KR102518033B1 - Superoxide dismutase and uses thereof for preventing or treating diabetic retinopathy or uveitis - Google Patents

Abstract

The present invention relates to superoxide dismutase and uses thereof for the prevention or treatment of diabetic retinopathy or uveitis. The superoxide dismutase according to the invention, particularly via oral administration, can be effectively used for preventing or treating diabetic retinopathy or uveitis.

Description

SUPEROXIDE DISMUTASE AND USES THEREOF FOR PREVENTING OR TREATING DIABETIC RETINOPATHY OR UVEITIS}

The present invention relates to the use of superoxide dismutase for the prevention or treatment of diabetic retinopathy or uveitis. More specifically, the present invention relates to the use, composition or method of superoxide dismutase for the prevention or treatment of diabetic retinopathy or uveitis.

Eyesight damage caused by various diseases, such as retinal nerve degeneration due to aging, is on the rise, and special attention is required because the eyeball, including the retina, is a nerve tissue related to visual function, and it is difficult to recover once damage progresses. Diseases causing visual impairment include, for example, diabetic retinopathy, uveitis, cataract, macular degeneration, retinal detachment, and the like.

Diabetic retinopathy is one of the chronic complications of diabetes and is one of the major causes of blindness worldwide, and treatment may be delayed because vision deteriorates without special pain. Diabetic retinopathy is treated by using laser treatment, which is a common treatment, to prevent the occurrence of new blood vessels and hemorrhage in the eye, thereby suppressing rapid loss of vision. . As a way to compensate for this, a method of injecting a steroid or vascular endothelial growth factor inhibitor (eg, dexamethasone) into the vitreous is used, which inhibits vascular endothelial growth factor and chronic inflammation in the retina of patients with diabetic retinopathy. Although it has the advantage of improving the condition, there is a risk of side effects when used for a long time.

Uveitis is an inflammatory disease of the uveal duct of the eye, and it can be recovered after treatment as a transient onset, but usually the inflammation appears repeatedly and continuously and is idiopathic with unknown cause, so in the end it can cause severe visual impairment and lead to blindness. . Uveitis is caused by infectious causes such as viruses, bacteria, fungi, parasites, etc., and non-infectious causes caused by autoimmune diseases. Uveitis is a specific endogenous disease in which no causative bacteria are found in most cases, and since abnormalities in the immune system are involved, corticosteroid preparations are mainly administered in the form of eye drops. In the case of acute inflammation, topical steroid eye drops and accommodative paralytic eye drops are used for treatment. In case of severe inflammation, systemic steroids are administered, or in the case of chronic diseases, immunosuppressants such as cyclosporine are administered.

Conventional steroid preparations have a risk of side effects when used for a long time, and accommodative paralysis agents have many disadvantages such as glare and difficulty in seeing close text. Therefore, it is necessary to develop an agent capable of preventing or treating eye diseases, particularly diabetic retinopathy and/or uveitis.

The object of the present invention is to solve all of the above problems.

An object of the present invention is to provide a superoxide dismutase for preventing, improving or treating diabetic retinopathy or uveitis.

Another object of the present invention is to provide a superoxide dismutase derived from Bacillus amyloliquefaciens that secures oral administration efficacy and safety for the prevention, improvement, or treatment of diabetic retinopathy or uveitis.

Another object of the present invention is to provide a Bacillus-derived or Bacillus amyloliquefaciens- derived superoxide dismutase that is conveniently produced and secreted extracellularly for the prevention or treatment of diabetic retinopathy or uveitis.

Another object of the present invention is to provide a pharmaceutical composition or treatment method for preventing or treating diabetic retinopathy or uveitis.

Another object of the present invention is to provide a food or feed composition for preventing or improving diabetic retinopathy or uveitis.

Another object of the present invention is to provide a composition for oral administration containing superoxide dismutase for the prevention, improvement or treatment of diabetic retinopathy or uveitis.

The object of the present invention is not limited to the object mentioned above. The objects of the present invention will become more apparent from the description that follows, and will be realized by means and combinations thereof set forth in the claims.

Representative configurations of the present invention for achieving the above object are as follows.

According to one aspect of the present invention, an improved superoxide dismutase (SOD) exhibiting preventive, ameliorative or therapeutic effects of diabetic retinopathy or uveitis is provided.

According to another aspect of the present invention, there is provided superoxide dismutase from a generally regarded as safe (GRAS) bacterium such as Bacillus for the prevention, amelioration or treatment of diabetic retinopathy or uveitis. .

According to another aspect of the present invention, a superoxide dismutase derived from Bacillus or Bacillus amyloliquefaciens that is conveniently produced and secreted extracellularly for the prevention, improvement or treatment of diabetic retinopathy or uveitis is provided.

According to another aspect of the present invention, an improved superoxide dismutase that exhibits preventive, ameliorative or therapeutic effects on diabetic retinopathy or uveitis even when administered orally is provided.

According to another aspect of the present invention, there is provided a superoxide dismutase derived from Bacillus amyloliquefaciens that secures oral administration efficacy and safety for the prevention, improvement, or treatment of diabetic retinopathy or uveitis.

According to another aspect of the present invention, a pharmaceutical composition for preventing or treating diabetic retinopathy or uveitis containing the superoxide dismutase as an active ingredient is provided.

According to another aspect of the present invention, a food or feed composition for preventing or improving diabetic retinopathy or uveitis containing the superoxide dismutase as an active ingredient is provided.

According to another aspect of the present invention, an oral composition for preventing, improving or treating diabetic retinopathy or uveitis containing the superoxide dismutase as an active ingredient is provided.

According to another aspect of the present invention, there is provided a method for preventing, improving or treating diabetic retinopathy or uveitis comprising administering the superoxide dismutase or the composition to a subject.

According to another aspect of the present invention, the use of the superoxide dismutase for preventing, improving or treating diabetic retinopathy or uveitis is provided.

According to another aspect of the present invention, the use of the superoxide dismutase for preparing a medicament for preventing, improving or treating diabetic retinopathy or uveitis is provided.

The superoxide dismutase, composition, method and kit according to the present invention can be effectively used for preventing or treating diabetic retinopathy or uveitis. In particular, it was confirmed that the superoxide dismutase according to the present invention is effective in preventing or treating diabetic retinopathy or uveitis even when administered orally.

The superoxide dismutase according to the present invention is derived from Bacillus or Bacillus amyloliquefaciens, which is a generally regarded as safe (GRAS) bacterium, so that oral administration efficacy and safety are secured, as well as when cultured. Production advantages of direct recovery from the supernatant can also be taken.

According to an embodiment of the present invention, the SOD of the present invention was orally administered to diabetic mice and normal mice to evaluate retinal vascular leakage, astrocyte immunofluorescence staining, and retinal vascular staining. As a result, SOD-administered diabetic mice It was confirmed that there was an effect of reducing retinal vascular permeability, restoring astrocyte foot processes, inhibiting pericyte cell loss, and inhibiting acellular capillaries. In addition, as a result of performing fundus evaluation and tissue evaluation by orally administering SOD to mice with acute and chronic uveitis, it was confirmed that the inflammatory findings were improved to a low grade. Therefore, the superoxide dismutase according to the present invention can be effectively used to prevent, improve, or treat diabetic retinopathy or uveitis through reduction of retinal vascular leakage and improvement of inflammatory conditions.

1 shows a schematic diagram for double crossover recombination performed in Example 1.1.
Figure 2 shows the results of confirming the defective gene using PCR in the expression host GFBS220 and the production strain BSBA310. W represents wild-type B. subtilis KCTC 3135, 220 represents expression host GFBS220, and 310 represents SodA2 production strain BSBA310.
Figure 3 shows the amino acid sequence of SodA (Mn-SOD identified through N-terminal sequencing in the culture supernatant of Bacillus amyloliquefaciens strain GF423) and superoxide dismutase (SodA2) of the present invention. is compared to
Figure 4 shows an expression vector for overexpression of the sodA2 gene. Here, rrnB T1T2 represents a transcription terminator; rep(pBR322) represents the replicon from pBR322 that works in E. coli ; rep(pUB110) is a replicon from pUB110 that works in B. subtilis ; Kan ^R represents kanamycin resistance gene (aminoglycoside O-nucleotidyltransferase); The BJ27 promoter represents a strong promoter for B. subtilis .
Figure 5 shows the overall procedure for making production strain BSBA310.
6a and 6b are views showing qualitative evaluation results of retinal vascular leakage in the 3-week diabetic retinopathy experimental group (scale bar is 500 μm), and FIG. 6c is a view showing quantitative evaluation results.
7a and 7b are views showing qualitative evaluation results of retinal vascular leakage in the 16-week diabetic retinopathy experimental group (scale bar is 500 μm), and FIG. 7c is a view showing quantitative evaluation results.
8a and 8b are views showing qualitative evaluation results of astrocyte immunofluorescence staining in the 3-week diabetic retinopathy experimental group, and FIG. 8c is a view showing quantitative evaluation results.
9a and 9b are views showing qualitative evaluation results of astrocyte immunofluorescence staining in the 16-week diabetic retinopathy experimental group, and FIG. 9c is a view showing quantitative evaluation results.
10a and 10b are views showing qualitative evaluation results of retinal vessel staining in the 16-week diabetic retinopathy experimental group (scale bar is 100 μm), and FIGS. 10c and 10d are views showing quantitative evaluation results.
11a and 11b are views showing the clinical score results of uveitis fundus evaluation. 11a is a fundus evaluation result of an endotoxin-induced uveitis model, and FIG. 11b shows a fundus evaluation result of an experimental autoimmune uveitis model.
12 is a diagram showing four regions of the retina within the eye segmented for uveitis tissue evaluation.
13a to 13c show the results of uveitis tissue evaluation of the endotoxin-induced uveitis model. Figure 13a shows the results of a normal control group and a normal mouse group administered with SodA2, and Figure 13b shows the results of an endotoxin-induced uveitis model and a model administered with SodA2. 13c shows the grade distribution results of the experimental group.
14a, 14b and 14c show the results of uveitis tissue evaluation of the experimental autoimmune uveitis model. Fig. 14a shows the results of normal mice and SodA2-administered normal mouse groups, and Fig. 14b shows the results of the experimental autoimmune uveitis model and the SodA2-administered model. 14c shows the grade distribution results of the experimental group.

The detailed description of the invention that follows will be described with reference to specific drawings in relation to specific embodiments in which the invention may be practiced, but the invention is not limited thereto and, if properly described, what the claims claim and All scopes of equivalence are limited only by the appended claims. It should be understood that the various embodiments of the present invention are different, but need not be mutually exclusive. For example, specific shapes, structures, and characteristics described herein may be changed from one embodiment to another, or a combination of embodiments, without departing from the spirit and scope of the present invention. Terms given in describing the invention are generally to be understood in their ordinary sense, unless otherwise indicated, and apply to both the aspect or embodiment of the invention in which the term is defined, as well as to the same term used herein. For purposes of interpreting this specification, the following definitions will apply and terms used in the singular will include the plural as appropriate and vice versa.

Justice

As used herein, the term “about” refers to the typical error range for each value known to one of ordinary skill in the art.

The term "subject" is used interchangeably with "patient" and is a mammal in need of prevention or treatment of diabetic retinopathy or uveitis, such as a primate (eg, human), companion animal (eg, dog, cat, etc.) ), livestock animals (eg, cows, pigs, horses, sheep, goats, etc.) and laboratory animals (eg, rat mice, guinea pigs, etc.). In one embodiment of the invention, the subject is a human.

The term “treatment” includes prophylactic and/or therapeutic treatment. The prophylactic and/or therapeutic treatment includes all types of treatment recognized in the art and includes, for example, administering the pharmaceutical composition or SOD of the present invention to a subject. If administered prior to clinical signs of an undesirable or undesirable condition (e.g., a disease or other undesirable or undesirable condition of a subject), such treatment or treatment is a prophylactic treatment or treatment (e.g., an undesirable or undesirable condition of a subject). to protect the subject from progressing the state). On the other hand, if administered after clinical signs of an undesirable or undesirable condition, such treatment or treatment is therapeutic, such as reducing, alleviating or stabilizing an existing undesirable or undesirable condition or its side effects.

The meaning of the term "prevention" is well known in the art. When used in relation to a medical condition such as diabetic retinopathy or uveitis, the pharmaceutical composition or SOD of the present invention is administered and the medical condition (discomfort, visual impairment, eye blood vessel leakage, ocular surface damage, It means reducing the frequency of ocular surface inflammation, etc.) or delaying the onset and symptoms.

The term "administration" means providing an active ingredient to achieve a prophylactic or therapeutic purpose (eg, prevention or treatment of diabetic retinopathy or uveitis) to a subject.

Diabetic retinopathy and uveitis

The present invention is based, at least in part, on the discovery that administration of superoxide dismutase (SOD), particularly oral administration, is effective in preventing or treating diabetic retinopathy or uveitis. Accordingly, according to one aspect of the present invention, use of SOD for preventing or treating diabetic retinopathy or uveitis is provided.

In one embodiment, diabetic retinopathy or uveitis may exhibit one or more symptoms selected from the group comprising visual impairment, ocular vascular leakage, or ocular inflammation.

The term "diabetic retinopathy" refers to an eye complication in which visual acuity is reduced due to damage to capillaries due to persistent hyperglycemia caused by diabetes. Diabetic retinopathy is asymptomatic in the early stages, but as invasion of the macula occurs, visual acuity deteriorates. Diabetic retinopathy is a disease that develops or progresses accompanied by various pathological features such as microvascular flow, venous dilatation, retinal hemorrhage, retinal infarction, macular edema, neovascularization, vitreous hemorrhage, and traction membrane.

In one embodiment, SOD may bring about one or more effects selected from reduction of vascular permeability of diabetic retinopathy, restoration of astrocyte foot projections, inhibition of pericytes loss, and inhibition of acellular capillaries.

The term “uveitis” refers to inflammation of the inner part of the eye, particularly of the middle layer of the eye (uvea). More specifically, uveitis includes anterior uveitis, an inflammation of the first half of the uveal system, including inflammation of the iris (iritis) and inflammation of the iris and ciliary body (ciliform); intermediate uveitis, an inflammation of the vitreous; and panuveitis, which is uveitis affecting the entire uveal system, as well as posterior uveitis, which is inflammation of the part of the uveal system behind the lens of the eye, including inflammation of the choroid (choroiditis) and of the choroid and retina (chorioretinitis). .

In one embodiment, uveitis may include at least one selected from the group consisting of infectious causes and non-infectious causes, but is not limited thereto. Specifically, infectious causes of uveitis may include one or more selected from bacteria, viruses, fungi, and parasites, and non-infectious causes may include one or more selected from autoimmune diseases, tumors, trauma, surgery, and systemic diseases. can

In one embodiment, the SOD is an improvement in one or more fundus evaluation indices selected from focal lesions of uveitis, linear lesions, chorioretinal lesions, confluent lesions, vasculitis, vitreousitis, vitreous hemorrhage, optic nerve papillary edema, and retinal detachment. or an emollient effect; an ameliorating or alleviating effect in one or more tissue evaluation indices selected from inflammatory cell infiltration, retinal wrinkles, intra/subretinal hemorrhage, intra/subretinal exudate, and retinal damage; And it can show the improvement or alleviation effect of both of the above.

Superoxide dismutase (SOD)

According to another aspect of the present invention, an improved superoxide dismutase (SOD) exhibiting an effect of preventing, improving or treating diabetic retinopathy or uveitis is provided.

Superoxide dismutase is an enzyme that alternately catalyzes the dismutation of superoxide radicals (O ₂ ^- ) into ordinary molecular oxygen (O ₂ ) and hydrogen peroxide (H ₂ O ₂ ). It plays an important role in reducing oxidative stress by scavenging oxygen species. SODs are widely distributed in prokaryotic and eukaryotic cells and are classified into four classes according to the different types of metal centers (copper/zinc, nickel, manganese, and iron). Manganese-containing SOD [Mn-SOD] is widely present in the chloroplasts, mitochondria, and cytoplasm of several bacterial and eukaryotic cells. The term "SOD" can be used interchangeably with a polypeptide having superoxide dismutase activity.

In one embodiment, the SOD may be manganese binding (Mn-SOD). Specifically, SOD may be deamidated Mn-SOD. More specifically, SOD may be one in which amino acid residues at positions 74 and 137 of SEQ ID NO: 2 are substituted with Asp. More specifically, it may include or consist of the amino acid sequence represented by SEQ ID NO: 4.

It is construed that the SOD or polypeptide having SOD activity of the present invention also includes an amino acid sequence showing substantial identity to the above amino acid sequence. The substantial identity is 80% or more, preferably 90% or more, more preferably 95% or more, and most preferably 98% or more when the aligned sequences are analyzed using an algorithm commonly used in the art. Means an amino acid sequence that exhibits identity.

In another embodiment, the SOD is a modified or engineered polypeptide having SOD enzymatic activity that does not affect or affect various aspects (in vivo, in vitro or ex vivo stability, uniformity, and/or morphological alteration). may include one or more mutations, such as deletions, insertions or substitutions of one or more amino acids. In addition, the polypeptide may further include a heterologous material (e.g., a tag known in the art including HIS tag, Ha tag, myc tag, GFC and/or Fc domain of an antibody) for purification, detection, or increased stability. there is.

In one embodiment, SOD may be derived from natural or recombinant microorganisms, and may be enzymes prepared through isolation or purification from various sources.

In one embodiment, the SOD may be derived from natural or recombinant microorganisms. For example, SOD may be derived from bacteria. Preferably, the SOD may be supplied from bacteria generally regarded as safe (GRAS) for use in drugs or foods. Specifically, SOD may be derived from a Bacillus species strain. More specifically, the SOD may be derived from a Bacillus amyloliquefaciens strain. For example, the SOD may be derived from Bacillus amyloliquefaciens GF423 strain (KCTC 13222 BP). The GF423 strain (KCTC 13222 BP) was deposited with the Korea Research Institute of Bioscience and Biotechnology on March 6, 2017. In addition, the SOD may be derived from a recombinant strain containing the expression vector shown in FIG. 4 . In addition, the SOD may be derived from a recombinant strain prepared by a method including the method shown in FIG. 5 . The recombinant strain may be a Bacillus strain containing a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 and having the following genes deleted: AprE, NprE, Bpr, Epr, NprB, Vpr, Mpr, IspA, SrfAC, spoIIAc, EpsE and Xpf . See Example 1 for detailed procedures for the preparation of the strain.

Since SOD derived from the strain is an enzyme secreted outside the cell, when manufacturing SOD using the strain, SOD that is safe for humans can be produced in large quantities without going through an expensive purification process (eg, column purification). Since it can be produced, efficient production is possible.

In one embodiment, SOD can be isolated or purified from a variety of sources, including natural or recombinant hosts. For example, SOD having an activity for preventing or treating diabetic retinopathy or uveitis can be extracted from a culture supernatant of Bacillus amyloliquefaciens strain GF423. Briefly, a culture medium can be obtained by first culturing the Bacillus amyloliquefaciens strain GF423 in various types of media. For example, the strain is grown at 25°C to 42°C for 1 to 4 days using a complex medium (pH 6.0 to 7.0). Other suitable media for culturing Bacillus amyloliquefaciens strain GF423 include Luria-Bertani (LB) medium, International Streptomyces Project (ISP) medium, nutrient agar (NA) medium, brain heart infusion agar (BHI) medium, SDA ( sabouraud dextrose agar) medium, PDA (potato dextrose agar) medium, NB (nutrient broth) medium, and the like. Preferably, LB medium, ISP medium, BHI medium, SDA medium, or NB medium may be used. SOD can also be sourced from other natural or recombinant hosts using information provided in databases such as PubMed or BRENDA (brenda-enzymes.org on the World Wide Web).

In one embodiment, the SOD may be an isolated or purified enzyme. In this case, the isolated or purified SOD or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which it was derived. For example, the purified product may be a pure product separated from a strain culture through ultrafiltration, ammonium sulfate treatment, column purification, concentration, or the like, or a culture concentrate obtained through ultrafiltration, concentration, or the like. The phrase "substantially free of cellular material" includes preparations of the protein in which the protein is isolated from cellular components of the cell from which the protein is isolated or recombinantly produced. Specifically, the phrase “substantially free of cellular material” means less than about 30%, preferably less than about 20%, more preferably less than about 10%, and most preferably less than about 10% by dry weight of unwanted proteins. It may include preparations of less than about 5% protein.

In another embodiment, SOD may be preferably purified by the following purification method, but is not limited thereto. The culture solution obtained by culturing the Bacillus amyloliquefaciens strain GF423 is centrifuged to collect the culture supernatant. The supernatant fraction is pretreated by solid phase extraction and then isolated and purified by chromatography. At this time, SOD may be purified using various methods of chromatography. Preferably, hydrophobic interaction chromatography is used.

In one embodiment, the SOD may be included in a strain lysate, a strain culture, a strain culture concentrate, a strain culture extract, or a dried form thereof. At this time, the "strain lysate" means obtained by mechanically or chemically disrupting the strain by culturing it, and may include all of the additional processes such as extraction, dilution, concentration, and purification therefrom. "Strain culture" may refer to a culture medium itself or a supernatant thereof obtained by culturing a strain. "Strain culture concentrate" refers to a culture concentrate obtained by ultrafiltration, ammonium sulfate treatment, column purification, concentration, or the like from a strain culture, or obtained through ultrafiltration, concentration, or the like. "Strain culture extract" refers to an extract obtained from the culture medium or a concentrate thereof, and may include an extract, a dilution or concentrate of the extract, a dried product obtained by drying the extract, or a crude or purified product thereof, or a fraction thereof. The dried form may include a freeze-dried form.

In one embodiment, the SOD is orally administered to a subject in need of prevention or treatment of diabetic retinopathy, thereby reducing vascular permeability, restoring astrocytic foot projections, inhibiting pericyte loss, and inhibiting the generation of acellular capillaries. effect was confirmed.

In another embodiment, the SOD is orally administered to a subject in need of prevention or treatment of uveitis to treat focal lesions, linear lesions, chorioretinal lesions, confluent lesions, vasculitis, vitreousitis, vitreous hemorrhage, and optic nerve papillary edema. and an ameliorating or alleviating effect in one or more fundus evaluation indices selected from retinal detachment; an ameliorating or alleviating effect in one or more tissue evaluation indices selected from inflammatory cell infiltration, retinal wrinkles, intra/subretinal hemorrhage, intra/subretinal exudate, and retinal damage; or both of the above showed an ameliorating or mitigating effect.

pharmaceutical composition

According to another aspect of the present invention, a pharmaceutical composition for preventing or treating diabetic retinopathy or uveitis containing SOD as an active ingredient is provided.

In one embodiment, the SOD according to the present invention may be combined with a pharmaceutically acceptable carrier, excipient and/or diluent to form a pharmaceutical composition for preventing or treating diabetic retinopathy or uveitis. The pharmaceutical composition of the present invention may be used interchangeably with the term veterinary composition when applied to animals other than humans.

The pharmaceutical or veterinary composition of the present invention may further include one or more selected from the group consisting of pharmaceutically acceptable carriers, excipients and diluents. The pharmaceutically acceptable carrier, excipient and/or diluent may be one commonly used in the art. Carriers, excipients or diluents include, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginates, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Mineral oils such as cellulose, hydroxypropyl methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and silicon dioxide, etc. It may include, but is not limited thereto.

When formulated, it may be prepared using additives such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Additives for the formulation may be selected from those commonly used in the pharmaceutical field.

In addition, the pharmaceutical or veterinary composition of the present invention may be formulated in a preferred form depending on the method of use, and particularly known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal. It can be formulated by adopting a method. Specific examples of such formulations include tablets, pills, powders, granules, syrups, solutions, capsules, suspensions, emulsions, injection solutions, plasters, lotions, liniments, limonade, aerosols, and extracts. There are extracts, elixirs, ointments, fluid extracts, infusions, creams, soft or hard gelatin capsules, and patches.

Furthermore, the pharmaceutical or veterinary composition of the present invention can be prepared using a suitable method known in the art or using a method disclosed in Remington's Pharmaceutical Science (latest edition), Mack Publishing Company, Easton PA). can be formulated accordingly.

In one embodiment, the SOD can be administered orally or parenterally. For oral administration, SOD may be coated with shellac for protection from gastric acid, but the coating agent is not limited thereto. Examples of coatings suitable for use in the present invention include shellac, ethyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, zein, Eudragit, and combinations thereof. When SOD is coated, SOD may be coated in solution. Specifically, the purified solution and the shellac-containing solution are mixed and then lyophilized. This lyophilized sample can be made into a powder and stored at about 4°C until use. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in a complex composition, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc. It can be prepared by mixing. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, internal solutions, emulsions, syrups, etc., and various excipients such as wetting agents, sweeteners, aromatics, and preservatives in addition to water and liquid paraffin, which are commonly used simple diluents. can be used

For parenteral administration, intraocular administration including sublingual administration, intravitreal administration, nasal spray, external skin application, patch, intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection You can choose.

In addition, the pharmaceutical or veterinary composition of the present invention is administered in a pharmaceutically or veterinarily effective amount. The term "pharmaceutically effective amount" or "veterinarily effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical or veterinary treatment, and the effective dosage level is the level of the patient or animal. Weight, gender, age, health condition, severity, activity of drug, sensitivity to drug, time of administration, route of administration and rate of excretion, duration of treatment, factors including concomitantly used drugs, and other factors well known in the medical field. can Preferably, the pharmaceutical or veterinary composition of the present invention is about 2 to about 1500 U/mg, specifically about 5 to about 1000 U/mg, more specifically about 10 to about 800 U/mg, based on the total weight of the composition. mg, and more specifically from about 100 to about 500 U/mg of SOD.

The pharmaceutical or veterinary composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously. In addition, the pharmaceutical composition may be administered single or multiple times as needed. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, and this amount can be easily determined by a person skilled in the art.

Methods of treatment or prevention

According to another aspect of the present invention, for the treatment or prevention of diabetic retinopathy or uveitis, comprising administering the SOD or pharmaceutical composition according to the present invention to a subject having or at risk of diabetic retinopathy or uveitis A method is provided.

In the present invention, "administration" includes any of various administrations that enable treatment by performing a desired action. The route of administration may be oral, parenteral, inhalational, topical or topical administration (eg intralesional administration). For example, parenteral administration may include intravenous, subcutaneous, intraperitoneal, intraarterial, or intraocular administration, but is not limited thereto. In the case of oral administration, as described above, SOD may be administered in a form coated with a coating agent such as shellac.

An effective or effective non-toxic amount of SOD according to the present invention can be determined by routine experimentation. For example, the therapeutically active amount of an SOD of the present invention may vary depending on factors such as disease stage, severity of disease, age, sex, medical complication, and body weight of the subject. Dosages and dosing regimens of the SODs of the present invention can be adjusted to provide the optimal therapeutic response. For example, several divided doses can be administered daily, weekly, every 2 weeks, every 3 weeks, every 4 weeks, etc., and/or the dose can be proportionally reduced or increased according to the exigencies of the therapeutic situation.

In one embodiment, the method may include administering one or more additional agents to treat or prevent diabetic retinopathy or uveitis. The other agents include, but are not limited to, any agent that can improve or improve diabetic retinopathy or uveitis, such as compounds, gene therapy agents, proteins (including antibodies), and the like. The one or more additional agents may be administered simultaneously with the SOD or pharmaceutical composition, sequentially or in reverse order. Also, individual components may be administered to a subject by the same or different routes.

food composition

According to another aspect of the present invention, a food composition for improving or preventing diabetic retinopathy or uveitis containing SOD according to the present invention as an active ingredient is provided. Such food compositions include medical or nutraceutical food compositions.

The term "medical food" or "nutraceutical food" refers to food made from raw materials or ingredients that have the potential to have beneficial functions in the human body, which maintain or improve health by maintaining normal functions or activating the physiological functions of the human body. Refers to food, as defined by, but not limited to, the Ministry of Food and Drug Safety, and does not exclude any conventional health food in that sense.

In addition, the food includes, but is not limited to, various foods, food additives, beverages (eg, functional drinks, natural fruit juice and vegetable drinks), gum, tea, vitamin complexes, health functional foods, and other functional foods. .

The food may be prepared by a conventional method known in the art. For example, the medical food, nutraceutical food, or health functional food further includes at least one of a carrier, a diluent, an excipient, and an additive in addition to the SOD for the purpose of preventing or improving diabetic retinopathy or uveitis, such as tablets, pills, It may be formulated as one selected from the group consisting of powders, granules, powders, capsules and liquid formulations. Specific examples of the carrier, excipient, diluent, and additive are well known in the art, and a person skilled in the art can prepare them by combining appropriate components according to the formulation.

The content of the superoxide dismutase according to the present invention as an active ingredient in the above-described formulation can be appropriately adjusted according to the form and purpose of use, the patient's condition, the type and severity of symptoms, etc., and is about 0.001 to about 0.001 to about 99.9% by weight, preferably from about 0.01 to about 50% by weight, but is not limited thereto.

The dosage of the food of the present invention may vary depending on the patient's age, weight, sex, dosage form, state of health and degree of disease, and divided administration once a day to several times at regular time intervals according to the judgment of a doctor or pharmacist You may. For example, the daily dosage may be about 10 to about 1000 mg/kg based on the content of the active ingredient. The above dosage is an example of an average case, and the dosage may be higher or lower depending on individual differences. If the daily dose of the health functional food of the present invention is less than the above dose, a significant effect may not be obtained, and if it exceeds more than that, it is uneconomical and may cause undesirable side effects because it is out of the range of the usual dose. there is.

feed composition

According to another aspect of the present invention, a feed composition for preventing or improving diabetic retinopathy or uveitis comprising the SOD according to the present invention as an active ingredient is provided. In the present invention, the food composition may include a feed composition. These feed compositions can be prepared in any formulation commonly used in the art. For example, the feed composition of the present invention may include auxiliary components such as amino acids, inorganic salts, vitamins, antibiotics, antimicrobial substances, antioxidants, antifungal enzymes, and other probiotic-type microorganism preparations; grains such as ground or crushed wheat, oats, barley, corn and rice; vegetable protein feeds such as those based on rape, soybean and sunflower; animal protein feed such as blood meal, meat meal, bone meal and fish meal; dry ingredients consisting of sugar and dairy products, such as various powdered milk and whey powder; main components such as lipids, for example, animal fats and vegetable fats optionally liquefied by heating; Additives such as nutritional supplements, digestion and absorption enhancers, growth promoters, and disease preventives may be further included.

The feed composition of the present invention may be in the form of a powder or liquid formulation, and may include a feed additive excipient (calcium carbonate, horse powder, zeolite, jade powder or rice bran, etc.).

kit

The composition of the present invention may be provided in the form of a kit. For example, a composition of the present invention (e.g., a modified polypeptide, a pharmaceutical composition, a food composition, a feed composition, a combination administration composition comprising at least one or more additional agents, or a combination thereof) may be packaged and included in an appropriate container, Instructions for such use may be further included. Kits may also include components such as administration tools packaged in separate containers.

Hereinafter, the present invention will be described in more detail by the following examples. The following examples are presented to aid understanding of the present invention, and are not intended to limit the scope thereof in any way, and should not be construed as limiting.

Example 1. Preparation of a recombinant strain expressing superoxide dismutase (SodA2)

Example 1.1. Preparation of expression host GFBS220

Expression host GFBS220 was prepared using Bacillus subtilis KCTC 3135. B. subtilis KCTC 3135 was purchased from the Korea Research Institute of Bioscience and Biotechnology (KCTC). To facilitate post-processing, the genes shown in Table 1 below were removed from the B. subtilis KCTC 3135 genome.

gene name protein name function AprE Serine alkaline protease (subtilisin E) extracellular protease NprE extracellular neutral metalloprotease extracellular protease Bpr bacillopeptidase F extracellular protease Epr extracellular serine protease extracellular protease NprB extracellular neutral protease B extracellular protease Vpr extracellular serine protease extracellular protease Mpr extracellular metalloprotease extracellular protease IspAs intracellular serine protease intracellular protease SrfAC surfactin synthase Surfactin synthesis spoIIAC RNA polymerase sporulation-specific sigma factor (sigma-F) sporulation EpsE putative glycosyltransferase extracellular polysaccharide Xpf RNA polymerase sigma factor Transcription of the PBSX prophage gene

Deletion of the gene was performed using double cross-over recombination on the genome (FIG. 1). Specifically, DNA fragments (up fragments and down fragments) having homology to DNA sequences on both sides of the gene to be manipulated were cloned into the vector pUCori-ts-cm having a temperature-sensitive replication origin. PCR conditions and primers used for cloning are shown in Table 2 and Table 3, respectively.

PCR step temperature hour initial denaturation 95℃ 30 seconds 30 cycles 95℃50℃
72℃ 30 seconds
30 seconds
1 minute/kb final height 72℃ 10 minutes DNA polymerase used for PCR was Taq DNA polymerase (NEB, USA).

target gene homologous pair Primer sequence (5'→3') sequence number AprE fragment 1 F ctacggggtctgacgcagatatcgtaaccgaagaacg 5 R tgttgcagacatgttgctgaacgccatc 6 fragment 2 F caacatgtctgcaacatatcttggaaac 7 R gataagctgtcaaaccagagattggataggctatcaag 8 NprE fragment 1 F ctacggggtctgacgcagggcattactgcaccataatc 9 R gaggtacgccttcagcagcctgaacacc 10 fragment 2 F gctgaaggcgtacctcacgccttcttcc 11 R gataagctgtcaaaccagttgtcagatttgcatccttc 12 Bpr fragment 1 F ctacggggtctgacgcagagcaatttccagcccgcttc 13 R gtatgatgaggcatgaacagcaatcccg 14 fragment 2 F tcatgcctcatcatactcaacaagggtg 15 R gataagctgtcaaaccagttcccagccggatgttcaac 16 Epr fragment 1 F ctacggggtctgacgcaggctttctgccagccgatagg 17 R tgtgtcaaagccgttatgcttggctccg 18 fragment 2 F taacggctttgacacagcacaaactgcc 19 R gataagctgtcaaaccaggtctcccatacatgaacgac 20 NprB fragment 1 F ctacggggtctgacgcagagtaatcttgtaggaggctg 21 R tgtgactgtcatattcaccgtcgtgtgg 22 fragment 2 F tgaatatgacagtcacacagtattccgcc 23 R gataagctgtcaaaccagattaggatacggtctggctg 24 Vpr fragment 1 F ctacggggtctgacgcagatgtacgctgagccgaatag 25 R ggaatcacatttgcggagatacggcgtc 26 fragment 2 F ccgcaaatgtgattccggcacatcaaac 27 R gataagctgtcaaaccagaccgttttccgaatctgacc 28 Mpr fragment 1 F ctacggggtctgacgcagcgttatcccgaatgcccgtg 29 R ggctttgttcctttagtgtcaaccaccc 30 fragment 2 F ctaaaggaacaaagccgattcgctccgc 31 R gataagctgtcaaaccagaaattgactgctccacgctg 32 SrfAC fragment 1 F ctacggggtctgacgcaggatatgtattacctatcgcc 33 R gccccttcatccagttcactgcttccttg 34 fragment 2 F ggaagcagtgaactggatgaaggggcttcgctg 35 R gataagctgtcaaaccagaacgcttcgacatcactttc 36 spoIIA
fragment 1 F ctacggggtctgacgcagagcggacgatggggagactgg 37 R gccacctcatgcagccgatctggaagag 38 fragment 2 F ggctgcatgaggtggctgagcggctcgg 39 R gataagctgtcaaaccagctcattgttttggtgagctg 40 IspAs fragment 1 F ctacggggtctgacgcagtgctgcttggcattcatttc 41 R gccattgaagcaatgcctccgtttgaatc 42 fragment 2 F acggaggcattgcttcaatggctgcccctcatg 43 R gataagctgtcaaaccagtcaatgctctcgtcatattc 44 EpsE fragment 1 F ctacggggtctgacgcagcaagcaaatgggctgggagg 45 R gacaagccatgctttctgccaaagtgcg 46 fragment 2 F gaaagcatggcttgtcaagcatgaatag 47 R gataagctgtcaaaccagtgttgtatacattcagcagc 48 Xpf fragment 1 F gatcctctacggttcatccatgtccgaac 49 R tctatgatcctcctcattttg 50 fragment 2 F gaggaggatcatagaaagcttgtcatacgtttgcc 51 R ggttttcgttcggatcctccgctttttgtttg 52

After introducing the prepared vector into B. subtilis cells, transformants (single crossover homologous recombination) were selected using a medium containing chloramphenicol at 37°C (non-replication temperature). The selected transformants were cultured (second crossing) in LB medium without antibiotics at 30°C (permissive temperature for cloning), and then cultured in LB agar medium without antibiotics at 39°C. A strain (plasmid curing) having chloramphenicol sensitivity was selected for the resulting colony. PCR was performed on the selected colonies to obtain a double cross-over recombinant, and a final recombinant was selected by performing secondary pure separation and named GFBS220. The defective gene region of GFBS220 was amplified using the primers and PCR shown in Table 4, and then confirmed using agarose gel electrophoresis. The result of confirming the defective gene using PCR in the expression host GFBS220 is shown in FIG. 2 .

gene locus PCR primers (SEQ ID NO) B. subtilis
Size of PCR product of KCTC 3135 Size of GFBSL210 PCR product AprE F caaggcttgaaataacgttg (SEQ ID NO: 53)
R ttcgctgattacaacattgg (SEQ ID NO: 54) 3115bp 2116bp NprE F ggaacagatgatagctcatc (SEQ ID NO: 55)
R acactccgagaaggctgaag (SEQ ID NO: 56) 3487bp 2145bp Vpr F ctgcggcctgcacagccgcc (SEQ ID NO: 57)
R cgctgaatgacggtggtaag (SEQ ID NO: 58) 3733bp 2293bp NprB F agtaatcttgtaggaggctg (SEQ ID NO: 59)
R cgccaatgaagtgaaggagg (SEQ ID NO: 60) 2666bp 2153bp Mpr F ggttgaggcgattgcgacgg (SEQ ID NO: 61)
R ccattctgcaaaatcagctc (SEQ ID NO: 62) 2734bp 2076bp spoIIAC F aagatatgaagaaagccggg (SEQ ID NO: 63)
R acagccgcttcataagcctg (SEQ ID NO: 64) 2628bp 2102bp ThrC F tcaagctgtcatgtacggag (SEQ ID NO: 65)
R tccgatacgaatggctgtcg (SEQ ID NO: 66) 376bp 5455bp

Example 1.2. Construction of expression vector pBE1-sodA2

Mn-SOD was confirmed in the culture supernatant of Bacillus amyloliquefaciens strain GF423 through N-terminal sequencing (Kang et al., 2018). The GF423 strain was deposited with the Korea Research Institute of Bioscience and Biotechnology on March 6, 2017, respectively (accession number KCTC 13222 BP). The gene of the Mn-SOD was named sodA according to the nomenclature for bacterial SOD, and its amino acid sequence is shown in Figure 3 and SEQ ID NO: 2 (its nucleotide sequence is SEQ ID NO: 1). LC-UV-MS/MS peptide mapping of the enzyme preparation yielded 100% amino acid sequence coverage, but deamidation was observed at residues Asn74 and Asn137 at 73% and 17% abundance, respectively. Therefore, two Asn residues were substituted with Asp to improve the homogeneity of the purified enzyme. The amino acid sequence of this variant sodA, designated SodA2, see Figure 3 and SEQ ID NO: 4 (see SEQ ID NO: 3 for its nucleotide sequence).

The sodA2 gene was amplified using four primers (Table 5) and overlapping extension PCR using the Bacillus amyloliquefaciens GF423 genome as a template. Nucleotides for substitution of Asn to Asp are underlined.

primer Sequence (5'→3') sequence number One SOD F GGAGGAATTACAATGGCTTACAA 45 2 D74 R TGCATGTCCGCCGCC ATC GTTGCGGAC 46 3 D74 F CAGTCCGCAAC GAT GGCGGCGGACATG 47 4 D137R TTCAAGTTTGCC GTC GTTTACAACGAGC 48 5 D137 F CTCGTTGTAAAC GAC GGCAAACTTG 49 6 SOD R CAAAACAGAAGCTTCATTATTTTGCT 50

The amplified DNA fragment containing the sodA2 gene and the plasmid pBE1 linearized by Nde I and Hind III treatment were assembled in vitro by the SLIC method (Jeong et al. 2012), and the resulting construct was then E was transformed into E. coli C2984H. Correct clones were screened by restriction enzyme mapping and confirmed by nucleotide sequencing. The expression vector pBE1-sodA2 thus generated is shown in FIG. 4 .

Example 1.3. Preparation of production strain BSBA310

The expression vector pBE1-sodA2 was transformed into B. subtilis GFBS220. Strains were selected from the transformants and pure clones were established by two single colony isolation procedures in LB2 medium. The selected strain was named BSBA310 and was stored at -80°C by the glycerol stock method. The result of confirming the defective gene using PCR in this production strain BSBA310 is shown in FIG. 2 . In addition, the overall procedure for making production strain BSBA310 is summarized in FIG. 5 .

Example 2. Isolation and purification of superoxide dismutase (SodA2) from production strain BSBA310

Example 2.1. Cultivation of production strain BSBA310

For the cultivation of the production strain BSBA310 obtained in Example 1, LB agar medium (LB (Luria-Bertani) agar; tryptophan 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, agar 15 g/L) A single colony formed in was inoculated into 30 ml of LB medium and incubated at 37° C. for 12 hours. This seed culture was again inoculated into 3 L of LB medium containing 1 mM manganese sulfate (MnSO4), and cultured at 37°C for 20 hours.

Example 2.2. Isolation and purification of SodA2

The cell culture medium obtained in Example 2.1 was centrifuged at 4° C. and 3,578 x g for 20 minutes to obtain a supernatant, and then concentrated 10 times using ultrafiltration (UF, MWCO 10,000). 390 g of ammonium sulfate was added per 1 L of the concentrated cell culture medium, stirred for 20 minutes, centrifuged, and the supernatant was taken. The collected supernatant was purified using a PhenylSepharose HP column. In the purification process, the column was equilibrated using 50 mM potassium phosphate pH 7.0 at a concentration of 2 M ammonium sulfate, and then the supernatant obtained by adding ammonium sulfate was passed through the column. recovered using The purified liquid purified through the column was collected and concentrated by ultrafiltration to remove high-concentration salts formed during the purification process. The concentrated solution was filtered through a sterilization filter and lyophilized. The activity of SodA2 was analyzed using a SOD assay kit (Cayman Chemical, Michigan, USA). One unit of SOD activity is defined as the amount of enzyme that inhibits superoxide radicals by 50%. The activity of the dried SodA2 enzyme was 1000 to 1200 U/mg.

Example 3. Preparation of Dosage Materials

Shellac (EXCELACS co., LTD., Bangkok) was dissolved to a concentration of 3% ethanol and sterilized using a 0.2 um sterile filter. Shellac dissolved in ethanol was diluted with PBS. The lyophilized SodA2 was dissolved at 20 mg/mL, the shellac solution and the SOD solution were mixed in a ratio of 1:1, and lyophilized. The lyophilized shellac-coated SodA2 was mixed with dextrin at a ratio of 1:9 to 12 (shellac-coated SodA2 : dextrin) to prepare a material used in animal testing. The SOD activity of the final material was set to be 90 to 110 U/mg.

Example 4. Construction of diabetic retinopathy model

120 6-week-old male C57BL/6 mice (obtained from Coretech) were purchased and maintained on a 12-hour light/dark cycle and mice were allowed free access to food and water. Diabetes mellitus (hereinafter "DM") mice were induced by intraperitoneal injection of Streptozotocin (hereinafter "STZ") solution (10 mM citrate buffer (pH 4.5), 180 mg/kg), and 3 days after injection. After checking blood glucose levels, only mice with a blood sugar level of 300 mg/dl or more were selected as diabetic mice. C57BL/6 mice were classified into 10 groups as shown in Table 6 according to the concentration of the oral drug administered and whether or not diabetes was induced. According to the SodA2 administration period, the 3-week experimental group (60 rats) and the 16-week experimental group (60 rats) were divided. divided and tested. In the case of the SodA2 administration group, SodA2 was administered daily from the streptozotocin induction stage regardless of diabetes.

3-week experimental group
(60 in total) 16-week experimental group
(60 in total) normal control C57BL/6 vehicle administered control group, n=6 Normal mouse group administered with 1 unit SodA2 C57BL/6 control + SodA2 1 unit, 150 ul oral administration once a day, n=6 Normal mouse group administered with 5 unit SodA2 C57BL/6 control + SodA2 5 units, 150 ul oral administration once a day, n=6 Normal mouse group administered with 10 unit SodA2 C57BL/6 control + SodA2 10 unit, 150 ul oral administration once a day, n=6 Normal mouse group administered with 20 unit SodA2 C57BL/6 control + SodA2 20 unit, 150 ul oral administration once a day, n=6 diabetes control group STZ injected C57BL/6 mice (DM), n=6 Diabetic group administered with 1 unit SodA2 STZ injection C57BL/6 mice (DM) + SodA2 1 unit, 150 ul oral administration once a day, n=6 Diabetic group administered with 5 unit SodA2 STZ injection C57BL/6 mice (DM) + SodA2 5 units, 150 ul oral administration once a day, n=6 Diabetic group administered with 10 unit SodA2 STZ injection C57BL/6 mice (DM) + SodA2 10 units, 150 ul oral administration once a day, n=6 Diabetic group administered with 20 unit SodA2 STZ injection C57BL/6 mice (DM) + SodA2 20 units, 150 ul oral administration once a day, n=6

Example 5. Construction of uveitis model

120 6-week-old male C57BL/6 mice (obtained from Coretech) were purchased and maintained on a 12-hour light/dark cycle and mice were allowed free access to food and water. Of the total of 120 animals, 60 animals were used for the endotoxin-induced uveitis model experimental group and 60 animals were used for the experimental autoimmune uveitis model. All animal experiments were performed in accordance with the Statement of the Association for Research in Vision and Ophthalmology for the Use of Animals in Ophthalmic and Vision Research and approved by the Institutional Animal Care and Use Committees of Seoul National University and Seoul National University Hospital. received.

Example 5.1. Construction of an endotoxin-induced uveitis model and administration of SodA2

After oral administration (once a day, 200 ul) of 1, 5, 10, 20 units of SodA2 drug according to the concentration for 7 days to create an Endotoxin-Induced Uveitis (hereinafter "EIU") model 1 ng of LPS (Lipopolysaccharide, L2880-10MG), a component of the outer membrane of Gram-negative bacteria, was injected into the vitreous to induce acute induction. See Table 7 for mouse models used in acute uveitis experiments.

Endotoxin-induced uveitis model (EIU, oral administration for 1 week) normal control C57BL/6 vehicle administered control group, n=6 Normal mouse group administered with 1 unit SodA2 C57BL/6 control
+ SodA2 1 unit, 150 ul oral administration once a day, n=6 Normal mouse group administered with 5 unit SodA2 C57BL/6 control + SodA2 5 units, 150 ul oral administration once a day, n=6 Normal mouse group administered with 10 unit SodA2 C57BL/6 control + SodA2 10 unit, 150 ul oral administration once a day, n=6 Normal mouse group administered with 20 unit SodA2 C57BL/6 control + SodA2 20 unit, 150 ul oral administration once a day, n=6 EIU control group LPS-administered uveitis-induced C57BL/6 mice (LPS), n=6 EIU mouse group administered with 1 unit SodA2 LPS-administered uveitis-induced C57BL/6 mice (LPS)
+ SodA2 1 unit, 150 ul oral administration once a day, n=6 EIU mouse group administered with 5 unit SodA2 LPS-administered uveitis-induced C57BL/6 mice (LPS) + SodA2 5 unit, 150 ul oral administration once a day, n=6 EIU mouse group administered with 10 unit SodA2 LPS-administered uveitis-induced C57BL/6 mice (LPS) + SodA2 10 unit, 150 ul oral administration once a day, n=6 EIU mouse group administered with 20 unit SodA2 LPS-administered uveitis-induced C57BL/6 mice (LPS) + SodA2 20 unit, 150 ul oral administration once a day, n=6

Example 5.2. Construction of an experimental autoimmune uveitis model and administration of SodA2

The process of inducing T cell-mediated chronic uveitis to construct an Experimental autoimmune uveitis (hereinafter referred to as "EAU") model follows the following process. 30 mg of human IRBP _1-20 (Peptron, GPTHLFQPSLVLDMAKVLLD 95%) (Peptron) was dissolved in PBS and incubated at 26° C. for 30 minutes. Next, Mycobacterium tuberculosis H37 Ra (BD, 231141) and complete Freund's adjuvant (CFA; Sigma, F5881) were mixed and incubated at 26° C. for 30 minutes, and then mixed with human IRBP _1-20 at a ratio of 1:1. A total of 200 ul of the mixed reagent was subcutaneously injected into the back of the neck and two hind limbs of C57BL/6 mice, and then 200 ul of pertussis toxin (sigma, P7208) was intraperitoneally injected to chronically induce uveitis. Next, 1, 5, 10, and 20 units of SodA2 drug were orally administered for 21 days (once a day, 200 ul) according to the concentration. See Table 8 for mouse models used in chronic uveitis experiments.

Experimental autoimmune uveitis model (EAU, 3 weeks oral administration) normal control C57BL/6 vehicle administered control group, n=6 Normal mouse group administered with 1 unit SodA2 C57BL/6 control
+ SodA2 1 unit, 150 ul oral administration once a day, n=6 Normal mouse group administered with 5 unit SodA2 C57BL/6 control + SodA2 5 units, 150 ul oral administration once a day, n=6 Normal mouse group administered with 10 unit SodA2 C57BL/6 control + SodA2 10 unit, 150 ul oral administration once a day, n=6 Normal mouse group administered with 20 unit SodA2 C57BL/6 control + SodA2 20 unit, 150 ul oral administration once a day, n=6 EAU Control Autoimmune uveitis-induced C57BL/6 mice (EAU), n=6 EAU mouse group administered with 1 unit SodA2 Autoimmune uveitis-induced C57BL/6 mice (EAU)
+ SodA2 1 unit, 150 ul oral administration once a day, n=6 EAU mouse group administered with 5 unit SodA2 Autoimmune uveitis-induced C57BL/6 mice (EAU) + SodA2 5 unit, 150 ul oral administration once a day, n=6 EAU mouse group administered with 10 unit SodA2 Autoimmune uveitis-induced C57BL/6 mice (EAU) + SodA2 10 unit, 150 ul oral administration once a day, n=6 EAU mouse group administered with 20 unit SodA2 Autoimmune uveitis-induced C57BL/6 mice (EAU) + SodA2 20 unit, 150 ul oral administration once a day, n=6

Example 6. Confirmation of effect in diabetic retinopathy model

Example 6.1. Assessment of retinal vascular leakage

To check the degree of blood vessel leakage in the 3-week and 16-week experimental groups after the end of the SodA2 administration period, mice were anesthetized and Evans blue (20 mg/ml, 150 ul, dissolved in PBS) was intravenously injected and perfused for 1 hour. Extracted. All eye extraction procedures were performed in accordance with the Association for Research in Vision and Ophthalmology Statement on the Use of Animals in Ophthalmology and Vision Research. For qualitative analysis of retinal vascular leakage, the excised eyeball was fixed with 4% paraformaldehyde (PFA), flatmounted in 1x PBS, placed on a slide, and then subjected to a fluorescence microscope (Eclipse 90i, Nikon, Tokyo, Japan). was used to photograph the entire retina at x 40 magnification. In addition, for quantitative analysis of retinal vascular leakage, the entire retina is photographed with red fluorescence, and the image is set to a color threshold based on the automatic ISODATA algorithm using the ImageJ (1.47v, NIH, Bethesda, MD, USA) program. After adjustment, the red area was measured and expressed as the degree of retinal vascular leakage (%), and compared with a non-diabetic normal control group.

3-week administration group

As a result of qualitative analysis through a microscope, no vascular leakage was observed in both the normal control group without SodA2 administration and the normal mouse group with SodA2 administration (SodA2 concentration: 1, 5, 10, 20 units), and normal retinal vascular permeability was not affected regardless of SodA2 intake. It was confirmed that there was no change (Fig. 6a). In the diabetic control group, contrast enhancement in the retinal tissue due to an increase in vascular permeability was confirmed 3 weeks after diabetes induction (first picture of FIG. 6b). On the other hand, it was observed that retinal vascular permeability was significantly reduced in the SodA2-administered diabetic group compared to the control group (second to fifth pictures of FIG. 6B).

As a result of the quantitative analysis of retinal vascular leakage, similar to the qualitative evaluation result, there was no retinal vascular leakage in both the SodA2 non-administered normal control group and the SodA2-administered normal mouse group, and high retinal vascular leakage was confirmed in the diabetic control group. In the diabetic 3-week experimental group administered with SodA2, retinal vascular permeability decreased compared to the diabetic control group, and in particular, a statistically significant decrease was observed in the diabetic group administered with 5 unit SodA2. Quantitative evaluation of retinal vascular leakage in the 3-week experimental group is shown in FIG. 6c.

16-week administration group

As a result of qualitative analysis through a microscope, no vascular leakage was observed in both the normal control group without SodA2 administration and the normal mouse group with SodA2 administration (FIG. 7a). In some of the normal mouse groups administered with 10 and 20 unit SodA2, the retinal vascular permeability was increased compared to the non-diabetic control group, but the increase was not significant. In the diabetic control group, contrast enhancement in the retinal tissue due to an increase in vascular permeability was observed 16 weeks after diabetes induction (first picture of FIG. 7b). On the other hand, retinal vascular permeability decreased in the SodA2-administered diabetic group compared to the control group (second to fifth pictures in FIG. 7b), and in particular, vascular permeability significantly decreased in the 5 unit SodA2-administered diabetic group.

As a result of the quantitative analysis of retinal vascular leakage, similar to the qualitative evaluation results, retinal vascular leakage was not observed in the normal control group without SodA2 administration and the normal mouse group administered with SodA2 (20 unit SodA2-administered normal mouse group showed increased retinal vascular permeability). pattern, but not significant), and the diabetic control group showed high retinal vascular permeability. On the other hand, in the diabetic group administered with SodA2 for 16 weeks, retinal vascular permeability decreased compared to the diabetic control group, and in particular, a statistically significant decrease was observed in the diabetic group administered with 5 units of SodA2. Quantitative evaluation of retinal vascular leakage in the 16-week experimental group is shown in FIG. 7c.

Example 6.2. Assessment of astrocyte immunofluorescence staining

After separating retinas from eyes fixed in 4% paraformaldehyde, anti-GFAP antibody (1:100; Invitrogen, 53-9392-82) was added to Perm/Block solution (PBS solution containing 0.3% Triton-X and 0.2% BSA). ) and isolectin B4-594 (1:100; Invitrogen, I21412) and incubated overnight at 4°C. The next day, it was washed with PBS, and then the retina was mounted with fluoromount aqueous mounting medium (Sigma-Aldrich). To confirm the distribution of astrocyte foot processes outside the pericytes surrounding the retinal vascular network (the better distribution of astrocyte foot processes translates to better suppression of vascular permeability) , The retina was stained and photographed with a confocal microscope (Leica TCS STED, Leica Microsystems, Wetzlar, Germany), and the middle part of the retina was photographed at x 400 magnification and then used with ImageJ (1.47v, NIH, Bethesda, MD, USA). Astrocytes were quantified by group using the program.

3-week administration group

As a result of qualitative analysis through a microscope, there was no change in the distribution of astrocyte foot projections in both the normal control group without SodA2 administration and the normal mouse group with SodA2 administration (SodA2 concentration 1, 5, 10, 20 units) regardless of SodA2 administration (Fig. 8a). In the diabetic control group, a decrease in astrocyte foot projections was confirmed compared to the normal control group 3 weeks after diabetes induction (first picture of FIG. 8B). On the other hand, in the SodA2-administered diabetic group, it was observed that the distribution of astrocyte foot projections was significantly increased and recovered compared to the control group (second to fifth pictures of FIG. 8B).

As a result of quantitative analysis of immunofluorescent staining of astrocytes and qualitative evaluation results, no change was observed in the distribution of astrocyte foot projections in both the normal control group without SodA2 administration and the normal mouse group with SodA2 administration. In the diabetic control group, astrocytic foot projections decreased 3 weeks after diabetes induction. Compared to the diabetic control group, which showed a decrease in astrocyte foot processes, the distribution of astrocyte foot processes increased in the 3-week diabetic experimental group administered with SodA2. Quantitative evaluation of astrocyte immunofluorescence staining in the 3-week experimental group is shown in FIG. 8c.

16-week administration group

As a result of qualitative analysis through a microscope, the distribution of astrocyte foot processes was reduced in some of the normal mice administered with SodA2, unlike the normal control group without SodA2 administration, but the change was not significant (FIG. 9a). In the diabetic control group, a significant decrease in astrocyte foot projections was confirmed compared to the normal control group 16 weeks after diabetes induction (first picture of FIG. 9b). Compared to the control group, in the SodA2-administered diabetes group, it was observed that the distribution of astrocyte foot projections was significantly increased and recovered (second to fifth pictures of FIG. 9B).

As a result of quantitative analysis of astrocyte immunofluorescence staining, it showed the same pattern as the result of qualitative analysis. Compared to the diabetic control group, in which astrocytic foot projections decreased after 16 weeks of diabetes induction, the distribution of astrocyte foot projections significantly increased in the experimental group treated with SodA2 at 16 weeks of diabetes induction. Quantitative evaluation of astrocyte immunofluorescence staining in the 16-week experimental group is shown in FIG. 9c.

Example 6.3. Assessment of retinal vascular staining

After separating the retina from the eyeball fixed in 4% paraformaldehyde, the retina was placed in a 24-well plate and washed 4 times with PBS. Then, a 3% trypsin solution (Difco 1:250, 0.1M Tris (pH 7.8)) was added to the plate containing the retina and incubated at 37°C for 2 hours. After the reaction was over, trypsin was carefully removed, washed with water, and non-vascular tissues were carefully removed by transferring to a slide and using water. After drying the slide with only blood vessels remaining, H&E staining was performed.

Diabetic retinopathy may cause pericyte loss around blood vessels and the occurrence of acellular capillaries, which was confirmed by retinal blood vessel staining.

As a result of qualitative analysis through a microscope, loss of pericytes (indicated by arrows) and generation of acellular capillaries (indicated by arrowheads) were not observed in the normal control group without SodA2 administration and the normal mouse group administered with SodA2 at 16 weeks (Fig. 10a). . In the diabetic control group, pericyte cell loss increased after 16 weeks of diabetes induction, and acellular capillaries increased (first picture of FIG. 10b). On the other hand, in the diabetic group administered with SodA2, inhibition of pericyte cell loss and generation of acellular capillaries was observed (second to fifth pictures in FIG. 10B ).

As a result of additional quantitative analysis, there was no change in the number of pericytes and acellular capillaries in both the normal control group without SodA2 administration and the normal mouse group with SodA2 administration (FIG. 10c and 10d, 1st to 5th columns from the left). After 16 weeks of induction of diabetes, a decrease in the number of pericytes (increased loss of pericyte cells) was confirmed in the diabetic control group, but the number of pericyte cells significantly increased in the group administered with SodA2 for 16 weeks (6 to 10 from the left in FIG. 10c). column). In addition, in the diabetic group treated with SodA2 after 16 weeks of induction of diabetes, especially in the 5 unit administered group, the generation of acellular capillaries was reduced, although statistical significance was not secured (FIG. 10d).

Example 7. Eye disease experimental evaluation of uveitis model

Example 7.1. Fundus assessment of uveitis

In the endotoxin-induced uveitis (EIU) model, fundus examination was performed 24 hours after LPS injection (acute induction), and in the experimental autoimmune uveitis (EAU) model, 14, 16, 18, and 21 days after uveitis induction (chronic induction) ), fundus examination was performed. Fundus evaluation of uveitis is scored from 0 points in the absence of intraocular inflammation to 4 points according to the criteria of hemorrhage or ocular condition, and refer to Table 9 for the scoring criteria.

Fundus Evaluation Criteria for Uveitis score standard 4 points A vitreous hemorrhage that fills the vitreous cavity or a large retinal detachment (more than 1/2) 3.5 points Vitreous hemorrhage (more than half) or small retinal detachment 3 points Minor vitreous hemorrhage, pattern of linear lesions, large confluent lesions, or optic nerve papillary edema 2.5 points Chorioretinal lesions (>5) or linear lesions (2 or more, 1/4 area) 2 points Small focal lesions (3 to 5) or linear lesions (1 or less, 1/2 area or more) 1.5 points Small focal lesions (3 to 5) or linear lesions (1 or less, 1/4 area) 1 point Small focal lesions (1 to 2) or minimal vasculitis/vitreolitis (more than 1/2 area) 0.5 points Small focal lesions (1 to 2) or minimal vasculitis/vitreolitis (1/4 area) 0 points no inflammation

When evaluated according to the above evaluation criteria, in the case of the EIU model (acute induction group), the administration of SodA2 showed a significant reduction effect compared to the non-administration group (FIG. 11a). In the case of the EAU model (chronic induction group), SodA2 administration Compared to the non-administration group, a reduction effect was shown in the fundus evaluation score of uveitis (FIG. 11b). In particular, inflammation was most improved in the 5 unit SodA2 administration group.

Example 7.2. H&E staining and tissue evaluation

For evaluation of uveitis tissue, the excised eyeball was fixed in 4% paraformaldehyde and then a paraffin block was made. Paraffin blocks were fabricated into 4 μm-thick sections, and H&E (hematoxylin & eosin) staining was performed. See Table 10 and Figure 12 for information regarding uveitis tissue evaluation criteria.

Uveitis tissue evaluation criteria score standard 4 points Retinal folds (area 4), intra/subretinal hemorrhage or exudate (area 4), damage to inner and outer layers of the retina (area 4), inflammatory cell infiltration (area 4) 3.5 points Retinal folds (area 3), intraretinal/subretinal hemorrhage or exudate (area 3), damage to inner and outer layers of the retina (area 3), inflammatory cell infiltration (area 3) 3 points Retinal folds (area 3), intraretinal/subretinal hemorrhage or exudate (area 2), damage to inner and outer layers of the retina (area 2), inflammatory cell infiltration (area 3) 2.5 points Retinal folds (area 2), intraretinal hemorrhage or exudate (area 2), damage to the inner layer of the retina (area 2), inflammatory cell infiltration (area 2) 2 points Retinal wrinkles (area 2), intraretinal hemorrhage or exudate (area 1), damage to the inner layer of the retina (area 1), inflammatory cell infiltration (area 2) 1.5 points Retinal wrinkles (area 1), inflammatory cell infiltration (area 1), damage to the inner layer of the retina (area 1) 1 point Retinal folds (area 1), inflammatory cell infiltration (area 1) 0.5 points No inflammatory cell infiltration (area 1), no retinal wrinkles, no retinal hemorrhages or exudates, no retinal damage 0 points normal retina

EIU model (acute provocation group)

Histological abnormalities were not observed in both the SodA2 non-administered normal control group and the SodA2-administered normal mouse group (SodA2 concentration 1, 5, 10, 20 units) (FIG. 13a). In the case of the EIU control group induced by LPS injection, severe inflammation in the vitreous cavity and retinal tissue was observed (first picture of FIG. 13b). On the other hand, in the SodA2-administered EIU mouse group, a decrease in inflammation in the vitreous cavity and a decrease in inflammatory cell infiltration in the retinal tissue were observed compared to the EIU control group (second to fifth pictures of FIG. 13B).

As a result of histological grading, it was confirmed that histological inflammation was improved to a lower grade in the SodA2-administered EIU mouse group than in the EIU control group (FIG. 13c).

EAU model (chronic induced group)

Histological abnormalities were not observed in both the SodA2 non-administered normal control group and the SodA2-administered normal mouse group (SodA2 concentration 1, 5, 10, 20 units) (FIG. 14a). In the case of the EIU control group in which uveitis was induced by autoimmunity, inflammatory cell infiltration into the retinal tissue and consequent retinal changes were observed (first picture of FIG. 14b). On the other hand, in the SodA2-administered EAU mouse group, compared to the EAU control group, a significant reduction in the infiltration of inflammatory cells into the retinal tissue and consequent retinal changes was observed, and in particular, a significant reduction was observed in the 5 unit and 10 unit units (second in Fig. 14b). the fourth picture).

As a result of histological grading, similar to tissue evaluation, it was confirmed that the histological inflammatory findings were improved to a lower grade in the SodA2-administered EAU mouse group compared to the EAU control group, especially in the 5 unit and 10 unit SodA2-administered EAU mouse groups. was confirmed (FIG. 14c).

statistical treatment

One-way ANOVA and Tukey's multiple comparisons test were used for statistics. GraphPad Prism 7.0 was used as a statistical processing program.

<110> BiomLogic, Inc. GENOFOCUS CO., LTD. SEOUL NATIONAL UNIVERSITY HOSPITAL <120> SUPEROXIDE DISMUTASE AND USES THEREOF FOR PREVENTING OR TREATING DIABETIC RETINOPATHY OR UVEITIS <130> KC22020 <160> 72 <170> KoPatentIn 3.0 <210> 1 <211> 609 <212> DNA <213> Bacillus amyloliquefaciens <400> 1 atggcttaca aacttccaga attgccttac gcttatgatg ctttagaacc tcatatcgat 60 aaggaaacga tgacgattca ccatacgaag caccataaca catacgtgac aaacctcaac 120 aaagcgatcg aaggatctgc gcttgcagag aaatctgtag atgagcttgt tgctgatttg 180 aacgcagtgc cggaggacat ccgcacggca gtccgcaaca atggcggcgg acatgcaaac 240 cactctttat tctggactct tttatctccg aacggcggag gcgaaccgac tggtgagctt 300 gctgaagaga tcaaaagcac gttcggaagc ttcgatcaat ttaaagaaaa attcgccgca 360 gcagctgcag gccgtttcgg ttcaggctgg gcttggctcg ttgtaaacaa cggcaaactt 420 gaaattacaa gcacgccaaa ccaagattca ccgctttcag aaggtaaaac acctgttctc 480 ggtcttgatg tttgggagca tgcgtactac ctgaactacc aaaaccgccg tcctgattac 540 atttcagctt tctggaatgt tgtgaactgg gatgaagttg cccgtcttta cagcgaagca 600 aaataatga 609 <210> 2 <211> 201 <212> PRT <213> Bacillus amyloliquefaciens <400> 2 Met Ala Tyr Lys Leu Pro Glu Leu Pro Tyr Ala Tyr Asp Ala Leu Glu 1 5 10 15 Pro His Ile Asp Lys Glu Thr Met Thr Ile His His Thr Lys His His 20 25 30 Asn Thr Tyr Val Thr Asn Leu Asn Lys Ala Ile Glu Gly Ser Ala Leu 35 40 45 Ala Glu Lys Ser Val Asp Glu Leu Val Ala Asp Leu Asn Ala Val Pro 50 55 60 Glu Asp Ile Arg Thr Ala Val Arg Asn Asn Gly Gly Gly His Ala Asn 65 70 75 80 His Ser Leu Phe Trp Thr Leu Leu Ser Pro Asn Gly Gly Gly Glu Pro 85 90 95 Thr Gly Glu Leu Ala Glu Glu Ile Lys Ser Thr Phe Gly Ser Phe Asp 100 105 110 Gln Phe Lys Glu Lys Phe Ala Ala Ala Ala Ala Gly Arg Phe Gly Ser 115 120 125 Gly Trp Ala Trp Leu Val Val Asn Asn Gly Lys Leu Glu Ile Thr Ser 130 135 140 Thr Pro Asn Gln Asp Ser Pro Leu Ser Glu Gly Lys Thr Pro Val Leu 145 150 155 160 Gly Leu Asp Val Trp Glu His Ala Tyr Tyr Leu Asn Tyr Gln Asn Arg 165 170 175 Arg Pro Asp Tyr Ile Ser Ala Phe Trp Asn Val Val Asn Trp Asp Glu 180 185 190 Val Ala Arg Leu Tyr Ser Glu Ala Lys 195 200 <210> 3 <211> 609 <212> DNA <213> Bacillus amyloliquefaciens <400> 3 atggcttaca aacttccaga attgccttac gcttatgatg ctttagaacc tcatatcgat 60 aaggaaacga tgacgattca ccatacgaag caccataaca catacgtgac aaacctcaac 120 aaagcgatcg aaggatctgc gcttgcagag aaatctgtag atgagcttgt tgctgatttg 180 aacgcagtgc cggaggacat ccgcacggca gtccgcaacg atggcggcgg acatgcaaac 240 cactctttat tctggactct tttatctccg aacggcggag gcgaaccgac tggtgagctt 300 gctgaagaga tcaaaagcac gttcggaagc ttcgatcaat ttaaagaaaa attcgccgca 360 gcagctgcag gccgtttcgg ttcaggctgg gcttggctcg ttgtaaacga cggcaaactt 420 gaaattacaa gcacgccaaa ccaagattca ccgctttcag aaggtaaaac acctgttctc 480 ggtcttgatg tttgggagca tgcgtactac ctgaactacc aaaaccgccg tcctgattac 540 atttcagctt tctggaatgt tgtgaactgg gatgaagttg cccgtcttta cagcgaagca 600 aaataatga 609 <210> 4 <211> 201 <212> PRT <213> Bacillus amyloliquefaciens < 400>4 Met Ala Tyr Lys Leu Pro Glu Leu Pro Tyr Ala Tyr Asp Ala Leu Glu 1 5 10 15 Pro His Ile Asp Lys Glu Thr Met Thr Ile His His Thr Lys His His 20 25 30 Asn Thr Tyr Val Thr Asn Leu Asn Lys Ala Ile Glu Gly Ser Ala Leu 35 40 45 Ala Glu Lys Ser Val Asp Glu Leu Val Ala Asp Leu Asn Ala Val Pro 50 55 60 Glu Asp Ile Arg Thr Ala Val Arg Asn Asp Gly Gly Gly His Ala Asn 65 70 75 80 His Ser Leu Phe Trp Thr Leu Leu Ser Pro Asn Gly Gly Gly Glu Pro 85 90 95 Thr Gly Glu Leu Ala Glu Glu Ile Lys Ser Thr Phe Gly Ser Phe Asp 100 105 110 Gln Phe Lys Glu Lys Phe Ala Ala Ala Ala Ala Gly Arg Phe Gly Ser 115 120 125 Gly Trp Ala Trp Leu Val Val Asn Asp Gly Lys Leu Glu Ile Thr Ser 130 135 140 Thr Pro Asn Gln Asp Ser Pro Leu Ser Glu Gly Lys Thr Pro Val Leu 145 150 155 160 Gly Leu Asp Val Trp Glu His Ala Tyr Tyr Leu Asn Tyr Gln Asn Arg 165 170 175 Arg Pro Asp Tyr Ile Ser Ala Phe Trp Asn Val Val Asn Trp Asp Glu 180 185 190 Val Ala Arg Leu Tyr Ser Glu Ala Lys 195 200 <210> 5 < 211> 37 <212> DNA <213> Artificial Sequence <220> <223> AprE_frgament 1_forward primer <400> 5 ctacggggtc tgacgcagat atcgtaaccg aagaacg 37 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> AprE_frgament 1_reverse primer <400> 6 tgttgcagac atgttgctga acgccatc 28 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> AprE_frgament 2_forward primer <400> 7 cacatgtct gcaacatatc ttgga10 28 > 8 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> AprE_frgament 2_reverse <400> 8 gataagctgt caaaccagag attggatagg ctatcaag 38 <210> 9 <211> 38 <212> DNA <213> Artificial Sequence < 220> <223> NprE_frgament 1_forward primer <400> 9 ctacggggtc tgacgcaggg cattactgca ccataatc 38 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> NprE_frgament 1_reverse primer <400> 10 catatcaggcccat 28 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> NprE_frgament 2_forward primer <400> 11 gctgaaggcg tacctcacgc cttcttcc 28 <210> 12 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> NprE_frgament 2_reverse primer <400> 12 gataagctgt caaaccagtt gtcagatttg catccttc 38 <210> 13 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Bpr_frgament 1_forward primer <400> 13 ctacggggtc tgacgcagag caatttccag cccgcttc 38 <210> 14 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Bpr_frgament 1_reverse primer <400> 14 gtatgatgag gcatgaacag caatcccg 28 <210> 15 <2121> 2 2 DNA <213> Artificial Sequence <220> <223> Bpr_frgament 2_forward primer <400> 15 tcatgcctca tcatactcaa caagggtg 28 <210> 16 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Bpr_frgament 2_reverse primer < 400> 16 gataagctgt caaaccagtt cccagccgga tgttcaac 38 <210> 17 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Epr_frgament 1_forward primer <400> 17 ctacggggtc tgacgcaggc tttctgcaggc tttctgccag <400> 38 ccgatagg 28 <212> DNA <213> Artificial Sequence <220> <223> Epr_frgament 1_reverse primer <400> 18 tgtgtcaaag ccgttatgct tggctccg 28 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Epr_frgament 2_forward primer <400> 19 taacggcttt gacacagcac aaactgcc 28 <210> 20 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Epr_frgament 2_reverse primer <400> 20 gataagctgt caaaccaggt ctcccataca tgaacgac 38 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> NprB_frgament 1_forward primer <400> 21 ctacggggtc tgacgcagag taatcttgta ggaggctg 38 <210> 22 <211> 28 <212> DNA <213> Artificial Sequence <220 > <223> NprB_frgament 1_reverse primer <400> 22 tgtgactgtc atattcaccg tcgtgtgg 28 <210> 23 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> NprB_frgament 2_forward primer <400> 23 tgaatatgac agtcacagcc 23 tgaatatgac agtcacagcc tatt9 210> 24 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> NprB_frgament 2_reverse primer <400> 24 gataagctgt caaaccagat taggatacgg tctggctg 38 <210> 25 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Vpr_frgament 1_forward primer <400> 25 ctacggggtc tgacgcagat gtacgctgag ccgaatag 38 <210> 26 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Vpr_frgament 1_reverse primer <400> 26 ggaat ttgcggagat acggcgtc 28 <210> 27 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Vpr_frgament 2_forward primer <400> 27 ccgcaaatgt gattccggca catcaaac 28 <210> 28 <211> 38 <212> DNA < 200 > 29 ctacggggtc tgacgcagcg ttatcccgaa tgcccgtg 38 <210> 30 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Mpr_frgament 1_reverse primer <400> 30 ggctttgttc ctttagtgtc aaccaccc 28 <2821> 1 312 <2821> 212> DNA <213> Artificial Sequence <220> <223> Mpr_frgament 2_forward primer <400> 31 ctaaaggaac aaagccgatt cgctccgc 28 <210> 32 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Mpr_frgament 2_reverse primer <400> 32 gataagctgt caaaccagaa attgactgct ccacgctg 38 <210> 33 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> SrfAC_frgament 1_forward primer <400> 33 ctacggggtc tgacgcagga tatgtattac ctatcgcc0 38 211> 29 <212> DNA <213> Artificial Sequence <220> <223> SrfAC_frgament 1_reverse primer <400> 34 gccccttcat ccagttcact gcttccttg 29 <210> 35 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SrfAC_frgament 2_forward primer <400> 35 ggaagcagtg aactggatga aggggcttcg ctg 33 <210> 36 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> SrfAC_frgament 2_reverse primer <400> 36 gataagctgt caaaccagaa cgcttcgaca tcactttc 38 <210> 37 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> spoIIA_frgament 1_forward primer <400> 37 ctacggggtc tgacgcagag cggacgatgg gagactgg 38 <210> 38 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> spoIIA_frgament 1_reverse primer <400> 38 gccacctcat gcagccgatc tggaagag 28 <9210> 28 <212> DNA <213> Artificial Sequence <220> <223> spoIIA_frgament 2_forward primer <400> 39 ggctgcatga ggtggctgag cggctcgg 28 <210> 40 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> spoIIA_frgament 2_reverse primer <400> 40 gataagctgt caaaccagct cattgttttg gtgagctg 38 <210> 41 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> IspA_frgament 1_forward primer <400> 41 ctacggggtc tgacgcagtg ctgcttggca ttcatttc 38 <210> 42 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> IspA_frgament 1_reverse primer <400> 42 gccattgaag caatgcctcc gtttgaatc 29 <210> 43 <211> 33 <212> DNA <213> Artificial Sequence <220 > <223> IspA_frgament 2_forward primer <400> 43 acggaggcat tgcttcaatg gctgcccctc atg 33 <210> 44 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> IspA_frgament 2_reverse primer <400> 44 gatacatagctcgt a atacatagctcg a 38 <210> 45 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> EpsE_frgament 1_forward primer <400> 45 ctacggggtc tgacgcagca agcaaatggg ctgggagg 38 <210> 46 <211> 28 <212> DNA <213 > Artificial Sequence <220> <223> EpsE_frgament 1_reverse primer <400> 46 gacaagccat gctttctgcc aaagtgcg 28 <210> 47 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> EpsE_frgament 2_forward primer <400> 47 gaaagcatgg cttgtcaagc atgaatag 28 <210> 48 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> EpsE_frgament 2_reverse primer <400> 48 gataagctgt caaaccagtg ttgtatacat tcagcagc 38 <210> 49 <211> 29 DNA <213> Artificial Sequence <220> <223> Xpf_frgament 1_forward primer <400> 49 gatcctctac ggttcatcca tgtccgaac 29 <210> 50 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Xpf_frgament 1_reverse primer < 400> 50 tctatgatcc tcctcatttt tg 22 <210> 51 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Xpf_frgament 2_forward primer <400> 51 gaggaggatc atagaaagct tgtcatacgt ttgcc 35 <2101> 52 <22 <212> DNA <213> Artificial Sequence <220> <223> Xpf_frgament 2_reverse primer <400> 52 gagttttcgt tcggatcctc cgctttttgt ttg 33 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AprE_PCR primer_forward <400> 53 caaggcttga aataacgttg 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AprE_PCR primer_reverse <400> 54 ttcgctgatt acaacattgg 20 <210> 55 <211> 20 < 212> DNA <213> Artificial Sequence <220> <223> NprE_PCR primer_forward <400> 55 ggaacagatg atagctcatc 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NprE_PCR primer_reverse <400 > 56 acactccgag aaggctgaag 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vpr_PCR primer_forward <400> 57 ctgcggcctg cacagccgcc 20 <210> 58 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> Vpr_PCR primer_reverse <400> 58 cgctgaatga cggtggtaag 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NprB_PCR primer_forward <400> 59 agtaatcttg taggaggctg 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NprB_PCR primer_reverse <400> 60 cgccaatgaa gtgaaggagg 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Mpr_PCR primer_forward <400> 61 ggttgaggcg attgcgacgg 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Mpr_PCR primer_reverse <400> 62 ccattctgca aaatcagctc 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> spoIIAC_PCR primer_forward <400> 63 aagatatgaa gaaagccggg 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> < 223> spoIIAC_PCR primer_reverse <400> 64 acagccgctt cataagcctg 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ThrC_PCR primer_forward <400> 65 tcaagctgtc atgtacggag 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ThrC_PCR primer_reverse <400> 66 tccgatacga atggctgtcg 20 <210> 67 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SOD_forward primer <400> 67 ggaggaatta caatggctta caa 23 <210> 68 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> D74_reverse primer <400> 68 tgcatgtccg ccgccatcgt tgcggac 27 <210> 69 <211> 27 < 212> DNA <213> Artificial Sequence <220> <223> D74_forward primer <400> 69 cagtccgcaa cgatggcggc ggacatg 27 <210> 70 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> D137_reverse primer < 400> 70 ttcaagtttg ccgtcgttta caacgagc 28 <210> 71 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> D137_forward primer <400> 71 ctcgttgtaa acgacggcaa acttg 25 <210> 72 <2112 26 < > DNA <213> Artificial Sequence <220> <223> SOD_reverse primer<400> 72 caaaacagaa gcttcattat tttgct 26

Claims (21)

A pharmaceutical composition for the treatment or prevention of diabetic retinopathy or uveitis comprising superoxide dismutase (SOD) as an active ingredient,
The SOD is derived from a Bacillus species strain
pharmaceutical composition. According to claim 1,
The diabetic retinopathy or uveitis includes one or more symptoms selected from the group comprising visual impairment, ocular vascular leakage and ocular inflammation.
pharmaceutical composition. According to claim 1,
The SOD induces one or more effects selected from reduction of vascular permeability of diabetic retinopathy, restoration of astrocyte foot process, inhibition of pericyte loss, and inhibition of acellular capillary generation. doing
pharmaceutical composition. According to claim 1,
The SOD improves or alleviates one or more fundus evaluation indices selected from focal lesions of uveitis, linear lesions, chorioretinal lesions, confluent lesions, vasculitis, vitreousitis, vitreous hemorrhage, optic nerve papilloma, and retinal detachment;
improvement or alleviation in one or more tissue evaluation indices selected from inflammatory cell infiltration, retinal wrinkles, intra/subretinal hemorrhage, intra/subretinal exudate, and retinal damage; or
causing both improvement or alleviation in the fundus evaluation index and improvement or alleviation in the tissue evaluation index.
pharmaceutical composition. According to claim 1,
The uveitis is caused by an infectious cause or a non-infectious cause
pharmaceutical composition. According to claim 5,
Infectious causes of the uveitis include one or more selected from bacteria, viruses, fungi and parasites
pharmaceutical composition. According to claim 5,
The non-infectious cause of the uveitis includes one or more selected from autoimmune diseases, tumors, trauma, surgery and systemic diseases
pharmaceutical composition. According to claim 1,
The SOD is an isolated or purified enzyme
pharmaceutical composition. According to claim 1,
The SOD is contained in a strain lysate, a strain culture, a strain culture concentrate, a strain culture extract, or a dry form thereof.
pharmaceutical composition. According to claim 1,
The SOD is Mn-SOD
pharmaceutical composition. According to claim 1,
The SOD is deamidated Mn-SOD
pharmaceutical composition. delete According to claim 1,
The SOD is derived from Bacillus amyloliquefaciens GF423 strain (KCTC 13222 BP)
pharmaceutical composition. According to claim 1,
The SOD is one in which amino acid residues 74 and 137 of SEQ ID NO: 2 are substituted with Asp.
pharmaceutical composition. According to claim 1,
The SOD has an amino acid sequence represented by SEQ ID NO: 4,
pharmaceutical composition. According to claim 1,
The composition is for oral administration
pharmaceutical composition. According to claim 16,
The SOD is coated with a coating agent
pharmaceutical composition. A veterinary composition for the treatment or prevention of diabetic retinopathy or uveitis comprising superoxide dismutase (SOD) as an active ingredient,
The SOD is derived from a Bacillus species strain
Veterinary Compositions. A food composition for improving or preventing diabetic retinopathy or uveitis containing superoxide dismutase (SOD) as an active ingredient,
The SOD is derived from a Bacillus species strain
food composition. A feed composition for improving or preventing diabetic retinopathy or uveitis containing superoxide dismutase (SOD) as an active ingredient,
The SOD is derived from a Bacillus species strain
feed composition. A step of administering the pharmaceutical composition according to any one of claims 1 to 11 and 13 to 17 or superoxide dismutase (SOD) to a non-human subject
A method for treating or preventing diabetic retinopathy or uveitis.

Images