KR102519143B1 - Novel lactic acid bacteria having immune-enhancing activity and uses thereof - Google Patents

Abstract

The present invention relates to a novel lactic acid bacterium Limosilactobacillus fermentum, which has immune-enhancing activity, and a probiotic composition or immune-enhancing composition using the same. The Limosilactobacillus fermentum MG5091 strain according to the present invention is a strain with probiotic stability such as antibiotic sensitivity, hemolysis, acid resistance, and bile resistance, and at the same time, has an excellent ability for enhancing the production of cytokine activating natural killer (NK) cell and immune response, to be useful as an immune-boosting functional probiotic and further utilized as an active ingredient in food and pharmaceutical applications such as immune-boosting medicines, functional foods, and animal feed.

Description

Novel lactic acid bacteria having immune-enhancing activity and uses thereof {Novel lactic acid bacteria having immune-enhancing activity and uses thereof}

The present invention relates to a novel lactic acid bacterium having an immune-enhancing activity, Limosylactobacillus fermentum , and a probiotics composition or an immune-enhancing composition using the same.

The immune system is a defense system composed of various cells to protect the human body from internal and external pathogenic substances, and immunity is formed through the specific function of each immune cell and mutual exchange between each cell. The human immune system is composed of immune tolerance that suppresses and regulates immunity and immune response that promotes immunity. When the two immune actions are properly balanced, immunological homeostasis can be maintained, and immune homeostasis imbalance can prevent various diseases. cause In other words, when the immune tolerance mechanism is stronger than the immune response, cancer or viral diseases are caused, and conversely, when the immune response mechanism is stronger than the immune tolerance, inflammatory diseases such as autoimmune diseases, transplant rejection, and allergic diseases are caused.

However, the incidence of immune diseases is increasing along with changes in the living environment due to industrialization and westernization, which is emerging as a serious social problem due to social, economic and cultural shrinkage. Diseases caused by immune imbalance are still lacking in understanding of the exact cause and mechanism despite active research to date, and thus, there are still difficulties in developing treatment methods and therapeutic agents.

On the other hand, health functional foods, unlike pharmaceuticals, are not for treatment, but for the purpose of reducing the risk of disease occurrence or maintaining or promoting health through activation of biological functions. Busy modern people are consuming a variety of products to manage their health through health functional food intake, and consumption trends are changing with the preference for ‘personalized health functional food’ centered on consumers. In particular, after the COVID-19 (COVID-19·coronavirus infection-19) incident, consumers' understanding of immune management has increased, consumption of related products has increased, and consumption of health functional foods related to the prevention of certain diseases/diseases is rapidly increasing.

Among health functional foods, red ginseng, vitamins, and probiotics dominate the market. Probiotics are probiotic additives that benefit the health of the host by improving the balance of microorganisms in the intestine, and lactic acid bacteria known as beneficial intestinal bacteria are mainly used. Lactic acid bacteria have been used in fermented milk foods for a long time, and recently, many studies have been conducted worldwide to reveal the functionality of lactic acid bacteria and their mechanisms.

In particular, it is expected to have considerable potential in contributing to immune homeostasis, showing immunomodulatory effects such as enhancement of intestinal epithelial cell function, protection against physiological stress, regulation of cytokine secretion, effect on T lymphocyte population, and enhancement of antibody secretion. Despite the anticipated and rapid growth of the functional probiotics market, there are no probiotics products that have been identified for enhancing immune homeostasis, and most of them are introducing products that improve immune function through the addition of auxiliary ingredients.

Under this technical background, the present inventors screened candidate bacteria having the immune system balance enhancement function while meeting the probiotics selection criteria, among which Limosyllactobacillus fermentum ( Limosilactobacillus fermentum ) Excellent immune homeostasis enhancing efficacy and mechanism of strain MG5091 identified. Accordingly, the MG5091 strain, which is highly likely to be used as an immune system-enhancing probiotic, was deposited at the Center for Biological Resources (KCTC) and received accession number KCTC14946BP.

Therefore, the present invention can provide a Limosilactobacillus fermentum MG5091 strain deposited with accession number KCTC14946BP and a probiotics composition containing the same, a composition for enhancing immunity, a health functional food for enhancing immunity, and a feed additive.

The present invention provides a Limosilactobacillus fermentum MG5091 strain deposited with accession number KCTC14946BP.

The strain may be characterized as having an immunostimulating activity.

The strain may have one or more probiotics characteristics selected from the group consisting of antibiotic sensitivity, γ-hemolytic activity, acid resistance and bile resistance.

The antibiotic sensitivity group consisting of Ampicillin, Gentamicin, Kanamycin, Streptomycin, Tetracycline, Chloramphenicol, Erythromycin and Clindamycin It may be sensitive to one or more selected from.

The strain is D-arabinose, D-ribose, D-galactose, D-glucose, D-fructose, D-Esculin, D-maltose, D-melibiose, D-sucrose, D-trehalose, D - It may be characterized in that at least one selected from the group consisting of raffinose, gluconate, and 5-keto-gluconate is used as a carbon source.

In addition, the present invention provides a probiotics composition comprising a Limosilactobacillus fermentum MG5091 strain or a culture thereof deposited under accession number KCTC14946BP.

The probiotics may be characterized by having immunostimulating activity, antibiotic sensitivity, γ-hemolytic activity, acid resistance or bile resistance.

In addition, the present invention provides a composition for enhancing immunity comprising a Limosilactobacillus fermentum MG5091 strain, a culture thereof, or a lysate thereof deposited under accession number KCTC14946BP.

The composition may be any one selected from the group consisting of pharmaceutical compositions, food compositions, and feed compositions.

The immune enhancement is phagocytosis; Promote NK cell (Natural killer) activity; enhancing cytokine production of TNF-α, IL-1β, IL-6, iNOS or COX-2; or enhancing MARK/ERK or NF-κB signaling pathway activity; It can be characterized as being made through.

In addition, the present invention provides a health functional food for enhancing immunity including a Limosilactobacillus fermentum MG5091 strain, a culture thereof, or a lysate thereof deposited under accession number KCTC14946BP.

In addition, the present invention provides a feed additive for immunity enhancement comprising a Limosilactobacillus fermentum MG5091 strain, a culture thereof, or a lysate thereof deposited under accession number KCTC14946BP.

Limosilactobacillus fermentum MG5091 strain according to the present invention is a strain with probiotics stability such as antibiotic sensitivity, hemolysis, acid resistance and bile resistance, and simultaneously activates NK cells (Natural killer cell) and activates immune response cytokines It is useful as an immune-enhancing functional probiotic because of its excellent production enhancement ability, and can be further used as an active ingredient in food and medicine applications such as immunity-enhancing drugs, functional foods, and animal feeds.

1 is a diagram showing the amount of NO production (A) and cell viability (B) according to the treatment of lyophilisate of lactic acid bacteria culture filtrate in macrophages (RAW264.7) (*: p<0.05)
Figure 2 is a diagram showing the amount of NO production (A) and cell viability (B) according to the treatment of LPS-treated macrophages (RAW264.7) with the lyophilisate of the lactic acid bacteria culture filtrate (*: p<0.05).
Figure 3 is a diagram showing the iNOS mRNA expression level (A) and COX-2 mRNA expression level (B) according to the treatment of the lyophilized product of the lactic acid bacteria culture filtrate in macrophages (RAW264.7) (*: p<0.05).
Figure 4 is a diagram showing the amount of TNF-α production (A), IL-6 production (B), and IL-1β production (C) according to the treatment of lactic acid bacteria culture filtrate lyophilisate in macrophages (RAW264.7) (*: p <0.05).
Figure 5 is a diagram showing ERK, NF-kB and TLR2 phosphorylation (A) and quantitative graphs (B-D) according to the treatment of lyophilisate of lactic acid bacteria culture filtrate in macrophages (RAW264.7) (*: p<0.05).
Figure 6 is a diagram showing the phagocytosis of macrophages (RAW264.7) according to the lactic acid bacteria culture filtrate treatment (*: p<0.05).
7 is a diagram showing the proliferation of NK-92 cells according to the treatment of the lyophilisate of the lactic acid bacteria culture filtrate.
8 is a diagram showing the amount of granzyme B expression in NK-92 cells according to the treatment of the lyophilisate of the lactic acid bacteria culture filtrate (*: p<0.05).
Figure 9 is a diagram showing the toxicity of NK-92 cells treated with lactic acid bacteria culture filtrate to K562 target cells (*: p<0.05).
10 is a diagram showing hemolytic readings of lactic acid bacteria.
11 is a diagram showing the acid resistance of lactic acid bacteria.
12 is a diagram showing the bile resistance of lactic acid bacteria.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related art, and unless explicitly defined in this application, it should not be interpreted in an ideal or excessively formal meaning. don't In addition, in describing the present invention, if it is determined that a detailed description of a related known technology may unnecessarily obscure the subject matter of the present invention, the detailed description will be omitted.

The present inventors selected candidate bacteria having the function of enhancing the balance of the immune system while meeting the probiotics selection criteria, and identified the excellent immune homeostasis enhancing efficacy and mechanism of the Limosilactobacillus fermentum MG5091 strain. Accordingly, the MG5091 strain, which is highly likely to be used as an immune system enhancing probiotic, was deposited with the Center for Biological Resources (KCTC) on April 15, 2022, and was given accession number KCTC14946BP.

In one aspect, the present invention relates to a Limosilactobacillus fermentum MG5091 strain deposited with accession number KCTC14946BP.

The MG5091 strain may be characterized as having an immune enhancing activity.

According to one embodiment of the present invention, the macrophages treated with the MG5091 strain are similar to or better when compared with the macrophages in which the innate immune response is activated by LPS (Lipopolysaccharide) as a positive control. Confirmed.

Specifically, it is a group of proteins involved in immune modulation, which regulates the expression of various genes and activates the NF-kB pathway, which forms the central axis of the intracellular signal transduction system, and induces enzymes iNOS and COX-, which are regulated by this. 2 expression and increased production of cytokines TNF-α, IL-6 and IL-1β. In addition, it was confirmed that strain MG5091 can enhance the body's immune response by activating Toll-like receptors (TLRs), which are recognition molecules for various pathogens including bacteria, viruses, fungi and parasites.

In addition, it was confirmed that the MG5091 strain enhanced the phagocytosis of macrophages and enhanced the proliferation and activity of NK cells. NK cells (Natural killer cells; natural killer cells) perform the functions of eliminating host cells infected with tumor cells, bacteria, intracellular parasites or viruses without prior sensitization by antigens, rejecting inappropriate bone marrow transplantation, and T cells It is a behavioral cell that acts in the first line of the immune system defense mechanism in vivo, such as regulating the immune response of the body. The activity of these NK-cells and the phagocytosis of macrophages increase the in vivo immune response, so the MG5091 strain according to the present invention is a strain having an immune enhancing activity.

In addition, the MG5091 strain may have one or more probiotics characteristics selected from the group consisting of antibiotic sensitivity, γ-hemolytic activity, acid resistance and bile resistance.

Currently in use, the concept of probiotics, as adopted and recommended by the Food and Drug Organization (FAO) and the World Health Organization (WHO), refers to live microorganisms that have a beneficial effect on host health when ingested in adequate amounts, and are characterized by safety, functionality, and technological usefulness. have to be satisfied In addition, if lactic acid bacteria are resistant to various antibiotics, there may be a risk of spreading the antibiotic resistance gene to opportunistic or pathogenic microorganisms living in the intestine, so it is recommended to evaluate antibiotic resistance and virulence factors for probiotics.

According to one embodiment of the present invention, strain MG5091 exhibits acid resistance and bile resistance under conditions similar to the human intestinal environment, so that viability is not threatened, and stability as a probiotic is confirmed by exhibiting γ-hemolysis that does not cause hemolysis . In addition, through the resistance evaluation of each antibiotic, it was confirmed that the MG5091 strain is unlikely to transmit resistance genes to intestinal bacteria. The antibiotic is from the group consisting of Ampicillin, Gentamicin, Kanamycin, Streptomycin, Tetracycline, Chloramphenicol, Erythromycin, and Clindamycin It may be one or more selected species, but is not limited thereto.

Therefore, the MG5091 strain or its culture according to the present invention can be used as an active ingredient of a probiotics composition having functional and intestinal stability represented by immune enhancing activity.

In the present invention, the culture of lactic acid bacteria is a product obtained by culturing a predetermined strain in a medium, and the medium may be selected from known liquid medium or solid medium, for example, MRS liquid medium, MRS agar medium, BL agar It may be a badge, but is not limited thereto.

To culture MG5091 strain, D-arabinose, D-ribose, D-galactose, D-glucose, D-fructose fructose), D-esculin, D-maltose, D-melibiose, D-sucrose, D-trehalose ), at least one selected from the group consisting of D-raffinose, gluconate and 5-keto-gluconate can be used as a carbon source, but is not limited thereto .

From another point of view, the present invention relates to a variety of pharmaceutical, food, and feed uses as an immune enhancing composition comprising Limosilactobacillus fermentum MG5091 strain, culture thereof or lysate thereof deposited under accession number KCTC14946BP .

In the present invention, the composition may be embodied as a pharmaceutical composition, food additive, food composition or functional food composition, feed composition, etc., depending on the purpose or aspect of use. In addition, the content of lactic acid bacteria as an active ingredient may also be adjusted in various ranges according to the specific form, purpose or aspect of the composition. In addition, in order to enhance the convenience of intake or intake through enhancement of immune effect and addition of reinforcement or similar activity, one or more of any compounds or natural extracts known to have the corresponding activity and whose safety has already been verified in the art are added. can be included with

The composition for enhancing immunity may be provided as a pharmaceutical composition in one aspect.

NK cells, whose activity is confirmed to be enhanced by the MG5091 strain according to the present invention, play an important role in the innate immune response against pathogens or cancer cells infected with the host and the acquired immune response through cytokine secretion. The main mechanism used to kill is to secrete cytolytic granules such as Perforin and Granzyme B into target cells through immune synapses. The granzyme entered into the target cell through the induction of apoptosis of the target cell. As such, NK cells have been confirmed to play a crucial role in the carcinogenesis process in which cells are transformed into malignant cells or in the defense mechanism in the early stages of viral infection. Based on these studies, NK cell therapy is emerging for the treatment of cancer or immune diseases. .

In this regard, the MG5091 strain according to the present invention activates NK cells, activates immune response-related signal transduction, and increases the production of cytokines that induce immune responses, thereby preventing, improving or treating immune diseases according to the immune enhancing effect. .

The immune disease is a disease caused by decreased immune function, but is not limited thereto, autoimmune diseases such as rheumatoid arthritis, type I diabetes, multiple sclerosis and systemic lupus erythematosus, asthma, encephilitis, inflammatory enteritis , inflammatory diseases such as chronic obstructive pulmonary disease, allergy, septic shock, pulmonary fibrosis, undifferentiated spondyloarthrosis, undifferentiated arthropathy, arthritis, inflammatory osteolysis, and chronic inflammation caused by chronic viral or bacterial infections, various cancers, and It can include viral diseases such as the common cold.

The pharmaceutical composition may further include appropriate carriers, excipients, and diluents that are commonly accepted pharmaceutically in the art in addition to the active ingredient. In addition, it may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories and sterile injection solutions according to conventional methods. Suitable agents known in the art are preferably those disclosed in the literature (Remington's Pharmaceutical Science, recently, Mack Publishing Company, Easton PA), but are not limited thereto.

When the pharmaceutical composition is prepared as an oral dosage form, powders, granules, tablets, pills, dragees, capsules, solutions, gels, syrups, suspensions, wafers, etc. according to methods known in the art together with known suitable carriers. It can be prepared in the form of.

When the pharmaceutical composition is prepared as a parenteral dosage form, it may be formulated in the form of injections, transdermal preparations, quasi-drugs, nasal inhalants and suppositories along with known suitable carriers according to methods known in the art.

The composition for enhancing immunity may be provided as a food composition in another aspect. In addition, it is possible to provide a health functional food containing the MG5091 strain, its culture or its lysate according to the present invention.

The food composition includes all forms such as functional food, nutritional supplement, health functional food, and food additives. Food compositions of this type can be prepared in various forms according to conventional methods known in the art.

The food composition may include food additives in addition to the active ingredient. Food additives may generally be understood as substances that are added to, mixed with, or infiltrated into food in manufacturing, processing, or preserving food. Since food is consumed daily and for a long period of time, its safety must be guaranteed. According to the Food Additives Code under the laws of each country governing the manufacture and distribution of food (in Korea, it is the 「Food Sanitation Act」), safety-guaranteed food additives are limitedly regulated in terms of ingredients or functions. In the Korean Food Additives Codex (MFDS Notification 「Standards and Specifications for Food Additives」), food additives are classified into chemical synthetic products, natural additives and mixed preparations in terms of ingredients and are regulated. It is divided into additives, preservatives, emulsifiers, acidulants, and thickeners. The food additives may be selected and added in an appropriate amount to achieve the product type and the purpose of addition according to the conventional knowledge of a person skilled in the art by a method commonly used in the art. In addition to food additives, it may further include physiologically active substances or minerals known in the art for the purpose of supplementing or reinforcing functionality and nutrition and whose safety is guaranteed as food additives.

The composition for enhancing immunity may be provided as a feed composition in another aspect. In addition, it may be provided as a feed additive containing the MG5091 strain, its culture, or its lysate according to the present invention.

The MG5091 strain may be supplied in a dried state, or may be used as it is without performing a separate drying process. The MG5091 strain may be used alone or in combination with conventionally known feed additives or feeds. In addition, known feed additives or various excipients added to feed may be included according to the selection of a person skilled in the art.

The feed composition of the present invention may further include trace nutrients such as nutrients, preservatives, preservatives, antibiotics, and vitamins commonly used in animal feed. The nutrients, preservatives, preservatives, antibiotics, trace nutrients, etc. may be arbitrarily selected and used by those skilled in the art in an amount commonly added to feed.

The feed additive according to the present invention can be used individually, can be used in combination with conventionally known feed additives, and can be used sequentially or simultaneously with conventional feed additives. And it can be single or multiple administrations. It is important to administer the amount that can obtain the maximum effect with the minimum amount without side effects in consideration of all the above factors, and it can be easily determined by those skilled in the art and prepared in various known forms.

The present invention will be described in more detail through examples or experimental examples below. These examples or experimental examples are only for exemplifying the present invention, and the scope of the present invention is not construed as being limited thereto.

Example: Selection of Lactic Acid Bacteria with Immune System Enhancement

For macrophages (RAW264.7 cell), the change in Nitric Oxide (NO) production according to the treatment of cell free supernatant (CFS) of various lactic acid strains owned by Mediogen Co., Ltd. was measured, and this Among them, lactic acid bacteria showing excellent results were selected.

Retaining strains used are shown in Table 1.

NO. strain name origin One Limosilactobacillus reuteri MG505 Human 2 Limosilactobacillus reuteri MG5346 Food 3 Lactiplantibacillus plantarum MG4215 Human 4 Lactiplantibacillus plantarum MG4557 Infant feces 5 Lactiplantibacillus plantarum MG5203 Fermented food 6 Lactiplantibacillus plantarum MG5239 Fermented food 7 Lactiplantibacillus plantarum MG4604 Infant feces 8 Lactiplantibacillus plantarum MG5023 Food 9 Lactiplantibacillus plantarum MG5185 Fermented food 10 Lactiplantibacillus plantarum MG5283 Food 11 Lactiplantibacillus plantarum MG5347 Fermented food 12 Limosilactobacillus fermentum MG4538 Infant feces 13 Limosilactobacillus fermentum MG5091 Food 14 Limosilactobacillus fermentum MG5159 Fermented food 15 Lacticaseibacillus rhamnosus MG5007 Food 16 Lacticaseibacillus paracasei MG5015 Food 17 Ligilactobacillus salivarius MG5212 Food 18 Bifidobacterium breve MG729 Infant feces 19 Bifidobacterium bifidum MG731 Infant feces 20 Bifidobacterium lactis MG741 Infant Feces 21 Streptococcus thermophilus (S. thermophilus) MG5303 Fermented food

Production of RAW264.7 cell culture and lactic acid bacteria culture filtrate lyophilisate

RAW264.7 cells (Korea Cell Line Bank, Korea) were cultured in DMEM medium containing 10% FBS and 1% penicillin-streptomycin at 37°C and 5% CO ₂ conditions. The cells were subcultured every 2 days to maintain an appropriate number of cells.

Each isolate and identified strains were incubated in MRS broth at 37° C. for 18 hours, and then centrifuged (4° C., 15 minutes, 12,000 rpm) to recover the culture filtrate except for the pellet. The recovered culture filtrate was filtered through a 0.22 μm filter and freeze-dried. The culture filtrate lyophilisate (CFS) was refrigerated until use.

Immune-enhancing effect through increased production of nitric oxide (NO)

RAW264.7 cells were seeded in a 96 well plate at 1×10 ⁵ cells/well and cultured at 37° C. under 5% CO ₂ conditions. After culturing for 24 hours, the supernatant was removed, and the culture filtrate lyophilisate dissolved in FBS-free DMEM was treated at a concentration of 5 mg/mL and cultured for 24 hours. Thereafter, the supernatant was taken and dispensed into a 96-well plate, mixed 1:1 with Griess buffer, reacted at room temperature for 10 minutes, and the absorbance at 550 nm was measured with a microplate reader. The results are shown in FIG. 1A. The positive control group treated with LPS (0.01 μg/mL) was indicated as LPS(+), and the untreated control group as LPS(-).

Referring to Figure 1A, it was found that NO production in all groups except for MG5303 among the groups treated with the lyophilisate of the lactic acid bacteria culture filtrate was significantly increased compared to the untreated control LPS (-).

Confirmation of cytotoxicity

RAW264.7 cells were seeded in a 96 well plate at 1×10 ⁵ cells/well and cultured at 37° C. under 5% CO ₂ conditions. After culturing for 24 hours, the supernatant was removed, and the culture filtrate lyophilisate dissolved in FBS-free DMEM was treated at a concentration of 5 mg/mL and cultured for 24 hours. Thereafter, MTT reagent was added to the cells from which the supernatant was removed at a concentration of 0.1 mg/mL, reacted for 2 hours, the supernatant was removed, and the dye was dissolved by adding DMSO solution, and the absorbance was measured at a wavelength of 570 nm. As shown in B, it was confirmed that no cytotoxicity was observed in all lactobacillus treatment groups.

Through these results, it was confirmed that the treatment of the lyophilisate of the lactic acid bacteria culture filtrate can enhance immune activity by promoting NO production without cytotoxicity.

Anti-inflammatory effect through inhibition of nitric oxide (NO) production

RAW264.7 cells were seeded in a 96 well plate at 1×10 ⁵ cells/well and cultured at 37° C. under 5% CO ₂ conditions. After culturing for 24 hours, the supernatant was removed, and the culture filtrate lyophilisate dissolved in FBS-free DMEM was treated at a concentration of 5 mg/mL and cultured for 24 hours. At this time, inflammation was induced by combined treatment with LPS (1 μg/mL). Then, the supernatant was taken and dispensed into a 96-well plate, mixed with Griess buffer at a ratio of 1:1, reacted at room temperature for 10 minutes, and then the absorbance at 550 nm was measured using a microplate reader. Some of the cell viability was measured through MTT reagent reaction and shown in FIG. 2B. The positive control group in which cells were treated with only LPS (1 μg/mL) was indicated as LPS (+), and the untreated control group was indicated as LPS (-).

Referring to Figure 2A, it was found that NO production was reduced in all groups treated with LPS in combination with the lactic acid bacteria culture filtrate, compared to the positive control group LPS (+) treated only with LPS. In addition, looking at Figure 2B, cytotoxicity was not shown in all groups treated with the lyophilisate of the lactic acid bacteria culture filtrate, and it was confirmed that the decrease in NO production was not due to cell death.

Considering the immune enhancing effect and anti-inflammatory effect according to the change in the amount of NO production and the productivity of lactic acid bacteria, Limosilactobacillus reuteri MG505, three types of Limosilactobacillus fermentum MG4538, MG5091, MG5159, Seven strains consisting of Lacticaseibacillus paracasei MG5015, Bifidobacterium bifidum MG731 and Bifidobacterium lactis MG741 were selected.

Experimental Example 1: Evaluation of immune system enhancement efficacy of lactic acid bacteria

The immune system enhancement efficacy of the 7 strains selected in the above example was identified using macrophages.

1-1. Effects on iNOS and COX-2 gene expression

iNOS (Inducible nitric oxide synthase) is an enzyme that generates NO from L-arginine and is a molecule necessary for NO that activates immune cells at normal concentrations. Cyclooxygenase-2 (COX-2) is an enzyme that converts arachidonic acid, a fatty acid, into PGE2 (Prostaglandin E2), and PGE2 produced by this reaction controls the production of cytokines to control immunity. The iNOS and COX-2 mRNA expression levels according to each culture filtrate lyophilisate treatment of the 7 strains are shown in A and B of FIG. 3 , respectively.

RAW264.7 cells were seeded in a 6 well plate at 2×10 ⁶ cells/well and cultured at 37° C. under 5% CO ₂ conditions. After culturing for 24 hours, the supernatant was removed, and the lyophilisate of each culture filtrate of the 7 strains dissolved in FBS-free DMEM was treated at a concentration of 5 mg/mL and cultured for 24 hours. After removing the supernatant, the cells were washed twice with DPBS, and then cells were obtained using a scraper, transferred to a 2 mL tube, and DPBS was removed by centrifugation. Then, RNA was extracted using an RNA extraction mini kit, and the extracted RNA was quantified using a nano drop.

Thereafter, reagents were added and mixed as shown in Table 2, and then cDNA synthesis was performed. Primers used for RT-PCR analysis are shown in Table 3. RT-PCR reaction conditions for amplifying a specific gene were amplified for 30 cycles of 95 ° C for 45 sec, 60 ° C for 45 sec, and 72 ° C for 60 sec as one cycle. After completion of the PCR, bands were confirmed by electrophoresis on a 1% agarose gel. The target gene expression level was corrected after quantification with the relative expression level for the housekeeping gene.

Component Volume/Reaction (μL) 10X RT buffer 2.0 25X dNTP Mix (100 mM) 0.8 10X RT Random Primers 2.0 Reverse Transcriptase 1.0 Nuclease-free H ₂ O 4.2 1 μg RNA sample 10.0 Total cDNA synthesis per Reaction 20.0

Gene code Sequence (5'→3') iNOS Forward CCCTTCCGAAGTTTCTGGCAGCAGC (SEQ ID NO: 1) Reverse GGCTGTCAGAGCCTCGTGGCTTTGG (SEQ ID NO: 2) COX-2 Forward CACTACATCCTGACCCACTT (SEQ ID NO: 3) Reverse ATGCTCCTGCTTGAGTATGT (SEQ ID NO: 4)

Referring to Figure 3A, iNOS mRNA expression level significantly increased in each group treated with the lyophilisate of each culture filtrate of the selected 7 strains, and in particular, MG5091 showed a similar expression level to that of the LPS-treated group (LPS +), which is a positive control group. .

In addition, looking at Figure 3B, the amount of COX-2 mRNA expression significantly increased in each group treated with the lyophilisate of each culture filtrate of 7 strains, especially In cells treated with MG505, MG5015, MG4538, MG5091 and MG5159 culture filtrate, the expression level of COX-2 mRNA was high.

1-2. Effect on cytokine production

In order to confirm the effect of the 7 strains on the amount of cytokine production, cytokines produced by ELISA were quantified and shown in FIG. 4 .

Specifically, RAW 264.7 cells were seeded in a 6 well plate to be 2×10 ⁶ cells/well, and cultured for 24 hours at 37° C. under 5% CO ₂ conditions. Then, each culture filtrate lyophilisate of the 7 strains dissolved in FBS-free DMEM was treated at a concentration of 5 mg/mL to obtain a supernatant after culturing for 24 hours, and the obtained supernatant was used for ELISA. 100 μL of blocking buffer (1% BSA in PBS) was added to a 96 well plate coated with a capture antibody, followed by blocking at room temperature for 1 hour. After blocking, 100 μL of the obtained supernatant was added after washing three times using a washing buffer (0.05% Tween 20 in PBS) and reacted at room temperature for 2 hours. Thereafter, the supernatant was removed, washed three times using a washing solution, and then reacted at room temperature for 2 hours after adding a detection antibody. After washing again three times, 100 μL of streptavidin-HRP was added and reacted in the dark at room temperature for 20 minutes. Thereafter, a substrate solution (2NH ₂ SO ₄ ) was added, followed by enzymatic reaction for 20 minutes, and then the reaction was terminated by adding a stop solution. Absorbance of the finished reaction solution was measured at a wavelength of 450 nm.

Looking at A of FIG. 4, the TNF-α expression level of the positive control group treated with LPS was high, and the production of TNF-α in all groups treated with the lyophilisate of each culture filtrate of the 7 strains was significantly higher than that of the control group (LPS-). was unusually high. In particular, the expression level of TNF-α was the highest in cells treated with MG505, MG5091 and MG5159. Looking at B of FIG. 4, IL-6 was also highly produced when treated with LPS, and the production of IL-6 in all groups treated with the lyophilisate of each culture filtrate of the 7 strains was significantly higher than that of the control group (LPS-). Looking at C in FIG. 4, in the case of IL-1β, as a result of treating the lyophilisate of each culture filtrate of the 7 strains, the expression level of IL-1β of MG505, MG4538, MG5091 and MG5159 significantly increased compared to the control group (LPS-). .

1-3. Effects on immune response signaling pathways

The results of Western blotting were shown in FIG. 5 to confirm the effect of the 7 strains on the expression of proteins associated with the mechanism inducing the immune system enhancement effect.

Specifically, after treating the lyophilisate of each culture filtrate of the 7 strains for 24 hours, the RAW 264.7 cells were washed with PBS, and then the RIPA lysis buffer (0.5 M Tris-HCl, pH 7.4, 1.5 M sodium chloride, 2.5% deoxycholic acid, 10% NP-40, 10 mM EDTA) and left on ice for 20 minutes. The recovered cells were centrifuged at 12,000 rpm and 4° C. for 20 minutes, and the supernatant was collected to quantify the amount of protein. Each lysate was taken and mixed with 10% SDS loading buffer (100 mM Tris-HCl, pH 6.8, 20% glycerol, 200 mM β-mercaptoethanol, 10% SDS, 0.2% (w/v) bromophenol blue) for 10 Proteins were separated by electrophoresis on a % SDS polyacrylamide gel. The separated proteins were transferred to a PVDF membrane and blocked at room temperature with TBST (Tris Buffered Saline Tween) buffer supplemented with 5% skim milk. After blocking, react with the primary antibody diluted 1:1000, wash 3 times with TBST buffer, react with the anti-goat secondary antibody (1:2000 dilution) for more than 1 hour, wash 3 times with TBST buffer, and use the ECL detection kit It was developed using

Looking at A of FIG. 5, it was found that the phosphorylation of TLR2, ERK, and NF-kB were all higher than those of the control group when the lyophilisate of each culture filtrate of the 7 strains was treated. In the ERK of FIG. 5B, the MG5091 and MG5159 treatment groups induced high phosphorylation, and in the NF-kB of FIG. 5C, the MG4538, MG5015, MG5091 and MG5159 treatment groups showed significantly higher phosphorylation than the control group. +). The expression level of TLR2 in FIG. 5D was increased compared to the control group when each culture filtrate lyophilisate of the 7 strains was treated, and the expression level of MG731, MG5015 and MG5159 increased the highest, indicating a higher expression level than the positive control group LPS (+).

When considering the results of the immune response cytokines and immune response signaling pathway activity, it was shown that high immune enhancing effects of MG4538, MG5091 and MG5159 can be expected.

1-4. Effects on phagocytosis

Macrophages have receptors for various substances, and these receptors react with pathogens or foreign substances to cause phagocytosis to remove them. This phagocytosis can enhance the immune response.

RAW264.7 cells were seeded in a 24 well plate at 1×10 ⁵ cells/well and cultured at 37° C. under 5% CO ₂ conditions. After culturing for 24 hours, the lyophilisate of each culture filtrate of the 7 strains dissolved in FBS-free DMEM was treated at a concentration of 5 mg/mL and cultured for 24 hours. After removing the supernatant, washed twice with DPBS, and then reacted at room temperature for 2 hours by adding 0.01% neutral red solution. After staining, the cells were washed once with DPBS, and cells were lysed by adding lysis buffer (acetic acid:ethanol = 1:1 (v/v)), and absorbance was measured at a wavelength of 540 nm, as shown in FIG. 6 .

As shown in Figure 6, it was confirmed that phagocytosis was significantly increased in all groups treated with the lyophilisate of each culture filtrate of the 7 strains, so that the immune function enhancing effect could be expected. In particular, the rest of the groups except for MG5015 exhibited phagocytosis equal to or higher than that of the positive control group, LPS(+).

Experimental Example 2: Evaluation of NK cell activity of lactic acid bacteria

The immune system enhancement effect of 7 strains was identified using human natural killer cells (NK-92).

2-1. NK-92 cell proliferation effect

NK-92 cells (ATCC, USA) were seeded in a 96 well plate at 1×10 ⁴ cells/well and cultured for 24 hours at 37° C. under 5% CO ₂ conditions. After culturing for 24 hours, the supernatant was removed, and the lyophilisate of each culture filtrate of the 7 strains dissolved in FBS-free DMEM was treated at a concentration of 5 mg/mL and cultured for 24 hours. Thereafter, 10 μL of CCK-8 solution was added and reacted for 3 hours, and the result of measuring absorbance at a wavelength of 450 nm is shown in FIG. 7 . IL-2 was treated as a positive control group and the proliferation effect of 7 strains was compared.

7, MG4538, MG5091, and MG5159 treatment showed a higher proliferation effect than the control group, and in particular, the MG4538 and MG5091 treatment group showed a higher proliferation effect than the positive control IL-2.

2-2. Granzyme B expression effect

After treating the lyophilisate of each culture filtrate of 7 strains for 24 hours, NK-92 cells were washed with PBS and then lyophilized in RIPA lysis buffer (0.5 M Tris-HCl, pH 7.4, 1.5 M sodium chloride, 2.5% deoxygenate) to which protease cocktail was added. cholic acid, 10% NP-40, 10 mM EDTA) and left on ice for 20 minutes. The recovered cells were centrifuged at 4° C. at 12,000 rpm for 20 minutes, and the supernatant was collected to extract proteins. Then, as a result of protein quantification and Western blotting, as shown in FIG. 8, lactobacillus strains other than MG5015 showed significantly higher granzyme B expression levels than the control group, and higher expression than the IL-2 treatment group, which is a positive control group. indicated the amount.

Experimental Example 3: Toxic effect of lactic acid bacteria on target cells

NK-92 cells were seeded in a 96 well plate at 1×10 ⁴ cells/well and cultured for 24 hours at 37° C. under 5% CO ₂ conditions. After culturing for 24 hours, the supernatant was removed, and the lyophilisate of each culture filtrate of the 7 strains dissolved in FBS-free DMEM was treated at a concentration of 5 mg/mL and cultured for 16 hours. Thereafter, the culture medium was removed by centrifugation (4° C., 4 minutes, 1,600 rpm) and washed with a new medium. Then, the target cell K562 cells (Korea Cell Line Bank, Korea) were seeded in a 96 well plate at 5×10 ³ cells/well and cultured for 3 hours. After incubation for 3 hours, lysis buffer was added to the cells and incubation was continued for 1 hour. Thereafter, 50 μL of the supernatant was transferred to a new plate by centrifugation (4° C., 4 minutes, 1,600 rpm), and 50 μL of CytoTox96ⓡ reagent was added and reacted in the dark for 30 minutes. After 30 minutes, the reaction was terminated by treatment with 50 μL of the stop solution, and the result of measuring the absorbance at a wavelength of 490 nm is shown in FIG. 9 . Using IL-2-treated NK-92 cells as a positive control, the target cell killing effect of 7 strains was compared.

Referring to FIG. 9 , NK-92 cells treated with MG505, MG4538, MG5015, MG5091 or MG5159 showed significantly higher toxicity to K562 cells than NK-92 cells not treated with anything (Control). The strains were identified as MG4538, MG5015, MG5091, and MG5159 treatment groups in Experimental Example 2-1, in which the proliferation effect of NK-92 cells was high, and it was confirmed that the killing effect on target cells was high by enhancing the NK cell activity of the lactic acid bacteria. It became.

Experimental Example 4: Evaluation of probiotics properties of lactic acid bacteria

Carbon source availability, enzyme activity, antibiotic susceptibility, hemolysis, acid resistance and bile resistance tests were performed on the selected 7 strains for use as probiotics.

4-1. enzyme activity

In order to confirm the enzymes and enzyme activities produced by lactic acid bacteria, a total of 19 enzyme activities were analyzed using the API ZYM kit that can measure the activity. 7 strains were smeared on each MRS plate medium and cultured at 37° C. for 24 hours, and then the resulting colonies were inoculated into MRS liquid medium and cultured for 18 hours. Thereafter, the culture solution was centrifuged (4000 xg, 4° C., 5 minutes) to obtain cells, and washed twice with PBS. The washed cells were resuspended in a 2 mL suspension medium, adjusted to 5-6 McFarland turbidity, dispensed 60 μl into each tube of the API ZYM strip, and incubated at 37° C. for 4 hours. Thereafter, ZYM A and ZYM B reagents were added dropwise to each tube, reacted at room temperature for 10 minutes, and enzyme activity was confirmed through color change.

Enzyme activity was evaluated by comparing a standard color table and indicating a value of 0 to 5 according to the degree of color change, with 0 being a negative reaction and 3 or more being a positive reaction. As a result, as shown in Table 4, it was confirmed that all of the 7 selected strains showed different enzyme activities.

Enzymes assayed for MG4538 MG505 MG731 MG741 MG5015 MG5091 MG5159 Control (Negative) 0 0 0 0 0 0 0 Alkaline phosphatase 0 One 4 One 0 0 0 Esterase (C4) One One One 0 0 One 2 Esterase Lipase (C8) 2 One One 0 0 One One Lipase (C14) 0 0 0 0 0 0 0 Leucine arylamidase 3 3 3 4 3 2 3 Valine arylamidase One 2 0 0 3 0 0 Cystine arylamidase One 0 0 One 0 One 0 Trypsin 0 0 One 0 0 0 0 α-chymotrypsin 0 0 0 One 0 0 0 Acid phosphatase 2 5 4 0 One One One Naphthol-AS-BI-phosphohydrolase One 3 2 4 One One One α-galactosidase 5 0 3 2 0 5 3 β-galactosidase 5 3 5 3 One 5 5 β-glucuronidase 0 0 0 0 0 0 0 α-glucosidase 4 One 3 2 One 0 5 β-glucosidase 0 0 0 0 0 5 0 N-acetyl-β-glucosaminidase 0 0 5 0 0 0 0 α-mannosidase 0 0 0 0 0 0 0 α-fucosidase 0 0 0 0 0 0 0

Representatively, strain MG5091 exhibits β-glucosidase enzyme activity and does not produce α-glucosidase enzyme.

In common, strains MG4538, MG731, MG5091 and MG5159 have protease enzyme activity of leucine arylamidase, valine arylamidase or cystine arylamidase family and esterase lipase (C8) and the like, and high enzyme activity such as β-galactosidase, it was confirmed that the advantage of breaking down and digesting lactose would be high. In addition, it was confirmed that the high enzymatic activity of α-galactosidase facilitates the decomposition of indigestible carbohydrates.

In addition, it was found that all 7 strains did not produce β-glucuronidase, which can convert benzopyrene into a carcinogenic substance, confirming the stability of probiotics.

4-2. antibiotic susceptibility

After culturing the selected 7 strains in MRS broth at 37° C. for 18 hours, the bacterial solution was diluted to 0.5 Mcfarland turbidity in 0.85% NaCl. A sterilized cotton swab was immersed in the dilution solution, taken out, and the strain was smeared on a BHI plate medium. After drying the surface of the medium for 5 minutes, the antibiotic strip was placed in the middle of the plate medium and incubated at 37 ° C for 24 hours. After culturing, through visual observation, the point where the strip and the ring of inhibition formed along the strip meet was read as the minimum inhibitory concentration (MIC) value of the antibiotic. According to the criteria announced by EFSA (European Food Safety Authority), the reading is sensitive (S) if it is susceptible, resistant (R) if it shows resistance, and not require (n.r.) if it does not require antibiotic testing, and is shown in Table 5. .

Antimicrobials MG4538 MG505 MG731 MG741 MG5015 MG5091 MG5159 Ampicillin (AM) S S S S S S S Gentamicin
Gentamicin (GM) S S R R S S S kanamycin
Kanamycin (K) S S n.r. n.r. S S S streptomycin
Streptomycin(S) S S S R S S S tetracycline
Tetracycline (TC) S R S S S S S chloramphenicol
Chloramphenicol (C) S R S S S S S Erythromycin
Erythromycin (E) S S S S S S S vancomycin
Vancomycin (VA) n.r. n.r. S S n.r. n.r. n.r. Clindamycin
Clindamycin S S S S S S S

As a result of the reading, the strains identified as being sensitive to all tested antibiotics were strains MG4538, MG5015, MG5091 and MG5159. MG505 strain showed resistance to tetracycline and chloramphenicol, MG731 showed resistance to gentamicin, and MG741 showed resistance to gentamicin and streptomycin.

4-3. hemolytic

In order to confirm the avirulence of lactic acid bacteria, the selected 7 strains were subcultured three times in MRS medium to increase activity, and then smeared on Columbia agar medium containing 5% (w / v) blood. Thereafter, after culturing at 37 ° C. for 48 hours, a ring formed around the resulting colony was confirmed. Hemolysis is largely classified into three types. β-hemolysis produces a transparent ring around the colony after culturing with complete lysis, and α-hemolysis turns green-gray around the colony after culturing with partial lysis and gamma-hemolysis. Since γ-hemolysis does not cause hemolysis and does not cause any change around the colony after culture, hemolysis was read according to these criteria.

As shown in FIG. 10, all 7 strains did not produce transparent rings in the hemolytic medium and did not show hemolysis, and thus the stability as probiotics was confirmed as gamma hemolysis was determined.

4-4. Acid and bile resistant

Acid resistance and bile resistance tests were conducted to evaluate the viability of the 7 strains under conditions similar to the human intestinal environment. 7 strains were smeared on MRS plate medium and incubated at 37 ° C for 24 hours, and then the resulting colonies were inoculated into MRS liquid medium and cultured at 37 ° C for 18 hours. Thereafter, the culture solution was centrifuged (4000 xg, 4° C., 5 minutes), and the cells were washed twice with PBS (pH 7.4). The washed cells were resuspended in PBS at 10 ⁷ to 10 ⁸ CFU/mL to prepare a diluted strain solution.

Artificial gastric fluid (SGF, Simulated Gastric Fluid) used in the acid resistance test was prepared by adding pepsin at a concentration of 3 g/L to 0.1M Phosphate buffer adjusted to pH 3.0 or 4.0 using 1 NHCl. , Simulated Intestinal Fluid (SIF) used in the bile resistance test was pancreatin (Sigma-Aldrich, USA) to a final concentration of 1 g/L in sterile PBS adjusted to pH 7.0 to 8.0 using 1 N NaOH. ) was added.

After adding 1 mL dilution of the strain to 9 mL artificial gastric juice or artificial intestinal fluid, samples were taken at regular intervals while still in the incubator at 37 ° C. After dilution by decimal dilution, the diluted solution at a certain concentration was spread on MRS plate medium to count viable cells. By evaluating the viability of 7 strains as a method of confirming, the acid resistance results are shown in FIG. 11, and the bile resistance results are shown in FIG.

First, referring to FIG. 11, except for MG731, which showed a low survival rate under pH 3 conditions, all strains exhibited excellent acid resistance under pH 3 or pH 4 conditions. The biliary resistance of the 7 strains was also excellent as shown in FIG. 12 .

4-5. carbon source availability

Carbon source utilization of MG505, MG4538, MG5015, MG5091, and MG5159, which confirmed the effect of enhancing innate immune function in Experimental Example 2, was analyzed by sugar fermentation test using API 50 CHL Kit. Table 6 below shows the carbon source availability results of the 5 strains. When carbon source availability was positive, ‘+’ was marked, and when carbon source availability was negative, ‘-’ was marked.

Substrate MG4538 MG505 MG5015 MG5091 MG5159 0 Control (Negative) - - - - - One Glycerol - - - - - 2 Erythritol - - - - - 3 D-arabinose - - - - - 4 L-arabinose - + + + + 5 D-ribose + + + + + 6 D-xylose + - - - + 7 L-xylose - - - - - 8 D-adonitol - - - - - 9 Methyl-β D-xylopyranoside - - - - - 10 D-galactose + + + + + 11 D-glucose + + + + + 12 D-fructose + - + + + 13 D-mannose + - + - + 14 L-sorbose - - + - + 15 L-rhamnose - - - - - 16 Dulcitol - - - - - 17 Inositol - - - - - 18 D-mannitol - - + - + 19 D-sorbitol - - + - + 20 Methyl-α D-Mannoside - - - - - 21 Methyl-α D-glucoside - - - - + 22 N-acethyl-glucosamine - - + - + 23 Amygdalin - - + - + 24 Arbutin - - + - + 25 Esculin + + + + + 26 Salicin - - + - + 27 D-cellobiose - - + - + 28 D-maltose + + + + + 29 D-lactose + + + - + 30 D-melibose + + + + + 31 D-sucrose + + + + + 32 D-trehalose + - + + + 33 Inulin - - + - + 34 D-melezitose - - + - + 35 D-raffinose + + + + + 36 Starch - - - - - 37 Glycogen - - - - - 38 Xylitol - - - - - 39 Gentiobiose - - + - + 40 D-turanose - - + - + 41 D-lyxose - - + - + 42 D-tagatose - - + - + 43 D-fucose - - - - - 44 L-fucose - - - - - 45 D-arabitol - - - - - 46 L-arabirol - - + - + 47 Gluconate + + + + + 48 2-keto-gluconate - - - - - 49 5-keto-gluconate - - + + +

Through the above examples and experimental examples, the immune response cytokines of the selected 7 strains, the activity of cell signaling pathways, phagocytosis, NK cell activity, and the stability for the use of probiotics were comprehensively evaluated. As a result of consideration, in particular, the high usefulness of Limosilactobacillus fermentum MG4538, Limosilactobacillus fermentum MG5091 and Limosilactobacillus fermentum MG5159 strains was confirmed.

Specifically, the three strains excellently induced molecules involved in innate immunity and phagocytosis in RAW264.7 cells, which are macrophages, and significantly increased the activation of NK-92 cells, which are human natural killer cells. It was confirmed that it is activated through the κB signaling pathway or MAPK signaling mechanism. In addition, the above strains can be usefully used as immune system enhancing probiotics by showing excellent characteristics while meeting the selection criteria for probiotics.

Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC) KCTC14946BP 20220415

Claims (12)

increased phagocytosis; Increased NK cell (Natural killer) activity; increased cytokine production of TNF-α, IL-1β, IL-6, iNOS or COX-2; and increased MARK/ERK or NF-κB signaling pathway activity; Limosilactobacillus fermentum MG5091 strain deposited with accession number KCTC14946BP that induces immune enhancing activity by any one or more selected from the group consisting of. delete According to claim 1, wherein the strain is antibiotic sensitivity, γ- hemolytic activity, acid resistance and bile resistance, characterized in that it has one or more probiotics properties selected from the group consisting of Rimosyllactobacillus fermentum MG5091 strain. The method of claim 3, wherein the antibiotic susceptibility is ampicillin, gentamicin, kanamycin, streptomycin, tetracycline, chloramphenicol, erythromycin, and clindamycin. (Clindamycin) Rimosyllactobacillus fermentum MG5091 strain, characterized in that the sensitivity to one or more selected from the group consisting of. According to claim 1, wherein the strain is D- arabinose (L-arabinose), D- ribose (D-ribose), D- galactose (D-galactose), D- glucose (D-glucose), D- fructose (D-fructose), D-esculin (Esculin), D-maltose (D-maltose), D-melibiose (D-melibiose), D-sucrose (D-sucrose), D- trealose ( Characterized in that at least one selected from the group consisting of D-trehalose), D-raffinose, gluconate and 5-keto-gluconate is used as a carbon source Rimosyllactobacillus fermentum MG5091 strain. A probiotic composition for immune enhancing activity comprising Limosilactobacillus fermentum MG5091 strain or a culture thereof deposited under accession number KCTC14946BP according to claim 1. [Claim 7] The probiotics composition for immune enhancing activity according to claim 6, wherein the strain has immune enhancing activity, antibiotic sensitivity, γ-hemolytic activity, acid resistance or bile resistance. A composition for enhancing immunity comprising Limosilactobacillus fermentum MG5091 strain, a culture thereof, or a lysate thereof deposited under accession number KCTC14946BP according to claim 1. The composition for enhancing immunity according to claim 8, wherein the composition is any one selected from the group consisting of a pharmaceutical composition, a food composition, and a feed composition. The method of claim 8, wherein the immune enhancement is phagocytosis (Phagocytosis) increase; Increased NK cell (Natural killer) activity; increased cytokine production of TNF-α, IL-1β, IL-6, iNOS or COX-2; or increased MARK/ERK or NF-κB signaling pathway activity; A composition for enhancing immunity, characterized in that made through. Immunity enhancement functional food containing Limosilactobacillus fermentum MG5091 strain deposited under accession number KCTC14946BP according to claim 1, culture thereof or lysate thereof. Limosilactobacillus fermentum MG5091 strain deposited under the accession number KCTC14946BP according to claim 1, a feed additive for immunity enhancement comprising a culture thereof or a lysate thereof.

Images