KR102571308B1 - Novel Hyphopichia burtonii KJJ43, and uses thereof - Google Patents

Abstract

The present invention relates to a novel Hyphopichia burtonii KJJ43 strain and its use, and the novel Hyphopichia burtonii KJJ43 strain is a high salt condition in which NaCl or KCl is 0.5 M to 1.5 M and It is possible to grow under high osmotic conditions where sorbitol is 2 M to 3 M, and it expresses glycerol-3-phosphate dehydrogenase 1 (Gpd1) related to glycerol production at high levels in the cytoplasm and releases glycerol into cells. By accumulating, it serves as a strain for producing glycerol.

Description

Novel Hyphopichia burtonii KJJ43 strain and uses thereof {Novel Hyphopichia burtonii KJJ43, and uses thereof}

The present invention relates to a novel Hyphopichia burtonii KJJ43 strain and uses thereof.

Glycerol is a trihydric alcohol having three hydroxyl groups, and is an oil and fat component similar to fatty acids, and is also obtained industrially by decomposing fats and oils. Glycerin, a colorless, viscous liquid that is hygroscopic and has a slight sweetness, is used as a synthetic raw material for glyphthal resin, etc., as well as for lubricants or ointments, as well as for cigarettes and cosmetic deodorizers and flavoring agents, and furthermore as anti-freezing agents, cooling agents, and printing agents. It is an important material used in a very wide range of applications such as ink. In addition to being used as a medicine, as an enema, humectant, and lubricant, it is also used as a raw material for the production of nitroglycerin. Currently, glycerol is produced not only by decomposition of fats and oils but also by synthetic methods using propylene as a raw material, and natural products and synthetic products account for almost the same amount. In addition, a method of obtaining as a product of glycerol fermentation of yeast (a variant of alcohol fermentation) and the like are known. In particular, in the case of yeast, since increasing intracellular glycerol content was found to be the most important salt tolerance mechanism, attempts to develop yeast with high salt tolerance as glycerol producing strains have been increasing.

In addition to Debaryomyces hansenii , which is mainly isolated from salt farms and cheese, known as representative salt-tolerant yeasts , Millerozyma farinosa, Candida glycerinogenes, Candida krusei, Zygosaccharomyces rouxii, Starmerella bacillaris, and Wickerhamomyces anomalus are known. A study was attempted. In the case of W. anomalus isolated from the sea, the wild type showed 66.55 g/L glycerol production, but the mutant strain showed increased glycerol production of more than 80 g/L. However, cultivation under high osmosis conditions complicates the separation of glycerol, the final product, from the culture medium due to additionally supplied osmotic substances. In the case of C. glycerinogenes , which is currently used as a glycerol-producing strain industrially, it produces more than 120 g/L of glycerol in a medium supplied with high concentration of glucose. To overcome this, reverse osmosis, filtration, ion exchange and ion exclusion technologies are applied. As an interesting approach to reduce this complexity, in the case of C. krusei , polyethylene glycol 4000 (PEG4000) was introduced into the NaCS/PDMDAAC capsule to create an internal hyperosmotic stress condition.

In most yeast, the HOG pathway works as a signaling pathway that induces a representative stress resistance mechanism, and promotes glycerol synthesis in yeast by inducing the expression of Gpd1 protein when exposed to high salt and high osmosis conditions. During the glycerol accumulation process in yeast under high salt conditions, the expression of Stl1 protein, which absorbs glycerol, is also activated, and the Fps1 protein, which effluxes glycerol, is blocked. In addition, the synthesis of ergosterol, which increases the permeability of the cell membrane, is inhibited, thereby reducing the outflow of glycerol, thereby increasing the degree of accumulation into the cell. On the other hand, attempts to create recombinant strains through genetic manipulation related to the HOG pathway in order to increase glycerol biosynthesis targeting the traditional yeast Saccharomyces cerevisiae are also increasing. In the case of S. cerevisiae , glycerol-3-phosphate dehydrogenase 1 (Gpd1), an enzyme that plays an important role in the synthesis of glycerol, moves to peroxisomes under osmotic stress conditions and reacts with NADH. make glycerol It was reported that recombinant S. cerevisiae yeast with Gpd1 mutant protein did not phosphorylate serine residues that induce the activity of the Peroxisomal Targeting Signal Type 2 (PTS2) motif that helps translocate to peroxisomes, resulting in higher glycerol production in the cytoplasm. has been As another example of genetic manipulation, strains that overexpress the GPD1 - GPP1 gene while overexpressing the TPI1 gene, which expresses triose phosphate isomerase of S. cerevisiae , or genetically mutated the glycerol channel, Fps1, are always open. produced. As a result, the optimally recombinant strain was able to produce more than 20 g/L of glycerol under glucose and oxygenated culture conditions. Recently, it was found that when the HOG1 gene of C. glycerinogenes was expressed in a S. cerevisiae hog1- defective strain, the osmosis resistance property was restored and glycerol was accumulated at high concentrations. In addition, when the Saccharomyces kudriavzevii- derived GPD1 gene was expressed in the S. cerevisiae gpd1 Δ mutant, higher Gpd1 activity and increased glycerol productivity were reported.

Korean Patent Publication No. 10-2018-0135425 (2018. 12. 20. Notice)

In order to solve the above problems, an object of the present invention is to provide a novel Hyphopichia burtonii KJJ43 ( Hyphopichia burtonii KJJ43) strain that survives in high salt and high osmosis conditions while accumulating glycerol in high concentrations in the cytoplasm, which It is to provide a method for producing glycerol using the present invention.

The present invention provides Hyphopichia burtonii KJJ43 strain deposited with accession number KCTC14474BP.

In addition, the present invention provides a method for producing glycerol comprising culturing the strain in a medium.

According to the present invention, the novel Hyphopichia burtonii KJJ43 strain is capable of growing under high salt conditions in which NaCl or KCl is 0.5 M to 1.5 M and high osmosis conditions in which sorbitol is 2 M to 3 M, It can be provided as a strain for producing glycerol by expressing glycerol phosphate dehydrogenase 1 (Gpd1) at a high level in the cytoplasm and accumulating glycerol in the cell.

1 is Hyphopichia butoni ( Hyphopichia burtonii ) KJJ43 strain and Hypopikiya pseudoburtonii ( Hyphopichia pseudoburtonii ) Genome analysis results (A) and scanning electron microscope (SEM) pictures of KJS14 strain.
Figure 2 shows the results of analysis of salt tolerance and osmosis resistance of strain Hyphopichia burtonii KJJ43 and strain KJJ43 and Hyphopichia pseudoburtonii KJS14 (A) and the result of phosphorylation pattern analysis of Hog1 protein under high salt conditions ( B) is.
Figure 3 analyzes the HOG (High Osmolarity Glycerol) signaling pathway and related gene expression patterns of Hyphopichia burtonii KJJ43 strain (left) and Hyphopichia pseudoburtonii KJS14 strain (right) is a result
4 is a comparison result of Gpd protein sequences (A), expression pattern analysis results (B), and Hb Gpd1 and Hb of Hyphopichia burtonii KJJ43 strain and Hyphopichia pseudoburtonii KJS14 strain. It is the result of analyzing the intracellular expression location of Gpd2 (C).
5 is a result of glycerol productivity analysis of Hyphopichia burtonii KJJ43 strain and Hyphopichia pseudoburtonii KJS14 strain under high salt osmotic conditions.
6 is a result of glycerol productivity analysis of Hyphopichia burtonii KJJ43 strain and Hyphopichia pseudoburtonii KJS14 strain under high salt and high osmotic conditions.

The terms used in this specification have been selected from general terms that are currently widely used as much as possible while considering the functions in the present invention, but these may vary depending on the intention of a person skilled in the art, precedent, or the emergence of new technologies. In addition, in a specific case, there is also a term arbitrarily selected by the applicant, and in this case, the meaning will be described in detail in the description of the invention. Therefore, the term used in the present invention should be defined based on the meaning of the term and the overall content of the present invention, not simply the name of the term.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related art, and unless explicitly defined in this application, it should not be interpreted in an ideal or excessively formal meaning. don't

Numerical ranges are inclusive of the values defined therein. Every maximum numerical limitation given throughout this specification includes every lower numerical limitation, as if such lower numerical limitations were expressly written. Every minimum numerical limitation given throughout this specification includes every higher numerical limitation, as if such higher numerical limitations were expressly written. Every numerical limitation given throughout this specification will include every better numerical range within the broader numerical range, as if the narrower numerical limitations were expressly written.

Hereinafter, the present invention will be described in more detail.

The inventors of the present invention have prepared the genome sequences of Hyphopichia sp. yeast species, Hyphopichia burtonii KJJ43 and Hyphopichia pseudoburtonii KJS14, isolated from Korean Nuruk. were comparatively analyzed, growth characteristics were analyzed under high salt conditions, and the salt resistance mechanism based on genome and transcript information was identified to provide a novel Hyphopichia burtonii KJJ43 strain as a glycerol mass-producing strain. did

The present invention provides Hyphopichia burtonii KJJ43 strain deposited with accession number KCTC14474BP. The strain can grow under high salt conditions in which NaCl or KCl is 0.5 M to 1.5 M and in high osmosis conditions in which sorbitol is 2 M to 3 M. In addition, the strain expresses Gpd1 (glycerol-3-phosphate dehydrogenase 1) and accumulates glycerol in cells.

The Hyphopichia burtonii strain is also known as a yeast that causes 'chalky mold' in bread or cookies, and is used for fermentation of food in Vietnam under 'banh men' and high salt conditions It can also be found in dried foods such as dried ham.

In addition, the present invention provides a method for producing glycerol comprising culturing the strain in a medium.

The medium may be under a high salt condition containing NaCl or KCl at a concentration of 0.5 M to 1.5 M, and may be under a high osmosis condition containing sorbitol at a concentration of 2 M to 3 M.

Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are merely illustrative of the contents of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

<Example 1> Hyphopichia sp. Dielectric properties and morphological characteristics

In order to analyze the genetic and morphological characteristics of strain KJJ43 of Hyphopichia burtonii isolated from authentic Korean yeast, genes were isolated from the strain and compared with strain KJS14 of Hyphopichia pseudoburtonii did After culturing strains KJJ43 and KJS14 to the late exponential phase, suspend the cell pellets in sorbitol buffer (1 M sorbitol, 100 mM EDTA (pH 8.0), 2% β-mercaptoethanol), add lyticase to dissolve the cell walls did After securing high-quality genomes according to the phenol extraction method, PacBio SMRT and Illumina HiSeq sequencing were performed. After performing de novo assembly, the genome map was completed using the circus program. As shown in FIG. 1A, strain KJJ43 and strain KJS14 are haploid yeasts having genomes of 12.49 Mbp and 15.54 Mbp, respectively, and contain 8 chromosomes.

In addition, in order to observe the morphological characteristics of strains KJJ43 and KJS14 in a solid-phase culture such as a nuruk culture environment, after culturing in YPD medium at 30 ° C, scanning electron microscope (SEM) examined the results of strains KJJ43 and KJS14 The morphology was analyzed. As shown in FIG. 1B, the strains KJJ43 and KJS14 mainly grow in a filamentous form, some budding cells are found, and pseudohyphae and septate hyphae are shown. was

<Example 2> Hyphopichia sp. Comparative analysis of osmotic resistance of several yeast species, including

Hypopikiya butoni ( Hyphopichia burtonii ) KJJ43 strain and hypopichia pseudoburtonii ( Hyphopichia pseudoburtonii ) In order to compare and analyze the osmosis resistance of the KJS14 strain, a eukaryotic model, a traditional yeast strain Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) strain, chalky yeast Wickerhamomyces anomalus ( Wickerhamomyces anomalus ) strain, Saccharomycopsis fibuligera strain, and representative salt-tolerant yeast strain Devariomyces hansenii ( Debaryomyces hansenii ) Including the strain, a spotting experiment was performed in a medium under high osmosis conditions. Each strain was pre-cultured in 2 ml YPD medium at 220 rpm at 28 ° C, serially diluted at a ratio of 1/10 starting from OD = 1, and YPD medium supplemented with 2 M sorbitol or 3 M sorbitol under high osmosis conditions , or high salinity conditions of 1 M NaCl, 1.5 M NaCl, 1 M KCl, or 1.5 M KCl were added to the YPD medium to perform spotting, respectively, and cultured at 28 ° C and 37 ° C.

As shown in FIG. 2A, the yeast-derived yeast, Hyphopichia species, was found under high concentration conditions (1 M NaCl, 1.5 M NaCl, 1 M KCl, 1.5 M KCl) as well as high osmosis conditions (2 M sorbitol, 3 M sorbitol) showed a higher level of growth than other yeast species. In particular, the KJJ43 strain exhibited better salt tolerance than Debaryomyces hansenii strain, which is known as a salt-tolerant yeast strain in the prior art, and exhibited resistance even to 3 M sorbitol, which is a high osmosis condition. In addition, strain KJJ43 showed strong salt tolerance even at a high temperature (37 ° C.) at which strain KJS14 did not grow and proved to be a yeast strain with an excellent osmotic mechanism.

When the traditional yeast strain, Saccharomyces cerevisiae strain, is exposed to salt stress, phosphorylation of the Hog1 protein occurs, and a mechanism adapted to salt stress is activated by a signal transduction pathway. In order to confirm the phosphorylation pattern of the Hog1 protein of KJJ43 and KJS14 strains under osmotic stress conditions, the strains were incubated at 28° C. for 5 minutes, 15 minutes, and 30 minutes in 0.5 M NaCl and 1 M NaCl conditions, respectively. After collecting the strains, proteins were extracted using a buffer having a composition that prevents dephosphorylation, and Western blotting was performed using an anti-phospho p38 MAPK antibody.

As shown in Figure 2B, Saccharomyces cerevisiae strain was used as a control group, and phosphorylation of the Hog1 protein did not occur at 0 minutes without exposure to stress. However, in KJJ43 and KJS14 strains, the Hog1 protein was already phosphorylated even at 0 minutes when they were not exposed to stress, and as the time exposed to 1 M NaCl, a high-salt stress condition, increased, the control and KJS14 strains were exposed to high-salt stress. Phosphorylation increased as the time increased. In the case of the KJJ43 strain, the Hog1 protein increased in phosphorylation, but showed a tendency to dephosphorylate again after 15 minutes. The above results demonstrate that the KJJ43 strain has a superior ability to adapt to osmotic stress compared to the control and KJS14 strains.

In addition, the control and KJJ43 strains showed a tendency to dephosphorylate rapidly as the exposure time increased after phosphorylation occurred within a short time under the 0.5 M NaCl condition. All strains appeared to adapt rapidly to the conditions. The above results show that the Hog1 protein, which is active even under normal conditions other than osmotic conditions, makes an important contribution to the high salt tolerance of Hyphopichia species, and the KJJ43 strain has better salt tolerance performance than the KJS14 strain under high salt conditions. prove that it is

<Example 3> Hyphopichia Analysis of high osmolarity glycerol (HOG) signaling pathway related to salt tolerance in

In order to analyze the expression patterns of genes involved in glycerol accumulation in Hyphopichia burtonii KJJ43 strain and Hyphopichia pseudoburtonii KJS14 strain, RNA-Seq experiments were performed under high salinity conditions. . After inoculation with a starting OD of 0.6 in YPD medium supplemented with 1 M NaCl, the strain was incubated at 28° C. for 5 minutes, 15 minutes, and 30 minutes, and then yeast cells were collected. RNA was extracted by the formamide RNA extraction method, synthesized into cDNA, and a library was prepared and analyzed using the Illumina HiSeq 2500. Afterwards, the results of comparing the fold change values obtained through the expression level correction process were summarized as shown in FIG. 3. Expression values were organized by color through a heat map, and the left panel of the heat map corresponding to each gene means the gene of the Hyphopichia burtonii KJJ43 strain, and the right panel represents the Hyphopichia pseudobutoni ( Hyphopichia pseudoburtonii ) means the gene of KJS14 strain. The fold change values of the samples incubated for 5, 15, and 30 minutes from the left in one panel, respectively, are shown.

As shown in FIG. 3 , the expression of GPD1 and GPP2 genes encoding proteins corresponding to the last two steps of glycerol biosynthesis and STL1 gene involved in glycerol absorption were generally increased during osmotic stress. The expression of genes in the glycolysis process corresponding to the previous step of glycerol biosynthesis as well as genes inducing precursors to trehalose or TCA cycle decreased, and as the intracellular glycerol concentration increased, the expression of some genes involved in degradation also increased. . In addition, the biosynthetic process of cell membrane ergosterol, which causes the leakage of glycerol, was suppressed as a whole, and, specifically, the Fps1 transport protein involved in the leakage of glycerol was not found in Hyphopichia yeast.

<Example 4> In high salinity culture conditions Hyphopichia sp. Analysis of Gpd1 and Gpd2 expression patterns and intracellular expression location

Gpd ( glycerol phosphate , a major biosynthetic protein of glycerol that causes accumulation of glycerol in cells dehydrogenase) was analyzed. GPD1 (GENE 00228) and GPD2 (GENE 05904) in KJJ43 strain, and GPD1 (GENE 04673) and GPD2 (GENE 02496) in KJS14 strain, respectively, were analyzed. For comparative analysis of related Gpd protein homology, Hypopikiya Butoni ( H. burtonii ), Hypopikiya Pseudobutoni ( H. pseudoburtonii ), Amino acid sequence homology of Gpd proteins, including Hortaea werneckii , Wallemia ichthyophaga , and S. cerevisiae , was analyzed with CLUSTALW of the DNASTAR MegAlign program. Analyzed and aligned with the GeneDoc program.

As shown in FIG. 4A, NAD(P)/NAD(P)H binding pattern, NADB Rossmann domain and NAD_Gly3P_dh_C domain were conserved in all yeast species. On the other hand, the PTS2 (Peroxisomal Targeting Signal Type 2) motif (RLXXHL), which induces the protein to move to the peroxisome, and the serine amino acid, a phosphorylation residue that activates it, are derived from the model yeast S. cerevisiae . ) and the Gpd2 protein of H. burtonii KJJ43 strain and the Gpd2 protein of H. pseudoburtonii KJS14 strain. Three GPD proteins present in another salt-tolerant yeast, Hortaia werneckii ( H. werneckii ) and Wellemia ichthyophaga ( W. ichthyophaga ), and hypopikiya butoni ( H. burtonii ) KJJ43 strain and hypopikiya pseudo It was found that the PTS2 motif is not conserved in the Gpd1 protein present in the H. pseudoburtonii KJS14 strain. This means that the proteins remain in the cytoplasm without moving to the peroxisome even under high salt conditions, proving that the cytoplasm can have higher activity because it is known that there is more NADH, a cofactor required for Gpd protein activity, than peroxisome. do.

In addition, to analyze the expression patterns of GPD1 and GPD2 genes of Hyphopichia burtonii KJJ43 strain and Hyphopichia pseudoburtonii KJS14 strain under high salinity conditions, qRT-PCR experiments were performed. The strain was cultured in the same manner as in Example 3, RNA was extracted, and mRNA was synthesized into cDNA with SuperiorScript III Master mix (Enzynomics) using the reverse transcriptase principle. qRT-PCR was performed using the primers shown in Table 1 specific for the GPD1 and GPD2 genes in each strain. The qRT-PCR conditions were pre-denaturation at 95 ° C for 3 minutes, denaturation at 95 ° C for 10 seconds, and annealing at 62 ° C for 30 seconds 39 times, followed by 95 ° C for 10 seconds and 65 ° C for 5 seconds.

Primer name Sequence (5'-3') Description HbGPD1-RT-FW tggtttaaaggaaaccatccactttg qRT-PCR primers for HbGPD1 HbGPD1-RT-BW acaagtagtgattaaatcagcaacc " HbGPD2-RT-FW tttcccagaatctcaagcttcga qRT-PCR primers for HbGPD2 HbGPD2-RT-BW ttcagccatgtaacgaccaac " HpGPD1-RT-FW tcactgaagaatccgctggtgtt qRT-PCR primers for HpGPD1 HpGPD1-RT-BW gactttttcagcttcccaagcatc " HpGPD2-RT-FW agatgccttggctgctgaaaag qRT-PCR primers for HpGPD2 HpGPD2-RT-BW cttcaaacaaagggaattcgtgggt " SpeI-HbGPD1_1F gcgcactagtatgacttctgctattccatataaaatcg Construction of HbGPD1 expressing GFP HbGPD1_GFPfus_1B ctttagacat accgccaccgccacc attttctaagatggttggg " SpeI-HbGPD2_1F gcgcactagtatgtgttctgatcatcaaaagg Construction of HbGPD2 expressing GFP HbGPD2_GFPfus_1B ctttagacat accgccaccgccacc aatatagctactggtttc " 5Gly-yEGFP_F ggtggcggtggcggt atgtctaaaggtgaagaattattcac Primers for GFP amplification yEGFP-SalI_B gcgcgtcgac ttatttgtacaattcatccataccatg "

As shown in FIG. 4B, among the two GPD genes present in H. burtonii KJJ43 and H. pseudoburtonii KJS14, GPD1 is very high over time under high salt conditions. While the expression of the GPD2 gene was significantly increased, the expression of the GPD2 gene did not show a significant change. These results demonstrate that GPD1 rather than GPD2 plays a major role in the mechanism of salt tolerance.

In order to verify the intracellular location of Gpd1 and Gpd2 proteins of H. burtonii KJJ43 strain, GFP (Green Fluorescent Protein) using a centromere vector having HIS3 selection marker and expression controlled by TEF1 promoter A vector capable of expressing the Gpd protein in the form of a fusion protein in a foreign host, Saccharomyces cerevisiae , was constructed. Using the gDNA of H. burtonii KJJ43 strain as a template, the corresponding genes were amplified using the primers SpeI-HbGPD1_1F, HbGPD1_GFPfus_1B, SpeI-HbGPD2_1F, and HbGPD2_GFPfus_1B in Table 1, and pDLMOX-yEGFPm as a template 5Gly-yEGFP_F and yEGFP-SalI_B primers were used to amplify the GFP portion to which glycine was linked as a linker. The HbGPD1 product and GFP product obtained from the first PCR were used as templates, and the second PCR was performed using SpeI-HbGPD1_1F and yEGFP-SalI_B primers to obtain a product tagged with GFP to Gpd1, and the HbGPD2 product and GFP product were used as templates A DNA product in which GFP was fused to Gpd2 was obtained by performing secondary PCR using SpeI-HbGPD2_1F and yEGFP-SalI_B primers. After treating each PCR product and YCpHT vector with SpeI/SalI, they were connected to construct final expression vectors YCpHT_HbGPD1_GFP and YCpHT_HbGPD1_GFP in which HbGPD genes are expressed by TEF1 promoter. Saccharomyces cerevisiae transformed with the prepared YCpHT_HbGPD1_GFP and YCpHT_HbGPD1_GFP expression vectors were analyzed by western blotting for Saccharomyces cerevisiae cell lysates to confirm that proteins of the expected size were expressed, and the two strains were initially OD = 0.3 It was inoculated into SC-His medium, cultured until OD = 1, fixed with 4% paraformaldehyde, and observed under a fluorescence microscope. As shown in Figure 4C, H. burtonii Gpd1 of KJJ43 strain was found to be present in the cytoplasm rather than peroxisome, as expected from the absence of PTS2, and in the case of Gpd2, a large number of small GFP It was confirmed that the signal was present in the peroxisome.

<Example 5> H. burtonii and H. pseudoburtonii Glycerol production using

In Example 4, hypopikiya butoni ( H. burtonii ) KJJ43 and hypopikiya pseudoburtonii ( H. pseudoburtonii ) KJS14 strains confirmed the tendency to increase the expression of the GPD1 gene under high salt (1 M NaCl) conditions Accordingly, the glycerol content accumulated in cells was comparatively analyzed. Saccharomyces cerevisiae was used as a control strain to compare the amount of glycerol accumulated in cells. Each strain was pre-cultured at 28 ° C. at 220 rpm in YPD medium, and then inoculated into YPD medium and YPD medium containing 1 M NaCl at an initial OD of 0.5 and then cultured for 2 hours. After collecting all the yeast cells, they were suspended in 1 ml of sterile water, boiled at 100 ° C. for 10 minutes, centrifuged, and only the supernatant was separately collected, and intracellular glycerol content was analyzed using a glycerol assay kit (MAK117, Sigma Aldrich). First, 0 mM, 0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM, 1.0 mM glycerol was prepared as a colorimetric standard by diluting a 100 mM glycerol standard in sterile water by concentration, and then diluted with 10 μl of standard on a 96 well plate. The strain supernatant was added. Add 100 μl of the master reaction mix with the composition of assay buffer, enzyme mix, ATP, and dye reagent to each well, mix well using a shaker, and react for 20 minutes at room temperature conditions blocked from light. The absorbance was measured at 570 nm and the intracellular glycerol content was calculated using a standard curve.

As shown in Figure 5, hypopichia ( Hyphopichia ) In both species, intracellular glycerol content is significantly higher than that of Saccharomyces cerevisiae ( S. cerevisiae ) under both normal conditions and osmotic stress conditions cultured in YPD medium. It was high. Hypopikiya Butoni ( Hyphopichia burtonii ) KJJ43 strain and hypopichia pseudoburtonii ( Hyphopichia pseudoburtonii ) In the case of KJS14 strain, Saccharomyces cerevisiae in YPD medium conditions Saccharomyces cerevisiae ( S. cerevisiae ) 6.5 times and 4 times, respectively It can be confirmed that the amount of glycerol accumulation is high, and further improved intracellular glycerol accumulation can be observed when cultured under osmotic stress conditions of 1 M NaCl. In particular , Hyphopichia pseudoburtonii KJJ43 strain showed about 1.5 times more glycerol accumulation than Hyphopichia pseudoburtonii KJS14 strain.

In addition, the growth of the Hyphopichia burtonii KJJ43 strain and the Hyphopichia pseudoburtonii KJS14 strain are much more vigorous than S. cerevisiae under normal growth conditions as well as under high salt conditions, resulting in a total amount of cells secured. Since there are many, the amount of glycerol produced through yeast culture was compared and analyzed. As in the previous analysis, each strain, including Saccharomyces cerevisiae as a control strain, was pre-incubated in YPD medium at 220 rpm at 28 ° C., and then 1 M NaCl in YPD medium and YPD with an initial OD of 0.5 After inoculation in this supplemented medium, it was cultured for 24 hours. In order to avoid consuming glycerol accumulated in cells as a carbon source while glucose, the main carbon source, is depleted during culture, 0.5 M glucose at a higher concentration than the existing 0.1 M glucose was supplied and cultured, and then the intracellular glycerol content was compared and analyzed. .

As shown in Figure 6, Hyphopichia butoni ( Hyphopichia burtonii ) In the case of strain KJJ43, intracellular glycerol accumulation was observed under hyperintrasalt and hyperosmotic stress conditions in which 1 M NaCl was added with a high concentration of glucose supply. Levijiae ( S. cerevisiae ) and Hypopikiya pseudoburtoni ( Hyphopichia pseudoburtonii ) appeared significantly higher than KJS14 strain.

The above results show that in the Hyphopichia burtonii KJJ43 strain, the Hog1 protein, a key regulator of the signaling pathway that induces salt tolerance, is continuously activated, and the expression of the Gpd1 protein, a key enzyme in glycerol biosynthesis, in the cytoplasm under high salt conditions is By inducing it higher, it is confirmed that glycerol accumulates in a large amount in the cells. In particular, under the high osmotic pressure condition in which a high concentration of sugar is supplied, glycerol productivity is significantly increased, proving that it can be used as a glycerol production host.

Having described specific parts of the present invention in detail above, it is clear to those skilled in the art that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Korea Research Institute of Bioscience and Biotechnology KCTC14474BP 20210218

<110> Chung-Ang University Industry-Academy Cooperation Foundation Foundation of Soongsil University-Industry Cooperation <120> Novel Hyphopichia burtonii KJJ43, and uses its <130> ADP-2021-0020 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 26 <212> DNA <213> artificial sequence <220> <223> HbGPD1-RT-FW <400> 1 tggtttaaag gaaaccatcc actttg 26 <210> 2 <211> 25 <212> DNA <213> artificial sequence <220> <223> HbGPD1-RT-BW <400> 2 acaagtagtg attaaatcag caacc 25 <210> 3 <211> 23 <212> DNA <213> artificial sequence <220> <223> HbGPD2-RT-FW <400> 3 tttcccagaa tctcaagctt cga 23 <210> 4 <211> 21 <212> DNA <213> artificial sequence <220> <223> HbGPD2-RT-BW <400> 4 ttcagccatg taacgaccaa c 21 <210> 5 <211> 23 <212> DNA <213> artificial sequence <220> <223> HpGPD1-RT-FW <400> 5 tcactgaaga atccgctggt gtt 23 <210> 6 <211> 24 <212> DNA <213> artificial sequence <220> <223> HpGPD1-RT-BW <400> 6 gactttttca gcttcccaag catc 24 <210> 7 <211> 22 <212> DNA <213> artificial sequence <220> <223> HpGPD2-RT-FW <400> 7 agatgccttg gctgctgaaa ag 22 <210> 8 <211> 25 <212> DNA <213> artificial sequence <220> <223> HpGPD2-RT-BW <400> 8 cttcaaacaa agggaattcg tgggt 25 <210> 9 <211> 38 <212> DNA <213> artificial sequence <220> <223> SpeI-HbGPD1_1F <400> 9 gcgcactagt atgacttctg ctattccata taaaatcg 38 <210> 10 <211> 44 <212> DNA <213> artificial sequence <220> <223> HbGPD1_GFPfus_1B <400> 10 ctttagacat accgccaccg ccaccatttt ctaagatggt tggg 44 <210> 11 <211> 32 <212> DNA <213> artificial sequence <220> <223> SpeI-HbGPD2_1F <400> 11 gcgcactagt atgtgttctg atcatcaaaa gg 32 <210> 12 <211> 43 <212> DNA <213> artificial sequence <220> <223> HbGPD2_GFPfus_1B <400> 12 ctttagacat accgccaccg ccaccaatat agctactggt ttc 43 <210> 13 <211> 41 <212> DNA <213> artificial sequence <220> <223> 5Gly-yEGFP_F <400> 13 ggtggcggtg gcggtatgtc taaaggtgaa gaattattca c 41 <210> 14 <211> 37 <212> DNA <213> artificial sequence <220> <223> yEGFP-SalI_B <400> 14 gcgcgtcgac ttatttgtac aattcatcca taccatg 37

Claims (8)

delete delete delete delete delete A method for producing glycerol comprising culturing the Hyphopichia burtonii KJJ43 strain deposited with accession number KCTC14474BP in a medium,
Glycerol production method, characterized in that the strain expresses Gpd1 (glycerol-3-phosphate dehydrogenase 1) in the cytoplasm and accumulates intracellular glycerol. The method of claim 6, wherein the medium is in a high salt condition containing NaCl or KCl at a concentration of 0.5 M to 1.5 M. The method for preparing glycerol according to claim 6, wherein the medium is under a high osmotic condition containing sorbitol at a concentration of 2 M to 3 M.