasm or cell membrane is promoted.

Another object of the present invention is to provide a nucleic acid molecule encoding the mRNA molecule.

Another object of the present invention is to provide an expression construct comprising the nucleic acid molecule.

Another object of the present invention is to provide a recombinant vector containing the expression construct.

Another object of the present invention is to provide an isolated host cell containing the expression vector.

Another object of the present invention is to provide an mRNA production method in which the expression efficiency of the target protein is enhanced and the movement of the target protein to the cytoplasm or cell membrane is promoted.

According to one aspect of the present invention, the present invention provides (a) a coding region encoding a target protein; (b) 5'UTR (untranslated region, untranslated region) of β-catenin bound to the 5' end of the coding region; And (c) a fragment of the 3'UTR of β-catenin linked to the 3' end of the coding region, wherein the fragment of the 3'UTR comprises the RNA sequence of SEQ ID NO: 9 or SEQ ID NO: 13. Provides an mRNA molecule that

The present inventors wanted to develop an mRNA platform system that enhances the expression efficiency of a target protein by increasing the translation efficiency of mRNA and promotes the movement of the target protein to the cytoplasm or cell membrane so that it can be stably secreted to the outside of the cell. Efforts were made to research. As a result, in the case of mRNA sequences containing fragments of the 5'UTR and predetermined 3'UTR of β-catenin mRNA, the translation efficiency was significantly improved, and the ratio of protein expression to the cytoplasm or cell membrane was increased.

The term “β-catenin” used herein is also known as Catenin beta-1 and refers to a protein expressed from the human CTNNB1 gene. β-Catenin, a subunit of the cadherin protein complex, is known to be a major factor in Wnt cell signaling involved in determining cell fate, cell migration, and regulating cell polarity. The human CTNNB1 gene can be accessed through known databases such as GenBank (CTNNB1, catenin beta 1 [Homo sapiens (human)], Gene ID: 1499).

The term "target protein" in the present specification includes any protein as well as β-catenin, and a person skilled in the art can use the mRNA molecule of the present invention to increase expression efficiency and produce it in large quantities, or to promote movement into the cytoplasm or cell membrane. It means a protein to be stably secreted to the outside of the cell.

The term "coding region encoding a target protein" in the present specification is a part of mRNA and is a part composed of codons. Codons are translated into proteins according to the information provided by the "genetic code". A coding region usually starts with a start codon and ends with a stop codon. Typically, the start codon is an AUG triplet and the stop codon is UAA, UAG or UGA. In addition to protein-coding, portions of the coding region may serve as regulatory sequences in pre-mRNAs, either as exonic splicing enhancers or exonic splicing silencers. The coding region encoding the target protein of the present invention may include sequences transcribed from nucleic acid sequences of various foreign genes in addition to the coding region sequence of the β-catenin gene, and there are mutations in nucleotides that do not change the protein. Bar, even the mRNA sequence for obtaining the same target protein may include a coding region having various nucleotide mutations. Variations in nucleotides that do not result in a change in the protein described above include functionally equivalent codons or codons encoding the same amino acid (e.g., due to codon degeneracy, there are six codons for arginine or serine); Or a nucleic acid molecule containing a codon encoding a biologically equivalent amino acid, and considering the mutation having the above-described biological equivalent activity, the nucleic acid molecule used in the present invention has substantial identity with the sequence listed in the sequence listing. ) It is interpreted to include sequences representing. By using an mRNA molecule in which the 5'UTR and 3'UTR or a fragment thereof of the present invention are linked to the coding region of an mRNA sequence capable of translating a protein to be introduced into the subject, the protein It is possible to significantly increase the translation level of the protein to increase expression efficiency, and promote the movement of the protein to the cytoplasm or cell membrane so that the protein is stably secreted to the outside of the cell.

The term “untranslated region (UTR)” in the present specification refers to an untranslated sequence that is located upstream of the start codon and downstream of the stop codon of mRNA. The UTR upstream of the start codon of mRNA is called the 5'UTR, and the UTR downstream of the stop codon of mRNA is the 3'UTR. The untranslated region in mRNA plays a pivotal role in regulating both mRNA stability and mRNA translation. The inventors of the present invention use these characteristics of UTR to improve the translation efficiency of β-catenin mRNA, which has not been previously studied, to improve the expression efficiency of the target protein, and to promote the movement of the target protein to the cytoplasm or cell membrane to promote the target protein was stably secreted to the outside of the cell.

The term "5'UTR of β-catenin" in the present specification refers to the 5'UTR of the mRNA of the β-catenin gene, and the term "3'UTR of the β-catenin" in the present specification refers to the 3'UTR of the mRNA of the β-catenin gene. ' means UTR.

The term "3'UTR of β-catenin" or "fragment of 3'UTR of β-catenin" in the present specification is a kind of translation efficiency verified by the present inventors for optimization of the 3'UTR sequence of mRNA of β-catenin gene. It refers to 3'UTR sequences, and may include isoforms by alternative splicing of 3'UTR, and fragments (F1 to F4) of UTR-1 fragmented in an embodiment to be described later. β-catenin has the same coding region, but there are three 3'UTR isoforms (UTR-1, UTR-2 and UTR-3) by alternative splicing. UTR-3 is the longest isoform containing intron 15 (In15) and exon 16 (E16). UTR-2 is a medium length isoform with intron 15 removed. UTR-1 is the shortest isoform with intron 15 (In15) and exon 16A (E16A) removed. Depending on the type of 3'UTR or its fragment, the translation efficiency of mRNA and the distribution location of the expressed protein may be different.

In one embodiment of the present invention, the coding region encoding the target protein of the mRNA molecule of the present invention may include an initiation codon.

In one embodiment of the present invention, the coding region encoding the target protein of the mRNA molecule of the present invention may include a stop codon.

In one embodiment of the present invention, the 3'UTR fragment of β-catenin of the present invention is one in which at least intron 15 (Intron 15, In15) of the entire 3'UTR sequence is deleted. In the present invention, deletion of the Intron 15 (In15) region includes deletion of all or part of the Intron 15 region.

The term “intron 15 (Intron 15, In15) site” in the present specification is shown in SEQ ID NO: 3 and refers to the 13th to 317th nucleotide sequence portion of SEQ ID NO: 8. The nucleotide sequence of SEQ ID NO: 8 in the present specification is a heteromeric form including an In15 site and is referred to as UTR-3 in the present specification. In the case of mRNA sequences containing a 3'UTR sequence containing an In15 site, movement into the cytoplasm or cell membrane is limited, but in the case of mRNA sequences containing a 3'UTR sequence not containing an In15 site, movement into the cytoplasm is smooth. , which can affect the efficiency of translation into proteins.

In one embodiment of the present invention, the 3'UTR fragment of β-catenin of the present invention has an additional exon 16A (Exon 16A, E16A) region deleted. In the present invention, deletion of the exon 16A region includes deletion of all or part of the exon 16A region. "Exon 16A (E16A) region" in the present specification is shown in SEQ ID NO: 4, and refers to the 13th to 171st nucleotide sequence portion of SEQ ID NO: 7 and the 318th to 476th nucleotide sequence portion of SEQ ID NO: 8 . In particular, as demonstrated in Examples to be described later, when the 5'UTR and 3'UTR of β-catenin are used together, the In15 site is deleted as the 3'UTR and the 3'UTR containing the E16A site is used. When, the expression efficiency of the protein encoded by the coding region is enhanced.

In one embodiment of the present invention, the 3'UTR fragment of β-catenin of the present invention comprises any one RNA sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 9 to SEQ ID NO: 13 will be. More specifically, the 3'UTR fragment of β-catenin of the present invention is one comprising any one RNA sequence selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11 and SEQ ID NO: 13, more specifically, SEQ ID NO: 9 or the RNA sequence of SEQ ID NO: 13, and most specifically, the RNA sequence of SEQ ID NO: 13.

In the present specification, “promoting the movement of a target protein to the cytoplasm or cell membrane” means that the rate at which the expressed target protein is located in the cytoplasm or cell membrane increases or the range of the region where the expressed target protein is located in the cytoplasm extends from the nucleus to the nucleus. means far away As demonstrated in the Examples to be described later, when F1 + F3 (SEQ ID NO: 13), which is a 5'UTR and 3'UTR fragment of β-catenin, is present, the target protein is expressed in the cytoplasm and cell membrane far from the nucleus. The ratio observed up to , showed a heterogeneous effect of regulating the expression site of the target protein so that the protein could be stably secreted to the extracellular space.

The fragments of 5'UTR, 3'UTR and 3'UTR of β-catenin used in the present invention also include sequences showing substantial identity with the sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 6 to SEQ ID NO: 13, respectively. interpreted as doing The above substantial identity is at least 60% when the sequence of the present invention and any other sequence described above are aligned so as to correspond as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art. homology (e.g., 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, or 69%), more preferably a homology of 70% (e.g., 70%) %, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%), even more preferably 80% homology (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%), most preferably 90% homology (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). All integers greater than or equal to 70% and less than or equal to 100% and prime numbers therebetween are included within the scope of the present invention with respect to % homology.

Alignment methods for sequence comparison are known in the art. Various methods and algorithms for alignment are described in Smith and Waterman, Adv. Appl. Math. 2:482 (1981) Needleman and Wunsch, J. Mol. Bio. 48:443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73:237-44 (1988); Higgins and Sharp, CABIOS 5:151-3 (1989); Corpet et al., Nuc. Acids Res. 16:10881-90 (1988); Huang et al., Comp. Appl. BioSci. 8:155-65 (1992) and Pearson et al., Meth. Mol. Biol. 24:307-31 (1994). The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10 (1990)) is accessible from the National Center for Biological Information (NBCI), etc., and blastp, blasm, It can be used in conjunction with sequence analysis programs such as blastx, tblastn and tblastx. BLAST is accessible through the BLAST page on the ncbi website. The sequence homology comparison method using this program can be found on the BLAST help page of the ncbi website.

The mRNA molecule of the present invention may include a 5' cap structure at the 5' end of the 5'UTR, and may additionally include a poly(A) tail structure at the 3' end of the 3'UTR. In this way, the stability and translation efficiency of the mRNA molecule can be further enhanced. In addition, modified natural nucleotides and artificial nucleotides such as N1-methylpseudouridine, known to improve mRNA stability and enhance mRNA translation, may be incorporated, and modifications to the extent described above for the mRNA molecules of the present invention are permitted is obvious to those skilled in the art.

The mRNA molecule of the present invention can be used in various forms, such as direct injection into the body of a subject or application to in vitro cells, and various applications such as therapeutic agents using mRNA sequences, mRNA vaccines, disease diagnosis, and drug screening. can be used for a purpose. The mRNA molecule of the present invention can be used for intracellular delivery using various methods known in the art to improve the stability of the mRNA molecule, and specifically, for example, using a method of enclosing the mRNA molecule with a phospholipid membrane.

In one embodiment of the present invention, the 5'UTR of the present invention is to include the RNA sequence of SEQ ID NO: 1.

According to another aspect of the present invention, the present invention provides a nucleic acid molecule encoding the mRNA molecule of the present invention.

In this specification, the term "nucleic acids" has the meaning of comprehensively including DNA (gDNA and cDNA) and RNA molecules, and nucleotides, which are basic structural units in nucleic acid molecules, are natural nucleotides as well as sugar or base sites. also includes modified analogs (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).

In this specification, the term "nucleic acid molecule encoding an mRNA molecule" is sufficient to be a nucleic acid molecule as a template for transcription of the mRNA molecule of the present invention, and it is apparent to those skilled in the art that it is not limited to any specific nucleotide sequence.

In the present specification, the ORF (Open Reading Frame) region of the nucleic acid molecule encoding the mRNA molecule of the present invention may be a sequence transcribed from a foreign nucleic acid sequence, and there are mutations in nucleotides that do not result in protein changes, Even nucleic acid sequences for obtaining the same target protein may include ORFs having various nucleotide mutations. Variations in nucleotides that do not result in a change in the protein described above include functionally equivalent codons or codons encoding the same amino acid (e.g., due to codon degeneracy, there are six codons for arginine or serine); Or a nucleic acid molecule containing a codon encoding a biologically equivalent amino acid, and considering the mutation having the above-described biological equivalent activity, the nucleic acid molecule used in the present invention has substantial identity with the sequence listed in the sequence listing. ) It is interpreted to include sequences representing. In the case of 5'UTR and 3'UTR or fragments thereof, they correspond to untranslated regions, and compared to ORF regions, relatively limited transformation will be allowed, but at the level of common sense of those skilled in the art, fine details that do not cause significant changes in translation activity Variations may be permissible.

According to another aspect of the present invention, the present invention provides an expression construct comprising the nucleic acid molecule.

As used herein, the term "expression construct" is defined to mean a nucleic acid molecule containing only minimal elements for protein expression in cells. The expression construct of the present invention may include various conventionally known promoters. The promoter is operatively linked to the nucleic acid sequence of the present invention to regulate transcription and/or translation of the nucleic acid sequence.

As used herein, the term "operatively linked" refers to a functional linkage between a nucleic acid expression control sequence, such as a promoter, a signal sequence, or an array of transcriptional regulator binding sites, and another nucleic acid sequence, and thus whereby the regulatory sequence controls the transcription and/or translation of the other nucleic acid sequence.

According to another aspect of the present invention, the present invention provides a recombinant vector comprising the expression construct.

According to another aspect of the present invention, the present invention provides an isolated host cell containing the recombinant vector.

The vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are disclosed in Sambrook, et al., Cold Spring Harbor Laboratory Press (2001), which is incorporated herein by reference. inserted as a reference.

Vectors of the present invention may typically be constructed as vectors for cloning or vectors for expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host.

For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (eg, ^pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.) , a ribosome binding site for initiation of translation and a transcription/translation termination sequence. When E. coli is used as a host cell, the promoter and operator regions of the E. coli tryptophan biosynthetic pathway (Yanofsky, C., J. Bacteriol., 158: 1018-1024 (1984)) and the leftward promoter of phage λ (pL ^{The λ} promoter, Herskowitz, I. and Hagen, D., Ann. Rev. Genet., 14:399-445 (1980)) can be used as a regulatory region.

On the other hand, vectors that can be used in the present invention are plasmids often used in the art (eg, pGL3/Luc, pBABE, pSK349, pSC101, ColE1, pBR322, pUC8/9, pHC79, pGEX series, pET series and pUC19 ), phages (eg, λgt·λ4B, λ-Charon, λΔz1, and M13) or viruses (eg, SV40, etc.).

In one embodiment of the present invention, the vector may additionally carry genes encoding reporter molecules, such as luciferase and β-glucuronidase.

In a specific embodiment of the present invention, the vector may be a FLAG vector, a YFP vector, or a GFP vector, but is not limited thereto.

The host cell of the present invention includes not only a cell capable of transiently expressing the vector of the present invention by transient transformation or transfection with the vector of the present invention, but also a stable cell line capable of stably and continuously expressing the vector of the present invention ( stable cell line). A stable cell line refers to a cell line in which a specific gene is integrated into the genome and the gene is not lost over several generations even if the cell divides and proliferates and continues to be transmitted and expressed.

Any host cell or cell line known in the art can be used as a host cell or cell line capable of stably and continuously cloning and expressing the vector of the present invention, such as E. coli Origami2, E. coli JM109, E. coli BL21. (DE3), E. coli strains such as E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110 , Bacillus genus strains such as Bacillus subtilis, Bacillus thuringiensis , and Enterobacteriaceae and strains such as Salmonella typhimurium, Serratia marcessons, and various Pseudomonas species.

In addition, when the vector of the present invention is transformed or transfected into eukaryotic cells, yeast ( Saccharomyce cerevisiae ) , insect cells and animal cells (eg, HCT116, HT-29, SW480, HEK293, U2OS, CHO ( Chinese hamster ovary), W138, BHK, COS-7, HepG2, 3T3, RIN and MDCK cell lines) and the like can be used.

In the present invention, "transformation" or "transfection" means to enable expression after introducing a gene into a host cell. A method of transforming or transfecting a vector into a host cell into a host cell includes any method of introducing a base into a cell, and can be performed by selecting an appropriate standard technique as known in the art.

A method for delivering the vector of the present invention into a host cell, when the host cell is a prokaryotic cell, the CaCl2 method (Cohen, S.N. et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114 (1973)) , the Hanahan method (Cohen, S.N. et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114 (1973); and Hanahan, D., J. Mol. Biol., 166:557-580 ( 1983)) and electroporation (Dower, W.J. et al., Nucleic. Acids Res., 16:6127-6145 (1988)). In addition, when the host cell is a eukaryotic cell, microinjection method (Capecchi, M.R., Cell, 22:479 (1980)), calcium phosphate precipitation method (Graham, F.L. et al., Virology, 52:456 (1973)), electroporation (Neumann, E. et al., EMBO J., 1:841 (1982)), liposome-mediated transfection (Wong, T.K. et al., Gene, 10:87 (1980)), DEAE- Dextran treatment (Gopal, Mol. Cell Biol., 5:1188-1190 (1985)), and gene bombardment (Yang et al., Proc. Natl. Acad. Sci., 87:9568-9572 (1990)) ), etc., the vector can be injected into the host cell.

According to another aspect of the present invention, the present invention is a step of binding fragments of the 5'UTR of β-catenin and the 3'UTR of β-catenin to the 5'end and 3'end of the RNA sequence encoding the target protein, respectively A method for producing an mRNA molecule that promotes the movement of a target protein into the cytoplasm or cell membrane, comprising a, wherein the fragment of the 3'UTR comprises the RNA sequence of SEQ ID NO: 9 or SEQ ID NO: 13. .

In the present invention, the above-described “linking step” does not mean only physically binding each mRNA fragment, but also the binding of β-catenin to the 5' and 3' ends of the DNA molecule through transcription. and producing an mRNA sequence encoding a target protein to which the 5'UTR and the 3'UTR of β-catenin or a fragment thereof are bound.

In one embodiment of the present invention, the 3'UTR fragment of the present invention is one in which at least intron 15 (Intron 15, In15) of the entire 3'UTR sequence is deleted.

In one embodiment of the present invention, the 3'UTR fragment of the present invention has an additional exon 16A (Exon 16A, E16A) region deleted.

In one embodiment of the present invention, the 3'UTR or fragment thereof of the present invention comprises any one RNA sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 9 to SEQ ID NO: 13. More specifically, the 3'UTR fragment of the present invention comprises any one RNA sequence selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11 and SEQ ID NO: 13, more specifically, the RNA sequence of SEQ ID NO: 13 to include

In one embodiment of the present invention, the mRNA of the present invention may be produced through in vitro transcription.

The term " in vitro transcription" used herein refers to DNA-dependent RNA synthesis outside of a cell and in vitro. Template DNA can be linearized with suitable restriction enzymes prior to in vitro transcription. Reagents used for RNA in vitro transcription are typically polymerases such as bacteriophage-encoded RNA polymerases (T7, T3, SP6 or Syn5); a ribonucleotide triphosphate (NTP) for four bases (adenine, cytosine, guanine and uracil), optionally a cap analog; modified nucleotides; RNase inhibitors and the like, but are not limited thereto.

The inventors of the present invention not only when the 5'UTR of β-catenin and the 3'UTR of β-catenin or mRNA containing fragments thereof are synthesized in cells through DNA plasmids, but also in vitro transcription Even when using the mRNA synthesized through, it was confirmed that the efficiency of the target protein was enhanced, and thus the intracellular expression pattern could be regulated. Thus, it was suggested that the mRNA containing the 5'UTR of β-catenin and the 3'UTR of β-catenin or a fragment thereof of the present invention can modulate immunity and can be applied as a cancer vaccine mRNA construct capable of mass production. .

Since the mRNA production method of the present invention uses the mRNA molecule with improved expression efficiency of the other aspects of the present invention described above, all overlapping parts between the two inventions are equally applied, and to prevent complexity in the present specification, the description omit

In the case of using mRNA molecules, nucleic acid molecules encoding the same, expression vectors, transformants, host cells, and compositions that increase the expression efficiency of the target protein and promote the movement of the target protein into the cytoplasm or cell membrane of the present invention, the target protein Expression can be effectively enhanced, and movement of the target protein to the cytoplasm or cell membrane can be promoted so that the target protein can be stably secreted to the outside of the cell.

The features and advantages of the present invention are summarized as follows:

i) The present invention provides (a) a coding region encoding a target protein; (b) 5'UTR (untranslated region, untranslated region) of β-catenin bound to the 5' end of the coding region; and (c) an mRNA molecule comprising a 3'UTR of β-catenin linked to the 3' end of the coding region or a fragment thereof.

ii) The present invention provides a nucleic acid molecule encoding the mRNA molecule.

iii) The present invention provides an expression construct comprising the nucleic acid molecule.

iv) The present invention provides a recombinant vector containing the expression construct.

v) The present invention provides an isolated host cell containing the recombinant vector.

In the case of using mRNA molecules, nucleic acid molecules encoding the same, expression vectors, transformants, host cells, and compositions that increase the expression efficiency of the target protein and promote the movement of the target protein to the cytoplasm or cell membrane of the present invention, the target protein expression can be effectively enhanced. In addition, it is possible to stably secrete the target protein to the outside of the cell by promoting the movement of the target protein to the cytoplasm or cell membrane.

This is possible not only through transformation and transfection using a DNA plasmid, but also in the case of mRNA synthesized by in vitro transcription. As such, when using the present invention, it is possible to stably synthesize a protein with high antigenicity, thereby suggesting the possibility of application as a cancer vaccine mRNA construct capable of regulating immunity.

Figure 1a shows an expression construct containing the coding region (coding region, CR) of β-catenin labeled with FLAG.
Figure 1b shows the result of expressing β-catenin in a stable SW480 cell line using the construct of Figure 1a and analyzing the expression efficiency by western blot.
1c and 1d show the expression of β-catenin in a stable SW480 cell line using the construct of FIG. 1a, and immunofluorescence to observe the intracellular location of the expressed β-catenin The results of the analysis are shown (FIG. 1c: cell population, FIG. 1d: single cell).
Figure 2a shows an expression construct containing YFP (yellow fluorescent protein) labeled with FLAG. (1: YFP, 2: 5'UTR + YFP, 3: 5'UTR + YFP + UTR-1, 4: 5'UTR + YFP + UTR-2, 5: 5'UTR + YFP + UTR-3, 6 : 5'UTR + YFP + ACTB 3'UTR)
Figure 2b shows the result of expressing YFP in U2OS cells using the construct of Figure 2a and analyzing the expression efficiency by western blot. (1: YFP, 2: 5'UTR + YFP, 3: 5'UTR + YFP + UTR-1, 4: 5'UTR + YFP + UTR-2, 5: 5'UTR + YFP + UTR-3, 6 : 5'UTR + YFP + ACTB 3'UTR)
FIG. 2c shows the results of immunofluorescence analysis performed to express YFP in U2OS cells using the construct of FIG. 2a and observe the intracellular location of the expressed YFP.
Figure 2d shows the results of quantifying the distribution of the nucleus (N) and cytoplasm (C) according to the intracellular location of the YFP protein.
Figure 2e shows the result of quantifying the distance from the nucleus to the cytoplasm where YFP fluorescence is expressed.
Figure 3 shows the results of analyzing the expression efficiency according to the type of β-catenin UTR using the β-catenin UTR luciferase reporter in HEK293 cells.
Figure 4 shows the results of analyzing expression efficiency enhancing elements in HEK293 cells using a β-catenin 3'UTR fragment luciferase reporter.
Figure 5a shows a schematic diagram of FLAG YFP + 3'UTR fragment reporter expression constructs for expression efficiency enhancement and position control element analysis. (1: YFP, 2: 5'UTR + YFP + F1, 3: 5'UTR + YFP + F3, 4: 5'UTR + YFP + F1+F3)
Figure 5b shows the result of expressing YFP in U2OS cells using the fragment expression construct of Figure 5a and confirming the protein expression through western blotting. (1: YFP, 2: 5'UTR + YFP + F1, 3: 5'UTR + YFP + F3, 4: 5'UTR + YFP + F1+F3)
FIG. 5c shows the result of analyzing the amount of protein released through extracellular vesicles by expressing YFP in U2OS cells using the fragment expression construct of FIG. 5a, collecting the cell medium and concentrating the protein. (1: YFP, 2: 5'UTR + YFP + F1, 3: 5'UTR + YFP + F3, 4: 5'UTR + YFP + F1+F3)
FIG. 5d shows the results of cell fractionation in which YFP was expressed in U2OS cells using the fragment expression construct of FIG. 5a and cytoplasmic and nuclear proteins were separately separated. (1: YFP, 2: 5'UTR + YFP + F1, 3: 5'UTR + YFP + F3, 4: 5'UTR + YFP + F1+F3)
FIG. 6a shows the results obtained by expressing YFP in U2OS cells using the fragment expression construct of FIG. 5a and performing immunofluorescence analysis.
Figure 6b shows the result of quantifying the distance of YFP fluorescence expression from the nucleus to the cytoplasmic granule.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Example 1: Analysis of expression efficiency and protein localization according to β-catenin UTR type through FLAG β-catenin coding region + UTR reporter

1-1. Analysis of expression efficiency according to β-catenin UTR type through FLAG β-catenin coding region + UTR reporter

In order to confirm the effect of enhancing the expression efficiency when the 5'UTR and 3'UTR isoforms are co-expressed in actual cells, an expression construct containing the coding region (coding region, CR) of β-catenin labeled with FLAG A truct was constructed (FIG. 1A).

The pCAN Myc-tagged β-catenin coding region (CR) plasmid was prepared by Dr. Courtesy of Paul McCrea (University of Texas, Austin). For β-catenin expression, DNA was amplified from the provided pCAN Myc β-catenin CR (Coding Region) clone using β-cat CR F and β-cat CRR primers. The PCR product was digested with BamHI and XbaI enzymes and cloned into the p3xFLAG-CMV-10 vector. The pGL3/Luc β-catenin 5'UTR clone upstream of 3xFLAG-β-cat CR was amplified by PCR using the β-cat 5'UTR primer set, digested with BamHI and BglII enzymes, and 3xFLAG-β-cat CR Cloned into clones. β-cat CR including the 5'UTR was amplified by PCR, digested with BamHI and XbaI enzymes, and cloned into pCS2 vector. Three β-cat 3'UTRs from the three pGL3/Luc β-catenin 3'UTR clones previously prepared were amplified using the β-cat CR + 3'UTR primer set, digested with XbaI and ApaI enzymes, and cloned from above cloned into one pCS2 β-cat 5'UTR 3xFLAG β-cat CR clone. Primers used are shown in Table 1 below.

The clones prepared above were amplified by PCR using retroviral primers (Table 1), digested with BamHI and SalI enzymes, cloned into pBABE vector, and transfected into colon cancer SW480 cells to stably produce β-catenin. A cell line capable of continuous expression was created.

primer restriction enzyme Sequence (5'→3') sequence number β-cat CR F BamHI AAAAGGATCCATGGCTACTCAAGCTGATTTG 14 β-cat CR R XbaⅠ AAAATCTAGATTACAGGTCAGTATCAAACCA 15 β-cat 5'UTR F BamHI G GGATCC AGGATACAGCGGCTTCTGCG 16 β-cat 5'UTR R BglII ATG AGATCT TGTCCACGCTGGATTTTCAAAACA 17 β-cat CR+3’UTR-1 F XbaⅠ GC TCTAGA ATCATCCTTTAGGAGTAACAATAC 18 β-cat CR+3’UTR-2 F GC TCTAGA ATCATCCTTTAGCTGTATTGTCT 19 β-cat CR+3’UTR-3 F GC TCTAGA ATCATCCTTTAGGTAAGAAGTTTA 20 β-cat CR+3’UTR R ApaⅠ AT GGGCCC CAATCGAATGAATTAAAAGTTT 21 Retroviral β-cat 5’UTR F BamHI CC GGATCC AGGATACAGCGGCTTCTGC 22 Retro viral β-cat 3’UTR R SalⅠ CAGG GTCGAC CAATCGAATGAATTAAAAGTTTAATTCT 23

Protein expression efficiency in the cell line was analyzed by Western blot. Each stably expressed cell was harvested by washing with 1ХPBS, cell down by centrifugation, and lysed by adding 1Хpassive lysis buffer (Promega). The lysed cells were centrifuged at 13000 rpm for 15 minutes to cell down, and only the lysate in the supernatant was transferred to a new tube. The extracted protein lysate was suspended in 4Х sample buffer (200 mM Tris-HCl, pH6.8, 8% SDS, 40% glycerol, 0.4% bromophenol blue, 400 mM DTT). Protein samples were separated on 8% and 12% SDS-PAGE gels and transferred to polyvinylidene difluoride membrane (PVDF) (Millipore). The membrane was blocked with 5% skim milk for 1 hour and then incubated overnight at 4°C with the primary antibody. Antibodies used were as follows: anti-FLAG M2 (F3165, Sigma-aldrich) and anti-β-actin (ab6276, Abcam).

As a result, as shown in Figure 1b, expression efficiency when 5'UTR and UTR-1 coexist or 5'UTR and UTR-2 coexist compared to UTR-0 (only coding region) it was high When 5'UTR and UTR-3 coexist, there was a difference in expression depending on the clone, and it was confirmed that the expression efficiency was low.

1-2. Analysis of intracellular localization of proteins according to β-catenin UTR types through the FLAG β-catenin coding region + UTR reporter

In order to observe the intracellular location of the expressed β-catenin protein, FLAG antibody was stained with FITC secondary antibody and immunofluorescence analysis was performed.

For β-catenin protein immunofluorescence experiments, the above cell lines were cultured on coverslips, and each stably expressed cell was fixed with 4% paraformaldehyde for 10 minutes at room temperature, washed three times with 1 × PBS, and , permeabilized with 100% methanol. Samples were formaldehyde inhibited with 50 mM glycine, washed with 1×PBS, and blocked with 5% BSA for 30 minutes at room temperature. The primary antibody was diluted in 5% BSA at a ratio of 1:1000, added to the sample, and incubated for 16 hours. Next, the secondary antibody was diluted in 5% BSA at a ratio of 1:1000, added to the sample, and incubated for 2 hours. After washing three times with 1×PBS, DAPI was stained using VECTSHIELD mounting solution (Vector Laboratories) and mounted onto glass slides. The cells were visualized by confocal microscopy (Fluoview, FV3000; Olympus, Melcille, NY).

The results are shown in Figures 1c and 1d. In the case of UTR-0 in SW480 cells, the amount of expression was low, and most of the protein was observed only in the nucleus. On the other hand, UTR-1 and UTR-2 were highly expressed, and proteins were observed not only in the nucleus but also in the cytoplasm. In particular, in UTR-2, it was clearly observed that the cell morphology was elongated and the expression was expressed to the end of the cell. UTR-3 had a difference in expression depending on the clone as in the result of FIG. 1b, but the amount of expression was small (FIGS. 1c and 1d). As such, it was confirmed that the type of isoform of β-catenin 3'UTR mRNA plays an important role in protein expression efficiency and intracellular location.

Example 2: Analysis of expression efficiency according to β-catenin UTR type through FLAG YFP + 3'UTR isoform reporter

Since Example 1 observed the expression level of β-catenin protein, in order to more accurately determine the function of β-catenin 3'UTR mRNA itself, the β-catenin coding region was replaced with YFP (yellow fluorescent protein) to prepare an expression construct (Fig. 2a). The existing EcoRI enzyme site was replaced with the MluI enzyme site by site-directed mutagenesis, DNA was amplified from the pEBB YFP clone using YFP F and R primers (Table 2 below), and pCS2 prepared above Clones were digested with MluI, XbaI enzymes and cloned. In addition, in order to compare the expression efficiency of β-cat UTR, the 3'UTR of β-actin (SEQ ID NO: 24) among housekeeping genes that are well expressed in any situation was introduced into pCS2 β-cat 5'UTR 3xFLAG YFP clone in the same way. cloned.

primer restriction enzyme Sequence (5'→3') sequence number YFP Forward primer MluⅠ G ACGCGT ATGGTGAGCAAGGGCGA 25 YFP Reverse primer XbaⅠ TCTAGA TTAAGCTCGAGATCTGAGTCCGG 26 YFP β-actin 3′UTR F XbaⅠ CCC TCTAGA TAGGCGGACTATGACTTAGTTGCGT 27 YFP β-actin 3′UTR R ApaⅠ GCG GGGCCC TCATTTTTAAGGTGTGCACTTTTA 28

Osteosarcoma U2OS cells were transfected with the YFP construct, and protein expression efficiency was analyzed by Western blot. Antibodies used were as follows: anti-FLAG M2 (F3165, Sigma-aldrich), anti-GFP (SC-126, Santacruz) and anti-β-actin (ab6276, Abcam).

As a result, the expression efficiency was high when both 5'UTR and UTR-1 were present and when both 5'UTR and UTR-2 were present, and showed higher efficiency than 3'UTR of β-actin ( Fig. 2b).

Osteosarcoma U2OS cells were transfected with YFP constructs, and immunofluorescence analysis was performed to observe YFP fluorescence. The results are shown in FIG. 2C. When only the YFP coding region is present, expression is expressed in both the cytoplasm and nucleus, but slightly higher expression in the nucleus than in the cytoplasm was observed. In the case of 5'UTR + YFP (UTR-0), it was found that the ratio observed in the nucleus was higher than when only the YFP coding region was present. In the case of 5'UTR + YFP + UTR-1 and 5'UTR + YFP + UTR-2, expression was observed in both the nucleus and cytoplasm, as in the case of only the YFP coding region. In particular, in the case of 5'UTR + YFP + UTR-2, it was observed that YFP was expressed from the nucleus all the way to the cytoplasm (Fig. 2c).

The distribution of YFP protein in the nucleus (N) and cytoplasm (C) was quantified according to the location of the cell, and the results are shown in FIG. 2d. In all cases except for the case of 5'UTR + YFP (UTR-0), YFP protein was found to be distributed in the nucleus and cytoplasm in an approximately 6:4 ratio (Fig. 2d).

The distance from the nucleus to the cytoplasm where YFP fluorescence is expressed was quantified, and the results are shown in FIG. 2e. When only the distribution was quantified as in FIG. 2d, no difference was found according to the β-catenin 3'UTR isoform, but as shown in FIG. In the case of +UTR-2, YFP was expressed to the end of the cell, and it was found that the distance in the cytoplasm where the protein was expressed was the longest (FIG. 2e).

Through this, it was confirmed that the expression efficiency of β-catenin 3'UTR was excellent, and that UTR-2 mRNA, in particular, had a significant effect on cell morphology and expression location.

Example 3: Expression efficiency analysis according to β-catenin UTR type using β-catenin UTR luciferase reporter

As in Example 2, the difference in the intracellular expression location according to the type of β-catenin 3'UTR isoform suggests that protein expression can be regulated by the 3'UTR. To prove the possibility, a luciferase reporter was constructed to confirm the expression efficiency of β-catenin 3'UTR (FIG. 3).

To construct a β-catenin UTR luciferase reporter, 5'UTR and three 3' 5'UTR and three 3' luciferase reporters were prepared by RT-PCR from β-catenin mRNA in SW480 cells using the primers for luciferase assay listed in Table 3 below. UTRs (UTR-1, UTR-2, UTR-3) were amplified. The 5'UTR PCR product was digested with HindIII and NcoI enzymes and cloned into the pGL3/Luc vector upstream of the luciferase gene. Each of the three 3'UTR PCR products were digested with XbaI enzyme and cloned into the pGL3/Luc vector downstream of the luciferase gene. And to construct a β-catenin luciferase reporter containing a 5'UTR and each of the three 3'UTRs, In-Fusion HD Cloning PCR method was performed using In-Fusion primers from the three 3'UTR clones prepared above. amplified by The PCR products were digested with XbaI enzyme and cloned into the pGL3/Luc β-catenin 5'UTR clone downstream of the luciferase gene.

primer restriction enzyme Sequence (5'→3') sequence number β-cat 5'UTR F Hind III GG AAGCTT AGGATACAGCGGCTTCTGC 29 β-cat 5'UTR R NcoⅠ GG CCATGG TGTCCACGCTGGATTTTCA 30 β-cat 3'UTR F XbaⅠ AT TCTAGA GATACTGACCTGTAAATCATCC 31 β-cat 3′UTR R CA TCTAGA AATGAATTAAAAGTTTAATTCTGAACC 32 In-Fusion β-cat 3'UTR-1 F GCCGTGTAAT TCTAGA ATCATCCTTTAGGAGTAACAA 33 In-Fusion β-cat 3'UTR-2F GCCGTGTAAT TCTAGA ATCATCCTTTAGCTGTATTGT 34 In-Fusion β-cat 3'UTR-3F GCCGTGTAAT TCTAGA ATCATCCTTTAGGTAAGAAGT 35 In-Fusion β-cat 3'UTR R CCGCCCCGAC TCTAGA CAATCGAATGAATTAAAAGT 36

For the luciferase assay to measure the expression efficiency of β-catenin mRNA UTR, human embryonic kidney HEK293 cells were cultured in 12-well plates. Cells were co-transfected with each of the pGL3/Luc β-catenin UTR reporters together with the pRL-TK vector. The transfected cells were harvested by washing with 1×PBS, cell-downed by centrifugation, and 1×passive lysis buffer (Promega) was added to lyse the cells. The lysed cells were centrifuged at 13000 rpm for 15 minutes to down the cells, and only the lysate in the supernatant was transferred to a new tube. And each sample was analyzed with a GLOMAX20/20 photometer using the dual-luciferase assay kit (Promega).

The results are shown in Figure 3. As shown in FIG. 3, when only the 3'UTR is present, the expression efficiency for each isoform is generally low and there is no significant difference between each isoform. On the other hand, when 5'UTR is present, the expression efficiency is higher than when only 3'UTR is present, and similar to the actual cell situation, when 5'UTR and 3'UTR are present together, expression efficiency is significantly increased. could confirm that In particular, the expression efficiency increased further when 5'UTR and UTR-1 coexist and when 5'UTR and UTR-2 coexist, whereas in the case of 5'UTR and UTR-3, expression efficiency The degree of increase was low (Fig. 3). Accordingly, it was confirmed that UTR-1 and UTR-2 mRNAs play an important role in enhancing expression efficiency.

Example 4: Analysis of expression efficiency enhancing elements using β-catenin 3'UTR fragment luciferase reporter

In order to identify which part of β-catenin 3'UTR mRNA is the regulatory element that plays the greatest role in enhancing expression efficiency, UTR-1 and UTR-2 were fragmented, and luciferase reporter Expression constructs were constructed (FIG. 4).

Fragments include F1 (fragment 1, SEQ ID NO: 9, the entire E16A region), F2 (fragment 2, SEQ ID NO: 10, part of the E16B region), F3 (fragment 3, SEQ ID NO: 11, part of the E16B region) and F4 (fragment 4, SEQ ID NO: 12, part of the E16B region) was prepared.

For F1, F2, F3, and F4, DNA was amplified using the corresponding F and R primers, digested with XbaI and SalI enzymes, and inserted into pGL3/Luc clone and pGL3/Luc β-catenin 5'UTR clone prepared above did For DNA amplification, the pCS2 β-cat 5'UTR 3xFLAG β-cat CR+3'UTR-3 clone was used as a template. Primers used are shown in Table 4 below.

primer restriction enzyme Sequence (5'→3') sequence number Luc 3’UTR-2 F1 F XbaⅠ CCC TCTAGA CTGTATTGTCTGAACTTGCATT 37 Luc 3’UTR-2 F1 R SalⅠ CCC GTCGAC GAGAGACTTAAAAAACAGTTACTGC 38 Luc 3’UTR-1 F2 F XbaⅠ CCC TCTAGA GAGTAACAATACAAATGGATTTTG 39 Luc 3’UTR-1 F2 R SalⅠ CCC GTCGAC TGTCTACACCATTACTCAATTCT 40 Luc 3’UTR-1 F3 F XbaⅠ CCC TCTAGA GTAACTGTTTTTTAAGTCTCTCGT 41 Luc 3’UTR-1 F3 R SalⅠ CCC GTCGAC ACACCTCTTACTGATTTACCCTA 42 Luc 3’UTR-1 F4 F XbaⅠ CCC TCTAGA TGGTCCAATTAGTTTCCTTTTTAA 43 Luc 3’UTR-1 F4 R SalⅠ CCC GTCGAC CAATCGAATGAATTAAAAGTTTA 44

HEK293 cells were transfected with the fragment expression construct and protein expression was analyzed. The results are shown in FIG. 4 . As shown in FIG. 4, the translation efficiency when 3'UTR fragments were present was similar to that of the control group, but the expression efficiency was very high when 3'UTR F3 was present. . On the other hand, it was found that the expression efficiency increased when the 5'UTR was present than when only the 3'UTR fragment was present. In particular, 5'UTR; And when F2 or F3 of the 3'UTR are present together, the expression efficiency is increased. In particular, when the 5'UTR and F3 are present together, the expression efficiency is very high. Accordingly, it was found that among the 3'UTR fragments, F3 is the most important factor in enhancing expression efficiency.

Example 5: FLAG YFP + 3'UTR Fragment Expression Efficiency Enhancement and Location Control Element Analysis through a Reporter

In the above-described Example 2, in the case of 5'UTR + YFP + UTR-2, the protein was expressed to the end of the cell, confirming that UTR-2 is the most important factor influencing the cell shape and expression location. confirmed that UTR-2 is a factor that plays an important role in expression efficiency. The present inventors found that UTR-2 is the only 3'UTR isoform that contains E16A, so F1, a fragment corresponding to E16A among 3'UTR fragments, has an important effect on cell morphology and expression location like UTR-2. expected to go crazy.

A YFP construct was prepared using F1 and F3, which had high expression efficiency in Example 4 (FIG. 5a). After amplifying the DNA using the corresponding Forward and Reverse primers, it was digested with XbaI and ApaI enzymes, and inserted into the pCS2 β-cat 5'UTR 3xFLAG YFP clone of Example 2. For DNA amplification, the pCS2 β-cat 5'UTR 3xFLAG β-cat CR+3'UTR-3 clone was used as a template. Primers used are shown in Table 5 below.

primer restriction enzyme Sequence (5'→3') sequence number YFP 3’UTR-2 F1 F XbaⅠ ATA TCTAGA CTGTATTGTCTGAACTTGCATT 45 YFP 3’UTR-2 F1 R ApaⅠ ATA GGGCCC GAGAGACTTAAAAAACAGTTACTGC 46 YFP 3’UTR-1 F3 F XbaⅠ CCC TCTAGA GTAACTGTTTTTTAAGTCTCTCGT 47 YFP 3′UTR-1 F3 R ApaⅠ CGC GGGCCC TAGGGTAAATCAGTAAGAGGTGT 48 YFP 3’UTR-1 F1+F3 F ApaⅠ ATA GGGCCC GTAACTGTTTTTTAAGTCTCTCGT 49 YFP 3’UTR-1 F1+F3 R KpnⅠ ATA GGTACC TAGGGTAAATCAGTAAGAGGTGT 50 ApaⅠ deletion F . GTCCTTTTTGGTCGAGGTAACTGTTTTTTAAG 51 ApaⅠ deletion R . CTTAAAAAACAGTTACCTCGACCAAAAAGGAC 52

Osteosarcoma U2OS cells were transfected with the fragment expression construct, and protein expression was analyzed by western blot. As a result, it was confirmed that among the UTR-1 fragments, F3 had the highest expression efficiency (FIG. 5b).

In order to analyze how much protein is expressed and secreted through extracellular vesicles, osteosarcoma U2OS cells are transfected with the fragment expression construct, and then the cell medium is collected and the protein is concentrated through a centricon filter. The results are shown in Figure 5c. It was observed that F3, which had high protein expression, secreted a high amount of protein out of the cells, and in the case of F1+F3, the same result was observed, although the amount was smaller than that of F3 (FIG. 5c).

In order to analyze the expression location of the intracellular protein, U2OS cells were transfected with the fragment expression construct, and cell fractionation was performed to separate cytoplasmic and nuclear proteins separately, and the results are shown in FIG. 5D. In the case of no UTR (1: YFP), the expression was much lower than that of the UTR fragment, and as shown in FIG. 5B , it was confirmed that the expression of F3 was high. However, many bands below F3 (3: 5'UTR + YFP + F3) were detected in the cytoplasmic extract, indicating high proteolytic activity of F3. On the other hand, in the cytoplasmic extract, F1 (2: 5'UTR + YFP + F1) was observed to have less detection of the lower band than F3, confirming that the proteolytic activity was low. In the case of F1 + F3 (4: 5'UTR + YFP + F1 + F3), it was observed that the proteolytic activity was reduced compared to the case where only F3 was present (FIG. 5d).

As such, the present inventors have identified that F3 has high protein expression efficiency and F1 has low proteolytic activity in the cytoplasm, which means that the F1 + F3 protein, which is a combination of the above two proteins, can be stably expressed in the cytoplasm. present the possibility

Example 6: Analysis of expression position control elements through FLAG YFP + 3'UTR fragment reporter

Based on the analysis results in Example 5, U2OS cells were transfected with the fragment expression construct, and immunofluorescence analysis was performed to observe YFP fluorescence. The results are shown in FIG. 6A. As shown in Figure 6a, all constructs were highly expressed in the nucleus, but the pattern observed in the cytoplasm was different. In the case of no UTR (UTR-0) and F3, granules were observed around the nucleus. On the other hand, in the case of F1, the cytoplasm far from the nucleus and the outer membrane of the cell were observed, and the same was observed in the case of the combination of F1+F3.

When the distance of YFP fluorescence expression from the nucleus to the cytoplasmic granule was quantified, it was confirmed that the location of the expressed protein was the farthest from the nucleus in the presence of F1 or F1+F3 (FIG. 6b).

As such, the present inventors identified and demonstrated through the above-described examples that in the case of F1+F3, movement of the target protein to the cytoplasm or cell membrane is promoted, and thus it can be stably secreted to the extracellular region.

Claims (10)

mRNA molecules including:
(a) a coding region encoding a protein of interest;
(b) a 5' untranslated region (UTR) of β-catenin linked to the 5' end of the coding region; and
(c) a fragment of the 3'UTR of β-catenin linked to the 3'end of the coding region, wherein the fragment of the 3'UTR comprises the RNA sequence of SEQ ID NO: 13.
The mRNA molecule according to claim 1, wherein the 5'UTR comprises the RNA sequence of SEQ ID NO: 1.
A nucleic acid molecule encoding the mRNA molecule of claim 1 or 2.
An expression construct comprising the nucleic acid molecule of claim 3.
A recombinant vector comprising the expression construct of claim 4.
An isolated host cell comprising the recombinant vector of claim 5.
Linking fragments of the 5'UTR of β-catenin and the 3'UTR of β-catenin to the 5' end and 3' end of the RNA sequence encoding the target protein, respectively, to improve the expression efficiency of the target protein A method for producing an mRNA molecule that promotes the movement of a target protein into the cytoplasm or cell membrane, wherein the 3'UTR fragment comprises the RNA sequence of SEQ ID NO: 13.
The method of claim 7, wherein the mRNA molecule is prepared by in vitro transcription, and the expression efficiency of the target protein is enhanced and the movement of the target protein to the cytoplasm or cell membrane is promoted. . delete delete