KR102535845B1 - Composition containing lymphocytes comprising natural killer cell for preventing or treating of porcine epidemic diarrhea virus infection - Google Patents

Abstract

The present invention relates to a composition for preventing and treating porcine epidemic diarrhea virus infection comprising lymphocytes including NK cells as an active ingredient, and a method for culturing lymphocytes comprising anti-PED virus NK cells. Lymphocytes cultured by the lymphocyte culture method including anti-PED virus NK cells have the effect of inhibiting the proliferation of PED virus by selectively killing host cells infected with PED virus, so porcine epidemic diarrhea virus , PEDV) can be usefully applied as a pharmaceutical composition for preventing or treating infection.

Description

Composition for preventing and treating porcine epidemic diarrhea virus infection containing lymphocytes containing NK cells as an active ingredient

The present invention relates to a composition for preventing and treating porcine epidemic diarrhea virus infection comprising lymphocytes including NK cells as an active ingredient, and a method for culturing lymphocytes comprising anti-PED virus NK cells.

Porcine epidemic diarrhea virus (PEDV) is a disease that causes severe watery diarrhea and dehydration, and has a very high mortality rate, especially in piglets, resulting in significant economic losses worldwide. PEDV was first discovered in England in 1971, and since then outbreaks have been reported in swine-producing countries throughout Europe and Asia, including Belgium. In Korea, since the first outbreak in 1992, it has caused serious economic losses every year.

PEDV belongs to the Coronaviridae family and has a positive-sense, single-stranded RNA genome of about 28 kb, and has four structural proteins (glycosylated spike [S], 150-220 kDa; membrane [M], 20-30 kDa; envelope [E] , 7 kDa; nucleocapsid[N], 58 kDa) and three nonstructural proteins (replicase 1a, replicase 1b, ORF3). Among them, the PEDV S protein plays an important role in binding to the cell surface of the host in the early stage of infection, so many studies are being conducted, but the frequency of genetic mutation is very high. On the other hand, N protein was widely used for diagnosis in the early stage of PEDV infection because it is helically bound to the RNA of the virus particle and is genetically well conserved.

In order to prevent PEDV, passive immunity has been mainly performed so far by inoculating live vaccines into sows before farrowing and transferring antibodies formed to piglets through colostrum. Domestic vaccine manufacturers also produce and sell live PED vaccines, and as overseas vaccines, live PED vaccines from Japan and live mixed PED/TGE vaccines are imported.

However, in the case of live vaccines, especially in outdoor farms against PEDV, there is a high level of distrust in the preventive efficacy, and the incidence of diarrhea in piglets is increasing every year due to non-vaccination. Accordingly, there is an urgent need to develop effective agents for efficiently preventing or treating the above diseases.

Republic of Korea Patent No. 10-2126783

In order to solve the problems according to the prior art described above, the present invention is a composition for preventing and treating porcine epidemic diarrhea virus (PEDV) infection comprising lymphocytes containing NK cells as an active ingredient, and anti-PED virus NK A method for culturing lymphocytes containing cells is provided.

The present invention provides a composition for preventing and treating porcine epidemic diarrhea virus (PEDV) infection comprising lymphocytes including NK cells as an active ingredient.

Natural killer cells (NK cells) are important cells for innate immunity and are known to cause apoptosis by recognizing abnormal cells.

Immune cells containing NK cells are cells cultured by the culture method of the present invention, including NK cells, NKT cells and T cells, for example, lymphocytes, and the ratio of double NK cells and NKT cells is 50% of the total ratio Refers to cells that occupy an abnormality, such as lymphocytes.

NKT cells or NK-like T cells are cells very similar to NK cells, and unlike NK cells that mature in the liver or bone marrow, mature in the thymus and have a T cell receptor as a type of T cell. Both NK cells and NKT cells have NK cell receptors.

Specifically, the lymphocytes are characterized in that they have the ability to kill PED virus-infected cells.

The NK cells are activated NK cells, in which one or more of the activating receptors are overexpressed. The activating receptor may be any one of NKG2D, 2B4 (CD244), DNAM-1 (CD226), CD2, CD16, NKp30, NKp44, NKp46, and NKp80, but is not limited thereto.

After the lymphocytes are isolated from peripheral blood, they can be obtained by culturing them for 7 to 14 days, preferably for 7 to 9 days, and more preferably for 8 to 9 days. As a result of confirming the proliferation inhibitory effect of lymphocytes cultured for 8 and 14 days on porcine epidemic diarrhea virus, the present inventors confirmed that lymphocytes cultured for 8 days had a better proliferation inhibitory effect on porcine epidemic diarrhea virus than lymphocytes cultured for 14 days. did

The lymphocytes may be prepared by (a) separating lymphocytes from peripheral blood and suspending them in a culture medium; (b) in the suspension in step (a), at least two selected from the group consisting of IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody and plasma; It can be proliferated and obtained by an NK cell proliferation method comprising the step of introducing and culturing more than one species.

In addition, (c) after a new medium is added to the suspension in step (b) and suspended, IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody And at least two or more species selected from the group consisting of blood plasma may be further included and cultured.

In addition, (d) after a new medium is added to the suspension in step (c) and suspended, IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody And at least two or more species selected from the group consisting of blood plasma may be further included and cultured.

In addition, (e) a step of culture by adding only a new medium to the suspension in step (d) may be included.

Preferably, in steps (b) to (d), selected from the group consisting of IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody and plasma At least two or more may include any one or more of anti-NKp44 antibody and anti-NKp46 antibody, more preferably IL-2, IL-15, anti-CD56 antibody in the above steps (b) to (d); Anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody, and plasma may all be injected and cultured.

In steps (b) to (d), 100 to 500 ng/mL of IL-2, 50 to 200 ng/mL of IL-15, 0.5 to 5 μg/mL of anti-CD56 antibody, and 0.5 to 5 μg/mL of anti-CD16 antibody mL, 0.5 to 5 μg/mL of anti-NKp44 antibody, and 0.5 to 5 μg/mL of anti-NKp46 may be added, and 2 to 5 wt% of plasma may be added based on the total weight of the cell suspension. Preferably, IL-2 200 ng/mL, IL-15 80 ng/mL, anti-CD56 antibody 3 μg/mL, anti-CD16 antibody 3 μg/mL, anti-NKp44 antibody 3 μg/mL, anti-NKp46 3 ug/mL plasma is injected at 2.5 wt%.

Preferably, in step (b), at least two or more selected from the group consisting of IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody, and plasma. Silver can be added on the day of incubation.

Preferably, in step (c), at least two or more selected from the group consisting of IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody, and plasma. Silver can be introduced on the second day of culture.

Preferably, at least two or more selected from the group consisting of IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody, and plasma in step (d) It may be introduced on the 5th day of culture, and in the step (e), a new medium may be introduced on the 7th day.

Preferably, in the step (e), a new medium is introduced and further cultured for 1 to 2 days, and then obtaining cultured lymphocytes may be further included. Therefore, the composition of the present invention uses lymphocytes cultured for 8 to 9 days, more preferably for 8 days, as an active ingredient.

Referring to the experimental examples herein, the lymphocytes, specifically lymphocytes cultured for 8 to 9 days, contain 60 to 80% of NK cells, 4 to 5% of NK-like T cells, and T cells It may contain 10 to 11%. Compared to lymphocytes on day 14 of culture, it was confirmed that the ratio of NK cells in day 8 lymphocytes was lower, but the ratios of NK-like T cells and T cells were significantly increased.

In addition, the lymphocytes may have an IFN-γ secretion of 120 to 170 ng / ml, and the IFN-γ secretion of the lymphocytes on the 8th day is similarly increased by at least 5 times compared to the 14th day of culture. there was.

In addition, the lymphocytes are preferably mixed in the composition at a ratio of 1: 1 to 32: 1 compared to infected cells (target cells), and more preferably mixed in the composition at a ratio of 16: 1 to 32: 1 desirable.

In another embodiment of the present invention, a method for producing lymphocytes containing activated NK cells for the prevention and treatment of PED virus infection, that is, a method for culturing lymphocytes containing anti-PED virus NK cells is provided.

The culture method includes (a) separating lymphocytes from peripheral blood and suspending them in a culture medium; (b) in the suspension in step (a), at least two selected from the group consisting of IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody and plasma; It can be proliferated and obtained by an NK cell proliferation method comprising the step of introducing and culturing more than one species.

In addition, (c) after a new medium is added to the suspension in step (b) and suspended, IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody And at least two or more species selected from the group consisting of blood plasma may be further included and cultured.

In addition, (d) after a new medium is added to the suspension in step (c) and suspended, IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody And at least two or more species selected from the group consisting of blood plasma may be further included and cultured.

In addition, (e) a step of culture by adding only a new medium to the suspension in step (d) may be included.

Preferably, in steps (b) to (d), selected from the group consisting of IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody and plasma At least two or more types may include any one or more of anti-NKp44 antibody and anti-NKp46 antibody.

Preferably, in step (b), at least two or more selected from the group consisting of IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody, and plasma. Silver can be added on the day of incubation.

Preferably, in step (c), at least two or more selected from the group consisting of IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody, and plasma. Silver can be introduced on the second day of culture.

Preferably, at least two or more selected from the group consisting of IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody, and plasma in step (d) It may be introduced on the 5th day of culture, and in the step (e), a new medium may be introduced on the 7th day.

Preferably, in the step (e), a new medium is introduced and further cultured for 1 to 2 days, and then obtaining cultured lymphocytes may be further included.

Lymphocytes cultured by the lymphocyte culture method including anti-PED virus NK cells have the effect of inhibiting the proliferation of PED virus by selectively killing host cells infected with PED virus, so porcine epidemic diarrhea virus , PEDV) can be usefully applied as a pharmaceutical composition for preventing or treating infection.

1 is a graph showing the immune cell phenotype of cultured lymphocytes on day 8 and day 14 of culture.
Figure 2 is a schematic diagram schematically showing a co-culture test method of lymphocytes containing NK cells of the present invention and PEDV-infected Vero cells.
3 is a view showing images of cells after co-culture of lymphocytes containing NK cells of the present invention and PEDV-infected VeroE6 cells.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are only for helping the understanding of the present invention, and the scope of the present invention is not limited to these examples in any sense.

Example: Manufacturing method of immune cells containing activated NK cells

1. Phase 1

In order to prepare immune cells containing activated NK cells, the present inventors first isolated lymphocytes from human peripheral blood. Specifically, 30 ml to 60 ml of human peripheral blood was collected using a heparinized 10 ml vacuum collection tube (BD Vacutainer TM ). Then, 15 ml of Ficoll-Paque Plus (endotoxin tested, density 1.077 g/ml, GE Healthcare, USA) solution was placed in a 50 ml lymphocyte separation tube (Leuco sep, Greiner Bio-One, Swiss), and 2,000 Centrifugation at rpm allowed the solution to settle down the glass membrane in the tube. The collected blood was transferred to a separation tube and centrifuged at 2,500 rpm to separate the red blood cells and granulocyte layer into the lower layer and the mononuclear cell layer (lymphocyte layer), platelets and plasma into the upper layer to separate the blood components.

The upper layer of plasma separated by centrifugation was inactivated in a 56° C. water bath for 30 minutes. The lymphocyte layer was collected using a sterilized pipette, collected in a 15 ml tube, and centrifuged to remove the supernatant. Lymphocytes from which the supernatant was removed were suspended in 10 ml of a buffer solution (PBS) and washed. Part of the suspension was counted using a hemocytometer, and centrifuged again to collect only lymphocytes. The cell number of the harvested lymphocytes was measured to be 20 x 10 ⁶ in total.

2. Phase 2

After suspending the lymphocytes isolated in the first step in the culture medium (KBM502), IL-2 200 ng/mL, IL-15 80 ng/mL, anti-CD56 antibody 3 μg/mL, anti-CD16 antibody 3 were added to the cell suspension. ug/mL, anti-NKp44 antibody 3 ug/mL, anti-NKp46 antibody 3 ug/mL, and plasma 2.5 wt% were added, and immune cells were cultured in a 25T flask for 1-2 days at 37°C, 5% CO ₂ incubator. did Antibodies and plasma in this step were put into suspension on the day of the start of culture.

3. Step 3

After adding a new medium to the suspension in the second stage where immune cells are being cultured and suspending it, 200 ng/mL of IL-2, 80 ng/mL of IL-15, 3 μg/mL of anti-CD56 antibody, 3 μg/mL of anti-CD16 antibody, 3 μg/mL of anti-NKp44 antibody, 3 μg/mL of anti-NKp46 antibody, and 2.5 wt% of plasma were added, and incubated in a 75T flask for 2 to 3 days at 37°C, 5% CO ₂ Immune cells were cultured. Antibodies and plasma in this step were introduced on the second day of culture.

4. Step 4

In the third step, a new medium is added to the suspension in which immune cells are cultured and suspended, and then 200 ng/mL of IL-2, 80 ng/mL of IL-15, 3 μg/mL of anti-CD56 antibody, and 3 μg/mL of anti-CD56 antibody are added to the suspension. -Inject 3 μg/mL of CD16 antibody, 3 μg/mL of anti-NKp44 antibody, 3 μg/mL of anti-NKp46 antibody, and 2.5 wt% of plasma, and immunize in a 175T flask for 2 to 3 days in a 37°C 5% CO ₂ incubator cells were cultured. Antibodies and plasma in this step were introduced on the 5th day of culture.

5. Step 5

(1) A culture method

In the fourth step, 40-70 ml of a new medium was added to the suspension in which the immune cells were cultured and suspended, and then the immune cells were cultured in a 37°C, 5% CO ₂ incubator for 1-2 days.

(2) B culture method

In the fourth step, IL-2 and plasma were added to the cell suspension in which immune cells were cultured, transferred to a 1,000ml CO ₂ permeation bag, and the immune cells were cultured in a 37°C, 5% CO ₂ incubator for 7 to 10 days. IL-2 and plasma at this stage were introduced on the 7th day of culture.

6. Step 6

(1) A culture method

In step 5, the cell suspension contained in the 175T Flask was transferred to a centrifuge tube, and the cells were harvested by centrifugation at 2,500 rpm. The supernatant was discarded, and the pellet containing the cells was washed twice with 250 ml of sterile physiological saline, and the cells were harvested by centrifugation. The harvested cells were prepared by injecting the cells into a 100 ml pack of sterile saline solution for injection. This is used as the day 8 cultured cells.

(2) B culture method

In step 5, the cell suspension contained in the CO ₂ permeation bag was transferred to a centrifuge tube, and the cells were harvested by centrifugation at 2,500 rpm. The supernatant was discarded, and the pellet containing the cells was washed twice with 250 ml of sterile physiological saline, and the cells were harvested by centrifugation. The harvested cells were prepared by injecting the cells into a 100 ml pack of sterile saline solution for injection. This is used as the day 14 cultured cells.

Experimental Example 1. Phenotype analysis of immune cells containing prepared NK cells

The present inventors cultured lymphocytes isolated from peripheral blood for 8 and 14 days by the culture method of the above example, and then confirmed the phenotypes of NK cells, NK-like T cells, and T cells through flow cytometry (FIG. 1 ).

NK cells (%) NK-like T cells (%) T cells (%) Day 8 of culture 68.4 4.6 10.1 Day 14 of culture 95.6 1.2 1.5

Referring to [Table 1], as a result of analyzing the phenotype by culturing lymphocytes on the 8th day of culture, the NK cell ratio was 68.4%, the NK-like T cell ratio was 4.6%, and the T cell ratio was 10.1%. In addition, after culturing the isolated lymphocytes for 14 days, the NK cell ratio was 95.6%, the NK-like T cell ratio was 1.2%, and the T cell ratio was 1.5%.

Thus, the present inventors confirmed that immune cells containing activated NK cells (including at least 50%) can be mass-produced by isolating and culturing lymphocytes from peripheral blood. In addition, it was confirmed that the ratio of NK-like T cells and T cells was higher on the 8th day of culture than on the 14th day of culture, although the NK ratio was relatively lower.

Experimental Example 2. Confirmation of the amount of IFN-γ secretion, which is an indicator of the killing ability of immune cells containing NK cells prepared according to the culturing step

The present inventors cultured the lymphocytes isolated from peripheral blood for 8 days and 14 days by the culture method of the above example, and then confirmed the amount of IFN-γ secretion that can confirm NK cell activation.

After harvesting all the cells cultured on the 8th and 14th days, centrifugation was performed at 1500 rpm for 20 minutes, and 1 ml of the supernatant was transferred to a new tube. NK cell activity was confirmed by the amount of IFN-γ secretion using a human IFN-gamma ELISA kit (R&D systems).

incubation days IFN-γ (ng/ml) Case 1 Case 2 Case 3 Day 8 128 168 120 Day 14 19 24 21

Referring to [Table 2], it can be seen that the secretion of IFN-γ (cytokine) is increased in NK cells cultured on day 8 compared to immune cells containing NK cells cultured on day 14. This can be seen that the 8th day of culture secretes the maximum amount of interferon-γ (IFN-γ) than the 14th day, and the activity of natural killer cells is very high. It can be seen that the cultured cells on the 14th day are in the proliferative stage after the activation phase is completed compared to the activated cells on the 8th day, and thus have relatively less ability to secrete IFN-γ.

According to these results, the present inventors tested the effect of inhibiting the proliferation of the COVID-19 virus using NK cells cultured for 8 days.

Experimental Example 3. Inhibition of proliferation of PED virus through activated NK cells

1. Observation of cell shape after co-culture with NK-virus infected Vero cells

VeroE6 cells (monkey kidney cells) were infected with Porcine epidemic diarrhea virus (PEDV) to prepare PED virus-infected cells.

PEDV-infected VeroE6 cells (target cells, T) were treated with immune cells (effector cells, E) cultured on the 8th day of Example at a ratio of E: T = 16: 1, 32: 1 and co-cultured for 24 and 48 hours , The state of the cells was observed by taking pictures with a dissecting microscope (Figs. 2 and 3)

Figure 3A shows an image of VeroE6 cells not infected with PEDV as a negative control, which shows the appearance of a typical host cell. The cells at this time are used for the negative control group of qRT-PCR (virus non-detection control group).

3B shows an image of VeroE6 cells infected with PEDV as a positive control group, and after virus infection, the virus proliferated and ruptured the host cells, confirming that some cell shapes were not constant (virus detection control group).

3C shows that when the immune cells cultured on day 8 of Example and VeroE6 cells infected with PEDV are co-oriented, NK cells remain aggregated and exist close to PEDV-infected VeroE6 cells. It can be confirmed that the proliferation is suppressed to maintain the appearance of the host cell.

2. Real-time reverse transcription polymerase chain reaction (qRT-PCR) experiments

In order to quantitatively measure the amount of virus in VeroE6 cells, VeroE6 cells not infected with PED virus and VeroE6 cells infected with PED virus and immune cells cultured on day 8 of Example were co-cultured for 48 hours at different ratios, respectively. was harvested and qRT-PCR was performed using the primers in [Table 3].

For real-time reverse transcription polymerase chain reaction (qRT-PCR), Engenomics' TOPreal™ One-step RT qPCR Kit (SYBR Green, low Rox) and 1 μL each of PEDV-F and PEDV-R primers were used, and the reaction temperature conditions were First, reverse transcription was performed at 42 ° C for 30 minutes, denaturation at 95 ° C for 10 minutes, 35 cycles of 95 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 30 seconds were repeated, followed by 72 ° C was further elongated for 5 min. These results were observed and analyzed using Biorad's CFX96 Touch ^TM Real-time PCR detection system, and are shown in [Table 4].

primer Nucleotide sequence (5'-3') PEDV-F TTTATTCTGTCACGCCAT PEDV-R AGATTTACAAACACCTATGTTA

E:T 32:1 16:1 8:1 4:1 2:1 1:1 positive ¹⁾ voice ²⁾ C _t value 34.47 29.4 22.68 20.34 19.84 19.21 13.96 33.68

1) Positive control: VeroE6 cells infected with PED virus

2) Negative control: uninfected VeroE6 cells

It can be said that the closer the qRT-PCR result is to the negative control result value, the higher the cytotoxicity to virus-infected cells.

Referring to FIG. 4, the C _t value in the positive control group (VeroE6 cells infected with PED virus) was 13.96 cycles, indicating that the number of PCR cycles reached the gene detection limit, indicating that the virus was significantly present. In contrast, in the negative control group (uninfected VeroE6 cells), the C _t value was 33.68 cycles, indicating that a very small amount of PED virus was present.

When the immune cells cultured on day 8 of Example were co-cultured with PED virus-infected VeroE6 cells, the C _t value was 34.5 cycles when co-cultured with E:T=32:1. Since this is close to the value of the negative control group, it can be said that the PED virus is not significantly present. In other words, it means that the virus-infected cells are killed by the NK cells included in the immune cells of the present invention, and the virus replicated in the host cell has reached a level where it is not detected.

In the case of E:T=16:1 co-culture, the C _t value is 29.0 cycles. This means that more virus is present at a lower value than E: T = 32: 1, and also indicates that virus-infected cells are killed in a NK cell dose-dependent manner.

In fact, E:T = 32:1 -> 16:1 -> 8:1 -> 4:1 -> 2:1 -> 1:1 generally showed lower C _t values. When examining the increase in C _t value, the C _t value increased steadily from 1:1 to 8:1 ratio, but it was confirmed that the C _t value increased significantly when co-cultured at a ratio of 16:1 .

It can be said that the closer the qRT-PCR result is to the negative control result value, the higher the cytotoxicity to virus-infected cells. Therefore, when the PEDV-infected VeroE6 cells and the immune cells cultured on the 8th day of Example are co-cultured, the virus-infected cells are killed by the NK cells included in the immune cells, suppressing the proliferation of the virus and replicating in the host cell. It was confirmed that the detected amount of virus was reduced.

PEDV-infected cells will be killed by the cultured immune cells on day 8 of the example of the present invention, and these results suggest that the prognosis of PEDV-infected pigs depends on cytotoxic activation of NK cells, and the possibility of future animal immune cell therapy suggests

3. Comparison with immune cells cultured for 14 days

The present inventors conducted a real-time reverse transcription-polymerase chain reaction (qRT-PCR) experiment in the same manner as above using the immune cells cultured for 14 days in the above example, and the results are shown in [Table 5].

E:T 32:1 16:1 8:1 4:1 2:1 1:1 positive ¹⁾ voice ²⁾ C _t value 23.26 21.54 18.68 15.42 13.84 13.82 13.75 32.94

1) Positive control: VeroE6 cells infected with PED virus

2) Negative control: uninfected VeroE6 cells

Comparing [Table 4] and [Table 5], it was confirmed that immune cells cultured for 8 days showed higher C _t values than immune cells cultured for 14 days. This is consistent with the results shown in Experimental Examples 1 and 2, and means that the immune cells cultured on the 8th day are more effective in inhibiting viral growth than the immune cells cultured on the 14th day.

Claims (9)

Contains lymphocytes including NK cells as an active ingredient,
The lymphocytes may be prepared by (a) separating lymphocytes from peripheral blood and suspending them in a culture medium;
(b) IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody, and plasma were added to the suspension in step (a) on the first day of culture, and Incubated for ~2 days;
(c) After a new medium is added to the suspension in step (b) and suspended, the IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody and plasma incubating for 2 to 3 days by adding to the second day of culture;
(d) After a new medium is added to the suspension in step (c) and suspended, the IL-2, IL-15, anti-CD56 antibody, anti-CD16 antibody, anti-NKp44 antibody, anti-NKp46 antibody and plasma Introducing the culture on the 5th day and culturing for 2 to 3 days; And
(e) adding only a fresh medium to the suspension in step (d) on the 7th day of culture, culturing for 1 to 2 days, and then obtaining lymphoid cells;
The lymphocytes are lymphocytes cultured for 8 to 9 days.
A composition for preventing and treating porcine epidemic diarrhea virus (PEDV) infection.
According to claim 1,
The lymphocyte is a composition for preventing and treating porcine epidemic diarrhea virus infection having the ability to kill PED virus infected cells.
delete delete delete According to claim 1,
The lymphocytes contain 60 to 80% of NK cells, 4 to 5% of NK-like T cells, and 10 to 11% of T cells. A composition for preventing and treating porcine epidemic diarrhea virus infection.
According to claim 1,
The lymphocyte is a composition for preventing and treating porcine epidemic diarrhea virus infection with an IFN-γ secretion of 120 to 170 ng / ml.
delete delete

Images