KR102533009B1 - Polypeptide having antifibrinolytic function and fibrinolysis inhibitor composition comprising the same - Google Patents

Abstract

The present invention relates to an anti-fibrinolysis polypeptide and a fibrinolysis inhibitor composition comprising the same, and more particularly, to an anti-fibrinolysis polypeptide comprising an amino acid sequence binding to the C-terminal region of fibrinogen Aα chain; A nucleic acid molecule comprising a nucleic acid sequence encoding the anti-fibrinolytic polypeptide; And it relates to a fibrinolysis inhibitor composition comprising the anti-fibrinolysis polypeptide.

Description

Antifibrinolysis polypeptide and fibrinolysis inhibitor composition comprising the same {Polypeptide having antifibrinolytic function and fibrinolysis inhibitor composition comprising the same}

The present invention relates to an anti-fibrinolysis polypeptide and a fibrinolysis inhibitor composition comprising the same, and more particularly, to a polypeptide derived from a bacteriophage of Streptococcus mitis and having an anti-fibrinolysis inhibitory effect It relates to a lytic polypeptide and a fibrinolysis inhibitor composition comprising the same.

Bleeding is one of the most common clinical problems in trauma, surgery, hemorrhagic disease, seizure, menorrhagia and liver disease. When blood vessels are damaged by trauma or disease and bleeding occurs, in order to stop the bleeding, blood vessel constriction and platelet plug are formed by adhesion and aggregation of platelets, which is the first hemostasis process, and coagulation factor, which is the second hemostasis process. Through their activation, fibrin (fibrin) is made and a hemostatic plug is formed, resulting in complete hemostasis. Ultimately, prothrombin is converted to thrombin, and fibrinogen must be finally converted to fibrin due to thrombin to achieve hemostasis. The primary hemostasis process and the secondary hemostasis process are not separate processes but are related to each other. Platelet activation, the primary hemostasis process, accelerates blood coagulation, and thrombin, a product of the secondary hemostasis process, induces platelet activation. When the damage is restored, there is a process of dissolving fibrinolysis formed during the hemostasis process, and accordingly, blood flow is made normal. In other words, the hemostasis process is a series of complex processes involving blood vessels, platelets, coagulation factors, coagulation inhibitors, and fibrinolysis.

The fibrinolytic system refers to a system that enzymatically dissolves hemostatic clots or fibrin fibers that occur as a result of blood coagulation, and plays a role in maintaining the patency of blood vessels by inhibiting excessive formation of blood clots or dissolving clots. . The most important factor in the fibrinolysis system is plasminogen in plasma. On the other hand, fibrinogen is a 340 kDa glycoprotein composed of three pairs of distinct polypeptide chains (Aα, Bα, γ) linked by 29 disulfide bridges. It can be polymerized by hydrolytic catalysis of the terminal by thrombin, resulting in fibrin clots or blood clots. Fibrin polymers can be degraded by a proteolytic process known as fibrinolysis controlled by a series of cofactors, inhibitors and receptors. The bound plasminogen is cleaved from AA561 by plasminogen activator (PA) and activated as plasmin to induce fibrinolysis to dissolve fibrin lumps, thereby dissolving fibrin/fibrinogen (fibrin/fibrinogen). Fibrinogen) makes fibrin/fibrinogen degradation product (FDP).

Activation of this fibrinolytic process can be used to treat thrombotic diseases. Conversely, inhibition of fibrinolysis can be used in the treatment of hemorrhagic disorders, and there are several targets available for inhibition of fibrinolysis. For example, activity of plasminogen activator inhibitor 1 (PAI-1), inhibition of u-PA and/or t-PA activity, inhibition of PLN activity, and activation of antiplasmin, etc. No. 2011-0114376 discloses a nucleic acid molecule sequence encoding a venom Kunits-type serine protease inhibitor that specifically inhibits plasmin and a polypeptide encoded therein. However, it is very difficult to precisely inhibit the proteolytic sites of tPA, uPA and PLN.

On the other hand, inhibitors of fibrinolysis can reduce bleeding without increasing the risk of complications due to blood clots in surgery for, for example, menorrhagia, hemophilia and von Willebrand's disease, or can be used for general treatment of cancer, cardiovascular disease, inflammatory disease and many other diseases. It can be used to prevent plasmin-induced protein hydrolysis, which is a pathological mechanism, and can also be successfully used to treat hereditary angioedema. However, for example, tranexamic acid, a compound currently marketed for the treatment of excessive menstruation, requires multiple doses of a large amount, resulting in side effects on the stomach and the like. Therefore, it is expected that it can be usefully applied for related purposes when an inhibitor of fibrinolysis that is safer for the human body is provided.

Accordingly, one aspect of the present invention is to provide an anti-fibrinolytic polypeptide.

Another aspect of the present invention is to provide a fibrinolysis-inhibiting composition comprising such an anti-fibrinolytic polypeptide.

According to one aspect of the present invention, an antifibrinolysis polypeptide comprising an amino acid sequence that binds to the C-terminal region of fibrinogen Aα chain is provided.

According to another aspect of the present invention, a fibrinolysis-inhibiting composition comprising the anti-fibrinolysis polypeptide of the present invention is provided.

The present invention identified a region having fibrinolysis inhibitory effect among polypeptides derived from bacteriophage of Streptococcus mitis, and since the polypeptide binds to fibrinogen and can inhibit plasminogen binding, hemostasis It can be used to inhibit fibrinolysis in necessary hemorrhagic diseases, trauma, surgery, etc.

1(a) and 1(b) show the entire _Aα (variant 1), N-terminal region (1-197; variant 2) and The results of investigation of binding to the recombinant such as the C-terminal region (αC domain; 198-610; variant 3) by Far-Western blotting are shown. Furthermore, FIG. 1(c) shows the results of isolating several soluble cleaved forms of the MalE-fused region and testing for lysin _102-198 binding in order to identify the plasminogen-specific binding region on fibrinogen.
2(a) and 2(b) show the binding of immobilized fibrinogen Aα variants 4, 5 or 10 with FLAGlysin102-198 (Fig. 2(a)) and plasminogen (Fig. 2(b)) to anti-FLAG Or, it shows the result measured by ELISA using an anti-plasminogen antibody. Figure 2(c) shows the inhibition of lysin _102-198 binding to immobilized fibrinogen by fibrinogen, fibrinogen Aα variant 10 or 5. (* = P <0.05, compared with the untreated group) Figure 2 (d) shows the relative ratio of S. mitis SF100 (WT) or its isogenic mutant (PS1006) to immobilized fibrinogen, fibrinogen Aα variant 10 or 5 To show binding, bacteria (10 ⁹ CFU/ml) were incubated with immobilized fibrinogen, fibrinogen Aα variants 10 or 5 (1 μM). The bound bacteria were stained with 0.1% crystal violet and the optical density was measured at 630 nm. Bar graphs represent the mean (±SD) of triplicates of a representative experiment. (* = P <0.05, compared with WT) Meanwhile, A450 and A630 on the y-axis mean the absorbance at the corresponding nm.
FIG. 3 shows lysin _SM1 binding to fibrinogen (FIG. 3 (a)) and fibrinogen αC region (FIG. 3 (b)) to confirm the interaction between fibrinogen and fibrinogen αC domain of plasminogen and lysin _102-198 . Left panel), lysin _102-198 (middle panel) and plasminogen (right panel) show surface plasmon resonance analysis results.
Figure 4 shows inhibition experiments of plasminogen binding to fibrinogen by recombinant lysin _SM1 and secreted lysin _SM1 . Figure 4 (a) shows that recombinant lysin _SM1 inhibits plasminogen binding to immobilized fibrinogen. , Figure 4 (b) shows the inhibition of plasminogen binding to fibrinogen by lysin _102-198 (SPR analysis), and Figure 4 (c) shows S. mitis SF100 (WT) and lysine deficient strain (PS1006) The result of confirming Lysin _SM1 expression in the cytoplasm (CW) or _culture supernatant (CS) by rabbit anti-lysin _SM1 IgG is shown, and FIG. It shows the result of inhibition of minogen binding. On the other hand, A450 on the y-axis means the absorbance at the corresponding nm.
Figure 5 shows the results of inhibition of plasmin (plasminogen)-mediated fibrinolysis by recombinant lysin _SM1 .

Hereinafter, preferred embodiments of the present invention will be described with reference to the accompanying drawings. However, the embodiments of the present invention may be modified in various forms, and the scope of the present invention is not limited to the embodiments described below.

According to the present invention, an anti-fibrinolysis polypeptide having fibrinolysis inhibitory effect as a polypeptide derived from a bacteriophage of Streptococcus mitis and a fibrinolysis inhibitor composition comprising the same are provided.

The antifibrinolysis polypeptide of the present invention comprises an amino acid sequence that binds to the C-terminal region of the fibrinogen Aα chain. More specifically, the C-terminal region of the fibrinogen Aα chain is the αC domain (533-610 ) will be

The anti-fibrinolysis polypeptide preferably has the amino acid sequence of SEQ ID NO: 1, wherein the anti-fibrinolysis polypeptide is Streptococcal phage Lysin _102-198 .

The Streptococcal-derived phage Lysin _102-198 is a polypeptide derived from bacteriophage of Streptococcus mitis, and may be included in anti-fibrinolysis polypeptide Lysin _SM1 having fibrinolysis inhibitory effect there is. At this time, the amino acid sequence of the antifibrinolysis polypeptide Lysin _SM1 is as shown in SEQ ID NO: 3, and an exemplary nucleic acid sequence encoding it is as shown in SEQ ID NO: 4.

Lysin _SM1 is known to bind to fibrinogen and act as an adhesin that generally _increases the binding of bacteria _. , and through this, it was confirmed that the binding of plasminogen, a fibrinolytic enzyme, was inhibited.

On the other hand, according to the present invention, a nucleic acid molecule comprising a nucleic acid sequence encoding the anti-fibrinolysis polypeptide is provided, and the nucleic acid sequence encoding the anti-fibrinolysis polypeptide is, for example, the nucleic acid sequence of SEQ ID NO: 2 .

Furthermore, according to the present invention, a fibrinolysis inhibitor composition comprising the above-described antifibrinolysis polypeptide of the present invention is provided.

The antifibrinolytic polypeptide may be included in an amount of 0.5 to 250 μM, for example, 0.8 to 100 μM or 1 to 20 μM.

The fibrinolysis inhibitor composition of the present invention may be for treating a hemorrhagic disease, wherein the bleeding disease is not particularly limited, and may be a genetic or acquired bleeding disease, for example, platelet dysfunction, hemophilia, von Willebrand It may be at least one genetic or acquired hemorrhagic disease selected from the group consisting of diseases, liver diseases, and deficiency of coagulation factors due to vitamin K deficiency.

Furthermore, the fibrinolysis inhibitor composition of the present invention is a pharmaceutical composition and can be used according to conventional methods according to the purpose of use, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, oral formulations such as aerosols, sterile injection solutions, parenteral It can be formulated and used in various forms such as a spherical dosage form.

Examples of suitable carriers, excipients and diluents that may be included in such compositions include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginates, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, amorphous cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil; and the like.

In addition, the composition of the present invention may further include a filler, an anti-coagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifier, a preservative, and the like.

On the other hand, the fibrinolysis inhibitor composition may be for suppression of bleeding caused by at least one of trauma and surgery. At this time, the fibrinolysis inhibitor composition is a topical composition, preferably in an external formulation, and such an external composition is a cream, gel, patch, spray, ointment, warning agent, lotion, liniment agent, pasta agent or cataplasma agent. It can be prepared and used as a pharmaceutical composition in the form of an external skin preparation, but is not limited thereto.

Hereinafter, the present invention will be described in more detail through specific examples. The following examples are merely examples to aid understanding of the present invention, and the scope of the present invention is not limited thereto.

Example

1. Strains and Growth Conditions

Bacteria and plasmids used in this experiment are shown in Table 1 below.

Strains/Plasmids role Streptococcus mitis SF100 Strains with LysinSM1 Escherichia coli BL21 (DE3) Used for protein expression and purification pET28a Used for expression and purification of LysinSM1 or Lysin102-198 pMAL-c2x Used for Fibrinogen Aa chain polypeptide purification

Streptococcus mitis (S. mitis) SF100 was cultured in Todd-Hewitt broth (Difco; Franklin Lakes, NJ) supplemented with 0.5% yeast extract (THY). E. coli ( Escherichia coli ) The strain was cultured at 37 ℃ under aeration in Luria-broth (LB; Difco). Appropriate concentrations of antibiotics were added to the medium as needed.

On the other hand, an isogenic mutant (PS1006 = SF100Δlys) of S. mitis SF100, a lysine-deficient strain, was provided by Professor Paul M. Sullam, University of California at San Francisco School of Medicine.

2. Cloning and expression of fibrinogen Aα and its variants

cDNA encoding the Aα chain of human fibrinogen was provided by Susan Lord (University of North Carolina at Chapel Hill). The full length and truncates of the Aα chain were cloned into pMAL-C2X (New England Biolabs, Ipswich, MA) using the primer sets shown in Table 2 below to obtain variants of the Maltose binding protein MalE-tagged version. expressed. All recombinant proteins were purified by affinity chromatography using amylose resin according to the manufacturer's instructions.

primer One. 3357 aaGGATCCatgttttccatgaggatcgtctg 2. 3226 aaGGATCCga taggcaacac ttaccactg 3. 3399 gaGGATCCacgg aaagccccag gaaccctagc 4. 3400 caGGATCC ggcacatttg aagaggtgtc agg 5. 3531 ctGAATTCccttcccgtggtaaatcttc
6. 5432 ggaagccttccctgtccccccTAGTCTAGAa 7. 5409 Ga ggcctaacaa cccagactgg TGACTGCAGga 8. 5431 ctagacctggtagtaccggaacctggTAATCTAGAtg 9. 5415 ctcttatggaaccggatcagagTAGAAGCTTaa 10. 5456 GTTCTCATCACCCTGGGATAGCTTAGTCTAGATC

3.ysin _SM1 , lysin _102-198 or analysis by far-Western blotting for binding of plasminogen to fibrinogen and variants thereof

Purified human fibrinogen (Haematologic Technologies; Essex Junction, VT) and recombinant fibrinogen Aα variants were electrophoretically separated through 3–8% NuPAGE Tris-acetate gels (Invitrogen; Waltham MA) and PVDF membranes (Merck Millipore, Burlington, MA). ) moved to The membrane was blocked with a casein-based solution (Roche; Basel, Switzerland) for 1 hour at room temperature (RT) and then purified plasminogen (0.1 μM), FLAG in PBS-0.05% Tween20 (PBS-T). It was incubated for 1 hour with -tagged lysin _SM1 or FLAG-tagged lysin _102-198 . The membrane was then washed three times for 15 min in PBS-T and the bound proteins were stained with mouse anti-FLAG antibody (1:4000; Sigma-Aldrich; St. Louis, MO) or rabbit anti-plasminogen antibody 270 (1:3000; Abcam; Cambridge, UK).

To more clearly define the plasminogen-binding site of fibrinogen, we investigated the binding of recombinant human plasminogen to the above fibrinogen Aα chain subdomain. 1(a) and 1(b) show the entire Aα (variant 1), N _- terminal residues (1- 197; variant 2) and C-terminal region (αC domain; 198 - 610; variant 3) were purified and the binding was examined by far-western blotting. Lysin _102-198 binds variants 1 and 3 of fibrinogen but not variant 2, indicating that the lysin _SM1 binding domain is located in the αC domain of the Aα chain.

To identify the plasminogen-specific binding region on fibrinogen, several soluble truncated forms of the region fused to MalE were isolated and lysin _102-198 for immobilized recombinant fibrinogen AαC variants 3-10 (1 μM) and plasminogen was tested for binding (Fig. 1(c)). Recombinant fibrinogen digests were separated by SDS-PAGE, stained with Coomassie blue or transferred to nitrocellulose and probed with FLAG-tagged lysin _102-198 (5 μM) or plasminogen (5 μM). Binding proteins were detected with anti-FLAG or anti-plasminogen monoclonal antibodies. * indicates the expected molecular size of the recombinant variant. Recombinant lysin _102-198 was coupled to a variant comprising a region spanning amino acid residues 533 to 610, the C-terminus of the fibrinogen Aα chain. Plasminogen was shown to have two separate binding regions, binding to variants comprising regions spanning amino acid residues 533 to 610 and 283 to 410 (FIG. 1C).

4. Lysin by ELISA _SM1 , lysin _102-198 , or binding assay of plasminogen to fibrinogen and its variants

lys)에서 수집한 농축된 상층액으로 전처리하고 후속적으로 FLAG 태그된 lysin_SM1을 첨가하기 전에 세척하였다. 바인딩(binding, 결합) 수준은 3,3', 5,5'-테트라메틸벤지딘을 발색 물질로 사용하여 450 nm에서 흡광도에 의해 평가하였다. 바인딩 데이터는 GraphPad Prism ver. 7.0, 비선형 회귀 곡선 핏(fit) 및 현장(on-site) 총 바인딩 방정식을 사용하여 각 조건에 대한 평형 결합 상수(KD)를 사용하여 분석하였다.Purified fibrinogen or recombinant fibrinogen variants (0.1 μM in PBS) were fixed overnight in 96-well microtiter plates at 4°C. The wells were blocked with 300 μl of casein-based solution for 1 hour at room temperature. Plates were washed three times with PBS-T and lysin _SM1 , lysin _102-198 or plasminogen in PBS-T was added at various concentrations for 1 hour. The plate was incubated for 1 hour at 37°C, washed with PBS-T to remove unbound proteins, and rabbit anti-plasminogen antibody (1:3000) or mouse anti-plasminogen antibody (1:3000) in PBS-T for 1 hour at 37°C. Incubated with FLAG antibody (1:4000). Wash wells and incubate with goat anti-rabbit IgG (1:5000; Sigma-Aldrich) or HRP-conjugated rabbit anti-mouse IgG (1:5000; Sigma-Aldrich) in PBS-T for 1 hour at 37°C did. In some studies, wells containing immobilized fibrinogen were treated with lysin _SM1 , lysin _102-198 , lysin _1-102 , truncated recombinant fibrinogen variants Aα _533-610 or Aα _283-410 or S. mitis SF100 (WT) and allografts thereof. (isogenic) mutation (PS1006 = SF100

lys) and subsequently washed before adding FLAG-tagged lysin _SM1 . The binding (binding) level was evaluated by absorbance at 450 nm using 3,3', 5,5'-tetramethylbenzidine as a color developing material. Binding data were collected using GraphPad Prism ver. 7.0, a non-linear regression curve fit and an on-site total binding equation were analyzed using the equilibrium binding constant (KD) for each condition.

To directly compare lysin _SM1 and plasminogen that bind to the αC region, the same amounts of variants 4 (Aα198-282), 5 (Aα283-410), and 10 (Aα533-610; 0.1 μM) were immobilized in a 96-well plate. Binding between recombinant lysin _102-198 and purified plasminogen was measured by ELISA. As expected, all 100 proteins were bound to variant 10 (Fig. 2(a)). Lysin _102-198 did not show binding activity to variants 4 and 5. In contrast, plasminogen bound variant 5 (KD = 8.5 x 10 ^-5 M), but with lower affinity than variant 10 (KD = 1.8 x 10 ^-5 M) (Fig. 2(b)).

To verify this specific interaction, inhibition of binding with purified fibrinogen, variant 10 or variant 5 was investigated. When lysin _SM1 (1 μg) was co-incubated with 0 to 100 μM of these proteins (Fig. 2(c)), subsequent binding by lysin _SM1 was effectively blocked by purified fibrinogen and variant 10, whereas variant 5 was not blocked (Fig. 2(c)). These data indicate that fibrinogen's binding sites for both lysinSM1 and plasminogen co-localize within the αC domain (Aα533-610) of the fibrinogen Aα chain.

5. Binding of S. mitis to immobilized fibrinogen and recombinant proteins

Overnight cultures of S. mitis SF100 (WT) and the Δlysin isogenic mutant (PS1006) were harvested by centrifugation and suspended in PBS (final concentration, 10 ⁹ CFU/ml). Purified fibrinogen or recombinant cleaved fibrinogen variants (0.1 μM) were immobilized in 96-well microtiter plates and incubated with 100 μl of bacterial suspension at 37° C. for 30 minutes. Unbound bacteria were removed from the plate by washing with PBS and the number of bound bacteria was determined by staining with crystal violet (0.5% v/v) for 1 min as previously described.

Next, we evaluated the effect of lysin _SM1 expression on the binding of bacteria (streptococci) to fibrinogen. S. mitis SF100 (WT) and the Δlysin isogenic mutant (PS1006) were compared for binding to immobilized fibrinogen and recombinant Aα digest (variant 10). As a result, as shown in FIG. 2(d), WT bound only to fibrinogen and variant 10, but not to variant 5. Compared to the WT strain, PS1006 significantly reduced binding to both fibrinogen (P = 0.01) and variant 10 (P < 0.001). At this time, the control (control) was PBS. These findings strongly suggest that S. mitis surface lysin _SM1 mediates binding to the fibrinogen αC domain and that the binding domain is located within residues 533–610.

6. Affinity analysis for fibrinogen by surface plasmon resonance (SPR) spectroscopy

SPR spectroscopy was performed using a Reichert-4 SR7500DC system (Reichert Technologies, Munich, Germany). Human fibrinogen (0.1 μM) in purified sodium acetate buffer (pH 5.5) was covalently immobilized on a plain gold surface PEG sensor chip. Increasing concentrations (range, 0-250 µM) of lysin _SM1 , lysin _102-198 , or plasminogen in PBS were flowed over the fibrinogen at a rate of 30 µl/min with a 3 min association and dissociation time. gave. Sensorgram data were subtracted from the corresponding data from the reference flow cell and analyzed using Scrubber2 software (Reichert Technologies). A plot of binding levels (response units) at equilibrium against analyte concentration was used to determine K _D .

Figure 3 (a) shows the results of analyzing the binding affinity of lysin _SM1 , lysin _102-198 and plasminogen to purified human fibrinogen by SPR. Increasing concentrations of lysin _SM1 (12.5–100 nM), lysin _102–198 (12.5–100 nM), and plasminogen (12.5–250 nM) were flowed through the immobilized fibrinogen and the dissociation rate constants of binding for each protein. (KD) was calculated. The KD values of lysin _SM1 , lysin _102–198 and plasminogen for immobilized fibrinogen were determined to be 3.15 × 10 ^-5 , 2.32 × 10 ^-5 and 1.04 × 10 ^-5 M, respectively.

Next, the binding affinities of lysin _SM1 , lysin _102-198 and recombinant plasminogen to the Aα chain were analyzed, and the results are shown in FIG. 3(b). Lysin _SM1 did not show specific binding to immobilized variant 5, but plasminogen exhibited a _KD value of 9.2 Х 10 ^-5 M and concentration-dependent binding to this region.

In contrast, lysin _SM1 , lysin _102-198 and plasminogen showed high levels for immobilized variant 10 (Aα533-610) with affinities of 3.23 x 10 ^-5 , 1.73 x 10 ^-5 and 1.72 x 10 ^-5 M, respectively. showed a combination of

7. Lysin of plasminogen binding to fibrinogen _SM1 Inhibition assay by

Since lysin _SM1 and plasminogen bind to the αC region of fibrinogen Aα with similar affinity, then lysin _SM1 , lysin _102-198 or lysin _1-102 can competitively inhibit plasminogen binding to immobilized fibrinogen. We reviewed whether there is

Immobilized fibrinogen was pre-incubated with increasing concentrations of lysin _SM1 variants from 0 to 100 μM followed by incubation with 100 nM plasminogen. As a result, as shown in FIG. 4(a), minimal inhibition was detected for lysin _1-102 , but inhibition of 75% or more of plasminogen binding to immobilized fibrinogen was found in lysin _SM1 or lysin _102-198 . , which was significant compared to untreated fibrinogen (P < 0.05). Data expressed as mean ± standard deviation (SD) were presented in GraphPad Prism ver. 7.0 (GraphPad Software, Inc., La Jolla, CA, USA) compared for statistical significance by unpaired t test. P<0.05 is considered statistically significant.

In order to confirm the above results, the effect of lysine on plasminogen binding to fibrinogen was also investigated by SPR (FIG. 4(b)). Lysin _SM1 (1 μM) was streamed into immobilized fibrinogen followed by the addition of plasminogen (100 nM). Similar to what was observed by ELISA, the binding affinity of plasminogen to fibrinogen (K _D ) was 1.92 Х 10 ^-5 . It was reduced to 4.84 Х 10 ^-2 M in the presence of lysin _SM1 . However, after regenerating the SPR slides with glycine buffer (pH 2.0), the K _D value of plasminogen binding to fibrinogen was restored to 1.68 x 10 ^-5 M, indicating that lysin _SM1 competitively inhibits plasminogen binding to fibrinogen. confirmed that it did.

Next, we investigated whether the natural lysin _SM1 produced by S. mitis SF100 had a similar effect on plasminogen. As expected, lysin _SM1 was found in cell wall extracts and culture supernatants of S. mitis SF100, but not PS1006 (Fig. 4(c)). Approximately 0.45 ± 0.036 μg/ml of lysin _SM1 was detected in the culture supernatant of S. mitis SF100 as measured by ELISA. To determine the effect of lysin _SM1 on plasminogen binding to immobilized fibrinogen, fibrinogen-coated wells were pretreated with serial dilutions of supernatants from WT or PS1006 cultures and then incubated with plasminogen. As with recombinant lysin _SM1 , the supernatant of WT SF100 significantly inhibited plasminogen binding (P = 0.006 - 0.002), but the supernatant of PS1006 showed no effect (Fig. 4(d)).

8. Fibrinolysis analysis using thromboelasticity (TEG)

Fibrinolysis occurs with plasminogen binding to fibrinogen or fibrin, which is then cleaved by tPA to produce the active protease plasmin. To evaluate the effect of lysin _SM1 on fibrin polymerization and fibrinolysis, fibrinogen polymerization and fibrinolysis were evaluated by thromboelasticity using the Hemodyne Hemostasis Analysis System (Haemonetics; Niles, IL). This technique measures thrombus stiffness ("modulus of elasticity") over time as an indicator of clot formation or dissolution. Pre-incubation of 13.7 μM of lysin _SM1 , lysin _102-198 or lysin _1-101 in human fibrinogen (2 mg/ml) and HEPES buffer (pH 7.4) at 37°C for 30 minutes followed by TEG at 37°C. Transferred to cups and subsequently added thrombin (1 IU/ml) and plasmin (4 μg/ml) or thrombin (1 IU/ml), tPA (0.5 μg/ml) and plasminogen (4 μg/ml) . Coagulation moduli (n = 2) were recorded once per minute for 30 minutes.

Fibrinogen was pre-incubated with albumin (control), then thrombin (to activate fibrin formation and polymerization) and plasmin (to initiate fibrinolysis) were added. Coagulation was detected within 2 min, as indicated by an increase in elastic modulus, and peaked at 10 min. This was followed by a decrease in modulus (modulus), indicating that fibrinolysis was in progress, reaching less than 0 Kdyne/cm ² after 24 min (FIG. 5(a)). Fibrinolysis was completely blocked by the addition of epsilon-aminocaproic acid (EACA; 130 μg ml), a standard lysine analog used to competitively inhibit plasmin-induced fibrinolysis. When fibrinogen was pre-incubated with lysin _SM1 , coagulation reached a significantly higher level at 10 min and peaked at 15 min. These high levels of resistance to coagulation and proteolysis persisted after 30 min of exposure to thrombin and plasmin (P < 0.001). To determine whether this inhibition of fibrinolysis by lysin _SM1 is due to competitive inhibition of plasmin binding to the αC region of the fibrinogen Aα chain, fibrinogen was treated with lysin _102-198 (the region that binds to this domain) or lysin ₁ Tested by TEG after preincubation with _-102 (no αC region binding). Pre-incubation with lysin _1-102 had minimal effect that clot formation reached a similar level of clot elastic modulus. Fibrinolysis appeared to be slightly inhibited, but not to the extent seen with lysin _SM1 . In contrast, lysin _102-198 showed similar levels of clot formation and fibrinolysis inhibition (P < 0.001) as seen with lysin _SM1 .

Next, we directly investigated whether lysin _SM1 inhibits tPA-induced fibrinolysis. Fibrinogen pre-incubated with lysin _102-198 was incubated with thrombin, plasminogen and tPA for 4 minutes. As a result, as shown in FIG. 5(b), fibrinogen pre-incubated with albumin or lysin _102-198 exhibited polymerization and dissolution reactions similar to those observed in plasmin, indicating that there was no inhibition of plasminogen activation by tPA. showed up However, fibrinogen pre-incubated with lysin _102-198 did not show fibrinolysis (P < 0.001). Since tPA can only activate immobilized plasminogen, these data indicate that the blockade of fibrinolysis is due to inhibition of plasminogen binding to the αC region.

Although the embodiments of the present invention have been described in detail above, the scope of the present invention is not limited thereto, and various modifications and variations are possible without departing from the technical spirit of the present invention described in the claims. It will be obvious to those skilled in the art.

<110> KAERI <120> Polypeptide having antifibrinolytic function and fibrinolysis inhibitor comprising the same <130> DPP201239 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 97 <212> PRT <213> Streptococcus mitis <220> <221> PEPTIDE <222> (1)..(97) <223> Lysin 102-198 <400> 1 Ile Phe Val Asp Ser Asp Asn Ile Ile His Cys Asn Tyr Arg Phe Asp 1 5 10 15 Gly Ile Thr Val Asn Asp His Asp Asp Ile Trp Leu Tyr Ala Gly Arg 20 25 30 Pro Tyr Tyr Tyr Val Tyr Arg Leu Thr Asn Pro Ser Ala Ala Ala Glu 35 40 45 Glu Ile Lys Thr Gly Trp Gln Asn Asp Asp Thr Gly Tyr Trp Phe Val 50 55 60 Arg Ala Asn Gly Ser Tyr Pro Lys Asp Gln Phe Glu Tyr Ile Glu Glu 65 70 75 80 Asn Lys Ser Trp Phe Tyr Phe Asp Ala Asn Gly Tyr Met Val Ala Glu 85 90 95 Asp <210> 2 <211> 291 <212> DNA <213> Streptococcus mitis <220> <221> <222> (1)..(291) <223> Lysin 102-198 <400> 2 attttcgtgg atagtgataa cattatccac tgtaactatc gttttgatgg catcacagtg 60 aacgatcatg acgacatttg gctctatgcc ggacgacctt actattatgt gtatcgcttg 120 actaatccat ctgcagctgc cgaagaaatc aaaactggct ggcaaaatga cgatactggt 180 tactggttcg ttcgtgctaa cggatcctat ccaaaagacc aatttgagta cattgaagag 240 aacaaatcat ggttctactt cgatgcaaat ggatacatgg ttgctgaaga t 291 <210> 3 <211> 295 <212> PRT <213> Streptococcus mitis <220> <221> PEPTIDE <222> (1)..(295) <223> Full-length LysinSM1 <400> 3 Met Gly Leu Asn Leu Glu Thr Ala Ile Ala Trp Met Arg Ala Arg Lys 1 5 10 15 Gly Gln Val Ser Tyr Ser Met Asp Asp Arg Asn Gly Pro Asp Ser Tyr 20 25 30 Asp Cys Ser Ser Ser Ile Tyr Tyr Ala Leu Leu Ser Gly Gly Ala Val 35 40 45 Ser Ala Gly Trp Ala Val Asn Thr Glu Tyr Glu His Asp Trp Leu Lys 50 55 60 Lys Asn Gly Tyr Glu Leu Ile Ala Glu Asn Thr Pro Trp Asp Ala Gln 65 70 75 80 Arg Gly Asp Ile Phe Ile Trp Gly Cys Arg Gly Tyr Ser Ser Gly Ala 85 90 95 Gly Gly His Thr Gly Ile Phe Val Asp Ser Asp Asn Ile Ile His Cys 100 105 110 Asn Tyr Arg Phe Asp Gly Ile Thr Val Asn Asp His Asp Asp Ile Trp 115 120 125 Leu Tyr Ala Gly Arg Pro Tyr Tyr Tyr Val Tyr Arg Leu Thr Asn Pro 130 135 140 Ser Ala Ala Ala Glu Glu Ile Lys Thr Gly Trp Gln Asn Asp Asp Thr 145 150 155 160 Gly Tyr Trp Phe Val Arg Ala Asn Gly Ser Tyr Pro Lys Asp Gln Phe 165 170 175 Glu Tyr Ile Glu Glu Asn Lys Ser Trp Phe Tyr Phe Asp Ala Asn Gly 180 185 190 Tyr Met Val Ala Glu Asp Trp Val Lys His Thr Asp Gly Lys Trp Tyr 195 200 205 Trp Phe Asp Lys Asp Gly Tyr Met Ala Thr Ser Trp Lys Lys Ile Asn 210 215 220 Gly Lys Trp Tyr Tyr Phe Asn Arg Asp Gly Ser Met Gln Thr Gly Trp 225 230 235 240 Val Lys Tyr Tyr Glu Lys Trp Tyr Tyr Leu Asn Ser Glu Asn Gly Asp 245 250 255 Met Val Ser Asn Ala Phe Val Pro Tyr Asn Gly Gly Tyr Tyr Leu Met 260 265 270 Leu Glu Asp Gly Arg Leu Ala Glu Lys Glu Ser Phe Asn Ile Glu Pro 275 280 285 Asp Gly Leu Ile Thr Thr Lys 290 295 <210> 4 <211> 888 <212> DNA <213> Streptococcus mitis <220> <221> <222> (1)..(888) <223> Full-length LysinSM1 <400> 4 atgggactaa atcttgaaac agctatcgct tggatgcgtg ctcgaaaagg acaagtatct 60 tacagcatgg atgaccgcaa tggccctgac tcttacgact gttcaagttc aatctactac 120 gctctattga gtggaggagc cgtgtctgct ggttgggcag tcaatacaga gtatgagcat 180 gactggctca aaaagaacgg atatgagctc attgctgaga acactccatg ggatgctcaa 240 cgtggagata tcttcatttg ggggtgccgt ggatattcta gcggggcagg tggccatact 300 ggtattttcg tggatagtga taacattatc cactgtaact atcgttttga tggcatcaca 360 gtgaacgatc atgacgacat ttggctctat gccggacgac cttactatta tgtgtatcgc 420 ttgactaatc catctgcagc tgccgaagaa atcaaaactg gctggcaaaa tgacgatact 480 ggttactggt tcgttcgtgc taacggatcc tatccaaaag accaatttga gtacattgaa 540 gagaacaaat catggttcta cttcgatgca aatggataca tggttgctga agattgggtg 600 aaacacacgg atggtaaatg gtattggttt gacaaggatg gctacatggc cacttcctgg 660 aagaaaatca acgggaaatg gtattacttc aatcgtgatg gctctatgca gactggctgg 720 gttaaatact acgagaaatg gtattacctc aattcagaaa atggggacat ggtatcaaac 780 gcattcgtgc catacaacgg cggatactac ctcatgcttg aagatggtcg attggctgaa 840 aaagaaagct tcaacattga gcctgacggc ttgatcacaa cgaaataa 888

Claims (12)

A fibrinolysis inhibitor composition comprising an antifibrinolytic polypeptide comprising the amino acid sequence of SEQ ID NO: 1 that binds to the C-terminal region of fibrinogen Aα chain.
The fibrinolysis inhibitor composition according to claim 1, wherein the C-terminal region of the fibrinogen Aα chain is the αC domain (533-610) of the fibrinogen Aα chain.
delete The fibrinolysis inhibitor composition according to claim 1, wherein the antifibrinolytic polypeptide is Streptococcal Phage Lysin _102-198 .
delete The fibrinolysis inhibitor composition according to claim 1, wherein the nucleic acid sequence encoding the anti-fibrinolysis polypeptide is the nucleic acid sequence of SEQ ID NO: 2.
delete The fibrinolysis inhibitor composition according to claim 1, wherein the antifibrinolysis polypeptide is contained in an amount of 0.5 to 250 μM.
According to claim 1, wherein the fibrinolysis inhibitor composition is for the treatment of hemorrhagic disease, fibrinolysis inhibitor composition.
10. The method of claim 9, wherein the bleeding disorder is at least one genetic or acquired bleeding disorder selected from the group consisting of platelet dysfunction, hemophilia, von Willebrand disease, liver disease, and deficiency of coagulation factors due to vitamin K deficiency. , Fibrinolysis inhibitor composition.
The fibrinolysis inhibitor composition according to claim 1, wherein the fibrinolysis inhibitor composition is for suppression of bleeding caused by at least one of trauma and surgery.
The fibrinolysis inhibitor composition according to claim 11, which is a topical composition.

Images