KR102560055B1 - Biomarker for Diagnosing Nontuberculous Mycobacterium Infection and Pharmaceutical Composition for Prophylaxis or Treatment of Nontuberculous Mycobacterium Infectious Disease - Google Patents

Biomarker for Diagnosing Nontuberculous Mycobacterium Infection and Pharmaceutical Composition for Prophylaxis or Treatment of Nontuberculous Mycobacterium Infectious Disease Download PDF

Info

Publication number
KR102560055B1
KR102560055B1 KR1020200174113A KR20200174113A KR102560055B1 KR 102560055 B1 KR102560055 B1 KR 102560055B1 KR 1020200174113 A KR1020200174113 A KR 1020200174113A KR 20200174113 A KR20200174113 A KR 20200174113A KR 102560055 B1 KR102560055 B1 KR 102560055B1
Authority
KR
South Korea
Prior art keywords
mycobacterium
infection
mirna
tuberculous
diagnosing
Prior art date
Application number
KR1020200174113A
Other languages
Korean (ko)
Other versions
KR20220084544A (en
Inventor
조은경
김인수
전병우
박춘구
Original Assignee
충남대학교산학협력단
사회복지법인 삼성생명공익재단
전남대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충남대학교산학협력단, 사회복지법인 삼성생명공익재단, 전남대학교 산학협력단 filed Critical 충남대학교산학협력단
Priority to KR1020200174113A priority Critical patent/KR102560055B1/en
Publication of KR20220084544A publication Critical patent/KR20220084544A/en
Application granted granted Critical
Publication of KR102560055B1 publication Critical patent/KR102560055B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 비결핵항산균 감염의 진단을 위한 새로운 바이오마커 조성물과 비결핵항산균 감염질환의 예방 또는 치료용 약학 조성물에 관한 것으로서, 보다 상세하게는 miRNA-144-3p를 포함하는 것을 특징으로 하는 비결핵항산균 감염 진단용 바이오마커 조성물에 관한 것이다.The present invention relates to a new biomarker composition for the diagnosis of non-tuberculous mycobacterial infection and a pharmaceutical composition for the prevention or treatment of non-tuberculous mycobacterial infection diseases, and more particularly, to a biomarker composition for the diagnosis of non-tuberculous mycobacterial infection characterized by containing miRNA-144-3p.

Description

비결핵항산균 감염의 진단용 바이오마커 및 비결핵항산균 감염질환의 예방 또는 치료용 약학 조성물{Biomarker for Diagnosing Nontuberculous Mycobacterium Infection and Pharmaceutical Composition for Prophylaxis or Treatment of Nontuberculous Mycobacterium Infectious Disease}Biomarker for Diagnosing Nontuberculous Mycobacterium Infection and Pharmaceutical Composition for Prophylaxis or Treatment of Nontuberculous Mycobacterium Infectious Disease}

본 발명은 비결핵항산균 감염의 진단을 위한 새로운 바이오마커 조성물과 비결핵항산균 감염질환의 예방 또는 치료용 약학 조성물에 관한 것이다. The present invention relates to a novel biomarker composition for the diagnosis of non-tuberculous mycobacterial infection and a pharmaceutical composition for preventing or treating non-tuberculous mycobacterial infectious disease.

미코박테리움 속 균종은 병원성 정도에 따라 절대병원성 균인 결핵균과 나병균을 포함하는 결핵균군과 상기 균을 제외한 비결핵항산균(nontuberculous mycobacteria, NTM)의 두 그룹으로 구분된다. 비결핵항산균은 물, 토양 등 자연계에 널리 분포하며 호흡기를 통해 감염되는 기회감염성 균이다. 지금까지 약 150여 종의 비결핵항산균이 알려져 있으며 거의 매년 새로운 비결핵항산균이 발견되고 있으나, 인체 질환과 관련된 것은 대략 25종에 이른다. 균종에 따라서 질병을 일으키는 발병력의 차이도 커서 M. kansasii, M. avium, M. abscessus 등은 상대적으로 발병력이 크고, M. fortuitum은 상대적으로 발병력이 낮다. 비결핵항산균으로 인한 질환은 폐질환, 림프절염, 피부·연조직·골감염증, 파종성 질환 등 4가지 특징적인 임상 증후를 나타내며, 이 중 폐질환이 비결핵항산균으로 인한 질환의 90% 이상을 차지한다. Species of the genus Mycobacterium are classified into two groups according to the degree of pathogenicity: the Mycobacterium tuberculosis group, which includes the obligately pathogenic bacteria Mycobacterium tuberculosis and Bacillus leprosy, and the nontuberculous mycobacteria (NTM) excluding the bacteria. Non-tuberculous mycobacteria are opportunistic bacteria that are widely distributed in the natural world, such as water and soil, and are transmitted through the respiratory tract. Up to now, about 150 types of non-tuberculous mycobacteria are known, and new non-tuberculous mycobacteria are discovered almost every year, but about 25 types are related to human diseases. There is also a large difference in disease-causing virulence depending on the species. M. kansasii , M. avium , and M. abscessus have relatively high virulence, and M. fortuitum has relatively low virulence. Diseases caused by non-tuberculous mycobacteria show four characteristic clinical symptoms: lung disease, lymphadenitis, skin/soft tissue/bone infection, and disseminated disease.

비결핵항산균은 결핵균의 발견을 위한 항산균 도말검사에서 결핵균과 구별되지 않는다. 비결핵항산균 폐질환의 빈도가 상대적으로 높은 국가에서는 항산균 도말 양성 객담의 30~50%까지 비결핵 항산균이 분리되고 있으며, 선진국화될수록 비결핵항산균에 의한 감염 비율이 증가하는 것으로 보고되고 있다. 우리나라의 경우 비결핵항산균 질환의 빈도가 낮다고 알려져 있기 때문에 항산균 도말 양성일 경우 대부분 결핵으로 간주하고 항결핵제 치료를 시행하는 것이 일반적이었으나, 국내에서도 항산균 도말 양성 객담의 10% 이상에서 결핵균이 아닌 비결핵항산균이 분리되고 있다. 결핵의 경우 항결핵제의 개발에 따라 90% 이상의 치료율을 나타내며 전 세계적으로 발병율과 사망률이 1990년대 이후 지속적으로 감소하는 데 반하여, 비결핵항산균은 약제내성균의 분리비율이 매우 높고 2년 이상의 장기치료를 요하는 등의 어려움이 있어 2000년 이후 가속적인 증가추세를 나타내고 있다.Non-tuberculous mycobacteria are indistinguishable from Mycobacterium tuberculosis in the mycobacterium smear for the detection of Mycobacterium tuberculosis. In countries with a relatively high incidence of non-tuberculous mycobacteria lung disease, up to 30-50% of mycobacterial smear-positive sputum is isolated from non-tuberculous mycobacteria. In Korea, it is known that the frequency of non-tuberculosis mycobacteria disease is low, so it was common to consider most cases positive for mycobacterium tuberculosis as tuberculosis and to receive anti-tuberculosis treatment. In the case of tuberculosis, it shows a cure rate of more than 90% following the development of anti-tuberculosis drugs, and the incidence and mortality rates have been continuously decreasing worldwide since the 1990s.

국내에서 비결핵항산균 폐질환의 원인균으로 가장 흔한 균은 M. avium 이다. 특히 외국에서는 상대적으로 드문 신속 성장균인 M. abscesus가 국내에서는 두 번째로 흔한 원인균이라는 특징이 있다. M. abscessus 폐질환은 중년 이상의 비흡연자 여성에게서 흔히 발생한다. 증상은 기침, 발열, 객혈, 객담 등이 흔히 동반된다. M. abscesus는 특히 다제 내성을 나타내며 가능한 치료들이 제한적인 효능을 나타내기 때문에 임상적으로 매우 중요하다. 항생제 치료를 받지 않은 환자에게서 분리된 M. abscessus는 시험관 내 약제 감수성검사에서 클래리스로마이신, 아미카신, 세폭시틴 등에 대하여 감수성을 보이지만, 일반적인 항결핵제에 모두 내성을 나타낸다. 이에 대하여 정주용 항생제를 사용하여야 하며, 균음전에 성공한 이후에도 최소 12개월 이상의 치료기간이 필요하다는 점 등 때문에 M. abscessus 폐질환의 치료는 매우 어렵다. 환자들은 질환으로 인한 증상 뿐 아니라 장기간 항생제 투여에 의한 신체적 부담이 추가되어 어려움을 겪게 된다. 더구나 항생제에 내성을 지니게 되면 치료는 더욱 어려워지며 정주용 항생제를 포함한 치료를 하더라도 내과적 치료만으로 완치율이 10% 미만으로 객담 균음전을 이루기는 매우 어려워 병변이 국한된 경우는 폐절제술을 고려해야 하는 어려움이 있다. M. abscessus 감염은 특히 면역 결핍과 연관되어 있어, 면역억제 치료를 받는 환자나 고령의 환자, 폐질환이나 전신질환의 기저질환자에게는 위험도가 더욱 증가한다. 따라서, 점점 증가하고 있는 비결핵항산균 관련 질환에 대해 결핵의 치료와 구분된 치료법이 요구된다. The most common bacteria that cause non-tuberculous mycobacteria lung disease in Korea areM. avium am. In particular, relatively rare fast-growing bacteria in foreign countriesM. abscesusis the second most common causative organism in Korea.M. abscessusLung disease is common in middle-aged and older nonsmokers. Symptoms are often accompanied by cough, fever, hemoptysis, and expectoration.M. abscesusis particularly important clinically because it exhibits multi-drug resistance and available treatments show limited efficacy. isolated from patients not treated with antibiotics.M. abscessusshowed sensitivity to clarithromycin, amikacin, and cefoxitin in an in vitro drug susceptibility test, but showed resistance to all common antituberculosis drugs. In this regard, intravenous antibiotics must be used, and even after successful gyuneumjeon, a treatment period of at least 12 months is required.M. abscessus Lung disease is very difficult to treat. Patients suffer from not only the symptoms caused by the disease but also the physical burden caused by long-term antibiotic administration. Moreover, resistance to antibiotics makes treatment more difficult. Even with treatment including intravenous antibiotics, the cure rate is less than 10% with only medical treatment.M. abscessus Infection is particularly associated with immunodeficiency, which further increases the risk for patients receiving immunosuppressive treatment, elderly patients, and those with underlying lung or systemic diseases. Therefore, treatment for tuberculosis mycobacterium-related diseases, which are increasingly increasing, is required for a treatment that is distinct from treatment for tuberculosis.

miRNA(microRNA)는 소형의 비암호화(noncoding) RNA로 숙주세포에서 면역반응을 포함한 다양한 생리활성의 조절에 중요한 역할을 담당한다. 최근 들어, miRNA는 암, 심장질환, 임신, 당뇨, 정신질환, 감염질환 등 다양한 분야의 진단에서 새로운 형태의 바이오마커로서 심도 깊게 연구되고 있다. 본 발명자들도 miRNA-302f와 miRNA-17-5p를 사용하여 결핵을 조기 진단할 수 있음을 확인하고 이를 등록특허 10-1643748과 10-1476781로 각각 등록받은 바 있다. 비결핵항산균 감염질환 환자들에게서 다르게 발현되는 miRNA의 프로파일과 기능을 평가하는 것에 의해 NTM 감염에 대한 새로운 바이오마커 및 치료제를 개발할 수 있을 것으로 기대된다. miRNA (microRNA) is a small noncoding RNA that plays an important role in regulating various physiological activities including immune responses in host cells. Recently, miRNA has been studied in depth as a new type of biomarker in the diagnosis of various fields such as cancer, heart disease, pregnancy, diabetes, mental disease, and infectious disease. The present inventors also confirmed that tuberculosis can be diagnosed early using miRNA-302f and miRNA-17-5p and registered them as registered patents 10-1643748 and 10-1476781, respectively. It is expected that new biomarkers and therapeutics for NTM infection can be developed by evaluating the profile and function of miRNAs that are differentially expressed in patients with non-tuberculous mycobacterial infections.

등록특허 제10-2031409호Registered Patent No. 10-2031409 등록특허 제10-2137710호Registered Patent No. 10-2137710 등록특허 제10-1643748호Registered Patent No. 10-1643748 등록특허 제10-1476781호Registered Patent No. 10-1476781

본 발명은 상기와 같은 종래기술의 문제점을 해소하기 위하여 비결핵항산균 감염질환의 조기 진단 및 빠른 진단에 유용한 비결핵항산균 감염질환 진단용 조성물을 제공하는 것을 목적으로 한다. An object of the present invention is to provide a diagnostic composition for non-tuberculous mycobacterial infectious diseases useful for early diagnosis and rapid diagnosis of non-tuberculous mycobacterial infectious diseases in order to solve the problems of the prior art.

또한 본 발명은 비결핵항산균의 진단을 위하여 상기 조성물을 포함하는 비결핵항산균 감염질환 진단용 키트를 제공하는 것을 다른 목적으로 한다.Another object of the present invention is to provide a kit for diagnosing non-tuberculous mycobacteria infectious diseases comprising the above composition for the diagnosis of non-tuberculous mycobacteria.

본 발명의 또 다른 목적은 비결핵항산균 감염 의심 환자의 생체시료로부터의 비결핵항산균 감염질환의 진단을 위한 정보 제공 방법을 제공하는 것이다. Another object of the present invention is to provide a method for providing information for diagnosis of non-tuberculous mycobacterial infectious diseases from a biological sample of a patient suspected of being infected with non-tuberculous mycobacteria.

더 나아가 본 발명은 또한 기존 약제와는 다른 기전의 비결핵항산균 감염질환의 예방 또는 치료용 약학 조성물을 제공하는 것을 목적으로 한다. Furthermore, the present invention also aims to provide a pharmaceutical composition for the prevention or treatment of non-tuberculous mycobacterial infectious diseases of a different mechanism from existing drugs.

전술한 목적을 달성하기 위한 본 발명은 miRNA-144-3p를 포함하는 것을 특징으로 하는 비결핵항산균 감염 진단용 바이오마커 조성물에 관한 것이다.The present invention for achieving the above object relates to a biomarker composition for diagnosing non-tuberculous mycobacterial infection, characterized in that it contains miRNA-144-3p.

miRNA-144-3p는 서열번호 1의 서열을 갖는 마이크로알엔에이로, 비결핵항산균 감염에 대한 바이오마커로서 사용될 수 있음을 확인하였다. 본 발명에서 '바이오마커"란 정상이나 병적인 상태를 구분할 수 있거나 치료반응을 예측할 수 있는, 객관적으로 측정이 가능한 표지자를 말한다. miRNA-144-3p is a microRNA having the sequence of SEQ ID NO: 1, and it was confirmed that it can be used as a biomarker for infection with non-tuberculous mycobacteria. In the present invention, "biomarker" refers to an objectively measurable marker that can distinguish between normal and pathological conditions or predict treatment response.

서열번호 1 : 5'-UACAGUAUAGAUGAUGUACU-3'SEQ ID NO: 1: 5'-UACAGUAUAGAUGAUGUACU-3'

비결핵항산균 감염환자의 혈액에서 정상대조군에 비해 miRNA-144-3p의 발현이 크게 증가하였으며, 마우스를 대상으로 한 in-vivo와 in-vitro의 모델실험에서 비결핵항산균의 감염은 폐조직에서의 miRNA-144-3p의 발현을 증가시켰다. 이로부터 진단하고자 하는 개체의 생물학적 시료에서 발현량을 측정함으로써 비결핵항산균의 감염 여부를 유의적으로 진단할 수 있다. The expression of miRNA-144-3p was significantly increased in the blood of patients infected with non-tuberculous mycobacteria compared to the normal control group, and infection with non-tuberculous mycobacteria increased the expression of miRNA-144-3p in lung tissue in in-vivo and in-vitro model experiments on mice. From this, by measuring the expression level in the biological sample of the individual to be diagnosed, it is possible to significantly diagnose whether or not the non-tuberculous mycobacteria are infected.

이에, 본 발명은 비결핵항산균 감염에 의해 발현이 증가되는 miRNA-144-3p의 발현수준을 측정하는 제제를 포함하는 것을 특징으로 하는 비결핵항산균 감염 진단용 조성물을 제공한다. Accordingly, the present invention provides a composition for diagnosing non-tuberculous mycobacterial infection, comprising an agent for measuring the expression level of miRNA-144-3p, whose expression is increased by infection with non-tuberculous mycobacteria.

상기 제제는 miRNA-144-3p를 특이적으로 증폭시키거나, 특이적으로 결합하는 프라이머 또는 프로브의 형태일 수 있다. miRNA-144-3p를 특이적으로 증폭시킬 수 있는 프라이머는 공지되어 있는 miRNA-144-3p의 서열로부터 종래기술을 이용하여 이들 유전자 혹은 유전자의 특정영역을 특이적으로 증폭할 수 있도록 디자인할 수 있으며, 이러한 프라이머의 디자인은 당업자라면 용이할 것이다. 상기 프로브는 miRNA-144-3p와 특이적 결합을 이룰 수 있는 표지된 RNA 또는 DNA 등의 핵산 단편으로, 표지의 검출에 의해 miRNA-144-3p의 발현량을 측정할 수 있다. 프로브 역시 공지된 miRNA-144-3p의 서열로부터 종래기술을 이용하여 miRNA-144-3p와 특이적으로 결합할 수 있도록 디자인하는 것은 당업자라면 용이할 것이다.The agent may be in the form of a primer or probe that specifically amplifies or specifically binds to miRNA-144-3p. Primers capable of specifically amplifying miRNA-144-3p can be designed from known sequences of miRNA-144-3p using conventional techniques to specifically amplify these genes or specific regions of genes, and the design of these primers will be easy for those skilled in the art. The probe is a nucleic acid fragment such as labeled RNA or DNA capable of specific binding to miRNA-144-3p, and the expression level of miRNA-144-3p can be measured by detecting the label. It will be easy for those skilled in the art to design a probe to specifically bind to miRNA-144-3p using a prior art from known sequences of miRNA-144-3p.

또한 본 발명은 상기 조성물을 포함하는 비결핵항산균 감염 진단용 키트에 관한 것이다.In addition, the present invention relates to a kit for diagnosing non-tuberculous mycobacteria infection comprising the composition.

본 발명의 진단 키트를 이용한 바이오마커의 동정 또는 검출에는 당업계의 모든 방법이 포함될 수 있다. 즉, RT-PCR, 경쟁적 RT-PCR, 실시간 RT-PCR, RNase 보호 분석법, 노던 블랏팅 또는 DNA 마이크로어레이를 활용하여 상기 바이오마커의 발현량을 측정할 수 있으며 이에 한정되는 것은 아니다. 이에 본 발명의 진단 키트는 상기 분석 방법에 따라 적절한 형태로 구성되며, 각 분석 방법에 적합한 한 종류 이상의 다른 구성을 추가로 포함할 수 있다. 예를 들어, RT-PCR용 키트는 테스트 튜브, 완층액, 데옥시 뉴클레오타이드(dNTPs), 각종 효소, 사용 매뉴얼 등을 포함할 수 있다.Identification or detection of biomarkers using the diagnostic kit of the present invention may include any method known in the art. That is, the expression level of the biomarker may be measured using RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay, Northern blotting, or DNA microarray, but is not limited thereto. Accordingly, the diagnostic kit of the present invention is configured in an appropriate form according to the analysis method, and may further include one or more other components suitable for each analysis method. For example, a kit for RT-PCR may include a test tube, a buffer solution, deoxynucleotides (dNTPs), various enzymes, and an instruction manual.

본 발명은 또한 (A) 비결핵항산균 감염질환 의심 환자의 생체시료로부터 miRNA-144-3p의 발현 수준을 측정하는 단계; 및 (B) 상기 측정된 miRNA-144-3p의 발현 수준을 정상대조구 시료로부터 측정한 miRNA-144-3p의 발현 수준과 비교하는 단계;를 포함하는 것을 특징으로 하는 비결핵항산균 감염 진단을 위한 정보 제공 방법에 관한 것이다. 상기 miRNA-144-3p의 발현수준을 측정하는 방법으로는 당업계의 모든 방법이 포함될 수 있다. 즉, RT-PCR, 경쟁적 RT-PCR, 실시간 RT-PCR, RNase 보호 분석법, 노던 블랏팅 또는 DNA 마이크로어레이를 활용하여 상기 바이오마커의 발현량을 측정할 수 있으며 이에 한정되는 것은 아니다. 상기 생체시료는 혈액 또는 비결핵항산균 감염 의심 조직일 수 있다. The present invention also includes (A) measuring the expression level of miRNA-144-3p from a biological sample of a patient suspected of having a non-tuberculous mycobacterium infectious disease; and (B) comparing the measured expression level of miRNA-144-3p with the expression level of miRNA-144-3p measured from a normal control sample. As a method for measuring the expression level of the miRNA-144-3p, any method in the art may be included. That is, the expression level of the biomarker may be measured using RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay, Northern blotting, or DNA microarray, but is not limited thereto. The biological sample may be blood or tissue suspected of being infected with non-tuberculous mycobacteria.

miR-144-3p의 발현수준이 비결핵항산균의 감염에 의해 상향조절될 뿐 아니라, miR-144-3p의 과발현은 비결핵항산균의 증식을 촉진하고 전염증 사이토카인 및 케모카인의 발현을 증가시켜 비결핵항산균 감염질환의 진행에 영향을 미치는 것을 확인할 수 있었다. 이로부터 본 발명은 miRNA-144-3p의 안티센스 뉴클레오티드를 유효성분으로 하는 비결핵항산균 감염질환의 예방 또는 치료용 약학 조성물을 제공한다. Not only was the expression level of miR-144-3p upregulated by infection with nontuberculous mycobacteria, but overexpression of miR-144-3p promoted the proliferation of nontuberculous mycobacteria and increased the expression of pro-inflammatory cytokines and chemokines, thereby affecting the progression of nontuberculous mycobacterial infectious diseases. From this, the present invention provides a pharmaceutical composition for preventing or treating non-tuberculous mycobacterial infectious diseases comprising the antisense nucleotide of miRNA-144-3p as an active ingredient.

본 발명에서 miRNA-144-3p의 안티센스 뉴클레오티드는 miRNA-144-3p의 상보서열을 갖는 뉴클레오티드 또는 뉴클레오시드 단량체의 올리고머 또는 중합체를 지칭하며, RNA는 물론 DNA, DNA/RNA 하이브리드 또는 당업계에서 공지된 방법으로 변형된 올리고머의 모방체인 펩티드헥산(PNA) 또는 고정헥산(LNA), 당 또는 백본의 전체 또는 그 일부분이 치환 또는 변형된 염기를 모두 포함한다. 또한, miRNA-144-3p의 상보서열을 갖는 뉴클레오티드이나, 일부 영역의 서열에는 돌연변이를 포함하여도 무방하다.In the present invention, the antisense nucleotide of miRNA-144-3p refers to an oligomer or polymer of nucleotides or nucleoside monomers having a complementary sequence of miRNA-144-3p, and includes RNA as well as DNA, DNA/RNA hybrids, or peptide hexane (PNA) or fixed hexane (LNA), which is a mimic of an oligomer modified by a method known in the art, and bases in which the whole or part of the sugar or backbone is substituted or modified. In addition, although it is a nucleotide having a sequence complementary to miRNA-144-3p, it is okay to include mutations in the sequence of some regions.

상기 비결핵항산균은 미코박테리움 칸사시(M. kansasii), 미코박테리움 아비움(M. avium) 또는 미코박테리움 압세수스(M. abscessus)일 수 있다. 특히 신속 성장균으로 종래 모든 항결핵제에 대해 내성을 갖는 미코박테리움 압세수스일 수 있다.The non-tuberculous acidophilus may be Mycobacterium kansasii ( M. kansasii ), Mycobacterium avium ( M. avium ) or Mycobacterium abscesus ( M. abscessus ). In particular, it may be Mycobacterium absesus, which is a fast-growing bacterium and is resistant to all conventional anti-tuberculosis agents.

본 발명에서 비결핵항산균 감염 질환은 비결핵항산균의 감염에 의해 나타나는 모든 임상적 증상을 포함하는 것으로, 상기 질환은 폐질환, 림프절염, 피부·연조직·골감염증 또는 파종성 질환 등을 포함한다. 본 발명의 조성물은 비결핵항산균의 감염 후 치료적 용도 뿐 아니라, 비결핵항산균의 감염 우려가 높은 군에 예방적 목적으로도 사용될 수 있다. 즉, 본 발명의 조성물은 비결핵항산균의 증식 및 성장을 억제하므로 가족력이 있거나 AIDS 환자와 같이 지속적으로 면역체계가 불안정한 환자 등 비결핵항산균 감염 우려가 높은 경우에 예방적 목적으로도 사용될 수 있음은 당연하다. 또한 상기 약학 조성물은 인간 뿐 아니라, 비결핵항산균에 의해 감염되는 다른 동/식물의 질병 치료에도 사용될 수 있다.In the present invention, the non-tuberculous mycobacterial infection disease includes all clinical symptoms caused by infection with non-tuberculous mycobacteria, and the disease includes lung disease, lymphadenitis, skin, soft tissue, bone infection, or disseminated disease. The composition of the present invention can be used not only for therapeutic purposes after infection with non-tuberculous mycobacteria, but also for prophylactic purposes in groups at high risk of infection with non-tuberculous mycobacteria. That is, since the composition of the present invention inhibits the proliferation and growth of non-tuberculous mycobacteria, it is natural that it can also be used for preventive purposes in cases where there is a high risk of non-tuberculous mycobacteria infection, such as patients with a family history or continuously unstable immune system such as AIDS patients. In addition, the pharmaceutical composition can be used for the treatment of diseases of other animals / plants infected by non-tuberculous mycobacteria as well as humans.

한편, 본 발명의 조성물에서 상기 안티센스 뉴클레오티드는 안티센스 뉴클레오티드를 발현하는 발현 벡터의 형태로 제공될 수 있다. 본 발명의 안티센스 뉴클레오티드는 다양한 형질전환 기술을 이용하여 세포 내로 도입시킬 수 있는데, 이를 위해 상기 안티센스 뉴클레오티드는 세포 내로의 효율적인 도입을 가능하게 하는 전달체 내에 포함된 형태일 수 있다. 상기 전달체는 바람직하게는 벡터이며, 바이러스 벡터 및 비바이러스 벡터 모두 사용 가능하다. 본 발명의 조성물은 안티센스 뉴클레오티드를 세포 내로 도입시켜 비결핵항산균 감염질환의 치료에 사용될 수 있는데, 여기서 "도입"은 형질감염(transfection) 또는 형질도입(transduction)에 의해 외래 뉴클레오티드를 세포로 유입시키는 것을 의미한다.Meanwhile, in the composition of the present invention, the antisense nucleotide may be provided in the form of an expression vector expressing the antisense nucleotide. The antisense nucleotides of the present invention can be introduced into cells using various transformation techniques. To this end, the antisense nucleotides may be included in a delivery system enabling efficient introduction into cells. The delivery vehicle is preferably a vector, and both viral vectors and non-viral vectors can be used. The composition of the present invention can be used for the treatment of non-Mycobacterium tuberculosis infectious diseases by introducing antisense nucleotides into cells, where "introduction" means introducing foreign nucleotides into cells by transfection or transduction.

본 발명의 조성물은 약제학적 분야에서 공지의 방법에 의하여, 그 자체 또는 약학적 허용되는 담체(carrier), 부형제(forming agent), 희석제 등과 혼합하여 분말, 과립, 정제, 캡슐제 또는 주사제 등의 제형으로 제조되어 사용될 수 있다. 본 발명에 따른 유효성분의 투여량은 체내에서 활성성분의 흡수도, 물활성화율 및 배설속도, 환자의 연령, 성별 및 상태, 치료할 질병의 중증정도 등에 따라 적절히 선택되나, 일반적으로 성인에게 1일에 체중 1kg 당 상기 화합물을 1~100mg 의 양으로 1회 내지 수회로 나누어 투여할 수 있다.The composition of the present invention is prepared by a method known in the pharmaceutical field, itself or by mixing with a pharmaceutically acceptable carrier, excipient, diluent, etc. to form a formulation such as powder, granule, tablet, capsule or injection It can be used. The dosage of the active ingredient according to the present invention is appropriately selected depending on the absorption rate of the active ingredient in the body, the rate of water activation and excretion rate, the age, sex and condition of the patient, the severity of the disease to be treated, etc. In general, it can be administered to adults in an amount of 1 to 100 mg of the compound per 1 kg of body weight per day, divided into one to several times.

이상과 같이 본 발명의 비결핵항산균 감염질환 진단용 조성물에 의하면 비결핵항산균 감염 의심 환자의 생체시료로부터 miRNA-144-3p의 발현량을 측정하는 것에 의해 환자에게 부담을 주지 않으면서 빠르고 간편하게 비결핵항산균 감염을 진단할 수 있다. As described above, according to the composition for diagnosing non-tuberculous mycobacterial infectious diseases of the present invention, by measuring the expression level of miRNA-144-3p from a biological sample of a patient suspected of being infected with non-tuberculous mycobacteria, it is possible to diagnose non-tuberculous mycobacterial infection quickly and conveniently without burdening the patient.

또한 본 발명의 비결핵항산균 감염질환의 예방 또는 치료용 조성물에 의하면 새로운 기작에 의해 비결핵항산균의 성장을 촉진하는 miRNA-144-3p의 발현을 억제하고, 감염으로 인한 염증반응을 저해하기 때문에 비결핵항산균 감염질환의 예방 또는 치료에 효과적으로 이용될 수 있다. In addition, according to the composition for preventing or treating non-tuberculous mycobacteria infectious diseases of the present invention, it inhibits the expression of miRNA-144-3p, which promotes the growth of non-tuberculous mycobacteria, by a novel mechanism, and inhibits the inflammatory response caused by infection. Therefore, it can be effectively used for the prevention or treatment of non-tuberculous mycobacterial infectious diseases.

도 1은 비결핵항산균 감염질환 환자에게서 차등발현되는 miRNA를 보여주는 그래프.
도 2는 miR-144-3p, miR-1-3p 및 miR-132-3p의 타겟 유전자의 PANTHER 경로를 보여주는 그래프.
도 3은 정상대조군에 비해 비결핵항산균 감염질환 환자에서 발현수준 차이가 가장 큰 세 가지 miRNA의 상대적인 발현수준을 보여주는 그래프.
도 4는 miRNA-144-3p의 과발현이 전염증 사이토카인/케모카인의 발현에 미치는 영향을 보여주는 그래프.
도 5는 mmu-miR-144-3p mimic의 형질감염에 의해 miR-144-3p의 발현이 증가함을 보여주는 그래프.
도 6은 비결핵항산균 감염 마우스의 폐조직에서 miRNA-144-3p 및 전염증 사이토카인/케모카인의 발현이 증가함을 보여주는 그래프.
도 7은 마우스의 BMDM에서 비결핵항산균의 감염에 의해 miRNA-144-3p 및 사이토카인/케모카인의 발현이 증가함을 보여주는 그래프.
도 8은 mmu-miR-144-3p mimic이 형질감염된 마우스 BMDM에서 비결핵항산균의 증식이 촉진됨을 보여주는 그래프. 1 is a graph showing miRNAs differentially expressed in patients with non-tuberculous mycobacteria infectious diseases.
Figure 2 is a graph showing the PANTHER pathway of target genes of miR-144-3p, miR-1-3p and miR-132-3p.
Figure 3 is a graph showing the relative expression levels of three miRNAs with the largest difference in expression levels in patients with non-tuberculous mycobacteria infectious diseases compared to a normal control group.
Figure 4 is a graph showing the effect of overexpression of miRNA-144-3p on the expression of pro-inflammatory cytokines/chemokines.
Figure 5 is a graph showing that the expression of miR-144-3p is increased by the transfection of the mmu-miR-144-3p mimic.
Figure 6 is a graph showing the increase in the expression of miRNA-144-3p and pro-inflammatory cytokines / chemokines in lung tissues of mice infected with non-Mycobacterium tuberculosis.
Figure 7 is a graph showing that the expression of miRNA-144-3p and cytokine / chemokine increased by infection with non-tuberculous mycobacteria in BMDM of mice.
8 is a graph showing that the proliferation of non-tuberculous mycobacteria is promoted in mouse BMDM transfected with the mmu-miR-144-3p mimic.

이하 첨부된 실시예를 들어 본 발명을 보다 상세히 설명한다. 그러나 이러한 실시예는 본 발명의 기술적 사상의 내용과 범위를 쉽게 설명하기 위한 예시일 뿐, 이에 의해 본 발명의 기술적 범위가 한정되거나 변경되는 것은 아니다. 이러한 예시에 기초하여 본 발명의 기술적 사상의 범위 안에서 다양한 변형과 변경이 가능함은 당업자에게는 당연할 것이다. Hereinafter, the present invention will be described in more detail with reference to the attached examples. However, these embodiments are only examples for easily explaining the content and scope of the technical idea of the present invention, and thereby the technical scope of the present invention is not limited or changed. It will be obvious to those skilled in the art that various modifications and changes are possible within the scope of the technical spirit of the present invention based on these examples.

[실시예][Example]

실시예 1 : 비결핵항산균 감염환자의 miRNA 발현 분석Example 1: Analysis of miRNA expression in patients infected with non-tuberculous mycobacteria

Mabc 감염환자(n =10), Mmass 감염환자(n=7) 및 정상대조군(HC, n=6)의 정맥혈로부터 Ficoll-Hypaque(Lymphorprep; Alere technologies, Osio, Norway)의 정맥혈을 사용하여 miRNA의 발현을 분석하였다. 모든 실험군은 여성으로 연령대가 유사하였다(p=0.31, Kruskal-Wallis test). Mabc 감염환자의 평균연령은 61.1±8.0세, Mmass 감염환자는 59.4±8.7세이며, 정상대조군은 55.2±7.3세였다. The venous blood of Ficoll-Hypaque (Lymphorprep; Alere technologies, Osio, Norway) was analyzed for miRNA expression from the venous blood of Mabc- infected patients (n = 10), Mmass -infected patients (n = 7) and normal controls (HC, n = 6). All experimental groups were female and had similar ages (p=0.31, Kruskal-Wallis test). The average age of Mabc- infected patients was 61.1±8.0 years, Mmass -infected patients were 59.4±8.7 years, and normal controls were 55.2±7.3 years.

헤파린 처리된 정맥혈 시료로부터 Ficoll-Hypaque(Lymphoprep; Alere technologies, Oslo, Norway)를 사용하여 제조사의 매뉴얼에 따라 말초혈액단핵세포(PBMCs)를 분리하였다. PBMCs로부터 QIAzol lysis reagent(Qiagen, Hilden, Germay)와 miRNeasy Mini Kits(Qiagen, Hilden, Germany)를 사용하여 제조사의 매뉴얼에 따라 총 RNA를 분리하여 nCounter Human miRNA expression assays를 실시하였다. nCounter Human miRNA expression assays는 PhileKorea Technology(대전, 한국)에서 실시하였다. 구체적으로는 nCounter Human miRNA Assay Kit V3 (NanoString Technologies, Inc., Seattle, WA, USA)를 사용하여 분석하였으며, nSolver, version 4.0(NanoString Technologies, Inc., Seattle, WA, USA)을 사용하여 사용자 매뉴얼에 따라 nCounter assay 데이터로부터 차등 유전자 발현을 분석하였다.Peripheral blood mononuclear cells (PBMCs) were isolated from heparinized venous blood samples using Ficoll-Hypaque (Lymphoprep; Alere technologies, Oslo, Norway) according to the manufacturer's manual. Total RNA was isolated from PBMCs using QIAzol lysis reagent (Qiagen, Hilden, Germay) and miRNeasy Mini Kits (Qiagen, Hilden, Germany) according to the manufacturer's manual, and nCounter Human miRNA expression assays were performed. nCounter Human miRNA expression assays were performed at PhileKorea Technology (Daejeon, Korea). Specifically, the analysis was performed using nCounter Human miRNA Assay Kit V3 (NanoString Technologies, Inc., Seattle, WA, USA), and differential gene expression was analyzed from nCounter assay data using nSolver, version 4.0 (NanoString Technologies, Inc., Seattle, WA, USA) according to the user manual.

도 1의 (a)는 그 결과를 보여주는 그래프로 Mabc 감염환자는 정상군에 비해 25가지의 miRNA가 차등발현되었으며, 이 중 14개는 상향조절, 11개는 하향조절되었다. Mmass 감염환자는 10가지 miRNA가 차등발현되었으며, 이 중 8개는 상향조절, 2개는 하향조절되었다. 도 1의 (b)는 이들 중 동일한 패턴으로 발현된 9개의 miRNA를 나타낸 것으로, 7개는 상향조절, 2개는 하향조절되었다.Figure 1 (a) is a graph showing the results. Compared to the normal group, 25 miRNAs were differentially expressed in Mabc- infected patients, of which 14 were up-regulated and 11 were down-regulated. Mmass- infected patients showed differential expression of 10 miRNAs, of which 8 were up-regulated and 2 were down-regulated. Figure 1(b) shows 9 miRNAs expressed in the same pattern among them, 7 were up-regulated and 2 were down-regulated.

이들 차등발현된 miRNA들이 전염증반응 유전자의 발현을 조절할 수 있는 지 확인하기 위하여, TargetScan database(version 7.1)을 사용하여 잠정적인 miRNA 타겟 유전자를 스크리닝하고, miRNA에 의해 예상된 타겟 유전자의 경로가 유의적으로 증폭되는 지를 확인하였다. 그 결과 miR-144-3p, miR-1-3p 및 miR-132-3p의 타겟 유전자에 대해 각각 11, 9, 23개의 PANTHER 경로를 확인하였다. 도 2는 그 결과를 나타낸 것으로, 5가지 경로가 상기 세 가지 miRNA에 대해 공통적이었다. To confirm that these differentially expressed miRNAs can regulate the expression of pro-inflammatory genes, potential miRNA target genes were screened using the TargetScan database (version 7.1), and it was confirmed whether the expected target gene pathways were significantly amplified by the miRNAs. As a result, 11, 9, and 23 PANTHER pathways were identified for the target genes of miR-144-3p, miR-1-3p, and miR-132-3p, respectively. Figure 2 shows the results, and five pathways were common to the three miRNAs.

비결핵항산균 감염환자군과 정상대조군에서 발현수준 차이가 가장 큰 세 가지 miRNA를 선택하였으며, 이 중 도 3에서 확인할 수 있듯이, 세 가지 miRNA 중에서 miR-144-3p는 정상 대조군에 비해 Mabc군과 Mmass군에서 현저하게 발현수준이 높았다(도 3의 a; p<0.001). 이에 반해 miR-1255a와 miR-5001-3p는 차이에 유의성을 나타내지 않았다. 이는 miR-144-3p가 Mabc 또는 Mmass 감염의 바이오마커로 사용될 수 있음을 시사한다.Three miRNAs with the greatest difference in expression level between the non-tuberculous mycobacteria infected patient group and the normal control group were selected. As can be seen in Figure 3, among the three miRNAs, miR-144-3p was significantly higher in the Mabc and Mmass groups than in the normal control group (Figure 3a; p <0.001). In contrast, miR-1255a and miR-5001-3p showed no significance in the difference. This suggests that miR-144-3p can be used as a biomarker for Mabc or Mmass infection.

실시예 2 : miR-144-3p의 과발현이 전염증 사이토카인/케모카인의 발현에 미치는 영향 평가Example 2: Evaluation of the effect of overexpression of miR-144-3p on the expression of proinflammatory cytokines/chemokines

정상인의 정맥혈로부터 분리한 PDMC를 4 ng/mL의 hCSF/대식세포자극인자(Sigma-Aldrich)를 포함하는 배지에서 4일간 배양하여 말초혈관유래대식세포(PMDM)를 제조하였다. Peripheral vascular-derived macrophages (PMDM) were prepared by culturing PDMC isolated from venous blood of a normal person in a medium containing 4 ng/mL of hCSF/macrophage stimulating factor (Sigma-Aldrich) for 4 days.

PMDM에 mmu-miR-144-3p mimic (Sense 5'-UACAGUAUAGAUGAUGUACU 3', Antisense 5' AGUACAUCAUCUAUACUGUA 3'; Genolution, Seoul, South Korea) 또는 mimic negative control (Cat. 4464058, Invitrogen, CA, USA) 10 nM을 Lipofectamine 2000(Invitrogen)을 사용하여 사용자의 매뉴얼에 따라 24시간 형질감염시켰다. 이 후 Mabc(ATCC 19977) 또는 Mmass(KMRC-00136-13018)를 2 MOI로 3시간 감염시켰다. 이 후 세포외 비결핵항산균을 제거하기 위하여 PBS 완충액으로 세척한 후 추가적으로 6시간 배양하였다.10 nM of mmu-miR-144-3p mimic (Sense 5'-UACAGUAUAGAUGAUGUACU 3', Antisense 5' AGUACAUCAUCUAUACUGUA 3'; Genolution, Seoul, South Korea) or mimic negative control (Cat. 4464058, Invitrogen, CA, USA) was added to PMDM using Lipofectamine 2000 (Invitrogen) 24 hours transfection according to the manual. Then, Mabc (ATCC 19977) or Mmass (KMRC-00136-13018) were infected at an MOI of 2 for 3 hours. Thereafter, in order to remove extracellular non-tuberculous mycobacteria, the cells were washed with PBS buffer and cultured for an additional 6 hours.

배양된 세포로부터 QIAzol lysis reagent (Qiagen, Hilden, Germany)와 miRNeasy Mini Kits (Qiagen, Hilden, Germany)를 사용하여 제조사의 방법에 따라 전체 RNA를 분리하였다. 하기 표 1에 기재된 프라이어를 사용하여 rt-PCR에 의해 전염증 사이토카인/케모카인의 발현량을 분석하였다.Total RNA was isolated from the cultured cells using QIAzol lysis reagent (Qiagen, Hilden, Germany) and miRNeasy Mini Kits (Qiagen, Hilden, Germany) according to the manufacturer's method. Expression levels of pro-inflammatory cytokines/chemokines were analyzed by rt-PCR using the primers described in Table 1 below.

도 4는 그 결과를 보여주는 그래프로, Mabc의 감염 시 miR-144-3p의 과발현에 의해 4가지 사이토카인/케모카인의의 발현이 모두 유의적으로 증가하였다. Mmass의 감염 시에는 miR-144-3p의 과발현에 의해 IL6, TNFA, CXCL2의 발현은 증가하였으나, IL1B의 발현에는 유의적인 차이가 없었다.4 is a graph showing the results, and the expression of all four cytokines/chemokines was significantly increased by the overexpression of miR-144-3p during infection with Mabc . During infection with Mmass , the expression of IL6, TNFA, and CXCL2 increased due to the overexpression of miR-144-3p, but there was no significant difference in the expression of IL1B.

도 5는 대조군과 실험군에서 mmu-miR-144-3p mimic의 형질감염에 의한 miR-144-3p의 발현량을 hsa-miR-144-3p 프라이머(MS00020328, Qiagen)를 사용하여 rt-PCR로 측정한 결과이다. 도 5로부터 Mabc의 감염에 의해 miRNA-144-3p의 발현이 크게 증가하며, mmu-miR-144-3p mimic의 형질감염에 의해 그 증가량이 더욱 현저함을 확인할 수 있다. Mabc가 감염되지 않았을 때에는 형질감염에 의한 miRNA-144-3p의 발현량의 증가는 관측되지 않았다.5 is a result of measuring the expression level of miR-144-3p by transfection of the mmu-miR-144-3p mimic in the control group and the experimental group by rt-PCR using the hsa-miR-144-3p primer (MS00020328, Qiagen). From FIG. 5 , it can be confirmed that the expression of miRNA-144-3p is greatly increased by infection with Mabc , and the increase is more remarkable by transfection of mmu-miR-144-3p mimic. When Mabc was not infected, an increase in the expression level of miRNA-144-3p by transfection was not observed.

이로부터 miR-144-3p는 비결핵항산균 감염 시 전염증 사이토카인/케모카인의 발현을 증가시킴을 확인할 수 있다.From this, it can be confirmed that miR-144-3p increases the expression of pro-inflammatory cytokines/chemokines upon infection with non-tuberculous mycobacteria.

실시예 3 : 마우스 모델에서의 miR-144-3p의 발현 평가Example 3: Evaluation of expression of miR-144-3p in a mouse model

miR-144-3p는 사람과 마우스에서 공통적인 서열을 갖기 때문에, 마우스 모델을 사용하여 in-vivo와 in-vitro에서 Mabc 또는 Mmass 감염이 miR-144-3p의 발현에 미치는 영향을 평가하였다.Since miR-144-3p has a common sequence between humans and mice, the effect of infection with Mabc or Mmass on miR-144-3p expression was evaluated in vivo and in vitro using a mouse model.

1)One) in-vivo in-vivo 시험 test

마우스는 8~12주령의 웅성 C67BL/6(Samtako Bio, 경기도, 한국) 마우스를 연령 매치하여 사용하였다. 마우스들은 12시간 명암 조건의 특정 무병소 조건에서 유지하였다. 마우스는 Mabc 투여군, Mmass 투여군 및 정상 대조군 3개의 군으로 나누었으며, 각 군당 개체수는 4마리로 하였다.As mice, 8-12 week old male C67BL/6 (Samtako Bio, Gyeonggi-do, Korea) mice were age-matched and used. Mice were maintained in specific disease-free conditions in 12-hour light/dark conditions. The mice were divided into three groups: a Mabc- administered group, an Mmass- administered group, and a normal control group, and the number of mice in each group was 4.

C57BL/6 마우스에 Mabc 또는 Mmass 1×107 CFU를 비강을 통하여 감염시키고, 감염 7일째 마우스를 희생시키고 폐를 수득하였다. 폐조직으로부터 mmu-mir-144-3p 및 전염증 사이토카인의 발현수준을 quantative rt-PCR로 측정하여 도 6에 도시하였다. Ccl2의 정량에 사용된 프라이머는 표 2에 기재하였다. 도 6은 정상대조군에 비해 Mabc 또는 Mmass 감염 마우스의 페에서 miR014403p 및 염증성 사이토카인과 케모카인의 발현이 증가한 것을 보여준다. C57BL/6 mice were intranasally infected with 1×10 7 CFU of Mabc or Mmass , and on day 7 of infection, the mice were sacrificed and lungs obtained. Expression levels of mmu-mir-144-3p and pro-inflammatory cytokines from lung tissue were measured by quantitative rt-PCR and shown in FIG. 6 . Primers used for quantification of Ccl2 are listed in Table 2. Figure 6 shows that the expression of miR014403p and inflammatory cytokines and chemokines increased in the lungs of Mabc or Mmas infected mice compared to the normal control group.

2) 2) in-vitroin vitro 시험 test

골수유래 대식세포(BMDMs)의 수집 및 배양Collection and culture of bone marrow-derived macrophages (BMDMs)

C57BL/6 마우스의 골수로부터 대식세포(macrophage)를 수집하고 10% fetal bovine serum(Lonza), penicillin(100 IU/ml) 및 streptomycin (100 ㎍/ml)를 포함하는 DMEM(Lonza) 배지에서 배양하였다. 배지에 대식세포 집락 인자(macrophage colony-stimulating factor, M-CSF, R&D Systems)를 25 ng/ml의 농도로 첨가하여 4일간 분화하고, 37℃, 5% CO2, 가습 조건에서 배양하였다. 분화한 대식세포가 아닌 림프구들은 기계적인 파괴로 제거하여 골수유래 대식세포(BMDMs)을 수집하였다. Macrophages were collected from the bone marrow of C57BL/6 mice and cultured in DMEM (Lonza) medium containing 10% fetal bovine serum (Lonza), penicillin (100 IU/ml), and streptomycin (100 μg/ml). Macrophage colony-stimulating factor (M-CSF, R&D Systems) was added to the medium at a concentration of 25 ng/ml, differentiated for 4 days, and cultured at 37° C., 5% CO 2 , and humidified conditions. Lymphocytes other than differentiated macrophages were removed by mechanical destruction, and bone marrow-derived macrophages (BMDMs) were collected.

골수유래 대식세포에서 비결핵항산균의 감염Infection of nontuberculous mycobacteria in bone marrow-derived macrophages

BMDMs에 Mabc 또는 Mmass를 3 MOI로 2시간 동안 감염시킨 후, 이 후 세포외 비결핵항산균을 제거하기 위하여 PBS 완충액으로 세척하고 추가적으로 18시간 배양하였다. 배양 시간별로 배양 세포로부터 quantitative rt-PCR에 의해 mmu-miR-144-3p(mmu-miR-144-3p 프라이머(MS00032326, Qiagen) 사용) 및 전염증성 사이토카인/케모카인의 발현량을 정량하였다. 도 7은 그 결과를 보여주는 것으로, Mabc와 Mmass의 감염에서 피크 시간은 달랐지만, 두 균주 모두 감염에 의해 BMDMs에서 mmu-miR-144-3p의 발현량을 현저하게 상향조절하는 것을 확인할 수 있었다. 또한 Mabc의 감염에 의해 TNFA, IL1b 및 CXCL2의 발현도 시간 의존적으로 증가함을 나타내었다. 이에 비해 Mmass의 감염 시에는 감염 18시간 이후 TNFA, IL1b 및 CXCL2의 발현이 증가하였다. BMDMs were infected with Mabc or Mmass at a MOI of 3 for 2 hours, then washed with PBS buffer to remove extracellular non-tuberculous mycobacteria and cultured for an additional 18 hours. The expression levels of mmu-miR-144-3p (using mmu-miR-144-3p primer (MS00032326, Qiagen)) and pro-inflammatory cytokines/chemokines were quantified by quantitative rt-PCR from cultured cells for each culture time. Figure 7 shows the results. Although the peak times were different in the infection of Mabc and Mmass , it was confirmed that both strains significantly upregulated the expression level of mmu-miR-144-3p in BMDMs by infection. In addition, it was shown that the expression of TNFA, IL1b, and CXCL2 increased in a time-dependent manner by infection with Mabc . In comparison, Mmass infection increased the expression of TNFA, IL1b, and CXCL2 18 hours after infection.

골수유래 대식세포에서 mir-144-3p가 비결핵항산균 감염에 미치는 영향 평가Evaluation of the effect of mir-144-3p on non-tuberculous mycobacteria infection in bone marrow-derived macrophages

BMDMs에 mmu-miR-144-3p mimic 또는 mimic negative control(Cat. 4464058, Invitrogen, CA, USA) 10 nM을 Lipofectamine 2000(Invitrogen)을 사용하여 24시간 형질감염시켰다. 이 후 Mabc 또는 Mmass를 1 MOI로 3시간 감염시켰다. 이 후 세포외 비결핵항산균을 제거하기 위하여 PBS 완충액으로 세척한 후 추가적으로 24시간 배양하였다.BMDMs were transfected with 10 nM of mmu-miR-144-3p mimic or mimic negative control (Cat. 4464058, Invitrogen, CA, USA) using Lipofectamine 2000 (Invitrogen) for 24 hours. Then, Mabc or Mmass was infected at 1 MOI for 3 hours. Thereafter, in order to remove extracellular non-tuberculous mycobacteria, the cells were washed with PBS buffer and further cultured for 24 hours.

배양 후 세포내 박테리아를 방출시키기 위하여 증류수로 대식세포를 터트리고, PBS로 10배 희석하였다. 7H10 아가 플레이트에 분주하여 37℃, 5% CO2 incubator에서 3~4일 정도 배양하고 집락형성단위(CFU)를 측정하여 세포내 균 생존율을 확인하고 그 결과를 도 8에 각각 도시하였다. BMDMs에서 mmu-mir-144-3p 과발현은 Mabc 및 Mmass의 성장을 유의적으로 증가시킴을 확인할 수 있다. After culturing, macrophages were burst with distilled water to release intracellular bacteria, and diluted 10-fold with PBS. It was distributed on a 7H10 agar plate, cultured for 3 to 4 days in a 37°C, 5% CO 2 incubator, and colony forming units (CFU) were measured to confirm intracellular bacterial viability, and the results are shown in FIG. 8 . Overexpression of mmu-mir-144-3p in BMDMs significantly increased the growth of Mabc and Mmass .

이로부터 miR-144-3p의 발현수준은 Mabc 또는 Mmass의 감염에 의해 상향조절되며, miR-144-3p이 Mabc 또는 Mmass의 세포 내 성장을 촉진함을 알 수 있다. From this, it can be seen that the expression level of miR-144-3p is up-regulated by infection with Mabc or Mmass , and miR-144-3p promotes intracellular growth of Mabc or Mmass .

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) SAMSUNG LIFE PUBLIC WELFARE FOUNDATION INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Biomarker for Diagnosing Nontuberculous Mycobacterium Infection and Pharmaceutical Composition for Prophylaxis or Treatment of Nontuberculous Mycobacterium Infectious Disease <130> P1220-474 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 uacaguauag augauguacu 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ccacagacct tccaggagaa tg 22 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gtgcagttca gtgatcgtac agg 23 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gctgcacttt ggagtgatcg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 acaacatggg ctacaggctt 20 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tgtgaaagca gcaaagaggc actg 24 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 acagctctgg cttgttcctc acta 24 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ccgaagtcat agccacactc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ggatttgcca tttttcagca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ccccagtcac ctgctgttat 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 tggaatcctg aacccacttc 20 <110> The Industry & Academic Cooperation in Chungnam National University (IAC) SAMSUNG LIFE PUBLIC WELFARE FOUNDATION INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Biomarker for Diagnosing Nontuberculous Mycobacterium Infection and Pharmaceutical Composition for Prophylaxis or Treatment of Nontuberculous Mycobacterium Infectious Disease <130> P1220-474 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 1 uacaguaauag augauguacu 20 <210> 2 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 2 ccacagacct tccaggagaa tg 22 <210> 3 <211> 23 <212> DNA <213> artificial sequence <220> <223> primer <400> 3 gtgcagttca gtgatcgtac agg 23 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 4 gctgcacttt ggaggtgatcg 20 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 5 acaacatggg ctacaggctt 20 <210> 6 <211> 24 <212> DNA <213> artificial sequence <220> <223> primer <400> 6 tgtgaaagca gcaaagaggc actg 24 <210> 7 <211> 24 <212> DNA <213> artificial sequence <220> <223> primer <400> 7 acagctctgg cttgttcctc acta 24 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 8 ccgaagtcat agccacactc 20 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 9 ggatttgcca tttttcagca 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 10 ccccagtcac ctgctgttat 20 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 11 tggaatcctg aacccacttc 20

Claims (11)

miRNA-144-3p를 포함하는 것을 특징으로 하는 비결핵항산균 Mycobacterium abscessus 또는 Mycobacterium massiliense 감염 진단용 바이오마커 조성물.
A biomarker composition for diagnosing non-tuberculous mycobacteria Mycobacterium abscessus or Mycobacterium massiliense infection comprising miRNA-144-3p.
 miRNA-144-3p의 발현수준을 측정하는 제제를 포함하는 것을 특징으로 하는 비결핵항산균 Mycobacterium abscessus 또는 Mycobacterium massiliense 감염 진단용 조성물.
A composition for diagnosing non-tuberculous mycobacterium abscessus or Mycobacterium massiliense infection, comprising an agent for measuring the expression level of miRNA-144-3p.
 제 2 항에 있어서,
상기 제제는 프라이머 또는 프로브인 것을 특징으로 하는 비결핵항산균 Mycobacterium abscessus 또는 Mycobacterium massiliense 감염 진단용 조성물.
According to claim 2,
The agent is a composition for diagnosing non-tuberculosis mycobacterium abscessus or Mycobacterium massiliense infection, characterized in that the primer or probe.
 삭제delete 제 2 항 또는 제 3항의 조성물을 포함하는 비결핵항산균 Mycobacterium abscessus 또는 Mycobacterium massiliense 감염 진단용 키트.
A kit for diagnosing infection with a non- mycobacterium mycobacterium abscessus or Mycobacterium massiliense comprising the composition of claim 2 or claim 3.
 제 5 항에 있어서,
상기 키트는 RT-PCR, 실시간 RT-PCR, 노던 블랏팅, RNA 보호분석법 또는 마이크로어레이 칩용인 비결핵항산균 Mycobacterium abscessus 또는 Mycobacterium massiliense 감염 진단용 키트.
According to claim 5,
The kit is a kit for diagnosing non-tuberculous mycobacteria Mycobacterium abscessus or Mycobacterium massiliense infection for RT-PCR, real-time RT-PCR, Northern blotting, RNA protection assay or microarray chip.
 (A) 비결핵항산균 감염질환 의심 환자의 생체시료로부터 miRNA-144-3p의 발현 수준을 측정하는 단계; 및
(B) 상기 측정된 miRNA-144-3p의 발현 수준을 정상대조구 시료로부터 측정한 miRNA-144-3p의 발현 수준과 비교하는 단계;
를 포함하는 것을 특징으로 하는 비결핵항산균 Mycobacterium abscessus 또는 Mycobacterium massiliense 감염 진단을 위한 정보 제공 방법.
(A) measuring the expression level of miRNA-144-3p from a biological sample of a patient suspected of having a non-tuberculous mycobacterium infectious disease; and
(B) comparing the measured expression level of miRNA-144-3p with the expression level of miRNA-144-3p measured from a normal control sample;
An information providing method for diagnosing non-tuberculosis mycobacterium abscessus or Mycobacterium massiliense infection comprising a.
 제 7 항에 있어서,
상기 생체시료는 혈액 또는 비결핵항산균 감염 의심 조직인 것을 특징으로 하는 비결핵항산균 Mycobacterium abscessus 또는 Mycobacterium massiliense 감염 진단을 위한 정보 제공 방법.According to claim 7,
The method for providing information for diagnosing non-tuberculosis mycobacterium abscessus or Mycobacterium massiliense infection, characterized in that the biological sample is blood or tissue suspected of non-tuberculous mycobacterium infection. 삭제delete 삭제delete 삭제delete
KR1020200174113A 2020-12-14 2020-12-14 Biomarker for Diagnosing Nontuberculous Mycobacterium Infection and Pharmaceutical Composition for Prophylaxis or Treatment of Nontuberculous Mycobacterium Infectious Disease KR102560055B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020200174113A KR102560055B1 (en) 2020-12-14 2020-12-14 Biomarker for Diagnosing Nontuberculous Mycobacterium Infection and Pharmaceutical Composition for Prophylaxis or Treatment of Nontuberculous Mycobacterium Infectious Disease

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200174113A KR102560055B1 (en) 2020-12-14 2020-12-14 Biomarker for Diagnosing Nontuberculous Mycobacterium Infection and Pharmaceutical Composition for Prophylaxis or Treatment of Nontuberculous Mycobacterium Infectious Disease

Publications (2)

Publication Number Publication Date
KR20220084544A KR20220084544A (en) 2022-06-21
KR102560055B1 true KR102560055B1 (en) 2023-07-27

Family

ID=82221527

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200174113A KR102560055B1 (en) 2020-12-14 2020-12-14 Biomarker for Diagnosing Nontuberculous Mycobacterium Infection and Pharmaceutical Composition for Prophylaxis or Treatment of Nontuberculous Mycobacterium Infectious Disease

Country Status (1)

Country Link
KR (1) KR102560055B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115598353A (en) * 2022-10-24 2023-01-13 首都医科大学附属北京胸科医院（Cn） Application of cell factor as marker in preparation of extrapulmonary tuberculosis diagnosis or treatment prognosis product

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170240958A1 (en) 2016-02-19 2017-08-24 Keio University Biomarker of mycobacteriosis or mycobacterial infection

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101476781B1 (en) 2014-05-09 2014-12-29 충남대학교산학협력단 Biomarker MicroRNA for Diagnnosis of Tuberculosis
KR101643748B1 (en) 2015-08-13 2016-07-29 충남대학교산학협력단 Biomarker MicroRNA for Diagnnosis of Tuberculosis
KR20180044153A (en) * 2016-10-21 2018-05-02 충남대학교산학협력단 Composition for Diagnosing Tuberculosis Using Biomarker MicroRNA-144
KR102031409B1 (en) 2017-04-21 2019-10-14 한국화학연구원 Pharmaceutical composition for treating the non-tuberculous mycobacterial infectious diseases
KR102137710B1 (en) 2018-09-10 2020-07-28 서울대학교 산학협력단 Diagnostic method for endometrial cavity distorting uterine leiomyoma using microRNA

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170240958A1 (en) 2016-02-19 2017-08-24 Keio University Biomarker of mycobacteriosis or mycobacterial infection

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Hyeon Ji Kim 등. 2020 대한면역학회 초록집, EP-104(2020.11.11.)

Also Published As

Publication number Publication date
KR20220084544A (en) 2022-06-21

Similar Documents

Publication Publication Date Title
Abdulamir et al. Molecular detection, quantification, and isolation of Streptococcus gallolyticus bacteria colonizing colorectal tumors: inflammation-driven potential of carcinogenesis via IL-1, COX-2, and IL-8
Kesavan et al. Tuberculosis genes expressed during persistence and reactivation in the resistant rabbit model
CN113897302B (en) Bifidobacterium capable of relieving colitis and application thereof
Champagne et al. Development of a DNA microarray for enterococcal species, virulence, and antibiotic resistance gene determinations among isolates from poultry
Berg et al. Helicobacter pylori populations in Peruvian patients
Wang et al. Prevalence and distribution of Aggregatibacter actinomycetemcomitans and its cdtB gene in subgingival plaque of Chinese periodontitis patients
KR102560055B1 (en) Biomarker for Diagnosing Nontuberculous Mycobacterium Infection and Pharmaceutical Composition for Prophylaxis or Treatment of Nontuberculous Mycobacterium Infectious Disease
KR101476781B1 (en) Biomarker MicroRNA for Diagnnosis of Tuberculosis
KR101857684B1 (en) Primers and probe for detection of middle east respiratory syndrome coronavirus and detecting method for middle east respiratory syndrome coronavirus using the same
Rivera et al. Baboon vaginal microbiota: an overlooked aspect of primate physiology
US11047012B2 (en) Method for detecting the risk and prognosis of adult-onset Still&#39;s disease
Behruznia et al. Decreased Susceptibility of Shigella Isolates to Azithromycin in Children in Tehran, Iran
Flores et al. Multiresistant Shigella species isolated from pediatric patients with acute diarrheal disease
Macías-Farrera et al. Antibiotics susceptibility of quinolones against Salmonella spp. strains isolated and molecularly sequenced for gyrA gene
KR101522398B1 (en) Composition for diagnosing human papillomavirus infection and cervical cancer
JP7194548B2 (en) Primer for specifically amplifying at least part of base sequence complementary to 23S rRNA of Pseudomonas aeruginosa and method for detecting Pseudomonas aeruginosa using the same
KR102616105B1 (en) Kit for predicting therapeutic response of severe alcoholic hepatitis
US20210247394A1 (en) Isolated bacterial strain for inducing proliferation or accumulation of regulatory t-cells
KR101886520B1 (en) Method for diagnosing latent infection phase of Johne&#39;s Disease
KR20180044153A (en) Composition for Diagnosing Tuberculosis Using Biomarker MicroRNA-144
Stojanovska et al. Identification of periopathogenes from dental plaque in periodontal patients with PCR technique and their association with composite interleukin-1 genotype
Pohanka et al. Diagnosis of tularemia using biochemical, immunochemical and molecular methods: a review
Takahashi et al. In vitro analysis of the change in resistance of Chlamydia trachomatis under exposure to sub-MIC levofloxacin for a therapeutic term
Adwan et al. Characterization of Escherichia coli isolates from patients with urinary tract infections from Thabet Hospital-Tulkarm, Palestine
WO2023085397A1 (en) Detection method for hunner-type interstitial cystitis diagnosis marker, hunner-type interstitial cystitis diagnosis kit, and hunner-type interstitial cystitis therapeutic agent

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right