KR102552976B1 - Novel starter of Lactobacillus reuteri EFEL6901 with probiotic activity - Google Patents

Abstract

Lactobacillus reuteri EFEL6901 (KACC 81105BP) discovered in the present invention showed suitability as a fermentation starter and excellent probiotics properties. The strain of the present invention can grow in the kimchi environment and low temperature (15 ℃), produces an appropriate amount of acid, and is a natural fermentation and commercial kimchi spawn , Le. mesenteroides DRC1506 was suitable as a fermentation starter because it produced abundant aroma components and metabolites similar to those of mesenteroides DRC1506. In addition, acid bile resistance and intestinal adhesion are excellent, antioxidant activity and anti-inflammatory activity are high, and it has probiotic characteristics, and it has been shown to have excellent anti-inflammatory activity in an animal model inducing actual colitis. In addition, the strain of the present invention does not have a biogenic amine gene and is safe for use in food fermentation because it does not have hemolytic properties. In conclusion, Lactobacillus reuteri EFEL6901 is suitable as a fermentation strain for vegetables, fruits, grains, etc., and can be used as a healthy functional probiotic strain with anti-inflammatory activity.

Description

Novel starter of Lactobacillus reuteri EFEL6901 with probiotic activity}

The present invention relates to a novel Lactobacillus reuteri EFEL6901 (KACC 81105BP), and more particularly, to a novel Lactobacillus reuteri EFEL6901 (KACC 81105BP) fermentation starter having a probiotic function it's about

Probiotics refers to strains that have a beneficial effect on the intestinal environment when ingested and reach the intestine, and most probiotics are lactic acid bacteria, including some Bacillus . Probiotics must maintain the distribution of intestinal flora in a healthy state, and provide various health benefits such as preventing pathogen growth, enhancing immunity, anti-cancer effects, preventing diarrhea and relieving inflammatory bowel syndrome.

In modern times, consumers are increasingly interested in consuming functional foods based on vegetables, fruits and grains that are perceived for their beneficial nutritional value. Non-dairy probiotic products, including foods from vegetables, fruits and grains, are today healthy functional food ingredients. is being evaluated as

Microorganisms used in fermented foods such as fermented milk (fermented milk, yogurt) are largely classified into two based on their roles. The first is a starter that undergoes lactic acid fermentation to provide a unique flavor of fermented milk, and the second is probiotics that settle in the human intestine and provide various health functionalities. Most lactic acid bacteria are developed as spawn or probiotics and are used in fermented foods for different purposes, and 'probiotic spawn', which has both the role of a spawn for flavor and the role of probiotics for health, is not uncommon. not.

On the other hand, kimchi is a traditional Korean fermented vegetable made by fermenting cabbage and radish with various ingredients such as red pepper powder, garlic, and ginger. When kimchi is prepared by natural fermentation using non-sterilized raw materials, various microorganisms proliferate, resulting in uneven quality, off-flavors, and lack of flavor. On the other hand, if a starter is used for making kimchi, advantages such as uniform quality, improvement of sensory characteristics, extension of shelf life, and improvement of functional characteristics of kimchi products can be expected.

Recently, there have been several cases of using probiotics with health functional properties in kimchi fermentation, but there are very few cases in which they are actually used in kimchi and commercialized. This is because there are limitations that exist when applying lactic acid bacteria developed as probiotics to kimchi. The first problem is that most of the 19 types of probiotics notified by the Ministry of Food and Drug Safety were developed based on milk-based dairy products, and many of these probiotics do well in the nutritional environment of vegetable-based kimchi. A lot of times it doesn't grow. The second problem is that most probiotics are thermophilic lactic acid bacteria that grow at 37 ° C or higher and are not suitable for kimchi, which is mainly fermented at a low temperature of 15 ° C or lower. The third emerging problem is that even when probiotics grow in kimchi, a large amount of lactic acid is often produced to lower the palatability and shelf life, and in many cases, off-flavors are created to impede the flavor of kimchi. there is a point

In order to overcome this, a method of culturing existing probiotics lactic acid bacteria and adding them after fermentation of kimchi has been proposed, but it is judged to be less economical because it increases the price of kimchi. In addition, the Leuconostoc genus, which is currently widely used as a kimchi spawn, has weak acid and bile resistance, and is used as a spawn because it lacks the ability to attach to human colon epithelial cells, but is not considered a probiotic that provides health.

Korean Patent Registration No. 10-1871169 (registration date: 2018.06.20) describes a novel Kimchi Lactobacillus Weissella cibaria MFST strain and a jujube seed composition using the same. Korean Patent Registration No. 10-1014871 (registration date: 2011.02.08) describes a deep sleep fermented coffee fermented with kimchi lactic acid bacteria and a manufacturing method thereof.

The present invention is to provide a novel Lactobacillus reuteri EFEL6901 (KACC 81105BP) suitable as a fermentation starter and having excellent probiotics function.

The present invention provides Lactobacillus reuteri EFEL6901 (KACC 81105BP).

On the other hand, the Lactobacillus reuteri EFEL6901 (KACC 81105BP) of the present invention is preferably characterized by anti-inflammatory probiotic activity.

In addition, the present invention provides fermented vegetables prepared by inoculating vegetables with Lactobacillus reuteri EFEL6901 (KACC 81105BP) as a seed and fermenting them. At this time, the fermented vegetable may be, for example, kimchi.

In addition, the present invention provides a fermented fruit prepared by inoculating fruit with Lactobacillus reuteri EFEL6901 (KACC 81105BP) as a seed strain and fermenting the fruit.

In addition, the present invention provides fermented grains prepared by inoculating and fermenting grains with Lactobacillus reuteri EFEL6901 (KACC 81105BP) as a seed.

Lactobacillus reuteri EFEL6901 (KACC 81105BP) discovered in the present invention showed suitability as a fermentation starter and excellent probiotics properties. The strain of the present invention can grow in the kimchi environment and low temperature (15 ℃), produces an appropriate amount of acid, and is a natural fermentation and commercial kimchi spawn , Le. mesenteroides DRC1506 was suitable as a fermentation starter because it produced abundant aroma components and metabolites similar to those of mesenteroides DRC1506. In addition, acid bile resistance and intestinal adhesion are excellent, antioxidant activity and anti-inflammatory activity are high, and it has probiotic characteristics, and it has been shown to have excellent anti-inflammatory activity in an animal model inducing actual colitis. In addition, the strain of the present invention does not have a biogenic amine gene and is safe for use in food fermentation because it does not have hemolytic properties. In conclusion, Lactobacillus reuteri EFEL6901 is suitable as a fermentation strain for vegetables, fruits, grains, etc., and can be used as a healthy functional probiotic strain with anti-inflammatory activity.

1 shows the safety test results of Lactobacillus reuteri EFEL6901 of the present invention.
Figure 2 shows the viability of Lactobacillus reuteri EFEL6901 of the present invention in simulated stomach conditions.
Figure 3 is a result of the intestinal adhesion of the present invention Lactobacillus reuteri EFEL6901 to HT-29 cells as colonic epithelial cells.
Figure 4 shows the antioxidant activity of the present invention Lactobacillus reuteri EFEL6901.
Figure 5 shows the inhibitory effect of heat inactivated (killed) strains on the expression of nitric oxide (NO) in RAW 264.7 cells induced by LPS.
Figure 6 shows the inhibitory effect of heat inactivated (killed) strains on the expression of iNOS and COX-2 in LPS-induced RAW 264.7 cells.
7 is a result of measuring cytokine secretion of Lactobacillus reuteri EFEL6901 of the present invention.
Figure 8 shows a schematic diagram of colitis mouse model management in order to confirm the anti-inflammatory activity of the present invention Lactobacillus reuteri EFEL6901 in an animal model.
Figure 9 shows the effect of the Lactobacillus reuteri EFEL6901 of the present invention on the improvement of symptoms in an inflammation-induced colitis mouse model.
10 is a result of observing and analyzing histological scores of colon tissues of mice stained with hematoxylin and eosin (H & E).
11 is a result showing the effect of Lactobacillus reuteri EFEL6901 of the present invention on the level of tight junction-related proteins in the colon.
12 is a result showing the effect of Lactobacillus reuteri EFEL6901 of the present invention on cytokine levels in the colon.
13 is a comparison result of quantifying short-chain fatty acids (SCFA) in caecal samples.
Figure 14 is a measurement of the growth rate of the present invention Lactobacillus reuteri ( Lactobacillus reuteri ) EFEL6901 and control Leuconostoc mesenteroides ( Leuconostoc mesenteroides ) DRC1506 (KCCM11712P) strain.
15 is a graph measuring pH values of Lactobacillus reuteri EFEL6901 of the present invention and control Leuconostoc mesenteroides DRC1506 (KCCM11712P) during growth.
16 is a biplot result of principal components analysis (PCA) performed on the volatile flavor components of Nabak Kimchi.
17 is a biplot result of principal components analysis (PCA) performed on the metabolites of Nabak Kimchi.
18 is a sensory evaluation result of optimally aged nabak kimchi samples fermented with probiotic strains.

If a 'probiotic seed' that has both the role of a spawn for flavor and the role of probiotics for health is developed at once and applied to food, the value of fermented foods (especially kimchi) will increase, increasing consumer preference. There will be.

Therefore, in the present invention, a spawn that can be used as a 'probiotic spawn' was developed, which satisfied the following elements. First, it should be able to grow by using the nutrients of kimchi well. Second, it must be grown at a low temperature where kimchi fermentation takes place. Third, metabolites generated during fermentation should contribute to providing excellent flavor of kimchi. Fourth, it should have health functionalities such as safety, high acid-bile tolerance, intestinal adhesion, and immunomodulatory ability.

Accordingly, the present invention develops and provides Lactobacillus reuteri EFEL6901 (KACC 81105BP) that satisfies the above four requirements. Lactobacillus reuteri EFEL6901 of the present invention excellently plays a role as a fermentation starter suitable for kimchi fermentation and a role of probiotics for health (in particular, anti-inflammatory activity).

In order to investigate the characteristics of Lactobacillus reuteri EFEL6901 as a kimchi spawn, growth curves in kimchi simulated medium, GS / MS after manufacturing nabak kimchi, analysis of aroma components and metabolites using ¹ H-NMR, and sensory Evaluation was conducted. The strain of the present invention can grow in both the optimum temperature (37 ℃) as well as the low temperature of 15 ℃ in the kimchi medium, and produced an appropriate amount of acid. In addition, when kimchi is prepared using the strain of the present invention as a spawn, even though it is a strain of the genus Lactobacillus , it contains aroma components and metabolites similar to Leuconostoc mesenteroid DRC1506 used as a positive control, and kimchi with good flavor can be prepared this has been confirmed

Next, in the present invention, the probiotics activity of the Lactobacillus reuteri EFEL6901 strain was confirmed, acid-bile resistance was exhibited, intestinal stability was excellent, intestinal adhesion was excellent, and high antioxidant activity and anti-inflammatory activity of health functionalities. In other words, the heat-inactivated sample of the strain of the present invention inhibits nitric oxide (NO) in macrophages stimulated by LPS inflammation, inhibits the mRNA expression of inflammation-related genes iNOS and COX-2, inhibits pro-inflammatory cytokine and anti It showed high anti-inflammatory effect by inducing inflammatory cytokine. In addition, Lactobacillus reuteri EFEL6901 strain improved colitis symptoms through clinical trials in animal models, inhibited colon length reduction, decreased colonic mucosal damage, increased tight junction protein expression, inhibited pro-inflammatory cytokine and anti -Induction of inflammatory cytokine and increase of short-chain fatty acid showed high anti-inflammatory effect, confirming that it is safe for practical use and is an excellent probiotic spawn.

In addition, the Lactobacillus reuteri EFEL6901 strain of the present invention does not have a Biogenic amine gene and is safe for use in food fermentation because it has no hemolytic properties.

In addition, the present invention provides fermented vegetables prepared by inoculating vegetables with Lactobacillus reuteri EFEL6901 (KACC 81105BP) as a seed and fermenting them. At this time, the fermented vegetable is not limited to any, but may be kimchi as an example. In addition, the present invention provides a fermented fruit prepared by inoculating fruit with Lactobacillus reuteri EFEL6901 (KACC 81105BP) as a seed strain and fermenting the fruit. At this time, the fermented fruit is not limited to any, but may be, for example, Achara. In addition, the present invention provides fermented grains prepared by inoculating and fermenting grains with Lactobacillus reuteri EFEL6901 (KACC 81105BP) as a seed. At this time, the fermented grain is not limited to any, but may be oatmeal as an example.

On the other hand, when producing fermented vegetables, fermented fruits, and fermented grains using the Lactobacillus reuteri EFEL6901 (KACC 81105BP) of the present invention as a fermented starter, it is widely used in the art except for using the strain of the present invention as a starter. Known fermentation methods can be selectively applied and used. Therefore, the description of the specific fermentation method for each product will be omitted.

Hereinafter, the contents of the present invention will be described in more detail through the following examples or experimental examples. However, the scope of the present invention is not limited only to the following examples or experimental examples, and includes modifications of equivalent technical ideas.

[Example 1: Lactobacillus reuteri ( Lactobacillus reuteri ) EFEL6901 isolation and identification]

A selective medium was prepared by changing the carbon source for the isolation of Lactobacillus reuteri EFEL6901 of the present invention. Lactobacillus reuteri metabolizes arabinose and is reported to be resistant to tetracycline, adding 1% arabinose instead of glucose as the main carbon source , MRS+bromophenol blue (BPB) medium to which tetracycline (10 μg/ml) was added was prepared. Human feces were diluted with sterile saline (0.85% NaCl), spread on a selective medium, and cultured at 37° C. for 48 hours under anaerobic conditions to obtain colonies. Thereafter, genomic DNA was isolated and 16S rRNA was isolated from the isolated and selected colonies, and the gene sequence was analyzed. It was identified by comparing the sequence of the type strain in NCBI.

The strain of the present invention isolated from human feces through the above process was named EFEL6901, and the 16S rRNA gene sequence of this isolate was analyzed. As a result, it was identified as Lactobacillus reuteri having great similarity with the KACC11452 type strain of Lactobacillus reuteri .

Accordingly, the Lactobacillus reuteri EFEL6901 of the present invention was deposited with the Institute of Agricultural Biotechnology on June 2, 2020, and was given accession number KACC 81105BP.

[Example 2: Lactobacillus reuteri of the present invention ( Lactobacillus reuteri ) Confirmation of biogenic amine gene and hemolytic activity of strain EFEL6901]

In order for probiotics to be used in food, they must not produce biogenic amines from dietary proteins that can adversely affect health, such as food poisoning. Lactobacillus reuteri ( Lactobacillus reuteri ) In order to evaluate the stability of the EFEL6901 strain, the presence of genes related to the formation of biogenic amines was examined by PCR.

The 16s rRNA gene for each gene involved in biogenic amine production was detected using a multiplex PCR method. The hdc (histidine decarboxylase) and tyrdc (tyrosine decarboxylase) genes were amplified using the following primer pairs: hdc: HDC3 (5'-GATGGTATTGTTTCKTATGA-3') and HDC4 (5'-CAAACACCAGCATCTTC-3'); tyrdc: TD2 (5'-ACATAGTCAACCATRTTGAA-3') and TD5 (5'-CAAATGGAAGAAGAAGTAGG-3'); 16s rRNA genes: 27F and 1492R.

In multiplex PCR, each biogenic amine gene was amplified simultaneously with the 16s rRNA gene in a PCR tube by adding each corresponding primer set. The 16s rRNA gene was used as a positive control for PCR reactions and template conditions. The PCR conditions were as follows: 95°C for 5 minutes followed by 32 cycles of 95°C for 45 seconds, 58°C for 45 seconds, and 72°C for 75 seconds, followed by a final extension at 72°C for 5 minutes. The genomic DNA of L. reuteri ATCC 23272 and Enterococcus faecalis KCCM 11729 were used as positive controls for the hdc and tyrdc genes, respectively. For hemolysis analysis, bacterial cells were inoculated on BHI agar plates supplemented with 7% horse blood (MB CELL, Seoul, Korea) according to Ryu and Chang's method. After anaerobic culture at 37° C. for 24 hours using Listeria monocytogenes as a control, hemolysis was observed in the medium.

1 shows the results of the safety test of Lactobacillus reuteri EFEL6901 of the present invention. Figure 1 (A) shows the detection of genes related to biogenic amine production, and lane M is a 1 kb DNA marker; Lane 1 (B) is a negative control without template DNA; Lane 2 (P) is L. reuteri ATCC 23272 and Enterococcus faecalis KCCM with hdc (histidine decarboxylase, 440 bp) and tyrdc (tyrosine decarboxylase, 1100 bp) genes, respectively. 11729 genomic DNA as a positive control. The DNA of the 16S rRNA gene (1530 bp) was also amplified. Lane 3 is strain EFEL6901. Figure 1 (B) is the result of analysis of the hemolytic activity of Lactobacillus reuteri EFEL6901. Hemolytic activity was determined in BHI broth containing 7% horse blood. The left is the EFEL6901 strain, and the right is the positive control Listeria monocytogenes ( Listeria monocytogenes ).

As shown in (A) of FIG. 1, strain EFEL6901 did not possess hdc and tyrdc genes that produce histamine and tyramine, respectively. On the other hand, PCR products for these genes were detected in the genomic DNA of L. reuteri ATCC 23272 and Enterococcus faecalis KCCM 11729 as positive controls.

On the other hand, another important property for use in food is the absence of microbial hemolytic activity. To evaluate the hemolytic activity of the EFEL6901 strain, the cells were inoculated on horse blood agar medium and cultured at 37°C for 24 hours, and then the hemolytic activity was examined. As a result, as shown in B of FIG. 1, the EFEL6901 strain did not show a clear zone around the cell droplets, whereas the positive control group Listeria monocytogenes showed a clear zone that could be interpreted as hemolytic activity. These results show that the present invention Lactobacillus reuteri EFEL6901 has no hdc and tyrdc genes and no hemolytic ability.

[Example 3: Lactobacillus reuteri of the present invention ( Lactobacillus reuteri ) Confirmation of acid and bile resistance of strain EFEL6901]

Resistance to acidic conditions was tested using the method proposed by Conway with minor modifications. Bacterial strains were obtained by culturing overnight in MRS medium and centrifuging at 6,000 x g for 10 minutes. Cells were washed three times with phosphate-buffered saline (PBS) at pH 7.2 and then resuspended in equal volumes of PBS adjusted to pH 3.0 and 2.5 with HCl. After incubation at 37°C for 0, 90, and 180 minutes, the cells were plated on MRS agar medium, cultured at 37°C for 48 hours, and viable cells were counted to evaluate acid resistance. Resistance to bile salts was evaluated by suspending the cells in a PBS solution containing 0.3% (w/v) bile salts (Sigma, St. Louis, MO, USA) and culturing at 37°C. Bile salt tolerance was measured in the same way as acid tolerance.

Figure 2 shows the viability of Lactobacillus reuteri EFEL6901 in simulated gastric conditions. Figure 2 (A) shows the results under acidic conditions (pH 3.0), Figure 2 (B) under acidic conditions (pH 2.5), and Figure 2 (C) under 0.3% bile salt conditions. Results are expressed as mean ± standard deviation (n = 3). Significant in Lactobacillus plantarum ( L. plantarum ) WCFS1 (## p <0.01, ### p <0.001) or Lactobacillus rhamnosus ( L. rhamnosus ) GG (* p <0.05, ** p <0.01) A difference appeared.

As shown in (A) and (B) of Figure 2, probiotic strains used as positive control Lactobacillus rhamnosus ( L. rhamnosus ) GG (LGG) and Lactobacillus plantarum ( L. plantarum ) WCFS1 (WCFS1) and The viability of Lactobacillus reuteri EFEL6901 was maintained at pH3.0. When incubated for 180 minutes at pH 2.5, the viability of positive control groups LGG and WCFS1 was greatly reduced, but EFEL6901 was statistically significantly higher than them (p<0.001). In addition, as shown in (C) of FIG. 2, as a result of the bile tolerance assay in 0.3% bile salt, EFEL6901 showed reduced viability than WCFS1, but higher viability compared to LGG (Figure 2C). As a result, EFEL6901 has a higher acid tolerance than LGG and WCFS1, and shows bile tolerance similar to that of WCFS1, so the Lactobacillus reuteri EFEL6901 strain of the present invention was considered to be resistant to the gastrointestinal environment.

[Example 4: Lactobacillus reuteri of the present invention ( Lactobacillus reuteri ) Confirmation of intestinal epithelial cell adhesion ability of strain EFEL6901]

Attachment assays were performed as described by Messaoudi et al. (Messaoudi et al., 2012, "In vitro evaluation of the probiotic potential of Lactobacillus salivarius SMXD51", Anaerobe, 18:584-589). HT-29 cells, human colon epithelial cells, were obtained from the Korean Cell Line Bank (KCLB; Seoul, Korea) and supplemented with 10% fetal bovine serum (FBS; Hyclone), 10,000 U/mL penicillin, and 10 mg/mL streptomycin (Hyclone). They were cultured in Dulbecco's Modified Eagle's Medium (DMEM; Hyclone, Logan, UT, USA) supplemented with 1% each (in 0.85% NaCl). HT29 cells were seeded in 24-well tissue culture plates (2 cm ² per well) at a density of approximately 4.7x10 ⁵ cells per well. When the culture medium reached 80% saturation, it was replaced with antibiotic-free medium. After culturing EFEL6901 in MRS medium, EFEL6901 was recovered by centrifugation, washed twice with PBS (pH 7.4), and resuspended in DMEM without serum and antibiotics at a concentration of 10 ⁸ CFU/ml. Then, EFEL6901 cells were seeded on the HT29 cell monolayer in each well and incubated for 2 hours at 37°C (5% CO ₂ ). After incubation, non-adhered EFEL6901 was removed by washing twice with PBS. The attached EFEL6901 was treated with a detachment solution containing 0.1% Triton X-100 and 0.1% trypsin-EDTA (Sigma) for 15 minutes. To count the number of attached EFEL6901, the suspension of the isolated cells was appropriately diluted and cultured on MRS agar plates at 37°C for 48 hours.

Figure 3 is a result of the intestinal adhesion of the present invention Lactobacillus reuteri EFEL6901 to HT-29 cells as colonic epithelial cells. Results were expressed as mean ± standard deviation (n = 3). Statistical analysis was performed using an independent T-test compared to WCFS1. (#p<0.05).

As a result, as shown in FIG. 3, in HT-29 cells, EFEL6901 exhibited higher adhesion than LGG (509 CFU / 100 cells), but not WCFS1 (1178 CFU / mL), confirming that the intestinal adhesion was excellent enough to be comparable to the positive control group.

[Example 5: Lactobacillus reuteri of the present invention ( Lactobacillus reuteri ) Confirmation of antioxidant activity of strain EFEL6901]

The antioxidant activity of Lactobacillus reuteri strain EFEL6901 was measured by slightly modifying the DPPH inhibition assay proposed by Das & Goyal. For the production of intact cell and cell free extract, the EFEL6901 strain was pre-cultured and main cultured for 12 hours each, and the optical density at 600 nm was set to 1.0. The EFEL6901 strain was washed twice and resuspended in 0.85% saline to make intact cells. In the case of cell free extract, after sonicating for 10 minutes using a sonicator (VP-050N; Taitec Corp., Saitama, Japan), cell debris was removed by centrifugation (10,000 xg 4℃, 5 minutes). Removed. The ethanolic DPPH solution (100 μL, 0.4 mmol/L) was strongly mixed with the EFEL6901 strain sample or water (control) and incubated for 30 minutes in the dark at 37°C. The absorbance of this mixture was measured at 517 nm using a microplate reader.

Figure 4 shows the antioxidant activity of Lactobacillus reuteri EFEL6901. Antioxidant activity was measured by DPPH inhibition assay, and the results were expressed as mean±standard deviation (n=3). Different letters in error bars indicate significant differences. Significant difference from Lactobacillus plantarum ( L. plantarum ) WCFS1 (WCFS1) (#p <0.05, ### p <0.001) or Lactobacillus rhamnosus ( L. rhamnosus ) GG (*** p <0.01) appeared.

As shown in Figure 4, Intact cells of EFEL6901 showed 21.6% DPPH removal activity, which was statistically higher than that of WCFS1 (10.6%) and LGG (17.1%). Antioxidant activity of Cell free extract of EFEL6901 was 12.4%, significantly higher than that of WCFS1 (1.6%) and LGG (8.0%). Therefore, the present invention Lactobacillus reuteri ( Lactobacillus reuteri ) EFEL6901 strain was judged to have a higher antioxidant activity than L. plantarum ( L. plantarum ) WCFS1 and L. rhamnosus GG.

[Example 6: Lactobacillus reuteri of the present invention ( Lactobacillus reuteri ) Confirmation of anti-inflammatory activity of strain EFEL6901]

(1) Nitric oxide (NO) inhibition

In order to analyze the anti-inflammatory activity of Lactobacillus reuteri EFEL6901, RAW 264.7 macrophages were stimulated with LPS (1 ug/ml) to excessively produce nitric oxide (NO), an inflammatory mediator, and the strain The NO inhibition activity of the heat-inactivated samples was measured.

For the preparation of heat-inactivated strains, the absorbance of the strain was adjusted to 1.0 (OD600 nm), centrifuged at 10,000 xg for 5 minutes, the cell pellet was rinsed twice with PBS, suspended in DMEM and heat killed at 90 ° C. for 30 minutes. Macrophage cell line RAW 264.7 cell line was obtained from KCLB and maintained in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin (37°C, 5% CO ₂ ). Cells were sub-cultured on plates to 80-90% confluency. RAW 264.7 cells (5x10 ⁵ cells per ml in a 96well plate) were stimulated for 24 hours by adding LPS (1 μg/mL) and a heat-inactivated strain. After 24 hours, the supernatant of each well was mixed with an equal volume of Griess reagent and placed in the dark at room temperature for 10 minutes. Thereafter, absorbance was measured at 540 nm using a microplate spectrophotometer (BioTek, Winooski, VT, USA), and a standard curve was prepared using sodium nitrate to calculate the NO content. Methyl arginine (MA) was used as a positive control.

Figure 5 shows the inhibitory effect of heat inactivated (killed) strains on the expression of nitric oxide (NO) in RAW 264.7 cells induced by LPS. MA is methyl arginine, NO inhibition was measured by Griess reaction analysis, and results are expressed as mean±standard deviation (n=3). Different letters in error bars indicate significant differences. Statistical analysis was performed using independent t-tests compared with the LPS-treated group. (*p < 0.05, **p < 0.01, ***p < 0.001)

As shown in FIG. 5, NO production significantly increased when treated with LPS compared to the control group not treated with LPS. However, treatment with methyl arginine (MA), an NO synthase inhibitor, inhibited NO production in a dose-dependent manner compared to the LPS-treated group (p <0.001). In the case of all heat-inactivated strains tested, they showed significant inhibitory effects on NO production compared to the LPS -treated group.

(2) Verification of suppression of iNOS and COX-2 expression using RT-qPCR

Lactobacillus reuteri ( Lactobacillus reuteri ) The expression activity of inflammation-related mRNA of EFEL6901 was measured by LPS-induced RAW 264.7 cells treated with a heat-inactivated strain, RNA extracted, followed by cDNA synthesis and RT-qPCR. After culturing RAW 264.7 cells (1x10 ⁶ cells/well) in a 6 well plate, they were stimulated with LPS (1 μg/mL) and heat-inactivated strain for 24 hours.

RNA was extracted from each well using Trizol reagent, and cDNA was synthesized using a cDNA synthesis kit (LeGene Express 1 ^st Standard cDNA Synthesis System). GADPH, iNOS, and COX-2 genes were amplified by RT-qPCR using the following primer pairs. GADPH: Forward (5'-TTGTCTCCTGCGACTTCAACA-3') and Reverse (5'-GCTGTAGCCGTATTCATTGTCATA-3'); iNOS: Forward (5′-ACCATGGAGCATCCCAAGTA-3′) and Reverse (5′-CCATGTACCAACCATTGAAGG-3′); COX-2: Forward (5'-AGCATTCATTCCTCTACATAAGC-3') and Reverse (5'-GTAACAACACTCACATATTCATACAT-3'). The PCR conditions were as follows: 95°C for 5 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 30 seconds, and 60°C for 30 seconds.

Figure 6 shows the inhibitory effect of heat inactivated (killed) strains on the expression of iNOS and COX-2 in LPS-induced RAW 264.7 cells. Cells were treated with a heat kill strain and stimulated with LPS for 24 hours. Expressed mRNA levels of iNOS and COX-2 were determined by relative quantification by real-time PCR and normalization using GAPDH. Different letters in error bars indicate significant differences. Statistical analysis was performed using independent t-tests compared with the LPS-treated group. (*p < 0.05, **p < 0.01, ***p < 0.001)

As shown in FIG. 6, the mRNA expression of COX-2 and iNOS was hardly confirmed in RAW 264.7 cells in a stable state without LPS stimulation, but the expression level was significantly increased by LPS stimulation. In contrast, heat-inactivated samples of all strains tested significantly suppressed the mRNA expression of COX-2 and iNOS, and in particular, Lactobacillus reuteri EFEL6901 of the present invention showed anti-inflammatory activity similar to that of WCFS1.

(3) Measurement of secretion of inflammatory cytokines (IL-12) and anti-inflammatory cytokines (IL-10) using ELISA

The immunomodulatory activity of Lactobacillus reuteri EFEL6901 was measured by evaluating cytokine production in LPS-induced mouse peritoneal macrophages using an ELISA kit. The animal protocol was approved by the Animal Research Ethics Committee of Kyung Hee University (KHUASP(GC)-19-005). Peritoneal macrophages were collected from 7-week-old male Balb/c mice by washing the peritoneum with DMEM, and the cells (4x10 ⁵ cells/ml) were stimulated with LPS (1 μg/mL) and a heat-inactivated strain for 24 hours. Supernatants were collected from each well, and IL-10 and IL-12 secreted into the culture medium were quantified using an ELISA assay kit (R&D systems Mouse DuoSet ELISA IL-10 and IL-12, Minnesota, USA).

7 is a result of measuring cytokine secretion of Lactobacillus reuteri EFEL6901. Figure 7 (A) is IL-12, Figure 7 (B) is IL-10, Figure 7 (C) is IL-10 / IL-12, the results are average ± standard deviation (n = 6) indicated. Different letters in error bars indicate significant differences. Statistical analysis was performed using an independent t-test compared to the LPS treated group. (*p < 0.05, **p < 0.01, ***p < 0.001)

As a result, LPS strongly induced the release of the inflammatory cytokine IL-12 (Fig. 7(A)), whereas the anti-inflammatory cytokine IL-10 was not affected (Fig. 7(B)). On the other hand, all heat-inactivated strains tested completely inhibited IL-12 (FIG. 7(A)) and strongly induced IL-10 (FIG. 7(B)). In particular, the heat-inactivated strain of EFEL6901 is a strong inducer of IL-10 and an inhibitor of IL-12, and has a high anti-inflammatory index (IL-10/ IL-12 ratio).

Therefore, Lactobacillus reuteri EFEL6901 of the present invention can be evaluated as having immunomodulatory ability ex vivo, reducing IL-12 and inducing IL-10 in mouse peritoneal macrophages stimulated with LPS.

[Example 7: Lactobacillus reuteri of the present invention through animal experiments ( Lactobacillus reuteri ) Confirmation of anti-inflammatory activity of strain EFEL6901]

Lactobacillus reuteri ( Lactobacillus reuteri ) In order to verify the anti-inflammatory activity of EFEL6901, the colitis mitigation and suppression efficacy was tested using a DSS-induced colitis animal model.

(1) Production of animal models

First, EFEL6901 was cultured in MRS liquid medium at 37 °C for 24 hours, the absorbance (OD600 nm) was adjusted to 1x10 ⁹ CFU, and the culture medium was centrifuged at 10,000 rpm for 5 minutes, and the cell pellet was washed twice with PBS. Again, the same amount of PBS was resuspended and used as a sample. As experimental animals, 7-week-old BALB/c female mice from Coretech were used. After completing the adaptation period of 1 week, L. reuteri EFEL6901 1x10 ⁹ CFU was orally administered once a day for 2 weeks, and the same amount of PBS was administered to the control group. To induce inflammation, DSS (molecular mass 36,000-50,000 Da; MP Biomedical, USA) was suspended in PBS at 3% (w/v), and the animals were allowed to consume freely instead of water for 7 days (FIG. 8). This animal experiment was approved by the Animal Experiment Ethics Committee of Kyung Hee University (KHGASP-20-134). The normal experimental animal group not treated with DSS was designated as 'Control', the experimental animal group treated with only DSS was designated as 'DSS', and the experimental animal group in which Lactobacillus reuteri EFEL6901 was orally administered to animals together with DSS treatment was designated as 'Control'. DSS+EFEL6901'.

(2) Evaluation of clinical symptoms: body weight, disease activity index (DAI) score, colon length, histological changes

First, the weight change was observed for a total of 14 days of the experiment period, and the weight change with respect to the initial weight was calculated as a % and the result value was shown. Changes in disease activity index (DAI) were determined by Jang YJ et al's method (Jang YJ et al., 2019, " Lactobacillus fermentum species ameliorate dextran sulfate sodium-induced colitis by regulating the immune response and altering gut microbiota", Gut Microbes , 10 : 696-711), weight loss (%), stool consistency, and stool blood were observed and measured, and the methods are shown in Table 1. After the experimental animals were sacrificed by cervical dislocation on the 15th day of the experiment, the length from the point below the cecum to the tip of the large intestine was measured to measure the length of the large intestine.

Score Weight loss (%) Stool consistency blood in feces 0 None Normal Negative (no bleeding) One 1.0-5.0 2 5.0-10.0 loose stools Positive (slight bleeding) 3 10.0-15.0 4 Over 15.0 watery diarrhea Gross bleeding

Figure 9 shows the effect of Lactobacillus reuteri EFEL6901 on the improvement of symptoms in an inflammation-induced colitis mouse model. (A) body weight, (B) disease activity index scores were assessed throughout the experiment. Mice were sacrificed on day 15, whole colons were harvested, and colon lengths were measured in (C) and (D). Results are expressed as mean ± standard error mean (SEM) (n = 7). Statistical analysis was performed using independent t-tests compared with the DSS group.

As a result, as shown in FIG. 9, the group administered only with DSS (DSS) lost 4% of body weight compared to the control group, and when EFEL6901 was administered, weight loss was significantly suppressed (A, p < 0.05). As a result of the DAI score evaluation, the normal control group did not show any signs of colitis before DSS intake, the score increased over time when DSS intake, and the DAI score was significantly lowered from the 14th day when EFEL6901 was administered (Fig. (B, p<0.01) In addition, as a result of measuring the length of the colon, compared to the normal control group, the length of the colon was shortened when DSS was administered, but when EFEL6901 was administered, the reduction in colon length was significantly suppressed (Fig. 9 C, D, p<0.05).

Meanwhile, for observation of histological changes, distal colons were fixed in 10% formaldehyde and stained with hematoxylin and eosin (H&E) to observe the degree of damage to the colonic mucosa through an optical microscope did Histological changes were partially modified by Wirtz et al.'s method (Wirtz et al., 2017, "Chemically induced mouse models of acute and chronic intestinal inflammation". Nature protocol, 12:1295-1309) to score inflammation and loss of crypt structures. was evaluated by combining, and the method was shown in Table 2.

Histological score Inflammatory cell infiltration Loss of crypt glands 0 Infrequent, ranged in normal None One Mild increase of inflammatory cells in the lamina propria Loss of glands, one third of mucosa 2 Moderate increase of inflammatory cells in the lamina propria Loss of glands, two third of mucosa 3 Mild increase of inflammatory cells in the lamina propria and submucosa Entirely loss of glands

10 is a result of observing and analyzing histological scores of colon tissues of mice stained with hematoxylin and eosin (H & E). Figure 10 (A) shows the histological characteristics of representative colons of each group (Control, DSS, DSS+EFEL6901), m, mucosa; sm, submucosa; mm, muscular layer. Mag is a value that is X100 for all. 10(B) is a result showing histological scores combining inflammatory cell infiltration and crypt gland loss. Results are expressed as mean ± standard error mean (SEM) (n = 7). Statistical analysis was performed using independent t-tests compared with the DSS group. *, P<0.05; **, P<0.01.

As a result, as shown in FIG. 10, the degree of mucosal damage such as severe infiltration of inflammatory cells, loss of almost all intestinal glands, and erosive area was higher when only DSS was administered than in the control group (FIG. 10A). On the other hand, inflammation and mucosal damage were reduced during EFEL6901 treatment, and histological scores were significantly decreased compared to the DSS group (FIG. 10B, p<0.05). As such, when Lactobacillus reuteri EFEL6901 of the present invention is actually administered to an animal, weight loss, disease score, and colorectal length reduction due to inflammation are significantly suppressed, and damage to the colonic mucosa is also suppressed, thereby relieving symptoms caused by inflammation. considered to be efficacious.

(3) Measurement of tight junction protein (E-cadherin, Claudin-3, Occludin) expression through Western blot

To measure the tight junction protein expression in the large intestine, the large intestine tissue was 1X RIPA buffer (50mM Tris-HCL (pH 7.5), 150mM Nacl, 1mM EDTA, 20mM NaF, 0.5% NP- 40, 1% Triton X-100) using a tissue lyser (Qiagen). Thereafter, the supernatant was obtained by centrifugation (13,000 rpm, 10 min) and the protein was quantified by the Braford method. 20 ug of the protein sample was electrophoresed on an 8-10% gel, and the protein band on the gel was transferred to a PVDF membrane (Bio-RAD, 1620177). Subsequently, E-cadherin (Cell signaling technology, 3195S), Claudin-3 (Thermo Fisher Scientific, 34-1700), and Occludin (Thermo Fisher Scientific, 40-4700) were used as primary antibodies, and HRP-conjugated anti-rabbit antibody ( BETHYL, A120-101P) was labeled using a secondary antibody, and the protein expression level was observed through chemiluminescence staining.

11 is a result showing the effect of Lactobacillus reuteri EFEL6901 of the present invention on tight junction-related protein levels in the colon. Figure 11 (A) shows representative Western blotting of E-cadherin, Occludin, Claudin-3, and β-actin, and Figure 11 (B), (C), and (D) show the respective proteins in the colon. Expression levels were quantified (E-cadherin (B), Occludin (C) and Claudin-3 (D)). Results were expressed as mean ± standard error mean (SEM) (n = 7). Statistical analysis was performed using independent t-tests compared with the DSS group. *, P<0.05; **, P<0.01.

As a result of Western blot, as shown in Figure 11, the expression levels of E-cadherin and Claudin-3 were reduced when DSS was administered compared to the normal control group (A, B and D in Figure 11, p<0.05), and the expression level of Occludin was affected. did not affect (Fig. 11 C, p>0.05). On the other hand, when EFEL6901 was administered, the expression levels of E-cadherin and Claudin-3 were significantly increased in colon tissue compared to the DSS group administered with PBS (A, B and D in FIG. 11, p<0.05).

(4) Cytokine (IL-10, TNF-α, IL-1β) expression level measurement through RT-qPCR

In order to evaluate the anti-inflammatory activity of lactic acid bacteria, the amount of Cytokine (IL-10, TNF-α, IL-1β) mRNA expression in colon tissue was measured. 1 ml of Trizol reagent was added to the colon tissue, and the tissue was pulverized using a tissue lyser (Qiagen) to separate RNA. Then, cDNA was synthesized from the isolated RNA using a cDNA synthesis kit (LeGene Express ^1st Standard cDNA Synthesis System), and real-time qPCR was performed using the primers in Table 3. The polymerase chain reaction was performed at 95°C for 5 minutes, at 95°C for 15 seconds, at 60°C for 30 seconds, and at 60°C for 30 seconds for 40 cycles.

Gene Primer sequence (5'->3') GADPH F TTGTCTCCTGCGACTTCAACA R GCTGTAGCCGTATTCATTGTCATA IL-10 F GGACAACATACTGCTAACCGACTC R AAAATCACTCTTCACCTGCTCCAC IL-1β F GTTGACGGACCCCAAAAGAT R CACACACCAGCAGGTTATCA TNF-α F ATGATCCGCGACGTGGAA R ACCGCCTGGAGTTCTGGA

12 is a result showing the effect of Lactobacillus reuteri EFEL6901 of the present invention on cytokine levels in the colon. Quantification of each mRNA expression level in the colon (IL-10 (A), IL-1β (B) and TNF-α (C)). The mRNA levels of the expressed cytokines were determined by real-time PCR, and GAPDH was used as a housekeeping gene for quantification. Results were expressed as mean ± standard error mean (SEM) (n = 5). Statistical analysis was performed using independent t-tests compared with the DSS group. *, P<0.05; **, P<0.01.

As a result of RT-qPCR, as shown in FIG. 12, when DSS was administered, the mRNA expression of TNF-α and IL-1β, which are pro-inflammatory cytokines, increased significantly compared to the normal control group (B and C in FIG. 12, p<0.05), The expression level of IL-10, an anti-inflammatory cytokine, was not affected (Fig. 12A, p>0.05). On the other hand, when EFEL6901 was administered, the expression level of IL-10 was significantly increased, and the mRNA expression levels of TNF-α and IL-1β were significantly suppressed (A, B, C in FIG. 12, p<0.05).

(5) Measurement of the concentration of short chain fatty acids (SCFAs)

In order to measure the concentration of short-chain fatty acids (SCFAs), 90 mg of the contents of the cecum was suspended in 1 mL of PBS, and the supernatant was obtained by centrifugation, and the SCFAs concentration was measured under the conditions of Table 4 through HPLC analysis.

Item Condition Instrument HPLC (1260 Infinity, Agilent Technologies, USA) Detector UV (215 nm) Column AminexHPX-87H (300mm X 7.8mm, Biorad, USA) Injection volume 20 μl Mobile phase 0.008 NH ₂ SO ₄ Flow rate 0.6 mL/min

13 is a comparison result of quantifying short-chain fatty acids (SCFA) in caecal samples. Results were expressed as mean ± standard error mean (SEM) (n = 3). Statistical analysis was performed using independent t-tests compared with the DSS group. *, P<0.05; **, P<0.01.

As a result of short-chain fatty acids (SCFAs) analysis, as shown in FIG. 13, when DSS was administered compared to the normal control group, lactic acid and butyric acid were significantly reduced, whereas when EFEL6901 was administered, lactic acid and The concentration of butyric acid was significantly increased. These results indicate that the decrease in SCFAs caused by DSS can be recovered by Lactobacillus reuteri EFEL 6901.

[Example 8: Lactobacillus reuteri of the present invention in simulated kimchi juice Lactobacillus reuteri ) Measurement of growth rate of strain EFEL6901]

(1) Making Kimchi Mosa Juice

Materials and compositions of simulated kimchi juice are shown in Table 5. Raw materials (cabbage, radish, garlic, ginger, chives) were purchased from local markets. All ingredients were cut using a blender, salt was added in preparation for cabbage and left to marinate overnight. Fish peptone (Bision Co., Seongnam, Korea) was added instead of salted fish, and SKJ was pasteurized at 70℃ for 30 minutes. After cooling at room temperature, the mixture was centrifuged at 7,000 rpm for 10 minutes to remove the pulp, and only the supernatant was used in the experiment.

Ingredients Concentration Cabbage 700g Raddish 200g Leek 50g Ginger 10g Garlic 20g Salt 3% Fish peptone 0.5%

(2) Lactobacillus reuteri of the present invention in kimchi mock juice ( Lactobacillus reuteri ) Measurement of growth rate of strain EFEL6901

To investigate whether the isolate was suitable for kimchi fermentation, the fermentation characteristics of Lactobacillus reuteri EFEL6901 were monitored in kimchi mock juice. Leukonostok, a commercial kimchi starter Mesenteroid ( Le. mesenteroidesi ) DRC1506 was used as a positive control. After pre-culturing each strain, it was inoculated with 1% SKJ to reach 10 ⁷ CFU/mL, and the strain was incubated at the optimal growth temperature (30℃ for 24 hours, 15℃ for 8 days) and spectrophotometer (BioTek Instruments, Winooski, VT, USA) was used to measure the optical density (OD600nm), and the pH was measured using a pH meter (Orion Versa, Thermo, USA), that is, to compare the adaptability of live strains in the Kimchi environment, the optimal temperature in the Kimchi simulated juice. The growth rate was measured for 24 hours at (30 ℃ or 37 ℃) and 8 days at 15 ℃, and the pH value was measured to compare the effect on the taste of kimchi.

The results were shown in FIGS. 14 and 15. 14 is a measurement of the growth rate of the present invention Lactobacillus reuteri EFEL6901 and control Leuconostoc mesenteroides DRC1506 (KCCM11712P) strain, optical density (OD) values are 37 ℃ (A) and It was measured after inoculating these strains into kimchi mock juice (SKJ) at 15 ° C (B). Results are expressed as mean ± standard deviation (n = 3). Statistical analysis was performed using an independent T-test (* p <0.05, ** p <0.01, *** p <0.001). Figure 15 is the pH value during the growth of Lactobacillus reuteri EFEL6901 and the control Leuconostoc mesenteroides DRC1506 (KCCM11712P) of the present invention, kimchi at 37 ° C (A) and 15 ° C (B) It was measured after inoculating these strains into mock juice (SKJ). Results are expressed as mean ± standard deviation (n = 3). Statistical analysis was performed using an independent T-test (* p <0.05, ** p <0.01, *** p <0.001).

Lactobacillus reuteri EFEL6901 of the present invention showed a significantly higher growth rate than the positive control Leuconostoc mesenteroides DRC1506 at the optimum temperature (37 ° C), and the pH after 24 hours fermentation was lower than that of DRC1506 . As a result of culturing at 15 ° C, DRC1506 grew from the 1st day, whereas EFEL6901 grew from the 5th day of culture, but was confirmed to be able to grow at low temperatures (FIG. 14B, p<0.001). In addition, as a result of pH measurement on the 8th day of culture, it was statistically similar to DRC1506 (FIG. 15B, p<0.001). These results indicate that the Lactobacillus reuteri EFEL6901 of the present invention satisfies the nutritional requirements for growth in plants, can grow at low temperatures, and produces an appropriate amount of acid during fermentation, making it suitable as a starter for kimchi. judged

[Example 9: Lactobacillus reuteri of the present invention ( Lactobacillus reuteri ) Analysis of aroma components of Nabak Kimchi using EFEL6901 strain]

To evaluate the effect of starter on the flavor of nabak kimchi Nabak kimchi using each different starter was fermented until reaching the red season, and then volatile flavor components were analyzed by GC/MS. As a starter , Lactobacillus reuteri of the present invention and EFEL6901; As negative controls, Lactobacillus brevis DRC301, Lactobacillus paracasei CBA3611; As a positive control, Leuconostoc mesenteroides ( Leuconostoc mesenteroides ) DRC1506 was used.

Nabak-kimchi was prepared by the following method (basic recipe for Nabak-kimchi follows the recipe for Nabak-kimchi manufactured by T company in Korea). Chinese cabbage and radish, which are the main raw materials, were cut to a certain size, passed through a washer, and foreign substances were sorted out to prepare raw materials. Sub-ingredients such as chives, red pepper, water parsley, garlic, ginger, and carrots were washed according to the standard, and the carrots were pickled. The washed sub-materials were prepared by cutting them into prescribed sizes. Each raw material and supplementary material were weighed according to the mixing ratio, mixed with previously prepared brine (salinity 1.8%), and the starter was inoculated, respectively. The mixed nabakmul kimchi was aged for 2 days at a low temperature (4℃), and then packed in a container according to the kimchi broth and solid content.

2mL of kimchi prepared by the above method was put into a headspace vial (20 mL, 22.5 mm × 75.5 mm) and stirred at 51 ° C. for 20 minutes before analysis. Volatile flavor components of kimchi were extracted under the conditions shown in Table 6 using Solid-phase microextraction (SPME) fibers (DVB/CAR/PDMS, 50/30 μm, Supelco, 57298-U).

Fiber DVB/CAR/PDMS Incubation 51℃, 20min Adsorption 51℃, 30min Desorption 250℃, 2min

Meanwhile, the extracted volatile fragrance components were analyzed under the conditions of Table 7 using a gas chromatography-mass spectrometer (7820A/5977E MSD, Agilent Technologies, USA). Quantification of volatile flavor components in kimchi was calculated as the peak area of each compound relative to the peak area of methyl cinnamate (5 ppm), an internal standard.

Column DB-WAS (50 m x 200 µm x 0.2 µm) Carrier gas Helium oven temp 40℃(5min)
~150℃, 5℃/min(0min)
~200℃, 7℃/min(10min) Injector temp 250℃ Ion source temp 250℃ Split ratio splitless Mass scan range 35 to 350 amu

The experimental results for the fragrance components were shown in Table 8 and FIG. 16.

Aroma compounds Before fermentation After fermentation Nk 0day DRC1506 0day NK DRC1506 EFEL6901 CBA3611 DRC301 Sulfur-containing compounds 1019.85±146.83 1238.85±133.38 66.63±28.74 109.54±40.58 70.25±14.31 138.88±14.76 139.11±11.61 2-Thiophenecarboxylic acid, 5-(1,1-dimethylethoxy)- - 15.38±6.31 - - - - - N-Methyltaurine - 8.70±0.89 - - - - - Allyl methyl sulfide 218.41±30.02 230.57±28.76 - 21.36±1.25 16.53±0.36 18.72±3.87 15.18±1.73 Disulfide, dipropyl 4.03±0.64 5.31±0.19 - - - - - 1,5,2,4-Dioxadithiepane-2,2,4,4-tetraoxide - - - - 1.34±0.62 3.07±0.65 2.52±0.09 1,2-Dithiolane 29.79±2.94 21.93±13.68 9.01±4.77 - - - - 1-Butene, 4-isothiocyanato- - 0.00±0.00 26.47±2.58 24.58±12.80 18.22±8.83 39.30±4.85 38.56±3.52 Diallyl disulfide 767.63±114.03 956.97±119.01 31.15±21.78 36.17±16.52 34.16±5.56 32.56±4.51 37.54±4.20 Cyclopentyl isothiocyanate - - - 27.43±13.65 - 45.23±4.35 45.30±3.08 Nitrile-containing compounds 0.98±0.09 7.95±2.86 34.50±5.87 - 22.64±0.84 5.02±2.51 1.24±0.14 Hydroxyurea - - - - - - 1.24±0.14 2-t-Butyl-1-methyl-3-phenyl-imidazolidin-4-one - - - - - 3.85±1.72 - N-Methylcaprolactam - 7.95±2.86 34.50±5.87 - 22.64±0.84 - - R-(-)-Cyclohexylethylamine 0.98±0.09 - - - - - - N-Methoxy-1-ribofuranosyl-4-imidazolecarboxylic amide - - - - - 1.07±0.17 - N-Methoxy-1-ribofuranosyl-4-imidazolecarboxylic amide - - - - - 1.39±0.26 - Alcohols and Amino Alcohols 15.70±2.18 14.65±2.49 8.16±1.83 7.25±1.00 6.84±1.31 7.26±0.94 9.07±1.95 4-amino-1-pentanol 7.60±2.42 - 2.76±0.14 2.60±0.11 2.68±0.75 3.64±1.50 2.84±0.47 4-amino-1-pentanol 1.67±0.39 - 1.14±0.03 1.06±0.14 0.86±0.40 - 0.85±0.10 L-Valinol - 8.94±2.12 - - - - - 4-amino-1-pentanol 0.63±0.33 - - - - - 2.68±0.34 2-(2-Aminopropyl)phenol - 2.52±0.86 3.07±1.67 2.33±0.78 2.81±0.25 2.37±0.74 2.52±0.17 4-amino-1-pentanol - 1.22±0.35 - - - - - 1-Methylene-2b-hydroxymethyl-3,3-dimethyl-4b-(3-methylbut-2-enyl)-cyclohexane 2.12±0.22 1.98±0.20 1.20±0.11 1.26±0.13 1.38±0.21 1.25±0.18 1.08±0.06 2-Methyl-1-[3-methyl-6-(1-methylethylidene)-3-cyclohexen-1-yl]-3-buten-2-ol 3.89±1.40 - - - - - - Benzenes and benzene derivatives 9.62±3.10 6.24±0.54 13.35±2.54 27.01±6.33 25.96±4.07 24.63±2.97 35.49±21.58 Benzenethanamine, N-[(4-hydroxy)hydrocinnamoyl]- - - - 9.98±0.15 7.41±0.07 - 8.13±0.18 Benzene, 1-methyl-3-(1-methylethyl)- 2.94±2.28 - - 10.11±1.08 9.98±0.58 13.16±1.97 - Benzene, 1,3-bis(1,1-dimethylethyl)- - - 3.35±1.67 2.37±0.16 2.45±0.23 - 20.35±25.24 Benzaldehyde, 3-(2,4,6-trichlorophenoxymethyl)-4-methoxy- - - 2.48±0.59 2.06±0.24 1.77±0.21 1.55±0.36 1.30±0.27 Benzaldehyde, 3-(2,4,6-trichlorophenoxymethyl)-4-methoxy- - - - - 1.21±0.30 3.21±0.64 1.34±0.41 Benzenethanamine, 3-fluoro-β,5-dihydroxy-N-methyl- - - - - 0.55±0.11 - - Benzene, 1-(1,5-dimethyl-4-hexenyl)-4-methyl- 6.68±0.88 6.24±0.54 3.04±0.08 3.28±0.37 3.38±0.11 3.01±0.16 2.60±0.14 Benzene, (2-isothiocyanatoethyl)- - - 4.48±0.67 3.32±1.51 1.70±0.14 4.77±0.14 4.47±0.19 Acids 6.62±0.38 - 15.70±7.04 13.07±6.68 28.35±6.13 41.57±10.68 34.30±5.24 (Allythio)acetic acid - - - - 4.36±1.01 7.16±1.24 7.71±1.89 Oxaluric acid - - 15.70±7.04 13.07±6.68 23.98±5.93 34.40±9.50 26.59±3.37 2-Butoxyethyl acetate 6.62±0.38 - - - - - - Terpenes 14.81±1.90 11.76±3.97 10.09±0.84 25.62±1.49 53.90±42.23 35.23±5.79 18.07±1.01 β-Terpinen - - - 15.34±0.16 14.29±1.60 23.60±5.40 9.98±0.59 β-Caryophyllene 14.81±1.90 11.76±3.97 10.09±0.84 10.28±1.62 9.64±0.60 11.63±0.41 8.09±0.87 Aldehydes and ketones 1.72±0.47 12.22±2.75 1.32±0.54 1.44±0.54 1.45±0.61 1.43±0.62 1.28±0.47 Methyl salicylate 1.72±0.47 1.74±0.44 1.32±0.54 1.44±0.54 1.45±0.61 1.43±0.62 1.28±0.47 Dodecanal - 8.63±2.35 - - - - - 1,1-Dodecanediol, diacetate - 1.85±0.67 - - - - - Hydrocarbon 55.75±19.67 63.60±10.70 35.92±13.75 39.16±3.52 31.90±1.57 57.98±11.01 33.84±3.03 Limonene 55.75±19.67 63.60±10.70 35.92±13.75 36.00±2.81 31.90±1.57 57.98±11.01 33.84±3.03 Propane - - - 0.73±0.25 - - - Miscellaneous 51.82±8.65 29.14±5.87 32.37±1.84 32.14±3.20 25.37±8.90 35.75±3.11 32.17±2.12 Penicillamine, tri-TMS 5.10±5.85 - 0.93±0.11 0.89±0.20 0.98±0.42 - 0.68±0.28 Silane, trichlorodocosyl- 10.67±5.04 5.05±2.96 5.71±0.28 5.55±0.17 4.14±1.88 5.48±0.22 5.10±0.36 Silane, trichlorodocosyl- - - - 3.22±1.66 - - 3.96±0.50 2-Trifluoroacetoxydodecane 9.04±1.39 7.44±2.10 4.61±0.89 - - 4.36±0.76 - Silane, trimethyl(1-methyl-1-phenylethoxy)- - - - - 4.68±0.76 3.45±0.04 - trans-(2-Chlorovinyl)dimethylethoxysilane 1.39±0.10 - - - - - - trans-(2-Chlorovinyl)dimethylethoxysilane 1.67±0.53 - 1.18±0.06 1.43±0.46 - - - Silanediol, dimethyl- 23.28±4.04 15.94±3.42 19.50±0.76 19.78±2.08 16.72±4.70 23.62±2.83 21.56±1.22 Metaraminol 0.67±0.09 - - - 0.77±0.19 - - Topotecan - 0.71±0.05 - 0.54±0.11 0.77±0.03 - 0.86±0.02 Topotecan - - 1.15±0.20 0.90±0.51 - - -

As a result of the analysis of fragrance components, various volatile fragrance compounds including sulfur containing compounds, alcohols, acids, benzene, etc. were detected as shown in Table 8, and among them, the content of sulfur containing compounds was the highest. Among the aromatic compounds, sulfur containing compounds are derived from cabbage, radish, garlic, ginger, etc., and their content was relatively low in naturally fermented (NK) and EFEL6901 fermented nabak kimchi, and relatively high in DRC301 and CBA3611 fermented nabak kimchi. In addition, terpenes among flavor compounds are derived from garlic and ginger, and their content was relatively high in EFEL6901 fermented nabak kimchi and relatively low in naturally fermented (NK) and CBA3611 fermented nabak kimchi.

According to Hong EJ et al's study (Hong EJ et al., 2010. "The reduction of "off-flavor" in cheonggukjang and kimchi", Journal of the Korean Society of Food Culture , 25: 324-333), sulfur containing It was reported that the compounds have low threshold values and play an important role in determining the quality of kimchi products due to their strong flavor. In addition, according to Hawer et al's study (Hawer WS et al., 1994, "Effective separation and quantitative analysis of major heat principles in red pepper by capillary gas chromatography, Food Chemistry , 49: 99-103), sulfur containing compounds belonging to Although not all compounds are off-flavors, some foreigners have reported that they feel an off-flavor and have aversion to sulfur containing compounds, which suggests that excessive amounts of sulfur containing compounds may degrade the sensory properties of kimchi. indicates that there is

Meanwhile, according to Cha YH et al's study (Cha YH et al., 1998, "Aroma-active compounds in kimchi during fermentation", Journal of Agricultural and Food chemistry , 46: 1944-1953), terpenes are sulfur containing compounds reported that it had relatively high threshold values and did not have a relatively large effect on the flavor of kimchi. Rather, according to the study of Kim DW et al (Kim DW et al., 2017, "Effects of different salt treatments on the fermentation metabolites and bacterial profiles of kimchi", Journal of Food Science , 82:1124-1131), sulfur containing reported that a decrease in compounds and an increase in terpenes were related to improving the flavor of kimchi. Therefore, as a result of this study, EFEL6901 fermented nabak kimchi has a relatively low content of sulfur containing compounds and high content of terpenes compared to other nabak kimchi, so it is considered to be helpful in improving the flavor of kimchi.

Meanwhile, FIG. 16 is a biplot result of principal components analysis (PCA) performed on the volatile flavor components of Nabak Kimchi. (A) is the result including the sample before fermentation, and (B) is the result excluding the sample before fermentation. As shown in FIG. 16, there was a clear difference between non-volatile fragrance components before and after fermentation (FIG. 16A). When PCA was applied only to nabak kimchi after fermentation, natural fermentation (NK), DRC1506, EFEL6901 and fermented nabak kimchi were located on the left , DRC301, CBA3611 based on the PC1 axis Judging from the fermented nabak kimchi located on the right, it is determined that the Lactobacillus reuteri EFEL6901 of the present invention contains an aroma component similar to that of Leuconostoc mesenteroides DRC1506.

[Example 10: Lactobacillus reuteri of the present invention ( Lactobacillus reuteri ) Analysis of metabolites of Nabak Kimchi using EFEL6901 strain]

Metabolite analysis of Nabak Kimchi was performed using a 500 MHz NMR spectrometer. Briefly, 3 ml of kimchi broth was adjusted to pH 6.0 and then centrifuged at 13000 rpm for 5 minutes to obtain a supernatant. The supernatant was mixed with 99.9% D ₂ O (deuterium oxide; Sigma-Aldrich, USA) with 0.5 mM 2,2-dimethyl-2-silapentane-5-sulfonate sodium salt (DSS; Sigma-Aldrich, USA) in a 1:1 ratio. was suspended and transferred to a 5 mm NMR tube. Afterwards, ¹ H NMR spectra were obtained using a Bruker 500-MHz NMR spectrometer (Bruker Magnetics, Faellanden, Switzerland), and identification and quantification of individual metabolites were performed using 2,2-dimethyl-2-silapentane-5-sulfonate salt sodium (DSS ; Sigma-Aldrich, USA) as an internal standard, Chenomx NMR Suite v. 6.1 (Chenomx, Canada). The results were shown in Table 9 and FIG. 17.

Group Compound NK 0day DRC1506 0day NK DRC1506 EFEL6901 DRC301 CBA3611 Carbohydrates Glucose 7.85±0.22 7.64±0.12 6.06±0.36 6.39±0.24 6.58±0.94 5.13±0.18 6.34±0.24 Fructose 9.90±0.07 9.41±0.05 2.65±0.79 1.73±0.05 2.51±0.49 3.62±0.04 4.36±0.09 Sucrose 0.61±0.02 0.30±0.00 0.75±0.23 1.05±0.08 0.49±0.23 0.22±0.04 0.41±0.02 Alcohol Ethanol 4.14±0.68 3.23±0.00 10.52±0.50 11.85±0.11 11.97±0.41 6.58±0.21 7.98±0.08 Mannitol 1.72±0.22 1.43±0.08 12.92±0.32 13.08±0.60 13.34±0.08 8.01±0.33 10.80±0.17 organic acid 2-Aminobutyrate 0.08±0.00 0.08±0.01 0.16±0.06 0.19±0.09 0.16±0.05 0.27±0.02 0.30±0.01 4-Aminobutyrate 0.64±0.01 0.58±0.01 0.99±0.06 1.25±0.08 1.03±0.08 0.82±0.11 1.31±0.03 Acetate 0.23±0.00 0.58±0.00 9.68±0.31 10.46±0.06 10.81±0.22 9.36±0.49 10.84±0.11 Lactate 0.44±0.02 0.79±0.02 13.16±0.44 13.59±0.04 13.99±0.36 13.92±0.32 15.15±0.06 Succinate 0.07±0.00 0.09±0.00 0.29±0.16 0.45±0.03 0.41±0.01 0.39±0.01 0.08±0.00 Pyruvate 0.14±0.01 0.13±0.01 0.04±0.02 0.12±0.04 0.06±0.02 0.08±0.01 0.03±0.01 Amino acids Alanine 0.48±0.02 0.51±0.03 1.06±0.05 0.94±0.07 0.86±0.03 0.81±0.11 1.08±0.03 Arginine 0.24±0.01 0.23±0.05 0.38±0.24 0.91±0.02 0.55±0.16 0.46±0.00 1.15±0.01 Asparagine 0.53±0.00 0.61±0.10 0.57±0.12 1.21±0.07 0.58±0.11 0.35±0.00 0.98±0.25 Aspartate 0.45±0.09 0.26±0.06 0.30±0.09 0.99±0.08 0.19±0.01 0.28±0.04 0.94±0.11 Cysteine 0.29±0.04 0.23±0.02 0.19±0.10 0.55±0.03 0.24±0.10 0.35±0.00 0.45±0.02 Glutamate 1.43±0.01 1.32±0.02 0.91±0.12 1.11±0.00 1.18±0.13 1.17±0.07 1.35±0.09 Glutamine 0.18±0.03 0.18±0.00 0.95±0.25 0.72±0.08 1.24±0.03 1.05±0.00 1.51±0.04 Glycine 0.36±0.13 0.07±0.01 0.39±0.17 0.86±0.04 0.59±0.16 0.28±0.05 0.24±0.04 Histidine 0.00±0.00 0.00±0.00 0.08±0.06 0.05±0.05 0.00±0.00 0.06±0.09 0.04±0.03 Isoleucine 0.10±0.02 0.15±0.01 0.07±0.03 0.17±0.05 0.05±0.03 0.13±0.00 0.17±0.01 Leucine 0.10±0.01 0.14±0.01 0.10±0.06 0.17±0.02 0.15±0.02 0.16±0.04 0.24±0.02 Lysine 0.03±0.00 0.08±0.02 0.04±0.02 0.09±0.01 0.07±0.03 0.18±0.16 0.07±0.05 Malonate 0.13±0.02 0.12±0.02 0.04±0.06 0.34±0.05 0.10±0.02 0.16±0.03 0.15±0.04 Methionine 0.11±0.02 0.11±0.01 0.10±0.01 0.19±0.01 0.05±0.02 0.10±0.00 0.09±0.04 Proline 0.13±0.05 0.38±0.10 0.51±0.24 0.40±0.11 0.40±0.06 0.45±0.00 0.85±0.07 Phenylalanine 0.03±0.04 0.00±0.00 0.09±0.03 0.05±0.04 0.13±0.01 0.13±0.10 0.14±0.04 Serine 1.19±0.06 0.86±0.03 1.61±0.18 1.19±0.30 0.96±0.22 0.70±0.17 0.86±0.00 Ornithine 0.07±0.03 0.02±0.00 0.13±0.03 0.16±0.05 0.10±0.04 0.07±0.00 0.03±0.03 trans-4-Hydroxy-L-proline 0.54±0.00 0.53±0.02 0.34±0.13 0.92±0.13 0.08±0.06 0.37±0.13 0.52±0.03 Threonine 0.07±0.00 0.07±0.00 0.47±0.24 0.35±0.13 0.38±0.07 0.46±0.13 0.46±0.01 Tryptophan 0.00±0.00 0.00±0.00 0.05±0.03 0.02±0.02 0.02±0.02 0.09±0.04 0.23±0.02 Tyrosine 0.00±0.00 0.01±0.00 0.20±0.10 0.07±0.02 0.03±0.02 0.10±0.00 0.22±0.06 Valine 0.06±0.01 0.10±0.00 0.17±0.03 0.19±0.03 0.10±0.04 0.12±0.01 0.07±0.01

17 is a biplot result of principal components analysis (PCA) performed on metabolites of Nabak-kimchi. (A) is the result including the sample before fermentation, and (B) is the result excluding the sample before fermentation. As shown in A of FIG. 17, metabolites before and after fermentation were significantly different. In addition, as shown in B of FIG. 17, when PCA is applied only to nabak kimchi after fermentation, natural fermentation (NK), DRC1506, and EFEL6901 fermented nabak kimchi are located on the left , DRC301, CBA3611 based on the PC1 axis Judging from the fermented nabak kimchi located on the right, it is judged that EFEL6901 contains metabolites similar to natural fermentation (NK) and Leuconostoc mesenteroides DRC1506. In particular, EFEL6901 fermented nabak kimchi had a similar mannitol content to DRC1506. LAB produces mannitol by reducing fructose, which has a refreshing and mild sweetness and gives kimchi a refreshing feeling. In addition, it is reported that it helps to improve the taste of kimchi by suppressing the sour taste and suppressing the phenomenon of excessive souring of kimchi. These results indicate that the Lactobacillus reuteri EFEL6901 of the present invention contains the most similar metabolite to the Leuconostoc mesenteroides DRC1506, and can improve the taste and flavor of kimchi with a high mannitol content. it means.

[Example 11: Lactobacillus reuteri of the present invention ( Lactobacillus reuteri ) Sensory evaluation of Nabak Kimchi using EFEL6901 strain]

Sensory evaluation was evaluated by a total of 30 sensory agents according to a 9-point scale after a total of 5 types of Nabak kimchi reached the right season (acidity 0.17∼0.31%/pH 3.99). The contents of the evaluation were based on preference: aroma, sour taste, sweet taste, carbonic acid-like taste, off-flavor, and total preference. The closer to 1, the lower the preference, and the closer to 9, the higher the preference.

The results are shown in FIG. 18 . 18 is a sensory evaluation result of optimally aged nabak kimchi samples fermented with probiotic strains. The results were expressed as mean ± standard error mean (SEM) (n = 30), and EFEL6901 fermented nabak kimchi showed the highest preference in overall evaluation items, but there was no significant difference between samples.

In all evaluation items, all nabak kimchi showed average or higher preference with more than 5 points on average. As a result of the comprehensive preference evaluation, EFEL6901 fermented nabak kimchi showed the highest preference, and naturally fermented (NK) nabak kimchi showed the lowest preference, but no significant difference was found. Although there was no significant difference in the sensory evaluation results, overall preference was higher than normal in all fermented nabak kimchi, which indicates that the addition of Lactobacillus reuteri EFEL6901 starter of the present invention had a negative effect on the sensory properties of nabak kimchi. means it doesn't show

Name of Depositary Institution: Research Institute of Agricultural Biotechnology

Accession number: KACC81105

Entrusted date: 20200602

Claims (6)

Lactobacillus reuteri EFEL6901 (KACC 81105BP), which produces fragrance components during fermentation and has low-temperature growth ability, anti-inflammatory activity and probiotic activity.
delete Fermented vegetables prepared by inoculating vegetables with Lactobacillus reuteri EFEL6901 (KACC 81105BP) as a seed and fermenting them,
The Lactobacillus reuteri ( Lactobacillus reuteri ) EFEL6901 (KACC 81105BP) is a fermented vegetable characterized in that it produces a fragrance component during fermentation, and also has low-temperature growth ability, anti-inflammatory activity and probiotic activity.
According to claim 3,
The fermented vegetable,
A fermented vegetable characterized in that it is kimchi.
A fermented fruit prepared by inoculating fruit with Lactobacillus reuteri EFEL6901 (KACC 81105BP) as a seed and fermenting it,
The Lactobacillus reuteri ( Lactobacillus reuteri ) EFEL6901 (KACC 81105BP) is a fermented fruit, characterized in that it produces a fragrance component during fermentation, and also has low-temperature growth ability, anti-inflammatory activity and probiotic activity.
Fermented grains prepared by inoculating grains with Lactobacillus reuteri EFEL6901 (KACC 81105BP) as a seed and fermenting them,
The Lactobacillus reuteri ( Lactobacillus reuteri ) EFEL6901 (KACC 81105BP) produces a fragrance component during fermentation, and is a fermented grain characterized in that it has low-temperature growth ability, anti-inflammatory activity and probiotic activity.

Images