KR102559814B1

KR102559814B1 - Pharmaceutical composition for treating kidney disease comprising glutathione as an active ingredient

Info

Publication number: KR102559814B1
Application number: KR1020210062912A
Authority: KR
Inventors: 김용균; 남선아; 김진원; 이종영
Original assignee: 가톨릭대학교 산학협력단
Priority date: 2021-05-14
Filing date: 2021-05-14
Publication date: 2023-07-26
Also published as: KR20220155108A; WO2022240079A1

Abstract

본 발명은 글루타치온을 유효성분으로 포함하는, 신장질환 예방 또는 치료용 약학적 조성물에 관한 것으로서, 본 발명자들은 사람 글루타치온을 GLA 돌연변이 신장 파브리병 오가노이드 모델에 처리한 결과, 글루타치온이 GLA-변이된 신장 파브리병 오가노이드 모델의 구조적 변형을 감소시키며, 족세포(podocytes) 또는 세뇨관 마커의 발현을 증가시키고, 세포 사멸을 감소시킴을 확인하였다. 따라서 본 발명의 글루타치온은 신장 파브리병을 포함한 다양한 신장 질환의 예방 또는 치료를 위하여 매우 유용하게 활용될 수 있을 것으로 기대된다. The present invention relates to a pharmaceutical composition for preventing or treating kidney disease, comprising glutathione as an active ingredient. As a result of treating a GLA-mutated renal Fabry disease organoid model with human glutathione, it was confirmed that glutathione reduced structural deformation of the GLA-mutated renal Fabry disease organoid model, increased expression of podocytes or tubular markers, and decreased cell death. Therefore, glutathione of the present invention is expected to be very useful for the prevention or treatment of various renal diseases including renal Fabry disease.

Description

Pharmaceutical composition for treating kidney disease comprising glutathione as an active ingredient

본 발명은 글루타치온을 유효성분으로 포함하는 신장질환 치료용 약학적 조성물 등에 관한 것이다.The present invention relates to a pharmaceutical composition for the treatment of kidney disease containing glutathione as an active ingredient.

신장은 노폐물을 배설하고 산염기 및 전해질 대사 등 체내 항상성을 유지하며 여러 가지 호르몬을 생산하고 활성화시키는 내분비 기능을 하는 기관으로, 신장의 기능이 심하게 저하되거나 소실되는 경우 생명의 유지가 어려워진다.The kidney is an endocrine organ that excretes waste products, maintains body homeostasis such as acid-base and electrolyte metabolism, and produces and activates various hormones.

신장이 배설, 조절, 대사 및 내분비적 기능을 정상적으로 수행하지 못하고 기능이 저하되거나, 이상이 초래된 상태를 신장질환이라고 한다. 신장질환은 진행상태에 따라 만성 신부전과 급성 신부전으로 나눌 수 있다. 만성 신부전은 3개월 이상 신장이 손상되어 있거나, 신장 기능 감소가 지속적으로 나타나는 것으로 병의 진행이 지속되어 정상 신장에 비해 기능이 15% 이하로 심하게 감소하는 말기 질환이 유발되면 혈액투석이나, 복막투석, 신장이식과 같은 치료를 받지 않으면 정상적인 생활을 할 수 없는 상태가 된다. 우리나라에서는 당뇨병과 고혈압이 주된 발병원인으로 알려져 있다. 급성 신부전은 신장 기능이 수시간에서 수일에 걸쳐 급격하게 저하되는 것으로, 병원에 입원하는 환자의 약 5%, 중환자실에 입원하는 환자의 약 30%에서 관찰된다. 급성 신부전의 원인은 신혈류의 저하가 오래 이어져 세포가 허혈에 빠지는 허혈형과 화학물질이나 치료약물, 부적합 수혈 등의 독성으로 인한 신독성형이 주를 이룬다. 사망률은 원인에 따라 다르지만 수술 후 혹은 외상 후 발생한 급성 신부전의 경우에는 60~70%에 이르는 것으로 보고되고 있다. 생존 환자는 병에 걸리기 전과 비슷한 정도로 신장 기능이 서서히 회복되지만 만성 신기능 저하 상태로 유지되는 경우도 있다.Renal disease is a condition in which the kidney fails to normally perform excretion, regulation, metabolism, and endocrine functions, and the function is deteriorated or an abnormality is caused. Renal disease can be divided into chronic renal failure and acute renal failure depending on the progression. Chronic renal failure is a condition in which the kidneys have been damaged for more than 3 months or the renal function is continuously reduced. When the progression of the disease continues and a terminal disease in which the function is severely reduced to 15% or less compared to the normal kidney is induced, it is impossible to live a normal life without treatment such as hemodialysis, peritoneal dialysis, or kidney transplant. Diabetes and hypertension are known to be the main causes of disease in Korea. Acute renal failure is a rapid decrease in kidney function over several hours to several days, and is observed in about 5% of patients admitted to hospitals and about 30% of patients admitted to intensive care units. The causes of acute renal failure are mainly ischemic type, in which cells fall into ischemia due to prolonged decline in renal blood flow, and renal toxicity type due to toxicity such as chemicals, therapeutic drugs, and inappropriate blood transfusions. Mortality varies depending on the cause, but it has been reported that it reaches 60-70% in the case of acute renal failure that occurred after surgery or trauma. In surviving patients, renal function gradually recovers to a degree similar to that before the disease, but in some cases, it remains in a state of chronic renal insufficiency.

한편, 파브리병(Fabry disease)은 리소좀 효소인 α-galactosidase A(α-Gal A)의 활성이 없거나 결여된 결과로 인해 글리코스핑고리피드(glycosphingolipid) 대사 경로에 결함을 일으키는 희귀한 X-연관 유전장애이다. α-Gal A 결핍은 리보좀 내에 globotriaosylceramide(Gb3) 및 관련 중성 글리코스핑고리피드의 축적을 초래하여, 세포 형태 및 기능을 손상시킨다. 파브리병은 뇌졸중, 심부전, 심부정맥 및 말기 신장질환(ESRD, End Stage Renal Disease)과 같은 생명을 위협하는 합병증이 있는 다계통 질병으로, 기대 수명을 단축시킨다.On the other hand, Fabry disease is a rare X-linked genetic disorder that causes defects in the glycosphingolipid metabolic pathway as a result of absence or lack of activity of the lysosomal enzyme α-galactosidase A (α-Gal A). α-Gal A deficiency results in the accumulation of globotriaosylceramide (Gb3) and related neutral glycosphingolipids within ribosomes, impairing cell morphology and function. Fabry disease is a multisystem disease with life-threatening complications such as stroke, heart failure, cardiac arrhythmia, and end stage renal disease (ESRD), which reduces life expectancy.

신장 관련은 고전적인 남성 파브리병 뿐만 아니라 비고전적인 여성 파브리병의 신장 변이체에서 빈번하며, 이는 종종 20 내지 30세에 미세 알부민뇨 또는 단백뇨로 시작된다. 신장 기능의 점진적인 악화는 4-5년에 ESRD로 이어지며, 이는 치료되지 않은 파브리병 환자의 주요 사망 원인으로 알려져 있다.Renal involvement is frequent in classical male Fabry disease as well as in the renal variant of nonclassical female Fabry disease, which often begins between the ages of 20 and 30 with microalbuminuria or proteinuria. Progressive deterioration in renal function leads to ESRD at 4–5 years, which is known to be the leading cause of death in patients with untreated Fabry disease.

신장 파브리병은 족세포, 사구체 내피 세포, 사구체간질 세포, 세뇨관 상피 세포 및 혈관 내피 세포와 같은 신장 세포에서 Gb3의 축적으로부터 발생한다. agalsidase-α 및 agalsidase-β를 사용한 재조합 효소 대체 요법(ERT)은 Gb3의 세포 침착물을 제거하고 각각 질병 부담을 개선시킨다. 그러나, ERT는 추적 관찰기간 동안 용량 조절 후 족세포에서 Gb3의 재축적 및 주입 후 중화 항 약물 항체의 형성에 의해 잠재적으로 제한되며, 이는 증가된 세포성 Gb3 침착에 의한 ERT의 효능을 감소시키고 점진적 손실과 같은 신장 기능의 유해한 임상 결과를 초래한다. Renal Fabry disease results from the accumulation of Gb3 in renal cells such as podocytes, glomerular endothelial cells, glomerular mesangial cells, tubular epithelial cells and vascular endothelial cells. Recombinant enzyme replacement therapy (ERT) with agalsidase-α and agalsidase-β removes cellular deposits of Gb3 and improves disease burden, respectively. However, ERT is potentially limited by the re-accumulation of Gb3 in podocytes after dose adjustment during follow-up and the formation of neutralizing anti-drug antibodies after infusion, which reduces the efficacy of ERT by increased cellular Gb3 deposition and leads to deleterious clinical consequences of renal function, such as progressive loss.

이러한 신장 파브리병을 포함한 다양한 신장 질환의 예방 또는 치료를 위한 다수의 치료제가 개발되고 있으나, 고가이며 단지 부분증상만을 완화시키는 제한된 효능으로 새로운 신장 질환 치료제의 필요성이 대두되고 있다. A number of therapeutic agents for the prevention or treatment of various renal diseases, including such renal Fabry disease, have been developed, but the need for a new therapeutic agent for renal diseases is emerging due to their high cost and limited efficacy that relieves only partial symptoms.

대한민국 공개특허 제10-2016-0082071호(2016.07.08.)Republic of Korea Patent Publication No. 10-2016-0082071 (2016.07.08.)

본 발명자들은 상기와 같은 종래의 문제점을 해결하기 위하여 예의 연구 노력한 결과, GLA-변이된 신장 파브리병 오가노이드 모델에 글루타치온을 처리하면, 글루타치온이 산화스트레스를 감소시키고, GLA-변이된 신장 오가노이드의 구조적 변형을 감소시키며, 족세포(podocytes) 또는 세뇨관 마커의 발현을 증가시키고, 세포 사멸을 감소시킴을 확인하였는 바, 이에 기초하여 본 발명을 완성하였다.As a result of intensive research efforts to solve the above conventional problems, the present inventors have confirmed that glutathione reduces oxidative stress, structural deformation of GLA-mutated kidney organoids, increases expression of podocytes or tubular markers, and decreases cell death when glutathione is treated with a GLA-mutated kidney Fabry disease organoid model. Based on this, the present invention was completed.

이에, 본 발명은 글루타치온 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 신장질환 예방 또는 치료용 약학적 조성물을 제공하는 것을 목적으로 한다. Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating kidney disease comprising glutathione or a pharmaceutically acceptable salt thereof as an active ingredient.

또한, 본 발명은 글루타치온 또는 이의 식품학적으로 허용가능한 염을 유효성분으로 포함하는 신장질환 예방 또는 개선용 식품 조성물을 제공하는 것을 목적으로 한다. In addition, an object of the present invention is to provide a food composition for preventing or improving renal disease comprising glutathione or a food chemically acceptable salt thereof as an active ingredient.

그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

상기와 같은 본 발명의 목적을 달성하기 위하여, 본 발명은 글루타치온 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 신장질환 예방 또는 치료용 약학적 조성물을 제공한다.In order to achieve the object of the present invention as described above, the present invention provides a pharmaceutical composition for preventing or treating kidney disease comprising glutathione or a pharmaceutically acceptable salt thereof as an active ingredient.

또한, 본 발명은 글루타치온 또는 이의 식품학적으로 허용가능한 염을 유효성분으로 포함하는 신장질환 예방 또는 개선용 식품 조성물을 제공한다.In addition, the present invention provides a food composition for preventing or improving renal disease comprising glutathione or a food chemically acceptable salt thereof as an active ingredient.

본 발명의 일구현예로, 상기 신장질환은 신장 파브리병, 신장 섬유화, 당뇨병성 신증, 고혈압성 신증, 사구체 신염, 신우 신염, 간질성 신염, 루프스 신장염, 다낭성 신장질환, 및 신부전증으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.In one embodiment of the present invention, the kidney disease is renal Fabry disease, renal fibrosis, diabetic nephropathy, hypertensive nephropathy, glomerulonephritis, pyelonephritis, interstitial nephritis, lupus nephritis, polycystic kidney disease, and renal failure It may be one or more selected from the group consisting of, but is not limited thereto.

본 발명의 다른 구현예로, 상기 신장질환은 신장 파브리병일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the kidney disease may be renal Fabry disease, but is not limited thereto.

본 발명의 또 다른 구현예로, 상기 글루타치온은 Gb3(Globotriaosylceramide) 발현 수준을 감소시키는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the glutathione may decrease the expression level of Gb3 (Globotriaosylceramide), but is not limited thereto.

본 발명의 또 다른 구현예로, 상기 글루타치온은 신장 구조를 강화시키는 것을 특징으로 하는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the glutathione may be characterized in that it strengthens the renal structure, but is not limited thereto.

아울러, 본 발명은 글루타치온 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 약학적 조성물을 개체에 투여하는 단계를 포함하는, 신장질환 예방 또는 치료 방법을 제공한다.In addition, the present invention provides a method for preventing or treating kidney disease, comprising administering to a subject a pharmaceutical composition containing glutathione or a pharmaceutically acceptable salt thereof as an active ingredient.

또한, 본 발명은 글루타치온 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 약학적 조성물의 신장질환 예방 또는 치료 용도를 제공한다. In addition, the present invention provides a use for preventing or treating kidney disease of a pharmaceutical composition comprising glutathione or a pharmaceutically acceptable salt thereof as an active ingredient.

또한, 본 발명은 글루타치온 또는 이의 약학적으로 허용가능한 염의 신장질환 예방 또는 치료 약제를 제조하기 위한 용도를 제공한다. In addition, the present invention provides a use of glutathione or a pharmaceutically acceptable salt thereof for preparing a drug for preventing or treating kidney disease.

본 발명자들은 사람 글루타치온을 GLA 돌연변이 신장 파브리병 오가노이드 모델에 처리한 결과, 글루타치온이 GLA-변이된 신장 파브리병 오가노이드 모델의 구조적 변형을 감소시키며, 족세포(podocytes) 또는 세뇨관 마커의 발현을 증가시키고, 세포 사멸을 감소시킴을 확인하였다. As a result of treating the human glutathione in the GLA-mutated kidney Fabry disease organoid model, the present inventors confirmed that glutathione reduced the structural deformation of the GLA-mutated kidney Fabry disease organoid model, increased the expression of podocytes or tubular markers, and decreased cell death.

따라서 본 발명의 글루타치온은 신장 파브리병을 포함한 다양한 신장 질환의 예방 또는 치료를 위하여 매우 유용하게 활용될 수 있을 것으로 기대된다. Therefore, glutathione of the present invention is expected to be very useful for the prevention or treatment of various renal diseases including renal Fabry disease.

도 1a는 인간 GLA-specific gRNA 서열을 나타낸 것이다.
도 1b는 클론 #5 및 클론 #9의 GLA 유전자 결실 부위를 나타낸 것이다.
도 1c는 GLA-넉아웃 인간 iPSC에서 클론 #5 및 클론 #9의 GLA 단백질 발현량을 웨스턴 블롯 결과로 나타낸 것이다.
도 1d는 GLA-넉아웃 인간 iPSC 유래 신장 오가노이드에서 클론 #5 및 클론 #9의 GLA 단백질 발현량을 웨스턴 블롯 결과로 나타낸 것이다.
도 2a는 GLA-넉아웃 인간 iPSC 유래 신장 오가노이드의 구조를 명시야 현미경으로 확인한 결과를 나타낸 것이다.
도 2b는 GLA-넉아웃 인간 iPSC 유래 신장 오가노이드의 구조를 PAS 염색으로 확인한 결과를 나타낸 것이다.
도 2c는 GLA-넉아웃 인간 iPSC 유래 신장 오가노이드의 구조를 전자 현미경으로 확인한 결과를 나타낸 것이다.
도 3a는 GLA 돌연변이 신장 오가노이드 및 GSH 처리된 GLA 돌연변이 신장오가노이드에서 글로보트리아오실세라마이드(Gb3), 족세포 마커(NPHS1) 및 근위세뇨관 마커(LTL)의 면역형광염색 결과를 나타낸 것이다. Scale bar = 50 μm
도 3b는 GLA 돌연변이 신장 오가노이드에서 GSH 처리에 따른 NPHS1, PODXL, ECAD 및 CDH16의 발현을 qPCR 및 qRT-PCR 분석한 결과를 나타낸 것이다. *, p<0.05, **, p<0.01, ***, p<0.001
도 3c는 세포자멸사 세포를 Tunel 염색한 결과를 나타낸 것이다. Scale bar = 50 μm
도 3d는 세포자멸사 세포를 백분율로 정량화한 결과를 나타낸 것이다. *, p<0.05, **, p<0.01, ***, p<0.001Figure 1a shows the human GLA-specific gRNA sequence.
Figure 1b shows the GLA gene deletion site of clone #5 and clone #9.
Figure 1c shows the GLA protein expression levels of clone #5 and clone #9 in GLA-knockout human iPSCs as a result of Western blotting.
1D shows the GLA protein expression levels of clone #5 and clone #9 in kidney organoids derived from GLA-knockout human iPSCs, as a result of Western blotting.
Figure 2a shows the results of confirming the structure of GLA-knockout human iPSC-derived kidney organoids under a bright field microscope.
2B shows the result of confirming the structure of kidney organoids derived from GLA-knockout human iPSCs by PAS staining.
Fig. 2c shows the results of electron microscopic examination of the structure of kidney organoids derived from GLA-knockout human iPSCs.
Figure 3a shows the results of immunofluorescence staining of globotriaosylceramide (Gb3), podocyte marker (NPHS1), and proximal tubule marker (LTL) in GLA mutant kidney organoids and GSH-treated GLA mutant kidney organoids. Scale bar = 50 µm
Figure 3b shows the results of qPCR and qRT-PCR analysis of the expression of NPHS1, PODXL, ECAD and CDH16 according to GSH treatment in GLA mutant kidney organoids. *, p<0.05, **, p<0.01, ***, p<0.001
Figure 3c shows the results of Tunel staining of apoptotic cells. Scale bar = 50 µm
Figure 3d shows the results of quantifying apoptotic cells in percentage. *, p<0.05, **, p<0.01, ***, p<0.001

이하 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 글루타치온 또는 이의 염을 유효성분으로 포함하는 신장질환 예방, 개선 또는 치료용 약학적 조성물, 및 식품 조성물을 제공한다. The present invention provides a pharmaceutical composition for preventing, improving or treating kidney disease, and a food composition comprising glutathione or a salt thereof as an active ingredient.

본 발명에서 사용되는 용어 "글루타치온(Glutathione, GSH)“이란, 글루타메이트(Glutamate), 시스테인(Cystein) 및 글라이신(Glycine)을 포함하는 트라이펩타이드(Tripeptide)로 강력한 항산화 특성, 독성 물질의 해독 특성, 면역력 강화 특성에 효과가 있는 것으로 알려져 있다. 본 발명의 글루타치온은 하기 화학식 1로 표시될 수 있으나, 이에 제한되는 것은 아니다.The term "Glutathione (GSH)" used in the present invention is a tripeptide including glutamate, cysteine, and glycine, and is known to have strong antioxidant properties, detoxification properties of toxic substances, and immunity enhancement properties. Glutathione of the present invention may be represented by the following formula (1), but is not limited thereto.

[화학식 1][Formula 1]

본 발명에서, 상기 신장질환은 신장 파브리병, 신장 섬유화, 당뇨병성 신증, 고혈압성 신증, 사구체 신염, 신우 신염, 간질성 신염, 루프스 신장염, 다낭성 신장질환, 및 신부전증으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the kidney disease may be at least one selected from the group consisting of renal Fabry disease, renal fibrosis, diabetic nephropathy, hypertensive nephropathy, glomerulonephritis, pyelonephritis, interstitial nephritis, lupus nephritis, polycystic kidney disease, and renal failure, but is not limited thereto.

본 발명에서, 상기 신장질환은 신장 파브리병일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the kidney disease may be renal Fabry disease, but is not limited thereto.

본 발명에서 사용되는 용어, "파브리병(Fabry disease)"은 alpha-galactosidase A(α-Gal A)라 불리는 효소의 결핍으로 발생하는 리소좀 저장 질환(Lysosomal storage disorders) 중 하나이다. 파브리병은 X-연관 열성 형질로 유전되며 주로 남성에게 나타나고, 여성의 경우 증상이 비교적 경미하게 나타난다. 증상은 주로 아동기 또는 청소년기에 시작되며, 성인기 동안에 서서히 진행된다. 그리고 남성 40,000명당 한 명의 비율로 발생하며, 전체인구에서는 117,000명당 한 명의 비율로 나타난다고 알려져 있다. α-Gal A의 결핍은 리소좀 내에 Gb3 (globotriaosylceramide)의 축적을 야기하며, 이로 인해 말초 신경병증, 피부, 신장 질환, 심근병증, 뇌졸중의 심각한 합병증을 야기한다.As used herein, the term "Fabry disease" is one of lysosomal storage disorders caused by a deficiency of an enzyme called alpha-galactosidase A (α-Gal A). Fabry disease is inherited as an X-linked recessive trait and appears mainly in males, with relatively mild symptoms in females. Symptoms usually begin in childhood or adolescence and progress slowly during adulthood. It is known to occur at a rate of 1 in 40,000 males and 1 in 117,000 in the total population. Deficiency of α-Gal A leads to accumulation of Gb3 (globotriaosylceramide) in lysosomes, resulting in serious complications such as peripheral neuropathy, skin and kidney disease, cardiomyopathy, and stroke.

또한, 본 발명에서, 상기 신장질환은 노화에 의한 만성 신장질환 또는 신장섬유화일 수 있으나, 이에 제한되는 것은 아니다.In addition, in the present invention, the kidney disease may be chronic kidney disease or kidney fibrosis due to aging, but is not limited thereto.

본 발명에서 사용되는 용어 "만성신장질환(Chronic kidney disease, CKD)"은 단백뇨가 지속적으로 나오거나 혈뇨와 같은 신장 손상의 증거가 있거나, 3개월 이상 지속적으로 신장 기능이 감소하는 상태를 의미한다. 만성 신부전(Chronic renal failure, CRF)은 신장 기능이 60% 이하로 떨어진 상태가 3개월 이상 지속될 때 만성 신부전이라고 한다. 자각증세로는 다뇨, 눈 주위와 하지가 부음, 몸이 나른함, 쉽게 피로해짐, 식욕이 없음, 구역질이 남, 피부의 가려움, 구취(암모니아 냄새의 증세)등이 있으며, 빈혈과 고혈압의 증세를 동반하며 어린이는 발육이 늦어지고 안색이 나빠지는 증세를 동반할 수 있다. As used herein, the term "chronic kidney disease (CKD)" refers to a condition in which proteinuria is continuously present, there is evidence of renal damage such as hematuria, or renal function is continuously reduced for more than 3 months. Chronic renal failure (CRF) is called chronic renal failure when renal function drops below 60% for more than 3 months. Subjective symptoms include polyuria, swelling around the eyes and lower extremities, lethargy, fatigue easily, no appetite, nausea, itchy skin, bad breath (symptoms of ammonia odor), accompanied by symptoms of anemia and high blood pressure, and children may experience delayed growth and poor complexion.

본 발명에서 사용되는 용어 "신장 섬유화"는 신장의 조직 및/또는 혈관이 단단하게 굳어지는 증상을 의미한다. As used herein, the term "renal fibrosis" refers to a condition in which renal tissues and/or blood vessels are hardened.

본 발명에서 사용되는 용어, "GLA(galactosidase alpha) 유전자"는 alpha-galactosidase A(α-Gal A) 효소를 암호화 하는 유전자를 의미한다.As used herein, the term "GLA (galactosidase alpha) gene" refers to a gene encoding an alpha-galactosidase A (α-Gal A) enzyme.

본 발명에서, 상기 글루타치온은 Gb3(Globotriaosylceramide) 발현 수준을 감소시키는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the glutathione may decrease the expression level of Gb3 (Globothriaosylceramide), but is not limited thereto.

본 발명에서, 상기 글루타치온은 NPHS1 또는 LTL 발현 수준을 증가시킬 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the glutathione may increase the expression level of NPHS1 or LTL, but is not limited thereto.

본 발명에서, 상기 글루타치온은 신장 기능 관련 마커 NPHS1, PODXL(Podocalyxin-like protein), ECAD(E-cadherin) 및 CDH16(Cadherin-16)로 이루어진 군으로부터 선택된 하나 이상의 발현 수준을 증가시킬 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the glutathione may increase the expression level of one or more selected from the group consisting of kidney function related markers NPHS1, PODXL (Podocalyxin-like protein), ECAD (E-cadherin) and CDH16 (Cadherin-16), but is not limited thereto.

본 발명에서, 상기 글루타치온은 신장 구조를 강화시키는 것을 특징으로 하는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the glutathione may be characterized in that it strengthens the renal structure, but is not limited thereto.

본 발명에서, 상기 글루타치온은 하기 증상으로 이루어진 군으로부터 선택된 하나 이상의 증상을 개선할 수 있으나, 이에 제한되는 것은 아니다:In the present invention, the glutathione may improve one or more symptoms selected from the group consisting of the following symptoms, but is not limited thereto:

세뇨관의 구조적 변화로 인한 세뇨관 세포의 감소; Reduction of tubular cells due to structural changes in tubules;

세뇨관의 구조적 변화로 인한 세뇨관 극성의 파괴;Disruption of tubular polarity due to structural changes in tubules;

세뇨관의 구조적 변화로 인한 족세포(podocyte) 손상; 및podocyte damage due to structural changes in tubules; and

세포 생존능 감소.reduced cell viability.

본 발명에서, 상기 글루타치온은 0.01 내지 100 mM, 0.01 내지 90 mM, 0.01 내지 80 mM, 0.01 내지 70 mM, 0.01 내지 60 mM, 0.01 내지 50 mM, 0.01 내지 40 mM, 0.01 내지 30 mM, 0.01 내지 20 mM, 0.01 내지 10 mM, 0.1 내지 100 mM, 0.1 내지 90 mM, 0.1 내지 70 mM, 0.1 내지 50 mM, 0.1 내지 30 mM, 0.1 내지 10 mM, 0.5 내지 10 mM, 1 내지 10 mM, 1 내지 8 mM, 1 내지 7 mM, 1 내지 6 mM, 1 내지 5 mM, 2 내지 8 mM, 2 내지 7 mM, 2 내지 6 mM, 2 내지 5 mM, 2 내지 4 mM, 또는 약 3 mM의 농도로 조성물에 포함될 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the glutathione is 0.01 to 100 mM, 0.01 to 90 mM, 0.01 to 80 mM, 0.01 to 70 mM, 0.01 to 60 mM, 0.01 to 50 mM, 0.01 to 40 mM, 0.01 to 30 mM, 0.01 to 20 mM, 0.01 to 10 mM, 0.1 to 100 mM, 0.1 to 90 mM, 0.1 to 70 mM, 0.1 to 50 mM, 0.1 to 30 mM, 0.1 to 10 mM, 0.5 to 10 mM, 1 to 10 mM, 1 to 8 mM, 1 to 7 mM, 1 to 6 mM, 1 to 5 mM, 2 to 8 mM, 2 to 7 mM, 2 to 6 mM, 2 to 5 mM, 2 to 4 mM, or may be included in the composition at a concentration of about 3 mM, but is not limited thereto.

본 발명은 또한, 글루타치온의 약학적으로 허용가능한 염을 유효성분으로 포함할 수 있다. 본 발명에서 용어, "약학적으로 허용 가능한 염"이란 약학적으로 허용되는 무기산, 유기산, 또는 염기로부터 유도된 염을 포함한다. The present invention may also include a pharmaceutically acceptable salt of glutathione as an active ingredient. As used herein, the term "pharmaceutically acceptable salt" includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases.

적합한 산의 예로는 염산, 브롬산, 황산, 질산, 과염소산, 푸마르산, 말레산, 인산, 글리콜산, 락트산, 살리실산, 숙신산, 톨루엔-p-설폰산, 타르타르산, 아세트산, 시트르산, 메탄설폰산, 포름산, 벤조산, 말론산, 글루콘산, 나프탈렌-2-설폰산, 벤젠설폰산 등을 들 수 있다. 산부가염은 통상의 방법, 예를 들면 화합물을 과량의 산 수용액에 용해시키고, 이 염을 메탄올, 에탄올, 아세톤 또는 아세토니트릴과 같은 수혼화성 유기 용매를 사용하여 침전시켜서 제조할 수 있다. 또한, 동몰량의 화합물 및 물 중의 산 또는 알코올을 가열하고 이어서 상기 혼합물을 증발시켜서 건조시키거나, 또는 석출된 염을 흡인 여과시켜 제조할 수 있다.Examples of suitable acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid, benzoic acid, malonic acid, gluconic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, and the like. Acid addition salts can be prepared by conventional methods, for example, by dissolving a compound in an aqueous solution of excess acid and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It can also be prepared by heating equimolar amounts of the compound and an acid or alcohol in water and then evaporating the mixture to dryness, or suction filtering the precipitated salt.

적합한 염기로부터 유도된 염은 나트륨, 칼륨 등의 알칼리 금속, 마그네슘 등의 알칼리 토금속, 및 암모늄 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 알칼리 금속 또는 알칼리 토금속염은, 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리토 금속 수산화물 용액 중에 용해하고, 비용해 화합물염을 여과한 후 여액을 증발, 건조시켜 얻을 수 있다. 이 때, 금속염으로서는 특히 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하며, 또한 이에 대응하는 은염은 알칼리 금속 또는 알칼리토 금속염을 적당한 은염(예, 질산은)과 반응시켜 얻을 수 있다.Salts derived from suitable bases may include, but are not limited to, alkali metals such as sodium and potassium, alkaline earth metals such as magnesium, and ammonium. An alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving a compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. At this time, as the metal salt, it is particularly suitable for pharmaceutical purposes to prepare a sodium, potassium or calcium salt, and the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).

본 발명의 조성물 내의 상기 글루타치온의 함량은 질환의 증상, 증상의 진행 정도, 환자의 상태 등에 따라서 적절히 조절 가능하며, 예컨대, 전체 조성물 중량을 기준으로 0.0001 내지 99.9중량%, 또는 0.001 내지 50중량%일 수 있으나, 이에 한정되는 것은 아니다. 상기 함량비는 용매를 제거한 건조량을 기준으로 한 값이다.The content of the glutathione in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the progress of the symptoms, the condition of the patient, etc., and may be, for example, 0.0001 to 99.9% by weight, or 0.001 to 50% by weight based on the total weight of the composition, but is not limited thereto. The content ratio is a value based on the dry amount after removing the solvent.

본 발명에 따른 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 부형제는 예를 들어, 희석제, 결합제, 붕해제, 활택제, 흡착제, 보습제, 필름-코팅 물질, 및 제어방출첨가제로 이루어진 군으로부터 선택된 하나 이상일 수 있다. The pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions. The excipient may be, for example, one or more selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a moisturizer, a film-coating material, and a controlled release additive.

본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 서방형 과립제, 장용과립제, 액제, 점안제, 엘실릭제, 유제, 현탁액제, 주정제, 트로키제, 방향수제, 리모나아데제, 정제, 서방형정제, 장용정제, 설하정, 경질캅셀제, 연질캅셀제, 서방캅셀제, 장용캅셀제, 환제, 틴크제, 연조엑스제, 건조엑스제, 유동엑스제, 주사제, 캡슐제, 관류액, 경고제, 로션제, 파스타제, 분무제, 흡입제, 패취제, 멸균주사용액, 또는 에어로졸 등의 외용제 등의 형태로 제형화하여 사용될 수 있으며, 상기 외용제는 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 등의 제형을 가질 수 있다. The pharmaceutical compositions according to the present invention are powders, granules, sustained-release granules, enteric granules, solutions, eye drops, elsilic agents, emulsions, suspensions, spirits, troches, perfumes, limonadese, tablets, sustained-release tablets, enteric-coated tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, and soft drinks, respectively, according to conventional methods. It can be formulated and used in the form of external preparations such as extracts, dry extracts, fluid extracts, injections, capsules, irrigation solutions, warning agents, lotions, pastes, sprays, inhalants, patches, sterilized injection solutions, or aerosols.

본 발명에 따른 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, and propylhydroxy. hydroxybenzoate, talc, magnesium stearate and mineral oil.

제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

본 발명에 따른 정제, 산제, 과립제, 캡슐제, 환제, 트로키제의 첨가제로 옥수수전분, 감자전분, 밀전분, 유당, 백당, 포도당, 과당, 디-만니톨, 침강탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 미결정셀룰로오스, 덱스트린, 알긴산나트륨, 메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 카올린, 요소, 콜로이드성실리카겔, 히드록시프로필스타치, 히드록시프로필메칠셀룰로오스(HPMC), HPMC 1928, HPMC 2208, HPMC 2906, HPMC 2910, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤 등 부형제; 젤라틴, 아라비아고무, 에탄올, 한천가루, 초산프탈산셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스칼슘, 포도당, 정제수, 카제인나트륨, 글리세린, 스테아린산, 카르복시메칠셀룰로오스나트륨, 메칠셀룰로오스나트륨, 메칠셀룰로오스, 미결정셀룰로오스, 덱스트린, 히드록시셀룰로오스, 히드록시프로필스타치, 히드록시메칠셀룰로오스, 정제쉘락, 전분호, 히드록시프로필셀룰로오스, 히드록시프로필메칠셀룰로오스, 폴리비닐알코올, 폴리비닐피롤리돈 등의 결합제가 사용될 수 있으며, 히드록시프로필메칠셀룰로오스, 옥수수전분, 한천가루, 메칠셀룰로오스, 벤토나이트, 히드록시프로필스타치, 카르복시메칠셀룰로오스나트륨, 알긴산나트륨, 카르복시메칠셀룰로오스칼슘, 구연산칼슘, 라우릴황산나트륨, 무수규산, 1-히드록시프로필셀룰로오스, 덱스트란, 이온교환수지, 초산폴리비닐, 포름알데히드처리 카제인 및 젤라틴, 알긴산, 아밀로오스, 구아르고무(Guar gum), 중조, 폴리비닐피롤리돈, 인산칼슘, 겔화전분, 아라비아고무, 아밀로펙틴, 펙틴, 폴리인산나트륨, 에칠셀룰로오스, 백당, 규산마그네슘알루미늄, 디-소르비톨액, 경질무수규산 등 붕해제; 스테아린산칼슘, 스테아린산마그네슘, 스테아린산, 수소화식물유(Hydrogenated vegetable oil), 탈크, 석송자, 카올린, 바셀린, 스테아린산나트륨, 카카오지, 살리실산나트륨, 살리실산마그네슘, 폴리에칠렌글리콜(PEG) 4000, PEG 6000, 유동파라핀, 수소첨가대두유(Lubri wax), 스테아린산알루미늄, 스테아린산아연, 라우릴황산나트륨, 산화마그네슘, 마크로골(Macrogol), 합성규산알루미늄, 무수규산, 고급지방산, 고급알코올, 실리콘유, 파라핀유, 폴리에칠렌글리콜지방산에테르, 전분, 염화나트륨, 초산나트륨, 올레인산나트륨, dl-로이신, 경질무수규산 등의 활택제;가 사용될 수 있다.Corn starch, potato starch, wheat starch, lactose, white sugar, glucose, fructose, D-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, calcium monohydrogen phosphate, calcium sulfate, sodium chloride, sodium hydrogen carbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methyl cellulose, carboxymethyl cellulose sodium, kaol excipients such as phosphorus, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropylmethylcellulose (HPMC), HPMC 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, and Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose phthalate acetate, carboxymethylcellulose, calcium carboxymethylcellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethylcellulose, sodium methylcellulose, methylcellulose, microcrystalline cellulose, dextrin, hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, purified shellac, starch starch, hydroxypropylcellulose, hydroxypropylmethyl Binders such as cellulose, polyvinyl alcohol, and polyvinylpyrrolidone may be used, and hydroxypropyl methyl cellulose, corn starch, agar powder, methyl cellulose, bentonite, hydroxypropyl starch, sodium carboxymethyl cellulose, sodium alginate, calcium carboxymethyl cellulose, calcium citrate, sodium lauryl sulfate, silicic anhydride, 1-hydroxypropyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde disintegrants such as hydrotreated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, amylopectin, pectin, sodium polyphosphate, ethyl cellulose, sucrose, magnesium aluminum silicate, di-sorbitol liquid, light anhydrous silicic acid; Calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopod, kaolin, petrolatum, sodium stearate, cacao butter, sodium salicylate, magnesium salicylate, polyethylene glycol (PEG) 4000, PEG 6000, liquid paraffin, hydrogenated soybean oil (Lubri wax), aluminum stearate, Lubricants such as zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, silicic anhydride, higher fatty acid, higher alcohol, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, starch, sodium chloride, sodium acetate, sodium oleate, dl-leucine, light anhydrous silicic acid; can be used.

본 발명에 따른 액제의 첨가제로는 물, 묽은 염산, 묽은 황산, 구연산나트륨, 모노스테아린산슈크로스류, 폴리옥시에칠렌소르비톨지방산에스텔류(트윈에스텔), 폴리옥시에칠렌모노알킬에텔류, 라놀린에텔류, 라놀린에스텔류, 초산, 염산, 암모니아수, 탄산암모늄, 수산화칼륨, 수산화나트륨, 프롤아민, 폴리비닐피롤리돈, 에칠셀룰로오스, 카르복시메칠셀룰로오스나트륨 등이 사용될 수 있다.As the additives for the liquid formulation according to the present invention, water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, sucrose monostearate, polyoxyethylene sorbitol fatty acid esters (twin esters), polyoxyethylene monoalkyl ethers, lanolin ethers, lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, carr boxymethylcellulose sodium and the like can be used.

본 발명에 따른 시럽제에는 백당의 용액, 다른 당류 혹은 감미제 등이 사용될 수 있으며, 필요에 따라 방향제, 착색제, 보존제, 안정제, 현탁화제, 유화제, 점조제 등이 사용될 수 있다.In the syrup according to the present invention, a solution of white sugar, other sugars, or a sweetener may be used, and aromatics, coloring agents, preservatives, stabilizers, suspending agents, emulsifiers, thickeners, etc. may be used as necessary.

본 발명에 따른 유제에는 정제수가 사용될 수 있으며, 필요에 따라 유화제, 보존제, 안정제, 방향제 등이 사용될 수 있다.Purified water may be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. may be used as needed.

본 발명에 따른 현탁제에는 아카시아, 트라가칸타, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 미결정셀룰로오스, 알긴산나트륨, 히드록시프로필메칠셀룰로오스(HPMC), HPMC 1828, HPMC 2906, HPMC 2910 등 현탁화제가 사용될 수 있으며, 필요에 따라 계면활성제, 보존제, 안정제, 착색제, 방향제가 사용될 수 있다.Acacia, tragacantha, methyl cellulose, carboxymethyl cellulose, carboxymethyl cellulose sodium, microcrystalline cellulose, sodium alginate, hydroxypropylmethyl cellulose (HPMC), HPMC 1828, HPMC 2906, HPMC 2910, etc. suspending agents may be used in the suspension agent according to the present invention, and surfactants, preservatives, stabilizers, colorants, and fragrances may be used if necessary.

본 발명에 따른 주사제에는 주사용 증류수, 0.9%염화나트륨주사액, 링겔주사액, 덱스트로스주사액, 덱스트로스+염화나트륨주사액, 피이지(PEG), 락테이티드 링겔주사액, 에탄올, 프로필렌글리콜, 비휘발성유-참기름, 면실유, 낙화생유, 콩기름, 옥수수기름, 올레인산에칠, 미리스트산 이소프로필, 안식향산벤젠과 같은 용제; 안식향산나트륨, 살리실산나트륨, 초산나트륨, 요소, 우레탄, 모노에칠아세트아마이드, 부타졸리딘, 프로필렌글리콜, 트윈류, 니정틴산아미드, 헥사민, 디메칠아세트아마이드와 같은 용해보조제; 약산 및 그 염(초산과 초산나트륨), 약염기 및 그 염(암모니아 및 초산암모니움), 유기화합물, 단백질, 알부민, 펩 톤, 검류와 같은 완충제; 염화나트륨과 같은 등장화제; 중아황산나트륨(NaHSO₃) 이산화탄소가스, 메타중아황산나트륨(Na₂S₂O₅), 아황산나트륨(Na₂SO₃), 질소가스(N₂), 에칠렌디아민테트라초산과 같은 안정제; 소디움비설파이드 0.1%, 소디움포름알데히드 설폭실레이트, 치오우레아, 에칠렌디아민테트라초산디나트륨, 아세톤소디움비설파이트와 같은 황산화제; 벤질알코올, 클로로부탄올, 염산프로카인, 포도당, 글루콘산칼슘과 같은 무통화제; 시엠시나트륨, 알긴산나트륨, 트윈 80, 모노스테아린산알루미늄과 같은 현탁화제를 포함할 수 있다.The injection according to the present invention includes injected distilled water, 0.9%sodium chloride liquid, ring gel injection, dextros+sodium chloride injection, fiji (PEG), lactated ring gel injection, ethanol, propylene glycol Sorghum oil, oleic acid, mirist isopropyl, and sabbatic benzene; solubilizing agents such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, twins, nijuntinamide, hexamine, and dimethylacetamide; buffers such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumins, peptones, and gums; tonicity agents such as sodium chloride; Stabilizers such as sodium bisulfite (NaHSO ₃ ) carbon dioxide gas, sodium metabisulfite (Na ₂ S ₂ O ₅ ), sodium sulfite (Na ₂ SO ₃ ), nitrogen gas (N ₂ ), ethylenediaminetetraacetic acid; Sulfating agents such as sodium bisulfide 0.1%, sodium formaldehyde sulfoxylate, thiourea, ethylenediamine disodium tetraacetate, acetone sodium bisulfite; analgesics such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; Suspending agents such as Siemesis sodium, sodium alginate, Tween 80, aluminum monostearate may be included.

본 발명에 따른 좌제에는 카카오지, 라놀린, 위텝솔, 폴리에틸렌글리콜, 글리세로젤라틴, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 스테아린산과 올레인산의 혼합물, 수바날(Subanal), 면실유, 낙화생유, 야자유, 카카오버터+콜레스테롤, 레시틴, 라네트왁스, 모노스테아린산글리세롤, 트윈 또는 스판, 임하우젠(Imhausen), 모놀렌(모노스테아린산프로필렌글리콜), 글리세린, 아뎁스솔리두스(Adeps solidus), 부티룸 태고-G(Buytyrum Tego-G), 세베스파마 16 (Cebes Pharma 16), 헥사라이드베이스 95, 코토마(Cotomar), 히드록코테 SP, S-70-XXA, S-70-XX75(S-70-XX95), 히드록코테(Hydrokote) 25, 히드록코테 711, 이드로포스탈 (Idropostal), 마사에스트라리움(Massa estrarium, A, AS, B, C, D, E, I, T), 마사-MF, 마수폴, 마수폴-15, 네오수포스탈-엔, 파라마운드-B, 수포시로(OSI, OSIX, A, B, C, D, H, L), 좌제기제 IV 타입 (AB, B, A, BC, BBG, E, BGF, C, D, 299), 수포스탈 (N, Es), 웨코비 (W, R, S, M ,Fs), 테제스터 트리글리세라이드 기제 (TG-95, MA, 57)와 같은 기제가 사용될 수 있다.The suppository according to the present invention includes cacao butter, lanolin, witapsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cacao butter + cholesterol, lecithin, lanet wax, glycerol monostearate, twin or span, Imhausen, monolen (monosteol) Propylene Glycol Phosphate), Glycerin, Adeps Solidus, Buytyrum Tego-G, Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydrocote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hydrocote (Hydr okote) 25, Hydrocote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Masupol, Masupol-15, Neosupostal-N, Paramound-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), suppository type IV (AB, B , A, BC, BBG, E, BGF, C, D, 299), Supostal (N, Es), Wecobi (W, R, S, M, Fs), Testester triglyceride bases (TG-95, MA, 57).

경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations are prepared by mixing the extract with at least one or more excipients, for example, starch, calcium carbonate, sucrose or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.

본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, drug activity, sensitivity to the drug, administration time, administration route and discharge rate, treatment period, factors including concurrently used drugs, and other factors well known in the medical field.

본 발명에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 본 발명이 속하는 기술분야에 통상의 기술자에 의해 용이하게 결정될 수 있다.The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention belongs.

본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구 복용, 피하 주사, 복강 투여, 정맥 주사, 근육 주사, 척수 주위 공간(경막내) 주사, 설하 투여, 볼점막 투여, 직장 내 삽입, 질 내 삽입, 안구 투여, 귀 투여, 비강 투여, 흡입, 입 또는 코를 통한 분무, 피부 투여, 경피 투여 등에 따라 투여될 수 있다.The pharmaceutical composition of the present invention can be administered to a subject by various routes. All modes of administration can be envisaged, for example, oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal mucosal administration, rectal insertion, vaginal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, and the like.

본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별, 체중 및 질환의 중등도 등의 여러 관련 인자와 함께 활성성분인 약물의 종류에 따라 결정된다.The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient together with various related factors such as the disease to be treated, the route of administration, the age, sex, weight and severity of the disease of the patient.

본 발명에서 사용되는 용어, "개체"는 신장질환의 예방 또는 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는, 인간 또는 비-인간인 영장류, 생쥐(mouse), 개, 고양이, 말, 및 소 등의 포유류를 의미한다.As used herein, the term "individual" refers to a subject in need of prevention or treatment of a kidney disease, and more specifically, to a mammal such as a human or non-human primate, mouse, dog, cat, horse, and cow.

본 발명에서 사용되는 용어, "투여"는 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.As used herein, the term "administration" means providing a given composition of the present invention to a subject by any suitable method.

본 발명에서 “예방”이란 신장질환의 발병을 억제하거나 지연시키는 모든 행위를 의미하고, “치료”란 본 발명에 따른 약학적 조성물의 투여에 의해 신장질환과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, “개선”이란 본 발명에 따른 조성물의 투여에 의해 신장질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.In the present invention, “prevention” means any action that suppresses or delays the onset of kidney disease, and “treatment” means any action that improves or beneficially changes kidney disease and its resulting metabolic abnormalities by administration of the pharmaceutical composition according to the present invention, and “improvement” means any action that reduces parameters related to kidney disease, for example, the severity of symptoms, by administration of the composition according to the present invention.

또한, 본 발명은 글루타치온 또는 이의 식품학적으로 허용가능한 염을 유효성분으로 포함하는 식품 조성물을 제공한다.In addition, the present invention provides a food composition comprising glutathione or a food chemically acceptable salt thereof as an active ingredient.

본 발명에서 용어, “식품학적으로 허용 가능한 염”이란 식품학적으로 허용되는 유기산, 무기산, 또는 염기로부터 유도된 염을 포함한다.In the present invention, the term "acceptable salt in food science" includes salts derived from organic acids, inorganic acids, or bases acceptable in food science.

본 발명의 글루타치온을 식품 첨가물로 사용할 경우, 상기 글루타치온을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시 본 발명의 글루타치온은 원료에 대하여 15 중량% 이하, 또는 10 중량% 이하의 양으로 첨가될 수 있다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.When glutathione of the present invention is used as a food additive, the glutathione may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment). In general, glutathione of the present invention may be added in an amount of 15% by weight or less, or 10% by weight or less based on the raw material when preparing food or beverage. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount greater than the above range.

상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다.There is no particular limitation on the type of food. Examples of foods to which the substance can be added include meat, sausages, bread, chocolates, candies, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages and vitamin complexes, and includes all health functional foods in a conventional sense.

본 발명에 따른 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당 및 과당과 같은 모노사카라이드, 말토오스 및 수크로오스와 같은 디사카라이드, 덱스트린 및 시클로덱스트린과 같은 폴리사카라이드, 및 자일리톨, 소르비톨 및 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 mL당 일반적으로 약 0.01-0.20g, 또는 약 0.04-0.10g 이다.The health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as additional components, like conventional beverages. The aforementioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrins and cyclodextrins, and sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetener, natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used. The proportion of the natural carbohydrate is generally about 0.01-0.20 g, or about 0.04-0.10 g per 100 mL of the composition of the present invention.

상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01-0.20 중량부의 범위에서 선택되는 것이 일반적이다.In addition to the above, the composition of the present invention may contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like. In addition, the composition of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The ratio of these additives is not critical, but is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention.

이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, a preferred embodiment is presented to aid understanding of the present invention. However, the following examples are provided to more easily understand the present invention, and the content of the present invention is not limited by the following examples.

[실시예][Example]

실험방법Experiment method

GLA 돌연변이 신장 오가노이드의 생성Generation of GLA mutant kidney organoids

먼저, GLA 넉아웃 인간 iPSC를 생성하기 위하여, CRISPR/Cas9 All-in-one 플라스미드를 구성하고 GLA 돌연변이 클론을 생성하였다. GLA gRNA 서열은 다음과 같다: TTGGCAAGGACGCCTACCAT(서열번호 1). Cas9 nuclease 리포터 벡터로 올리고 어닐링 및 서브클로닝을 지침에 따라 수행하였다. GLA에 대한 gRNA를 포함하는 All-in-one Cas9 nuclease 리포터 벡터를 iPSC(CMC11)로 전기 천공하여 형질감염 시키고, 이들 세포를 7-10일 동안 배양하였다. GFP-발현 세포를 FACS에 의해 분류하고, 96-well에 단일 세포로서 시딩한 후 순수한 클론이 될 때까지 배양하였다. GFP를 발현하는 총 6개의 클론을 수득하고 Sanger 시퀀싱에 의해 분석하였다. First, in order to generate GLA knockout human iPSCs, a CRISPR/Cas9 All-in-one plasmid was constructed and GLA mutant clones were generated. The GLA gRNA sequence is: TTGGCAAGGACGCCTACCAT (SEQ ID NO: 1). Oligo annealing and subcloning into the Cas9 nuclease reporter vector was performed according to the instructions. The all-in-one Cas9 nuclease reporter vector containing the gRNA for GLA was electroporated into iPSCs (CMC11) and transfected, and these cells were cultured for 7-10 days. GFP-expressing cells were sorted by FACS, seeded as single cells in 96-wells and cultured until pure clones. A total of 6 clones expressing GFP were obtained and analyzed by Sanger sequencing.

그 결과, 클론 #5에서, GLA 단백질은 대조 GLA 단백질과 비교하여 GLA 항체에 의해 검출되지 않았다. 한편, 클론 #9는 대조군보다 낮은 수준의 GLA 단백질을 나타냈다(도 1c 및 도 1d 참조). 상기 결과에 따라, 클론 #5에서 GLA 단백질의 소멸은 조기 정지 코돈으로 인한 것으로 예측되고, 클론 #9에서는 mRNA 발현이 적어 GLA 단백질의 양이 적은 것으로 예측되어 클론 #9를 선별하였다. 클론 #9의 결실 부위 염기서열은 다음과 같다: CCTACCATG(서열번호 2). 따라서, CRISP/Cas9 게놈 편집 시스템을 사용하여 성공적으로 GLA 넉아웃 iPSC 세포주가 생성 된 것을 확인하였다.As a result, in clone #5, the GLA protein was not detected by the GLA antibody compared to the control GLA protein. On the other hand, clone #9 showed a lower level of GLA protein than the control group (see Figs. 1c and 1d). According to the above results, the disappearance of GLA protein in clone #5 was predicted to be due to the premature stop codon, and the amount of GLA protein was predicted to be low in clone #9 because mRNA expression was low in clone #9, so clone #9 was selected. The nucleotide sequence of the deletion site of clone #9 is as follows: CCTACCATG (SEQ ID NO: 2). Therefore, it was confirmed that a GLA knockout iPSC cell line was successfully generated using the CRISP/Cas9 genome editing system.

iPSC 세포는 계대수 30과 60 사이인 것을 사용하였다. 신장 오가노이드 분화를 위하여, GLA 넉아웃된 인간 iPSC를 3% GelTrex(Thermo Fisher Scientific)로 코팅된 유리 플레이트(LabTek)상에서 mTeSR1 배지(Stem Cell Technologies) + 10 μM Y27632(LC Laboratories)로 24-well 플레이트의 5,000 cells/well의 밀도로 플레이팅 하였다(-3일). 배지는 1.5 % GelTrex in mTeSR1(-2일), mTeSR1(-1일), RPMI(Thermo Fisher Scientific) + 12 μM CHIR99021(Tocris)(0일), 또는 RPMI + B27 supplement(Thermo Fisher Scientific)(1.5일)의 순서로 교환하고, 세포는 2-3일마다 공급하여 신장 오가노이드 분화를 촉진시켰다. 오가노이드는 18일째에 NOD-SCID 마우스에 고정시키거나 이식하였다. 상기 방법에 따라 제작된 오가노이드의 특징 및 신장 파브리병 모델로서의 사용 가능성은 대한민국 출원번호 제10-2020-0056875호에 보다 자세히 설명되어 있다.iPSC cells between passage numbers 30 and 60 were used. For kidney organoid differentiation, human iPSCs knocked out of GLA were plated in mTeSR1 medium (Stem Cell Technologies) + 10 μM Y27632 (LC Laboratories) on glass plates (LabTek) coated with 3% GelTrex (Thermo Fisher Scientific) at a density of 5,000 cells/well in a 24-well plate (-3 days). The medium was changed in the order of 1.5% GelTrex in mTeSR1 (day -2), mTeSR1 (day -1), RPMI (Thermo Fisher Scientific) + 12 μM CHIR99021 (Tocris) (day 0), or RPMI + B27 supplement (Thermo Fisher Scientific) (day 1.5), and cells were supplied every 2-3 days to promote kidney organoid differentiation. Organoids were fixed or transplanted into NOD-SCID mice on day 18. The characteristics of organoids prepared according to the above method and the possibility of using them as a renal Fabry disease model are described in detail in Korean Application No. 10-2020-0056875.

상기 방법에 따라 제작된 GLA-넉아웃 인간 iPSC 유래 신장 오가노이드의 구조를 명시야 현미경, 전자현미경 및 PAS 염색으로 확인하였다. The structure of kidney organoids derived from GLA-knockout human iPSCs prepared according to the above method was confirmed by bright field microscopy, electron microscopy, and PAS staining.

그 결과, 야생형 인간 iPSC(CMC11) 및 GLA-넉아웃 인간 iPSC(GLA9)는 18일째 신장 오가노이드로 분화되었고(도 2a 참조), 분화된 GLA-넉아웃 신장 오가노이드는 apoptotic 세포 사멸을 갖는 구조로 변형된 것을 확인하였다(도 2b 참조). 또한, GLA-넉아웃 신장 오가노이드를 전자 현미경으로 확인한 결과, 족세포 및 세뇨관 상피세포에서 electron-dense deposition이 광범위하게 관찰되며 파브리병의 특징적인 병리현상인 Zebra body가 관찰되고, 또한 족세포 분리 및 세뇨관 상피세포의 공포화(vacuolation)와 같은 구조적 손상이 관찰되는 것을 확인하였다(도 2c 참조). 이는 인간 파브리병에 보이는 병리 현상과 일치하였는 바, 본 발명자들은 상기 방법에 의해 제조된 신장 파브리병 오가노이드를 사용하여 글루타치온의 치료 효과를 확인하였다.As a result, wild-type human iPSCs (CMC11) and GLA-knockout human iPSCs (GLA9) were differentiated into kidney organoids on day 18 (see Fig. 2a), and it was confirmed that the differentiated GLA-knockout kidney organoids were transformed into structures with apoptotic cell death (see Fig. 2b). In addition, as a result of examining the GLA-knockout kidney organoids with an electron microscope, it was confirmed that electron-dense deposition was extensively observed in podocytes and tubular epithelial cells, zebra bodies, a characteristic pathology of Fabry disease, and structural damage such as podocyte separation and vacuolation of tubular epithelial cells were observed (see FIG. 2c). Since this was consistent with the pathological phenomenon seen in human Fabry disease, the present inventors confirmed the therapeutic effect of glutathione using the renal Fabry disease organoids prepared by the above method.

면역형광분석Immunofluorescence analysis

오가노이드는 18일 차에 고정시켰다. 고정을 위해 동일한 부피의 PBS (Thermo Fisher Scientific) + 8% 파라포름알데히드(Electron Microscopy Sciences)를 15분 동안 배지에 첨가한 후 샘플을 PBS로 3회 세척하였다. 고정된 오가노이드 배지는 5% 당나귀 혈청(Millipore) + 0.3% Triton-X-100/PBS로 차단하였고, 3% 소 혈청 알부민(Sigma) + 1차 항체가 있는 PBS에서 밤새 배양하고, 세척한 후, AlexaFluor 2차 항체(Invitrogen)와 함께 배양하고, 세척한 후, DAPI로 염색하거나 Vectashield H-1000에 장착하였다. 그리고 Zeiss LSM 510 공초점 현미경(Carl Zeiss, Germany) 및 LSM 510 version 2.02 소프트웨어를 사용하여 이미지를 획득하였다. 1차 항체는 다음 종류가 사용되었다 : 항-Gb3 (TCI chemicals A2506, 1:1000 dilution), 항-LTL (Vector Labs FL-1321, 1:1000 dilution) 및 항-NPHS1 (R&D AF4269, 1:1000). Organoids were fixed on day 18. For fixation, an equal volume of PBS (Thermo Fisher Scientific) + 8% paraformaldehyde (Electron Microscopy Sciences) was added to the medium for 15 minutes, and then the samples were washed three times with PBS. The fixed organoid medium was blocked with 5% donkey serum (Millipore) + 0.3% Triton-X-100/PBS, incubated overnight in PBS with 3% bovine serum albumin (Sigma) + primary antibody, washed, incubated with AlexaFluor secondary antibody (Invitrogen), washed, then stained with DAPI or mounted on Vectashield H-1000. And images were acquired using a Zeiss LSM 510 confocal microscope (Carl Zeiss, Germany) and LSM 510 version 2.02 software. The following types of primary antibodies were used: anti-Gb3 (TCI chemicals A2506, 1:1000 dilution), anti-LTL (Vector Labs FL-1321, 1:1000 dilution) and anti-NPHS1 (R&D AF4269, 1:1000).

TUNEL 염색TUNEL staining

제조업체의 지침에 따라 상용 키트(Millipore, Billerica, MA, USA)를 사용하여 TUNEL 염색을 수행하였다.TUNEL staining was performed using a commercial kit (Millipore, Billerica, MA, USA) according to the manufacturer's instructions.

qRT-PCRqRT-PCR

NucleoSpin RNA/Protein 컬럼 (Macherey-Nagel)을 사용하여 iPSC 클론 및 신장 오가노이드에서 RNA를 추출하고 제조업체의 프로토콜에 따라 M-MLV 역전사 효소 (Promega)로 역전사했다. 상보적 DNA는 SYBR Green 및 표적 유전자용 프라이머와 혼합하였다. 모든 qRT-PCR은 삼중으로 수행되었으며 상대적 mRNA 발현 수준은 2^-ΔΔCt 방법을 사용하여 결정하였다.RNA was extracted from iPSC clones and kidney organoids using NucleoSpin RNA/Protein columns (Macherey-Nagel) and reverse transcribed with M-MLV reverse transcriptase (Promega) according to the manufacturer's protocol. Complementary DNA was mixed with SYBR Green and primers for the target gene. All qRT-PCR was performed in triplicate and relative mRNA expression levels were determined using the 2 ^-ΔΔCt method.

사용한 프라이머 서열은 하기 표 1에 기재하였다.Primer sequences used are listed in Table 1 below.

PRIMERPRIMER Forward (5’->3’)Forward (5’->3’) Reverse (5’->3’)Reverse (5’->3’) NPHS1NPHS1 GGCTCCCAGCAGAAACTCTTGGCTCCCAGCAGAAACTCTT CACAGACCAGCAACTGCCTACACAGACCAGCAACTGCCTA PODXLPODXL GATAAGTGCGGCATACGGCTGATAAGTGCGGCATACGGCT GCTCGTACACATCCTTGGCAGCTCGTACACATCCTTGGCA ECADECAD CGAGAGCTACACGTTCAGGCGAGAGCTACACGTTCAGG GGGTGTCGAGGGAAAAATAGGGGGTGTCGAGGGAAAAAATAGG PDGFRBPDGFRB TGCAGACATCGAGTCCTCCAACTGCAGACATCGAGTCCTCCAAC GCTTAGCACTGGAGACTCGTTGGCTTAGCACTGGAGACTCGTTG CDH16CDH16 CCTCATCCTCATTTTCACCCCTCATCCCTCATTTTCACC GGGCTTCTACTCTGTCCTGGGGCTTCTACTCTGTCCTG GAPDHGAPDH AGGGCTGCTTTTAACTCTGGTAGGGCTGCTTTTAACTCTGGT CCCCACTTGATTTTGGAGGGACCCCACTTGATTTTGGAGGGA

실시예 1. 글루타치온(Glutathione, GSH)의 신장 파브리병 오가노이드의 구조적 및 기능적 개선 효과 확인Example 1. Confirmation of structural and functional improvement effects of glutathione (GSH) on renal Fabry disease organoids

GSH 처리에 따른 GLA 돌연변이 신장 오가노이드의 구조적 및 기능적 개선 효과를 확인하기 위하여, 파브리병 또는 신장 기능과 관련된 다양한 마커의 발현 및 조직 이미지를 관찰하였다.In order to confirm the structural and functional improvement effects of GLA mutant kidney organoids by GSH treatment, expression of various markers related to Fabry disease or kidney function and tissue images were observed.

파브리병은 리소좀에 존재하는 가수분해효소인 GLA의 활성 결여 및 부족으로 인해 글리코스핑고리피드의 대사 경로에 결함이 초래되고 글로보트리아오실세라마이드(Gb3)가 다양한 조직과 세포의 리소좀에 축적되어 임상 증상이 나타난다. In Fabry disease, the lack of activity of GLA, a hydrolase present in lysosomes, causes a defect in the metabolic pathway of glycosphingolipids, and globotriaosylceramide (Gb3) accumulates in lysosomes of various tissues and cells, resulting in clinical symptoms.

도 3a에 나타난 바와 같이, 신장 파브리병 오가노이드에 GSH를 처리한 결과, GLA 돌연변이에 의해 증가된 Gb3을 유의하게 감소시키며, As shown in Figure 3a, as a result of GSH treatment of renal Fabry disease organoids, Gb3 increased by GLA mutation was significantly reduced,

신장 구조 관련 세포 마커인 NPHS1 및 근위세뇨관 마커인 LTL(Lotus Tetragonolobus Lectin)이 유의하게 증가됨을 확인하였다. 이는 GSH가 신장 세뇨관 구조를 강화시킬 뿐만 아니라, 파브리병을 개선함을 나타내는 결과이다.It was confirmed that NPHS1, a cell marker related to renal structure, and Lotus Tetragonolobus Lectin (LTL), a proximal tubule marker, were significantly increased. This is a result indicating that GSH not only strengthens the renal tubular structure, but also improves Fabry disease.

또한, 도 3b에 나타난 바와 같이, 신장 기능 관련 마커인 NPHS1, PODXL(Podocalyxin-like protein), ECAD(E-cadherin) 및 CDH16(Cadherin-16) 수준이 GSH 처리에 따라 유의하게 증가함을 확인하였다. 이는 GSH가 신장 기능 및 신장 구조를 강화시킴을 나타내는 결과이다.In addition, as shown in FIG. 3B, it was confirmed that the levels of renal function-related markers, NPHS1, Podocalyxin-like protein (PODXL), E-cadherin (ECAD), and Cadherin-16 (CDH16), were significantly increased by GSH treatment. This result indicates that GSH enhances renal function and renal structure.

또한, 도 3c 및 도 3d에 나타난 바와 같이, 세포자멸사(apoptotic) 세포가 GSH 처리에 따라 유의하게 감소함을 확인하였다.In addition, as shown in Figures 3c and 3d, it was confirmed that apoptotic cells were significantly reduced by GSH treatment.

종합하면, 글루타치온은 GLA-변이된 신장 오가노이드에서의 Gb3 수준을 감소시키고, 신장의 구조적 변형을 감소시키며, 족세포(podocytes) 또는 세뇨관 마커의 발현을 증가시키고, 세포 사멸을 감소시킴을 확인하였는 바, 신장 파브리병을 포함한 다양한 신장 질환의 치료제로서 유용하게 사용될 것으로 기대된다.Taken together, it was confirmed that glutathione reduces the level of Gb3 in GLA-mutated kidney organoids, reduces structural deformation of the kidney, increases the expression of podocytes or tubular markers, and reduces cell death. Therefore, it is expected to be useful as a therapeutic agent for various renal diseases including renal Fabry disease.

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.The above description of the present invention is for illustrative purposes, and those skilled in the art may understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting.

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Pharmaceutical composition for treating kidney disease comprising glutathione as an active ingredient <130> MP21-042 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GLA gRNA <400> 1 ttggcaagga cgcctaccat 20 <210> 2 <211> 9 <212> DNA <213> Artificial Sequence <220> <223> clone 9 <400> 2 cctaccatg 9 <110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Pharmaceutical composition for treating kidney disease comprising glutathione as an active ingredient <130> MP21-042 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> GLA gRNA <400> 1 ttggcaagga cgcctaccat 20 <210> 2 <211> 9 <212> DNA <213> artificial sequence <220> <223> clone 9 <400> 2 cctaccatg 9

Claims

A pharmaceutical composition for preventing or treating renal Fabry disease, comprising glutathione or a pharmaceutically acceptable salt thereof as an active ingredient.

delete

According to claim 1,
The glutathione is a pharmaceutical composition for preventing or treating kidney disease, characterized in that reducing the expression level of Gb3 (Globothriaosylceramide).

According to claim 1,
The glutathione is a pharmaceutical composition for preventing or treating kidney disease, characterized in that strengthening the kidney structure.

A food composition for preventing or improving renal Fabry disease, comprising glutathione or a food chemically acceptable salt thereof as an active ingredient.

delete

According to claim 6,
The glutathione is a food composition for preventing or improving kidney disease, characterized in that reducing the expression level of Gb3 (Globotriaosylceramide).

According to claim 6,
The glutathione is a food composition for preventing or improving kidney disease, characterized in that it strengthens the kidney structure.