KR102513569B1 - High sensitive sensor on transcriptional system - Google Patents

Abstract

The present invention is a specific binding material; and a polynucleotide comprising a sequence encoding a light-up aptamer.

Description

High sensitive sensor on transcriptional system}

The present invention relates to a binding material-polynucleotide conjugate for highly sensitive detection of a target material.

A target substance detection technique for determining whether a specific target substance is present in a sample and how much of the target substance is present in a sample can be used in various fields such as diagnosis of various diseases, biotechnology research, and food. The key technical features of this detection technology are how accurately it can detect the target substance and whether it can detect even a small amount of the target substance with high sensitivity, and various detection technologies developed by improving these points. have been developed For example, Western blotting, two-dimensional electrophoresis, immunofluorescence, immunochemical staining (IHC), co-immunoprecipitation, FACS, radioimmunoassay (RIA), which are techniques that can recognize and detect specific proteins ), radioimmunoassay, and MALDI-TOF analysis.

Among detection technologies that apply antibodies that bind with high selectivity and affinity to a target substance, the most representative is enzyme-linked immunosorbent assay (ELISA), which combines an antibody with an enzyme reaction. It is a detection method capable of confirming the presence of a target antigen by generating a color reaction or a fluorescence signal when an enzyme attached to an antigen and attached to an antibody reacts with a substrate therefor. By applying this ELISA technique, an antigen binds to a capture antibody immobilized on a substrate and an enzyme-linked detection antibody is treated thereto to increase the specificity and sensitivity of detection. There are several applied methods such as competitive ELISA in which binding competition is induced by treating a substrate coated with an antigen.

On the other hand, an aptamer is a single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure in itself and has the characteristics of being able to bind to a specific target substance with high affinity and specificity by this structure. is a molecule with Aptamers can be applied by developing, selecting, and applying aptamers with higher affinity for target molecules through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technique, which can replace antibodies previously used to detect target molecules. It has been suggested as a possible alternative.

A light-up aptamer is a type of aptamer that has a structure capable of generating fluorescence as single-stranded nucleic acids form a tertiary structure. In particular, the reason why the name light-up aptamer was given is that these aptamers do not always generate fluorescence signals, but do not generate fluorescence in their original structure and then combine with a specific fluorophore. This is because the fluorescence is turned on when the fluorescence can be generated only as the structure changes. An example of a light-up aptamer is spinach aptamer, which has a tertiary structure that mimics the fluorescence-generating structure of green fluorescent protein (GFP), a representative fluorescent protein. A fluorescence signal can be emitted, and a green fluorescence signal can be emitted only when the fluorophore 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI) binds to the spinach aptamer to form a complex. In addition to spinach aptamers, there are light-up aptamers that can generate fluorescence in a wavelength range different from those of spinach aptamers, such as broccoli and mango aptamers, which can generate fluorescence signals during various experiments or detection. It can be used as an alternative to labeling materials.

Attempts have been made to combine aptamers or light-up aptamers with antigen-antibody reactions by improving the conventional ELISA technique using an enzyme reaction as a method for detecting a target substance. A method using a light-up aptamer instead of a fluorescent substance labeled for detection, a method using a light-up aptamer molecule directly coupled to a domain capable of specific binding to a target antigen, and an aptamer capable of binding to a target antigen instead of an antibody Efforts and attempts have been made to use aptamers or light-up aptamers in the detection process of target substances, such as the detection method used, but such conventional attempts simply replace existing fluorescent labels with light-up aptamers. Therefore, it was not possible to expect a significant increase in the detection effect. For this reason, the enzyme reaction-based ELISA technique is still widely used for the purpose of detecting the target substance, and the introduction of a new technique that can effectively amplify the detection signal. there is a need for

The present invention generates a fluorescence signal with a stronger intensity than the enzyme-linked immunosorbent assay (ELISA) technique conventionally used for detecting a target substance and detects the target substance with higher sensitivity, and is specific to the target substance. To provide a binding material-polynucleotide conjugate that can be detected by amplifying the generation of a fluorescent signal by linking a polynucleotide encoding an aptamer that generates a fluorescent signal to a binding material capable of binding to a binding material and transcribing the same. do.

In addition, an object of the present invention is to provide a composition for detection capable of detecting a target substance in a sample in which the target substance is expected to be present.

Another object of the present invention is to provide a detection method capable of detecting a target substance in a sample in which the target substance is expected to exist.

In order to achieve the above object, one aspect of the present invention is a specific binding material; And a polynucleotide linked to the specific binding material; a binding material-polynucleotide conjugate comprising at least one sequence encoding a light-up aptamer, the binding material- Polynucleotide conjugates are provided.

Another aspect of the present invention provides a composition for detecting a target substance comprising the binding substance-polynucleotide conjugate.

Another aspect of the present invention is the step of reacting the binding material-polynucleotide conjugate with a sample; removing a conjugate that is not bound to the sample from a reaction product of the binding material-polynucleotide conjugate and the sample; Reacting the conjugate of the binding material-polynucleotide conjugate and the sample by treating a polymerase capable of synthesizing a light-up aptamer and a fluorophore molecule that reacts with the light-up aptamer to emit fluorescence; and measuring a fluorescence signal from the reaction product of the separated conjugate, the polymerase, and the fluorophore molecule.

The binding material-polynucleotide conjugate provided in the present invention recognizes a specific target material, binds to the target material using the specificity and selectivity of the material capable of binding, and uses a polymerase from the polynucleotide linked to the light-up aptamer. As it is synthesized by transcription, it can combine with a fluorophore to generate a fluorescence signal. Therefore, it is possible to determine whether a target substance is present in a sample by measuring a fluorescence signal using the binding substance-polynucleotide conjugate of the present invention.

Compared to the method of detecting the target antigen by measuring the color development/fluorescence of one enzyme reacting with one target antigen using the reaction of an enzyme coupled to an antibody, as in the conventional ELISA technique, the binding material-poly of the present invention Since the nucleotide conjugate uses a transcription system rather than an enzyme, a plurality of light-up aptamers can be polymerized for one target substance to generate a fluorescent signal, which can amplify the intensity of the fluorescent signal and detect the target substance with high sensitivity. It works.

In addition, since the binding material-polynucleotide conjugate of the present invention uses an RNA aptamer that is relatively easy to change and manipulate compared to proteins, the amplification effect of fluorescence signal intensity can be further improved by changing the polynucleotide sequence encoding it or forming a layered structure. It has the advantage of being easy to increase and improve.

However, the effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the following description.

1A to 1C are schematic diagrams showing a method for detecting a target substance using a fluorescence signal generated by transcription of the 'type 1 to 3 binding material-polynucleotide conjugate' (antibody-DNA conjugate form) of the present invention.
Figure 2a is a fluorescence signal measurement graph for confirming the optimal MgCl ₂ concentration when a polynucleotide containing the sequence encoding Spinach 2 aptamer of the present invention is transcribed to form a light-up aptamer, and Figure 2b is a fluorescence signal measurement graph for confirming the optimal DFHBI-1T concentration when a polynucleotide containing a sequence encoding Spinach 2 aptamer is transcribed to form a light-up aptamer.
Figure 3 is a conventional fluorescence-based ELISA technique and measuring the intensity of fluorescent signals using the type 1 binding material-polynucleotide conjugate and the type 2 binding material-polynucleotide conjugate connected by a linker composed of four layers of the present invention. It is a graph compared with the ELISA technique. The red bar graph represents the fluorescence signal level measured in the presence of antigen AFP, and the black bar graph represents the fluorescence signal level measured without AFP.
Figure 4a is a graph comparing the intensity of fluorescence signals measured by varying the number of linker layers of the type 2 binding agent-polynucleotide conjugate of the present invention. The red bar graph represents the fluorescence signal level measured in the presence of antigen AFP, and the black bar graph represents the fluorescence signal level measured without AFP.
Figure 4b (a) shows a schematic diagram of a biotinylated polynucleotide formed by varying the binding position of biotin to a polynucleotide in which the sequence encoding the Spinach aptamer is not repeated, and (b) shows the above It is a fluorescence measurement graph for confirming the transcription efficiency according to the position where biotin is bound to the polynucleotide. b-Spi2 refers to a form in which biotin is bound to the end near the promoter sequence, Spi2-b to the end near the terminator sequence, and b-Spi2-b to both ends.
Figure 4c is a graph comparing fluorescence signal intensities measured by maintaining a constant concentration of antigen AFP and varying the amount of biotinylated DNA in order to optimize the concentration of added DNA.
5a is a diagram showing three repeating forms of polynucleotides included in the 'type 3 binding material-polynucleotide conjugate' of the present invention. In FIG. 5A, PSST represents a type 3-1 binding material-polynucleotide conjugate, PSPST indicates a type 3-2 binding material-polynucleotide conjugate, and PSTPST indicates a type 3-3 binding material-polynucleotide conjugate, respectively. .
5B is a fluorescence signal measured using type 3-1 to type 3-3 binding material-polynucleotide conjugates, which are three repeating types of polynucleotides included in the type 3 binding material-polynucleotide conjugate of the present invention. It is an agarose gel image showing a graph comparing the intensity of and electrophoresis results of Spinach aptamer transcribed from the polynucleotide of the binding material-polynucleotide conjugate.
FIG. 6A is an agarose gel image showing the results of electrophoresis of the DNA fragments and pictures in which the sequence terminator sequences included in the polynucleotide of the binding material-polynucleotide conjugate of the present invention are designed in various combinations (T1 to T9).
FIG. 6B is a graph comparing agarose gel images showing electrophoresis results of spinach aptamers transcribed from the T1 to T9 polynucleotides and transcription termination efficiency calculated based thereon. In the agarose gel image, 'T' means a transcript synthesized by normal transcription termination at each terminator site, and 'R' means a transcript synthesized by read-through.
6C is a graph comparing the intensities of fluorescence signals measured using different repeat numbers of spinach aptamer sequences of type 3-3 binding material-polynucleotide conjugates.
(a) of FIG. 6D shows a schematic view of biotinylated polynucleotides formed by varying the position at which biotin binds to polynucleotides when forming a type 3 binding agent-polynucleotide conjugate of the present invention, and (b) is a fluorescence measurement graph for confirming the transcription efficiency of the polynucleotide according to the binding position of biotin in the type 3 binding material-polynucleotide conjugate (Spinich aptamer sequence repeated 16 times). b-Spi refers to a form in which biotin is bound to an end near a promoter sequence, Spi-b to an end near a terminator sequence, and b-Spi-b to both ends.
6E is a graph comparing fluorescence signal intensities measured by maintaining a constant concentration of antigen IL-6 and varying the amount of biotinylated DNA in order to optimize the concentration of added type 3-3 DNA.
Figure 7a shows a graph showing OD values of a color development-based ELISA technique measured by varying the concentration of antigen AFP, and a trend line and equation obtained therefrom.
Figure 7b shows a graph showing the intensity of the fluorescence signal of the fluorescence-based ELISA technique measured by varying the concentration of antigen AFP, and a trend line and equation obtained therefrom.
7C is a graph showing the fluorescence signal intensity of the binding material-polynucleotide conjugate (type 2 binding material-polynucleotide conjugate) of the present invention measured by varying the concentration of antigen AFP, and a trend line and equation obtained therefrom. .
Figure 8a is a fluorescence signal of the binding material-polynucleotide conjugate of the present invention (type 3 binding material-polynucleotide conjugate, Spinach aptamer sequence repeated 16 times) measured in PBS buffer solution with different concentrations of antigen IL-6. It shows the graph showing the intensity of and the trend line and equation obtained from it.
Figure 8b shows the fluorescence signal of the binding material-polynucleotide conjugate (type 3 binding material-polynucleotide conjugate, Spinach aptamer sequence repeated 16 times) of the present invention measured by FBS spiking at different concentrations of antigen IL-6. It shows the graph showing the intensity and the trend line and equation obtained from it.

First, the terms used in the present invention are defined.

In the present invention, 'detection' refers to confirming the presence of a target material, and includes quantifying or semi-quantifying the concentration of the target material.

In the present invention, 'sample' refers to any mixture or solution that needs to be detected because it contains or is suspected to contain a target substance to be detected. Water and food that contain or are believed to contain the target substance may be included, and may be a biological sample obtained from a human body or animal, and a processed sample obtained by processing a biological sample.

Hereinafter, the present invention will be described in detail.

1. A binding agent-polynucleotide conjugate containing a sequence encoding a light-up aptamer

One aspect of the present invention includes a binding agent-polynucleotide conjugate.

The binding material-polynucleotide conjugate of the present invention may include a specific binding material; and a polynucleotide bound to the specific binding material, wherein the polynucleotide includes at least one sequence encoding a light-up aptamer.

The specific binding material may include any material that has selectivity and specificity only for the target material and binds to the target material by distinguishing the target material from other materials, for example, physical and chemical properties unique to the target material Based on this, it may be a substance having characteristics capable of binding to the target substance. The binding form of the specific binding material and the target material may vary depending on the type of the binding material and the type of the target material, and may be reversibly or irreversibly bound. The binding force between the specific binding substance and the target substance may be stronger than the binding force between the specific binding substance and the non-target substance, and is not separated by a washing method commonly used in detection and sensing techniques. may be the binding force of Specifically, the specific binding material is a compound capable of specifically binding to a target substance, an antibody, a fragment of an antibody, an aptamer, a peptide, a peptide mimetics (peptide mimetics), biotin, avidin, streptavidin, neutravidin Or it may be a combination thereof, but is not limited thereto.

The antibody refers to an immunoglobulin molecule having a reactivity by specifically binding to an epitope of a target substance immunologically, and includes a monoclonal antibody, a polyclonal antibody, an antibody having a full-length chain structure, and at least an antigen-binding function. Antibodies of functional fragments having, e.g., Fab fragments, Fab' fragments, F(ab)'2 fragments, F(ab)'3 fragments, Fv, single-chain Fv antibodies ("scFv"), bis-scFv, ( scFv)2, minibodies, diabodies, triabodies, tetrabodies, disulfide stabilized Fv proteins ("dsFv"), and single-domain antibodies (sdAbs, nanobodies), and recombinant antibodies. .

The aptamer is a single-stranded nucleic acid (DNA, RNA or modified nucleic acid) that has a stable tertiary structure in itself and has the characteristics of being able to bind to a specific target substance with high affinity and specificity by this structure. means molecule. The aptamer as the specific binding material has a configuration different from the light-up aptamer described later, and when the aptamer is used as the specific binding material, the binding material-polynucleotide conjugate of the present invention A polynucleotide containing a sequence encoding the light-up aptamer; may be linked to the tamer. However, a light-up aptamer may be used as a kind of aptamer as the specific binding material. In this case, a molecule (eg, fluorophore) that specifically binds to the light-up aptamer is a target material. It can be. The aptamer can be produced through a Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technique, and when using the SELEX technique, there is an advantage in that an aptamer having high affinity for a target material can be more easily developed and used.

The peptide mimetics may be peptides or non-peptides having a similar structure by mimicking the structure of a peptide capable of specifically binding to the target substance.

The biotin may interact with and bind to avidin, streptavidin, or neutravidin with high binding force. When the specific binding material is biotin, the binding material-polynucleotide conjugate of the present invention binds to an avidinized, streptavidinized, or neutravidinized target material, or binds to an avidized, streptavidinized, or neutravidinized target material. It can bind to other specific binding substances (eg, antibodies, etc.) or linkers that have been dinlated. Similarly, when the specific binding material is avidin, streptavidin, or neutravidin, the binding material-polynucleotide conjugate of the present invention binds to a biotinylated target material, or other biotinylated specific binding material (e.g. eg, antibodies, etc.) or linkers.

The polynucleotide may include one or more sequences encoding the light-up aptamer, and specifically, two or more, four or more, six or more, eight or more, ten or more, twelve or more sequences, or It may include 16 or more, but is not limited thereto, and the greater the number of sequences encoding the light-up aptamer included in the polynucleotide, the more light-up aptamers can be transcribed in several parts at the same time. Since the mer can be synthesized, it is more effective in terms of amplification of the fluorescence signal. The polynucleotide may be DNA, RNA, or any variant thereof, as long as it can synthesize a light-up aptamer using an enzyme based on the coding sequence contained therein, and is generally used for DNA and RNA molecules. bases (A, T, G, C, U, etc.) as well as modified bases.

The sequence encoding the light-up aptamer is a nucleotide sequence capable of synthesizing the light-up aptamer (RNA molecule) when transcribed by a polymerase capable of synthesizing the light-up aptamer, such as RNA polymerase , It may be a polynucleotide sequence complementary to the RNA sequence constituting the light-up aptamer.

The light-up aptamer is a single-stranded RNA molecule synthesized by transcribing the nucleotide sequence encoding it by a polymerase, and forms a tertiary structure and has the property of generating a fluorescence signal in a structure in a state bound to a specific fluorophore. . In addition, the light-up aptamer may be obtained through SELEX (Systematic Evolution of Ligands by Exponential Enrichment), a nucleic acid library having a random sequence.

When the binding material-polynucleotide conjugate is treated with a sample in which a detection target material is expected to be present, the specific binding material of the binding material-polynucleotide conjugate specifically binds to the target material. And when the polynucleotide of the binding material-polynucleotide conjugate is transcribed in a state where the binding material-polynucleotide conjugate is bound to the target material, the light-up aptamer ( RNA molecules) are polymerized. When a specific fluorophore that binds to the light-up aptamer is added to the light-up aptamer thus polymerized, a fluorescence signal is generated from the structure in which the light-up aptamer and the fluorophore are combined. The presence or absence of the target substance in the sample may be confirmed.

The sequence encoding the light-up aptamer may be operably linked to a promoter or terminator. When the polynucleotide includes two or more sequences encoding the light-up aptamers, each sequence encoding the two or more light-up aptamers may independently include a promoter and/or a terminator operably linked thereto. there is. The promoter refers to a polynucleotide sequence to which a polymerase (eg, RNA polymerase) or transcriptional regulators can bind or act so that transcription of genetic information encoding the light-up aptamer can be started. Specifically, the promoter may be a tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pL λ promoter, pR λ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, or trp promoter, for example, a T7 promoter. However, it is not limited thereto, and may include any sequence capable of controlling the transcription of genetic information encoding the light-up aptamer. The terminator refers to a transcription terminator and refers to a polynucleotide sequence that determines the termination and termination of transcription performed by a polymerase (eg, RNA polymerase). Specifically, the terminator may be an ADH1 terminator, a T3 terminator, or a TonB terminator, for example, a T7 terminator or a VSV terminator, or a combination of two or more terminator, but is not limited thereto.

In addition, the promoter and terminator may be linked upstream or downstream of the sequence encoding the light-up aptamer, for example, the promoter may be linked upstream and the terminator may be linked downstream. The connection form of the terminator may be that one or more, for example, two or more or three or more terminator are connected downstream of the sequence encoding the light-up aptamer, and in this case, two or more types of terminator are connected together. may be connected. When two or more terminators are connected, a short length (eg, 20 or less, 18 or less, 15 or less, 10 or less, 8 or less, 6 or less, or 5 or less) between the terminators base) may be inserted, and one or more polynucleotides may be inserted between the terminators according to the number of terminators.

The terminator may include a nucleotide sequence of any one of SEQ ID NO: 4 to SEQ ID NO: 12, specifically, may include a nucleotide sequence of SEQ ID NO: 6 to SEQ ID NO: 12, and more specifically, SEQ ID NO: 10 It may contain a nucleotide sequence.

The specific binding material of the present invention and the polynucleotide may be directly linked or indirectly linked through a linker. Specifically, the polynucleotide may be bound to the specific binding material through a linker forming a covalent bond or a non-covalent bond. The linker is a substance that serves to connect one side to a specific binding material and the other side to a polynucleotide to link them, and may be one type of material, and a plurality of the linking materials form a complex It may be formed, and furthermore, it may be one in which two or more types of materials form a complex.

The linker may include at least one selected from the group consisting of Streptavidin, Avidin, or NeutrAvidin, and biotin. In the case of a fragment, a linker as described above may be used. For example, when the specific binding material is in a biotinylated form and the polynucleotide is in a biotinylated form, streptavidin, avidin or neutravidin links the biotinylated specific binding material and the biotinylated polynucleotide it may be Since streptavidin, avidin or neutravidin can strongly bind with biotin according to its high binding force, the biotinylated specific binding material and biotinylated polynucleotide can be linked to each other by binding to streptavidin, avidin or neutravidin .

Furthermore, the linker may further include a biotinylated protein. The linker may be one in which a complex of any one of streptavidin, avidin, or neutravidin and a biotinylated protein forms a layer. According to the high binding force of streptavidin, avidin, neutravidin and biotin, the streptavidin, avidin or neutravidin molecules and the biotinylated protein may interact to form a layer while forming a complex. The biotinylated protein may be biotinylated bovine serum albumin (BSA), but is not limited to BSA alone, and in the process of forming a layered structure by interacting and binding streptavidin, avidin, or neutravidin and biotin, Any protein that does not interfere can be used.

The linker may be in a dendrimer form having two or more layered structures. The dendrimer structure is formed by stacking layered structures to form a branch-like shape, and refers to a form in which molecular chains spread three-dimensionally from the center to the outside according to a predetermined rule. For example, the dendrimer structure may have three or more, four or more, five or more, or six or more layered structures, but is not limited thereto, and as the number of the layered structures increases, more polynucleotides may be included. Therefore, since a larger amount of light-up aptamer can be synthesized, it is more effective in terms of amplification of the fluorescence signal. When the specific binding material and the polynucleotide are linked by the dendrimer structure linker, two or more polynucleotides may be linked in parallel to one specific binding material. In addition, the linker of the dendrimer structure may be made by forming a layer of a complex of any one of streptavidin, avidin or neutravidin and a biotinylated polynucleotide, wherein the biotinylated polynucleotide is the outermost layer of streptavidin, It can be linked to a specific binding material by binding to avidin or neutravidin.

In the case of biotin bound to a polynucleotide, that is, in the case of a biotinylated polynucleotide, biotin may be bound to the end of the polynucleotide closer to the promoter, and to the end of the polynucleotide closer to the terminator. it could be In addition, biotin may be bound to both ends of the polynucleotide. Among the binding material-polynucleotide conjugates of the present invention, when the polynucleotide contains 4 or more sequences encoding the light-up aptamer, when the biotin is bound to both ends of the polynucleotide, the fluorescence signal The amplification effect may be better, and among the binding material-polynucleotide conjugates of the present invention, in the case where the polynucleotide and the specific binding material are connected by a dendrimer structure linker, the biotin is added to the terminator of the terminal of the polynucleotide. When coupled to the near end, the effect of amplifying the fluorescence signal may be better.

The light-up aptamer of the present invention may be a spinach aptamer. The spinach aptamer is a single-stranded RNA aptamer, which is made by mimicking the structure of green fluorescent protein (GFP), a representative fluorescent protein. Through the SELEX study, DFHBI (3,5-difluoro-4-hydroxybenzylidene imidazolinone) or DFHBI-1T was selected as a material that can replace the beta-cylinder structure of the site that acts as a fluorophore in GFP. When DFHBI or DFHBI-1T, which plays a single role, binds to the spinach aptamer, green fluorescence like GFP can be generated.

In addition, the light-up aptamer of the present invention is spinach2 aptamer, baby spinach aptamer, mbaby spinach aptamer, broccoli aptamer, mango ( mango) aptamer, malachite green aptamer, blue fluorescent RNA (BFR) aptamer, and sulforhodamine B aptamer. The spinach 2, baby spinach, mbaby spinach, and broccoli aptamers may each use DFHBI or DFHBI-1T as a fluorophore molecule, and the mango aptamer may use thiazole orange T01 or thia as a fluorophore molecule. Sol Orange T03 may be used, malachite green may be used as a fluorophore molecule for the malachite green aptamer, Hoechst may be used as a fluorophore molecule for the BFR aptamer, and the sulforhodamine B aptamer may be fluorescent Since sulforhodamine B can be used as a single molecule, a fluorescence signal can be generated by binding each aptamer and fluorophore.

The binding material-polynucleotide conjugate of the present invention is characterized by excellent detection sensitivity of a target material. The detection sensitivity may be represented by, for example, a limit of detection (LOD) value, which means a minimum target substance concentration capable of detecting and discriminating between the presence and absence of a target substance.

The binding agent-polynucleotide conjugate of the present invention may have better detection sensitivity compared to the ELISA technique, and may have, for example, a smaller LOD value. The ELISA technique may be a color-based ELISA or a fluorescence-based ELISA. The binding agent-polynucleotide conjugate may detect a target substance with a sensitivity that is 5,000 times higher than that of a color-based ELISA, such as 6,000 times, 7,000 times, 8,000 times, 9,000 times or more, or 10,000 times or more. It may be to detect with higher sensitivity. In addition, the binding material-polynucleotide conjugate may detect a target substance with a sensitivity that is 1,000 times or more higher than that of fluorescence-based ELISA, such as 1,200 times or more, 1,300 times or more, 1,400 times or more, 1,500 times or more, or 1,600 times or more. It may be to detect with more than twice higher sensitivity.

The LOD of the binding agent-polynucleotide conjugate of the present invention is 100 fM or less, such as 50 fM or less, 30 fM or less, 20 fM or less, 10 fM or less, 1 fM or less, 500 aM or less, 200 aM or less, 100 aM or less, 70 aM or less, 50 aM or less, 45 aM or less, 40 aM or less, 38 aM or less, or 37 aM or less.

2. A composition for detecting a target substance comprising a binding substance-polynucleotide conjugate

Another aspect of the present invention provides a composition for detecting a target substance comprising a binding substance-polynucleotide conjugate.

The composition for detecting a target substance includes at least one of the binding substance-polynucleotide conjugates described in section 1. Binding substance-polynucleotide conjugate containing a sequence encoding a light-up aptamer .

Description of the binding material-polynucleotide conjugate is the same as described above.

The composition may further include a polymerase capable of synthesizing a light-up aptamer and a fluorophore molecule that emits fluorescence by reacting with the light-up aptamer.

The polymerase capable of synthesizing the light-up aptamer may be, for example, an RNA polymerase, and the light-up aptamer coding sequence included in the polynucleotide of the binding material-polynucleotide conjugate of the present invention can be used as a light-up application. Any enzyme capable of catalyzing a reaction for synthesizing a tamer may be included. For example, as long as it can perform the above functions, the polymerase derived from any species may be included, and any modified polymerase may be used. In addition, the polymerase may be selected and included as a more appropriate enzyme according to a promoter sequence operably linked to the sequence encoding the light-up aptamer.

Descriptions of the light-up aptamer and the fluorophore are the same as described above.

In the composition of the present invention, the binding material-polynucleotide conjugate can directly or indirectly specifically and selectively bind to a target material, and when the light-up aptamer is polymerized by the polymerase, it binds to the fluorophore to generate a fluorescence signal As it may occur, it may be used for detection of a target substance. As described above, the binding material-polynucleotide conjugate of the present invention has an effect of amplifying the fluorescence signal by generating stronger fluorescence compared to previously used techniques such as ELISA, and the target material is present in a small amount, so the concentration is high. Since it has the advantage of being able to detect even at very low levels, the composition of the present invention is suitable for use as a substitute for conventional detection techniques.

The composition may further include a capture antibody capable of binding to a target substance. The capture antibody may be of a different type from the antibody, which is a type of specific binding material of the binding material-polynucleotide conjugate of the present invention, but is an antibody that has the characteristics of specifically binding to the same target material, and is a monoclonal antibody, Clonal antibodies, antibodies with a full-length chain structure, antibodies of functional fragments having at least an antigen-binding function, e.g., Fab fragments, Fab' fragments, F(ab)'2 fragments, F(ab)'3 fragments , Fv, single-chain Fv antibodies ("scFv"), bis-scFv, (scFv)2, minibodies, diabodies, triabodies, tetrabodies, disulfide stabilized Fv proteins ("dsFv"), and single-domain It may include both antibodies (sdAbs, nanobodies), and recombinant antibodies.

The light-up aptamer and fluorophore molecules; Spinach aptamer and DFHBI (3,5-difluoro-4-hydroxybenzylidene imidazolinone); spinach aptamer and DFHBI-1T; spinach2 aptamer and DFHBI; spinach2 aptamer and DFHBI-1T; baby spinach aptamer and DFHBI; baby spinach aptamer and DFHBI-1T, mbaby spinach aptamer and DFHBI; mbaby spinach aptamer and DFHBI-1T; broccoli aptamer and DFHBI; broccoli aptamer and DFHBI-1T; Mango aptamer and thiazole orange T01; Mango Aptamer and Thiazole Orange T03; malachite green aptamers and malachite green; BFR aptamers and Hoechst; And it may be selected from the group consisting of sulforhodamine B aptamer and sulforhodamine B (sulforhodamine B). As described above in 1. Binding material-polynucleotide conjugate containing sequence encoding light-up aptamer , the combination of fluorophore molecules used together may vary depending on the type of light-up aptamer. .

When a target substance is expected to be present in the composition for detecting the target substance of the present invention, if the target substance is present when the sample is processed, the specific binding substance of the binding substance-polynucleotide conjugate included in the composition for detecting the target substance is targeted When a substance binds and the polynucleotide of the binding substance-polynucleotide conjugate is transcribed, the light-up aptamer is polymerized, and a fluorescent signal is generated by combining it with a fluorophore, which can be used to detect a target substance by measuring it.

The composition for detecting a target substance may further include components necessary for polymerizing polynucleotides into RNA, and specifically, components such as nucleotides, transcription factors necessary for RNA polymerization, and salts (eg, MgCl ₂ ). there is.

The composition for detecting a target material of the present invention may also be provided in the form of a kit for detecting a target material. The kit may include the binding material-polynucleotide conjugate, polymerase, fluorophore, capture antibody, nucleotide, transcription factor, salt, and the like of the present invention as described above. In addition, the kit for detecting the target substance may further include a buffer capable of washing away and removing the binding substance-polynucleotide conjugate not bound to the target substance, and a user manual describing optimal reaction conditions may be added. can be included with The kit may further include a substrate. The substrate may be made of glass, plastic, metal, silicon, quartz, alumina, oxide crystal, or a mixture thereof. For example, the plastic may be PMMA, PC, COC, etc., the metal may be nickel, aluminum, iron or copper, and the oxide crystal may be SiO ₂ , TiO ₂ , Ta ₂ O ₅ or Al ₂ O ₃ . It may be, but is not limited thereto. The capture antibody may be included in a form immobilized on the substrate.

3. Method for detecting a target substance using a binding substance-polynucleotide conjugate

Another aspect of the present invention provides a method for detecting a target substance from a sample.

The method of detecting the target substance is to react at least one conjugate of the binding substance-polynucleotide conjugate described in the section 1. Binding substance-polynucleotide conjugate containing a sequence encoding a light-up aptamer with a sample. step; removing a conjugate that is not bound to the sample from a reaction product of the binding material-polynucleotide conjugate and the sample; reacting the conjugate of the binding material-polynucleotide conjugate and the sample by treating a polymerase capable of synthesizing a light-up aptamer and a fluorophore molecule that reacts with the light-up aptamer to emit fluorescence; and measuring a fluorescence signal from a reaction product of the separated conjugate, the polymerase, and the fluorophore molecule.

The method of detecting the target substance may further include, after the step of removing the conjugate that does not bind to the sample, separating the binding substance-polynucleotide conjugate and the conjugate of the sample.

Description of the binding material-polynucleotide conjugate is the same as described above.

When the binding material-polynucleotide conjugate is reacted with a sample according to each step of the method of detecting the target material, when the target material is present in the sample, the specific binding material of the binding material-polynucleotide conjugate binds to the target material. reaction result is obtained. A polymerase capable of separating the binding substance-polynucleotide conjugate and the target substance conjugate in the sample by removing the binding substance-polynucleotide conjugate and the sample that do not bind to the target substance, and synthesizing a light-up aptamer When treated, the polynucleotide of the conjugate is transcribed to polymerize the light-up aptamer RNA, and when the fluorophore molecule is treated, a fluorescence signal can be generated together with the transcribed light-up aptamer, and the fluorescence signal is measured. By doing so, it is possible to detect whether or not the target substance is present in the sample.

The step of removing the sample not bound to the binding material-polynucleotide conjugate may include treating the sample with a solution that does not affect the reaction result, such as a buffer solution, and washing away the unbound sample.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

Preparation and identification of polynucleotides containing sequences encoding spinach aptamers

<1-1. Preparation of Polynucleotide>

First, a DNA fragment was prepared as a polynucleotide containing a sequence encoding a light-up aptamer included in the binding material-polynucleotide conjugate of the present invention. As the light-up aptamer coding sequence, a sequence encoding a spinach aptamer having a characteristic of generating a fluorescence signal by binding to a DFHBI or DFHBI-1T fluorophore only when present was used.

Specifically, the sequence of SEQ ID NO: 1 in Table 1 was prepared by recombining the sequence encoding Spinach-2 aptamer into the pUC57 plasmid together with the T7 promoter and T7 terminator sequences. The DNA was amplified by PCR using primers composed of sequences of SEQ ID NOs 2 and 3 in Table 1 below. PCR was denaturated at 94° C. for 5 minutes; A total of 30 cycles were repeated at 94° C. for 30 seconds, at 53° C. for 30 seconds, and at 68° C. for 25 seconds; The final extension step was performed at 68°C for 5 minutes. All PCR products were purified with a PCR clean-up kit (Promega, Madison, WI, USA) prior to use, and the concentrations of the PCR products were checked with a Nanodrop spectrophotometer (Thermo Fisher Scientific).

sequence number sequence name Base sequence (5'→ 3') One Spinach-2 TAATACGACTCACTATAGGGGACGCAACTGAATGAAATGGTGAAGGACGGGTCCAGGTGTGGCTGCTTCGGCAGTGCAGCTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTCGCGTCCCGCTGAGCAATAACTAG 2 Spinach-2 Forward primer CCAAGCTTGCATGCAGGCCTCTGCAGTCGA 3 Spinach-2 Reverse primer CTAGTTATTGCTCAGCGG

<1-2. Identification of polynucleotide transcription and fluorescence signal>

Using the DNA fragment prepared in Example 1-1, in order to measure the fluorescence signal for the spinach aptamer polymerized by proceeding transcription, T7 RNA polymerase (Takara, Japan) was used for each PCR product 90 μL of folding buffer (40 mM Tris-HCl ph 7.5, 5 mM MgCl ₂ , 125 mM KCl) containing 1 μM concentration of DFHBI-1T (Tocris Bioscience, UK ). was mixed with and reacted at room temperature for 5 minutes so that the spinach aptamer could be properly folded and functioned. Fluorescent signals were measured using a VICTOR microplate reader (Model 2030-0050, PerkinElmer, USA). In order to find the optimal reaction conditions, the concentration of MgCl ₂ was measured at 0, 0.1, 1, 5, 10, 50, and 100 mM, respectively, and the concentration of DFHBI-1T was 0.1, 0.5, 1, 5, 10, Fluorescence signals were measured at different concentrations of 20 and 50 μM.

As a result, it was confirmed that folding of the spinach aptamer transcript occurred most efficiently when the concentration of MgCl ₂ was 10 mM, and as the concentration of DFHBI-1T increased, the ratio of the signal to background increased, and the 1 μM concentration It was confirmed that the highest signal strength was obtained when DFHBI-1T was added (see FIGS. 2a and 2b).

Comparison of fluorescence signal intensity measured by a technique using a binding material-polynucleotide conjugate and a conventional ELISA technique

In order to confirm the detection effect of the technique using the transcription system-based sensor of the present invention, the detection target material was reacted with the binding material-polynucleotide conjugate of the present invention to confirm fluorescence signals. A conjugate of a polynucleotide containing a sequence encoding a light-up aptamer and a specific binding material (hereinafter referred to as 'type 1 binding material-polynucleotide conjugate'), and a dendrimer structure formed by stacking two or more layers Using a binding material-polynucleotide conjugate (hereinafter referred to as 'type 2 binding material-polynucleotide conjugate') in which a plurality of polynucleotides are connected in parallel by forming a fluorescent signal, the fluorescence of the conventional ELISA technique compared to the signal.

Specifically, the polynucleotide of the binding material-polynucleotide conjugate contained a sequence encoding Spinach aptamer, and DNA prepared in Example 1 was used, and biotin was bound to the 5' end near the terminator. A DNA fragment in the form was used. As a target material, recombinant AFP (alphafeto protein, Merdidian Life Science, USA) was used, and as a specific binding material capable of binding thereto, anti-human AFP antibody (anti-human AFP, Merdidian Life Science, USA), biotinylated Anti-human AFP antibody (Merdidian Life Science, USA) was used.

100 μL of anti-human AFP antibody (2 μg/mL) to be used as a capture antibody was treated on a 96-well substrate at 37° C. for 2 hours, fixed to the substrate, and washed with 200 μL PBST. After treatment with a blocking buffer (PBST containing 300 μL of 2% BSA) and washing again, 100 μL of 5 ng/mL antigen AFP was reacted for 1 hour and washed three times with PBST. Then, 100 μL of 1 μg/mL biotinylated anti-AFP antibody was applied to each well and washed 5 times after 1 hour of reaction. 18 μM of biotinylated DNA fragment was treated in each well and treated with streptavidin at 1 μg/mL for 30 minutes at room temperature to link the biotinylated anti-AFP antibody with the biotinylated DNA fragment, and then the biotinylated anti-AFP antibody and the biotinylated DNA fragment were not bound. The unreacted DNA was washed with PBST, and transcription was performed by adding 40 μL of the reaction mixture containing RNA polymerase. After the reaction proceeded for 2 hours, fluorescence signals were confirmed through a fluorescence microplate reader.

In addition, the result of binding the DNA fragment encoding the spinach aptamer to the antibody in a dendrimer form of a 4-layer structure by increasing the layer through the linker including streptavidin and biotin was confirmed. The layer is formed in such a way that streptavidin and biotinylated BSA constitute one layer and are stacked. Specifically, proceed through the same process as in the above experimental method, but in the course of treating streptavidin, 100 μg/mL streptavidin and 100 μL of biotinylated BSA were sequentially repeated 4 times to stack 4 layers. A structure was created and the fluorescence signal was confirmed.

Furthermore, in order to compare the technique using the binding material-polynucleotide conjugate of the present invention with the existing ELISA technique using an enzyme, the fluorescence signal measured by detecting the target material using the binding material-polynucleotide conjugate prepared above The intensities were compared with the intensities of the fluorescence signals respectively measured through conventional fluorescence-based ELISA techniques. In the fluorescence-based ELISA, STA-HRP (streptavidin-horseradish peroxidase) was used as an enzyme to attach it to the antibody, and the target substance was detected using amplex ultrared reagent (Invitrogen, USA) as a fluorescent substrate. Specifically, 100 μL of 2 μg/mL anti-AFP antibody diluted in PBS was first placed at 4° C. overnight and then blocked with 200 μL of 2% BSA for 2 hours at room temperature. Here, 100 μL of 5 ng/mL antigen AFP was treated for 1 hour, followed by 1 μg/mL biotinylated anti-AFP antibody (detection antibody) for 1 hour, and then composed of PBST 0.1% and tween20 washed with buffer. Here, 100 μL of 1 μg/mL STA-HRP was treated for 30 minutes, washed again, treated with amplex ultrared reagent, and fluorescence signals were measured after 15 minutes of reaction at room temperature. The intensity of the fluorescence signal was calculated based on the amount of change obtained by subtracting the signal value measured without AFP from the signal value in the presence of AFP.

As a result, the intensity of the fluorescence signal measured using the binding material-polynucleotide conjugate of the present invention was 17,250 A.U. (Arbitrary Unit), higher than 1,238 A.U. when using the fluorescence-based ELISA technique, and furthermore, a 4-layer dendrimer structure In the case of using the binding material-polynucleotide conjugate, it was confirmed that 26,519 A.U. was measured, generating a fluorescence signal 20 times higher than that of the conventional fluorescence-based ELISA technique (see FIG. 3).

Through the above results, a stronger signal can be obtained when using the binding material-polynucleotide conjugate of the present invention compared to the conventional method of measuring fluorescence signals through enzyme-based color development or fluorescence reaction, and using a linker Thus, it was confirmed that as the number of layers was increased, more polynucleotides that could be transcribed into spinach aptamers could be linked, enabling signal amplification. Therefore, it was confirmed that even when the target substance is present in a small amount, it is possible to detect it with high sensitivity compared to conventional ELISA.

Confirmation of fluorescence signal amplification effect of type 2 binding material-polynucleotide conjugate by increasing the number of layers

<3-1. Confirmation of fluorescence signal intensity change of type 2 binding material-polynucleotide conjugate>

As confirmed in Example 2, when using the type 2 binding material-polynucleotide conjugate of the present invention, fluorescence signal intensity was measured more strongly than conventional ELISA techniques, and fluorescence when a 4-layer structure is formed through a linker Since the signal was further amplified, it was confirmed how the intensity of the fluorescence signal changes as the number of layers is further increased to further improve it.

A biotinylated AFP antibody was laminated with a layer composed of streptavidin and biotinylated BSA to measure the intensity of a fluorescence signal using a dendrimeric binding material-polynucleotide conjugate composed of various numbers of layers. The specific experimental method and procedure are the same as those of measuring the fluorescence signal using the binding material-polynucleotide conjugate in Example 2 above. A linker is made so that the number of layers is 1, 2, 4, 8, and 12, respectively, and a biotinylated DNA fragment containing the same spinach aptamer-encoding sequence prepared in Example 1 is coupled to the outermost part. The fluorescence signal intensity was measured and compared using the type 2 binding material-polynucleotide conjugate. As a negative control group, fluorescence signal intensity was measured when PBS was treated in the case where AFP, a target material, did not exist.

As a result, as the number of layers was increased up to 1, 2, and 4 layers, it was confirmed that the intensity of the fluorescence signal was significantly amplified. In this case, it was confirmed that there was no significant difference when compared with the measurement results of the four-layer binding material-polynucleotide conjugate (see FIG. 4a). In the negative control group, as the number of layers increased, the fluorescence intensity also increased, showing that the signal-to-noise ratio decreased after 4 layers.

From the above results, in the case of a binding material-polynucleotide conjugate of a dendrimeric structure in which a plurality of polynucleotides containing a sequence encoding a spinach aptamer are coupled in parallel, as the number of layers increases up to four layers, Although the amplification effect of the fluorescence signal is remarkable, it was confirmed that it is most efficient to use the four layers because there is no significant difference in the fluorescence signal intensity even if there are four or more layers.

<3-2. Confirmation of fluorescence signal change according to the difference in the binding position of biotin to the DNA fragment >

In the binding material-polynucleotide conjugate of the present invention, the polynucleotide may be biotinylated, and at this time, the biotin binding site may be distinguished according to the position of the promoter and terminator of the polynucleotide. When biotin is bound to the 5' end near the promoter (b-Spi2), when biotin is bound to the 5' end near the terminator (Spi2-b), and when biotin is bound to both ends (b-Spi2 As there may be -b), polynucleotides were prepared by varying the biotin binding position, and their fluorescence signals were measured and compared.

Specifically, the polynucleotides included in the binding material-polynucleotide conjugate of the present invention were configured with the same sequence as in Example 1-1, and the position of the biotin attached thereto was changed to b-Spi2, Spi2-b, and b- DNA fragments were prepared in three types of Spi2-b, and the difference in fluorescence signal according to the difference in the location of biotin attachment was confirmed (refer to (a) of FIG. 4b). Each of the b-Spi2, Spi2-b, and b-Spi2-b types of DNA fragments was treated with 1 μM of each of the b-Spi2, Spi2-b, and b-Spi2-b-typed DNA fragments on the streptavidin-coated substrate, and weakly bound DNA was removed using PBST. The DNA fragment was transcribed in vitro using T7 RNA polymerase, and 10 μL of the reaction was mixed with 90 μL of folding buffer containing 1 μM of DFHBI-1T (40 mM Tris-HCl pH 7.5, 10 mM MgCl ₂ , 125 mM KCl) was mixed and reacted, and fluorescence signals were measured.

As a result, among the three types of DNA fragments, when the DNA fragment prepared in the form of Spi2-b was transcribed, the fluorescence signal was measured to be the strongest (see (b) of FIG. 4b). In the Spi2-b form, biotin is bound to the end near the terminator sequence of the DNA fragment, and the spinach aptamer coding sequence is not repeated, so the length of the DNA fragment is relatively shorter in the form of a type 2 binding material-polynucleotide conjugate In the case of , it was confirmed that the strongest fluorescence signal was measured when biotin was bound to the end near the terminator of the DNA fragment. This is expected to be because biotin bound to the terminal near the terminator is immobilized by interaction with streptavidin, and it is easier for RNA polymerase to bind to the promoter region of the exposed DNA fragment.

<3-3. Optimization of Polynucleotide Concentration>

Furthermore, in order to optimize the concentration of biotinylated DNA added for the above reaction, the signal-to-noise ratio according to the polynucleotide concentration was confirmed. For 43 fM of antigen AFP, anti-AFP antibody was treated and a four-layered layered structure composed of streptavidin and biotinylated BSA was formed, and the concentration of biotinylated DNA was 18 nM, 180 nM, and 18 nM, respectively. Fluorescence signal intensity was measured when treated with μM and 180 μM respectively. The noise signal refers to a fluorescence signal in the absence of a target substance and a signal generated by non-specific binding. As a result of the measurement, the signal-to-noise ratio increased until the concentration of biotinylated DNA was 18 μM and then decreased thereafter, confirming that the concentration of 18 μM was the optimal DNA concentration (see FIG. 4c ).

Confirmation of fluorescence signal amplification through repetition of spinach aptamer sequence

Since the type 2 binding substance-polynucleotide conjugate corresponds to a form in which a plurality of polynucleotides capable of transcribing Spinach aptamers are linked in parallel, this time, the sequence encoding the Spinach aptamer is extracted from the DNA bound to the antibody. How much more the fluorescence signal can be amplified when the fluorescence signal is measured using the repeated and serially increased binding material-polynucleotide conjugate (hereinafter referred to as 'type 3 binding material-polynucleotide conjugate') Confirmed. The type 3 binding material-polynucleotide conjugate was prepared and used in the form of a DNA fragment in which a sequence encoding a spinach aptamer was repeated multiple times bound to an antibody.

4-1. Checking the optimal iteration shape

Regarding the method of serially repeating the Spinach aptamer DNA sequence, the spinach aptamer sequence was prepared in various forms and tested by varying the type of combination with the promoter or terminator, and whether or not the terminator was used.

First, DNA fragments were produced by dividing into three types by varying the combination of promoter and terminator. The order and combination of the promoter sequence (hereinafter referred to as 'P' in this example), the spinach aptamer sequence (hereinafter referred to as 'S' in this example), and the terminator sequence (hereinafter referred to as 'T' in this example) are different. Three types of DNA fragments were prepared by constructing them, and after they were transcribed, fluorescence intensity was measured and compared. T7 promoter and T7 terminator were used as the promoter and terminator, respectively, and the DNA fragments were 'P-S-S-T' (Type 3-1), 'P-S-P-S-T' (Type 3-2) and 'P-S-T-P-S-T' ( Type 3-3) was constructed with the sequence configuration (see FIG. 5a). DNA fragments of the type 3-1 to type 3-3 binding material-polynucleotide conjugates were added to a transcription solution containing RNA polymerase and reacted at 37 ° C for 2 hours, and then the transcribed RNA spinach aptamer was DFHBI The fluorescence signal generated by the addition of -1T was measured through a fluorescence microplate reader. In addition, spinach aptamers transcribed from the type 3-1 to type 3-3 binding material-polynucleotide conjugates using RNA polymerase as described above were confirmed on an agarose gel through electrophoresis.

As a result, as shown in FIG. 5B, the intensity of the fluorescence signal was measured to be lower in the DNA fragment of the type 3-1 double repeat binding material-polynucleotide conjugate compared to the form in which the spinach aptamer sequence was not repeated. The fluorescence signals of the DNA fragments of type 3-2 and type 3-3 binding material-polynucleotide conjugates were measured to be much higher than those in which the sequence was not repeated, and type 3-3 binding material than type 3-2. - When measured by transcribing the DNA fragment of the polynucleotide conjugate, the fluorescence signal intensity was higher, and the effect was the most excellent. In addition, in the agarose gel image in which transcription products of the type 3-1 to type 3-3 binding material-polynucleotide conjugates were confirmed through electrophoresis, in the case of DNA fragments of the type 3-3 binding material-polynucleotide conjugates, Most smeared bands appeared. In the case of the type 3-3 binding material-polynucleotide conjugate, since the promoter and terminator sequences are linked for each spinach aptamer coding sequence, most of the normal spinach aptamers are produced, and read-through at the terminator site is generated. Due to the various lengths of transcripts that can be produced when this occurs, smear-type bands can be observed as in the above result.

In the case of the type 3-1 or type 3-2 binding material-polynucleotide conjugate, a transcript in which two Spinach aptamer sequences are linked is produced, but misfolding between the repeated Spinach aptamer sequences This or incomplete folding is more likely to occur. Therefore, these transcripts produce a much lower fluorescence signal than the case of the type 3-3 binding material-polynucleotide conjugate in which a single Spinach aptamer is transcribed, and thus the fluorescent signal of the type 3-3 binding material-polynucleotide conjugate. is expected to be the largest.

In view of the above results, when a signal is amplified by repeating a polynucleotide sequence encoding a spinach aptamer, a promoter sequence is connected to the front of each repeated spinach aptamer sequence and a terminator sequence is connected to the rear. It was confirmed that the amplification efficiency of the fluorescent signal intensity was the most excellent when constructs were constructed and constructed in the form of repeating them, and the number of repetitions was increased using the DNA fragment structure of the type 3-3 binding material-polynucleotide conjugate. Additional experiments were performed that increased

Second, various types of DNA fragments were prepared by varying the type of terminator and the number of repetitions thereof, and transcription was performed on them to determine which form had the highest transcription termination efficiency.

Specifically, the T7 promoter was used as a promoter for each DNA fragment, and the gene encoding the spinach aptamer was regulated by the promoter. And according to Table 2 below, a form in which the T7 terminator is linked downstream of the spinach aptamer gene (T1), a form in which one VSV (vesicular stomatitis virus) terminator is linked (T2), and a form in which two VSV terminators are linked (T3), a polynucleotide of arbitrary 5 bp (TAGTA sequence) is placed between two VSV terminators and linked (T4), a polynucleotide of arbitrary 10 bp (AGCTCTAGTA sequence) is placed between two VSV terminators (T5), a polynucleotide of arbitrary 15 bp (AAGTAAGCTCTAGTA sequence) is placed between two VSV terminators (T6), three VSV terminators are linked without a linker (T7), linker DNA fragments were designed in a form in which a VSV terminator and a T7 terminator were sequentially connected (T8) without a linker and in a form in which a T7 terminator and a VSV terminator were sequentially connected (T9) without a linker.

sequence number sequence name Base sequence (5'→ 3') 4 T7 terminator CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG 5 VSV terminators TATCTGTTAGTTTTTTTC 6 VSV-VSV terminators TATCTGTTAGTTTTTTTCTATCTGTTAGTTTTTTTC 7 VSV-linker (5bp)-VSV terminator TATCTGTTAGTTTTTTTCTAGTATATCTGTTAGTTTTTTTC 8 VSV-linker (10bp)-VSV terminator TATCTGTTAGTTTTTTTCAGCTCTAGTATATCTGTTAGTTTTTTTC 9 VSV-linker (15bp)-VSV terminator TATCTGTTAGTTTTTTTCAAGTAAGCTCTAGTATATCTGTTAGTTTTTTTC 10 VSV-VSV-VSV terminator TATCTGTTAGTTTTTTTCTATCTGTTAGTTTTTTTCTATCTGTTAGTTTTTTTC 11 VSV-T7 terminator TATCTGTTAGTTTTTTTCCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG 12 T7-VSV terminator CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGTATCTGTTAGTTTTTTTC

Based on the composition of each of the nine types of DNA fragments as described above, PCR was used to amplify and synthesize DNA fragments in which different terminators were inserted, and their synthesis was confirmed on a 1.2% agarose gel ( see Figure 6a). Primers for each DNA fragment sequence used in PCR are shown in Table 3 below.

sequence number sequence name Base sequence (5'→ 3') 13 forward primer GATCCCGCGAAATTAATAC 14 T1 reverse primer CACATAGCAGAACTTTACAAGTGCTCAGTACAAAAAACCCCTCAAGACCCGTTTAGAGGCC 15 T2 reverse primer CACATAGCAGAACTTTACAAGTGCTCAGTAGAAAAAAACTAACAGATAGATGTAACTAGTTACGGAG 16 T3 reverse primer CACATAGCAGAACTTTACAAGTGCTCAGTAGAAAAAAACTAACAGATAGAAAAAAACTAACAGATAGATGTAACTAGTTACGGAG 17 T4 reverse primer CACATAGCAGAACTTTACAAGTGCTCAGTAGAAAAAAACTAACAGATATACTAGAAAAAAACTAACAGATAGATGTAACTAGTTACGGAG 18 T5 reverse primer CACATAGCAGAACTTTACAAGTGCTCAGTAGAAAAAAACTAACAGATATACTAGAGCTGAAAAAAACTAACAGATAGATGTAACTAGTTACGGAG 19 T6 reverse primer CACATAGCAGAACTTTACAAGTGCTCAGTAGAAAAAAACTAACAGATATACTAAGCTTACTTGAAAAAAACTAACAGATAGATGTAACTAGTTACGGAG 20 T7 reverse primer CACATAGCAGAACTTTACAAGTGCTCAGTAGAAAAAAACTAACAGATAGAAAAAAACTAACAGATAGAAAAAAACTAACAGATAGATGTAACTAGTTACGGAG 21 T8 reverse primer CACATAGCAGAACTTTACAAGTGCTCAGTACAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGGAAAAAAACTAACAGATAGATGTAACTAGTTACGGAG 22 T9 reverse primer CACATAGCAGAACTTTACAAGTGCTCAGTAGAAAAAAACTAACAGATACAAAAAACCCCTCAAGACCCGTTTAGAGGCC

After the DNA fragment prepared as described above was transcribed using RNA polymerase, the transcription product was confirmed through electrophoresis to confirm the tendency of transcription termination according to each terminator configuration. Depending on the type and composition of the terminator, the degree of occurrence of the read-through phenomenon, in which RNA polymerase continues transcription without terminating transcription at the terminator site, may vary. The transcriptional termination tendency according to the type and configuration of the terminator was confirmed by electrophoresis to confirm the transcription products when the 9 types of DNA fragments prepared as described above were each transcribed using RNA polymerase.

As a result, depending on the type of terminator, the amount of transcript produced by normal transcription termination at the terminator position and the amount of read-through transcript produced were different. As a result of comparing the efficiency of transcription termination based on this, the terminator sequence Transcription termination efficiency was higher when two or more terminator sequences were linked than when only one was included. In particular, when a DNA fragment in which the VSV terminator was repeated 3 times (T7 above) was transcribed, read-through did not occur and normal transcription was performed. It was confirmed that the efficiency of termination was the best (see FIG. 6b). Considering the characteristics of an aptamer that functions by forming a specific structure by folding of an RNA molecule, the transcription efficiency of the light-up aptamer and the binding material-poly of the present invention when using a terminator with the highest transcription termination efficiency The detection efficiency of nucleotide conjugates can also be increased.

4-2. Confirmation of fluorescence signal amplification according to the increase in the number of repeats of the spinach aptamer sequence

From the above experimental results, it was confirmed that when the spinach aptamer sequence is serially repeated, it is most efficient to construct a type 3-3 binding material-polynucleotide conjugate. Polynucleotides in which a sequence in the form of 'sequence' was repeated several times were transcribed, respectively, and their fluorescence signals were measured. A DNA fragment (type 1 binding material-polynucleotide conjugate DNA fragment, single) in which the sequence encoding the spinach aptamer is not repeated, and the 'promoter sequence-spinach aptamer sequence-terminator sequence' are respectively 2 150 μM of DNA fragment of the type 3-3 binding material-polynucleotide conjugate repeated 3, 4, 8, and 16 times was transcribed and the fluorescence signal intensity was measured. In the case of the terminator sequence, one containing a sequence obtained by repeating the VSV terminator sequence three times (SEQ ID NO: 10 in Table 2 above) was used.

As a result, compared to DNA in which the spinach aptamer sequence was not repeated, the fluorescence signal intensity amplification effect was significantly greater when the transcription was repeated 2 or 4 times, and the fluorescence signal was significantly amplified even when the spinach aptamer sequence was repeated 8 times. It was confirmed that And when the DNA repeated 16 times was transcribed, the amplification of the fluorescence signal was the highest (see FIG. 6c).

From the above results, it was confirmed that the intensity of the fluorescence signal was amplified as the number of repetitions of the spinach aptamer sequence was serially repeated.

Furthermore, in view of the results of the above examples, it was confirmed that the amplification effect of the fluorescence signal was good when forming a dendrimer form composed of streptavidin and biotinylated BSA layer and forming four or more layers, serial When repeating the Spinach aptamer sequence, it is most efficient to construct a type 3-3 binding material-polynucleotide conjugate that repeats the entire form of 'promoter sequence-spinach aptamer sequence-terminator sequence'. It was confirmed that the amplification effect of fluorescence signal intensity was excellent as the number of repetitions increased.

4-3. Confirmation of fluorescence signal change according to the binding position of biotin to polynucleotide

As confirmed in Example 3-2, the change in fluorescence signal intensity according to the location of biotin bound to the polynucleotide of the type 3 binding material-polynucleotide conjugate was confirmed. A DNA fragment was prepared in the form of a type 3 (type 3-3) binding material-polynucleotide conjugate in which the sequence encoding the spinach aptamer was repeated 16 times in the same manner as in Example 4-2, Fluorescent signal intensity was measured by varying the location of biotin (see (a) in FIG. 6d). In the case of the terminator sequence, one containing a sequence obtained by repeating the VSV terminator sequence three times (SEQ ID NO: 10 in Table 2 above) was used. As in the experiment of the type 2 binding material-polynucleotide conjugate, three types of b-Spi2, Spi2-b, and b-Spi2-b were tested according to the location of biotin binding, and the experimental conditions other than the type of DNA fragment were Fluorescence signal intensity was measured in the same manner.

As a result, unlike the experiment using a DNA fragment in which the spinach aptamer coding sequence was not repeated as in Example 3-2, a form in which biotin was bound to both ends of the DNA fragment (b-Spi2-b) In the measurement result using , the intensity of the fluorescence signal was measured most strongly. In the case of the DNA fragment of the type 3-3 binding material-polynucleotide conjugate used in this experiment, the sequence including the T7 promoter, Spinach aptamer coding sequence, and VSV terminator (repeated 3 times) was repeated a total of 16 times. That is, its DNA size corresponds to about 3 kb. That is, compared to the polynucleotide of the type 2 binding agent-polynucleotide conjugate, the length of the polynucleotide is 10 times or more longer, and accordingly, the length of the polynucleotide is higher than the position of the promoter present in the extended polynucleotide or the degree of external exposure. It is expected that the immobilization efficiency of the polynucleotide plays a more important role.

For the above reasons, in the case of using a type 3 binding material-polynucleotide conjugate in which a sequence containing the Spinach aptamer coding sequence is serially repeated several times, a form in which biotin is bound to both ends of the polynucleotide is used. By using it, it was confirmed that the fluorescence signal could be further amplified by increasing the probability and opportunity for streptavidin or antibody to bind.

4-4. Optimization of polynucleotide concentration

As confirmed above, the highest fluorescence signal was measured when using a polynucleotide in which the Spinach aptamer sequence was repeated 16 times in series. The noise ratio (signal/background ratio) was checked. IL-6 (interleukin-6) was used as the antigen, and the type 3-3 binding material-polynucleotide conjugate prepared by the same method as in Example 4-2 was used for 100 pg/ml of IL-6. DNA fragments (16 repeats of the spinach aptamer sequence) were treated at concentrations of 0.5 pM, 5 pM, 50 pM, 500 pM, and 5,000 pM, respectively. After transcribing the DNA fragment by treating with T7 RNA polymerase, its fluorescence signal was measured and compared. As a result of comparing the signal-to-noise ratio calculated by calculating the ratio of the fluorescence signal to the background signal in the absence of the antigen IL-6, it was highest when the concentration of the DNA fragment was 500 pM, and the higher amount of DNA It decreased when fragments were used. This is interpreted as a result caused by an increase in the noise fluorescence signal measured even in the absence of antigen IL-6, and when measuring the fluorescence signal by detecting it for 100 pg/ml antigen, the optimal DNA concentration is 500 pM It was confirmed that (see FIG. 6e).

Confirmation of sensitivity according to the concentration of the target substance

The target substance detection sensitivity of the binding substance-polynucleotide conjugate of the present invention was confirmed by determining the minimum concentration of the target substance that can be detected by the binding substance-polynucleotide conjugate of the present invention.

First, the target substance detection sensitivity of the dendrimeric binding material-polynucleotide conjugate (type 2 binding material-polynucleotide conjugate) was measured, and the sensitivities of conventional color development-based ELSIA and fluorescence-based ELISA techniques were measured together and compared. A certain amount of the binding material-polynucleotide conjugate is treated with different concentrations of the target material, and then the intensity of the fluorescence signal according to each target material concentration is measured. Compared to the case of the ELISA technique, it was confirmed whether the sensitivity was better.

In the case of ELISA techniques, the concentration of AFP, an antigen, is treated differently at 0, 2.187, 4.375, 8.75, 17.5, 35, and 70 pM and reacted using each sensor to obtain an O.D value (color development-based ELISA) or excitation at a wavelength of 450 nm. The fluorescence signal intensity (fluorescence-based ELISA) was measured at /emission wavelengths of 485/535 nm. A total of three experiments were performed under the same conditions as above to obtain the average and standard deviation of the measured O.D. values or fluorescence signal intensities, and a trend line and equation based on the measured O.D. If the value obtained by multiplying the standard deviation by 3 is added to the O.D value when the antigen concentration is 0 or the average value of fluorescence signal intensity, the minimum O.D value or fluorescence signal intensity that can be detected by each sensor can be obtained. The LOD (limit of detection) value was obtained by substituting y in the trend line equation obtained above.

The color development-based ELISA used STA-HRP (streptavidin-horseradish peroxidase) as an enzyme and TMB (3,3',5,5'-Tetramethylbenzidine, BD Biosciences, USA) as a color development substrate. STA-HRP was used as the fluorescence substrate, and amplex ultrared reagent (Invitrogen, USA) was used for measurement.

In order to confirm the sensitivity of the binding material-polynucleotide conjugate of the present invention, the intensity of the fluorescence signal was measured by treating with different concentrations of antigen AFP at 0, 0.875, 1.75, 3.5, 7, and 14 fM, respectively, under the same conditions as above. A total of three experiments were performed to obtain the average and standard deviation values of the measured fluorescence signal intensity values, and a trend line and equation were obtained. As in the case of the ELISA technique, when the value obtained by multiplying the standard deviation by 3 is added to the average value of fluorescence signal intensity when the antigen concentration is 0, the minimum fluorescence signal intensity that can be detected by the binding material-polynucleotide conjugate of the present invention can be obtained, and the LOD value was obtained by substituting this value into y of the trend line equation obtained above.

As a result, the LOD of the color-based ELISA was calculated as '1,000 fM', the LOD of the fluorescence-based ELISA was calculated as '160 fM', and the LOD of the binding material-polynucleotide conjugate of the present invention was calculated as '0.1 fM'. . Accordingly, it was confirmed that when using the binding material-polynucleotide conjugate of the present invention, the target material can be detected with a sensitivity that is about 1,600 times higher than that of fluorescence-based ELISA and about 10,000 times higher than that of color-based ELISA (FIG. 7a). see 7c through).

In view of the above results, since the binding material-polynucleotide conjugate of the present invention has significantly better sensitivity than conventional color/fluorescence-based ELISA techniques, when a small amount of target material that cannot be detected by ELISA technique exists It was also confirmed that it can be effectively detected.

Next, using a binding material-polynucleotide conjugate (type 3-3 binding material-polynucleotide conjugate) prepared using a DNA fragment in which the sequence encoding the spinach aptamer is repeated in series 16 times, The target substance detection limit was determined. IL-6 was used as a target material, and IL-6 was The intensity of the fluorescence signal was measured after treatment at concentrations of 0, 0.3125, 0.625, 1.25, 2.5, 5, and 10 fM. The target substance IL-6 was first reacted with the binding substance-polynucleotide conjugate in a PBS buffer solution and then in fetal bovine serum (FBS), and fluorescence signals were measured. The average and standard deviation values of the intensity of the measured fluorescence signal were obtained, and a trend line and equation were obtained based on the intensity of the measured fluorescence signal. If the value obtained by multiplying the standard deviation by 3 is added to the average value of the fluorescence signal intensity when the concentration of the target substance is 0, the minimum fluorescence signal intensity that each sensor can detect can be obtained. The LOD (limit of detection) value was obtained by substituting y in .

As a result, the LOD value was calculated to be 37 aM when the target material reacted in the PBS buffer solution, and the LOD value was calculated to be 38 aM as a result of the FBS spiking test (see FIGS. 8A and 8B ). In view of the above results, the binding material-polynucleotide conjugate of the present invention is a light-up aptamer made by transcription from the binding material-polynucleotide conjugate bound thereto even when the target material is present in an extremely small amount such as 37 aM. Since the fluorescence signal generated from can be sufficiently measured and detected, it was confirmed that it can be used as a much more sensitive detection sensor compared to conventional detection technologies.

In the above, the present invention has been described in detail only for the described embodiments, but it is obvious to those skilled in the art that various changes and modifications are possible within the scope of the technical idea of the present invention, and it is natural that these changes and modifications fall within the scope of the appended claims.

<110> Korea Research Institute of Bioscience and Biotechnology BIONANO HEALTH GUARD RESEARCH CENTER <120> High sensitive sensor on transcriptional system <130> 2020-DPA-3599 <150> KR 10-2019-0031121 <151> 2019-03-19 <160> 22 <170> KoPatentIn 3.0 <210> 1 <211> 136 <212> DNA <213> artificial sequence <220> <223> Spinach-2 <400> 1 taatacgact cactataggg gacgcaactg aatgaaatgg tgaaggacgg gtccaggtgt 60 ggctgcttcg gcagtgcagc ttgttgagta gagtgtgagc tccgtaacta gtcgcgtccc 120 gctgagcaat aactag 136 <210> 2 <211> 30 <212> DNA <213> artificial sequence <220> <223> Spinach-2 forward primer <400> 2 ccaagcttgc atgcaggcct ctgcagtcga 30 <210> 3 <211> 18 <212> DNA <213> artificial sequence <220> <223> Spinach-2 reverse primer <400> 3 ctagttattg ctcagcgg 18 <210> 4 <211> 48 <212> DNA <213> artificial sequence <220> <223> T7 terminator <400> 4 ctagcataac cccttggggc ctctaaacgg gtcttgaggg gttttttg 48 <210> 5 <211> 18 <212> DNA <213> artificial sequence <220> <223> VSV terminator <400> 5 tatctgttag ttttttc 18 <210> 6 <211> 36 <212> DNA <213> artificial sequence <220> <223> VSV-VSV terminator <400> 6 tatctgttag tttttttcta tctgttagtt tttttc 36 <210> 7 <211> 41 <212> DNA <213> artificial sequence <220> <223> VSV-linker (5bp)-VSV terminator <400> 7 tatctgttag tttttttcta gtatatctgt tagttttttt c 41 <210> 8 <211> 46 <212> DNA <213> artificial sequence <220> <223> VSV-linker (10bp)-VSV terminator <400> 8 tatctgttag tttttttcag ctctagtata tctgttagtt tttttc 46 <210> 9 <211> 51 <212> DNA <213> artificial sequence <220> <223> VSV-linker (15bp)-VSV terminator <400> 9 tatctgttag tttttttcaa gtaagctcta gtatatctgt tagttttttt c 51 <210> 10 <211> 54 <212> DNA <213> artificial sequence <220> <223> VSV-VSV-VSV terminator <400> 10 tatctgttag tttttttcta tctgttagtt tttttctatc tgttagtttt tttc 54 <210> 11 <211> 66 <212> DNA <213> artificial sequence <220> <223> VSV-T7 terminator <400> 11 tatctgttag tttttttcct agcataaccc cttggggcct ctaaacgggt cttgaggggt 60 66 <210> 12 <211> 66 <212> DNA <213> artificial sequence <220> <223> T7-VSV terminator <400> 12 ctagcataac cccttggggc ctctaaacgg gtcttgaggg gttttttgta tctgttagtt 60 tttttc 66 <210> 13 <211> 19 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 13 gatcccgcga aattaatac 19 <210> 14 <211> 61 <212> DNA <213> artificial sequence <220> <223> T1 reverse primer <400> 14 cacatagcag aactttacaa gtgctcagta caaaaaaccc ctcaagaccc gtttagaggc 60 c 61 <210> 15 <211> 67 <212> DNA <213> artificial sequence <220> <223> T2 reverse primer <400> 15 cacatagcag aactttacaa gtgctcagta gaaaaaaact aacagataga tgtaactagt 60 tacggag 67 <210> 16 <211> 85 <212> DNA <213> artificial sequence <220> <223> T3 reverse primer <400> 16 cacatagcag aactttacaa gtgctcagta gaaaaaaact aacagataga aaaaaactaa 60 cagatagatg taactagtta cggag 85 <210> 17 <211> 90 <212> DNA <213> artificial sequence <220> <223> T4 reverse primer <400> 17 cacatagcag aactttacaa gtgctcagta gaaaaaaact aacagatata ctagaaaaaa 60 actaacagat agatgtaact agttacggag 90 <210> 18 <211> 95 <212> DNA <213> artificial sequence <220> <223> T5 reverse primer <400> 18 cacatagcag aactttacaa gtgctcagta gaaaaaaact aacagatata ctagagctga 60 aaaaaactaa cagatagatg taactagtta cggag 95 <210> 19 <211> 99 <212> DNA <213> artificial sequence <220> <223> T6 reverse primer <400> 19 cacatagcag aactttacaa gtgctcagta gaaaaaaact aacagatata ctaagcttac 60 ttgaaaaaaa ctaacagata gatgtaacta gttacggag 99 <210> 20 <211> 103 <212> DNA <213> artificial sequence <220> <223> T7 reverse primer <400> 20 cacatagcag aactttacaa gtgctcagta gaaaaaaact aacagataga aaaaaactaa 60 cagatagaaa aaaactaaca gatagatgta actagttacg gag 103 <210> 21 <211> 115 <212> DNA <213> artificial sequence <220> <223> T8 reverse primer <400> 21 cacatagcag aactttacaa gtgctcagta caaaaaaccc ctcaagaccc gtttagaggc 60 cccaaggggt tatgctagga aaaaaactaa cagatagatg taactagtta cggag 115 <210> 22 <211> 79 <212> DNA <213> artificial sequence <220> <223> T9 reverse primer <400> 22 cacatagcag aactttacaa gtgctcagta gaaaaaaact aacagataca aaaaacccct 60 caagaccccgt ttagaggcc 79

Claims (14)

target substance specific binding substance; And a polynucleotide linked to the target material-specific binding material; a binding material-polynucleotide conjugate comprising,
Wherein the polynucleotide comprises at least one sequence encoding a light-up aptamer, a binding material-polynucleotide conjugate.
The method of claim 1,
The target material-specific binding material is at least one selected from the group consisting of antibodies, fragments of antibodies, aptamers, peptides, peptide mimetics, biotin, avidin, streptavidin and nucravidin, binding material-poly nucleotide conjugate.
The method of claim 1,
A binding material-polynucleotide conjugate wherein the light-up sequence encoding the aptamer is operably linked to a promoter or terminator.
The method of claim 1,
Wherein the polynucleotide is linked to the target material-specific binding material through a linker forming a covalent bond or a non-covalent bond, the binding material-polynucleotide conjugate.
The method of claim 4,
Wherein the linker comprises at least one selected from the group consisting of Streptavidin, Avidin and NeutrAvidin and Biotin, a binding substance-polynucleotide conjugate.
The method of claim 5,
The linker further comprises a biotinylated protein, the binding material-polynucleotide conjugate.
The method of claim 6,
The linker is a dendrimer structure having a layered structure of two or more, the binding material-polynucleotide conjugate.
According to any one of claims 1 to 7,
The light-up aptamer is a Spinach aptamer, a binding material-polynucleotide conjugate.
According to any one of claims 1 to 7,
The light-up aptamer is spinach2 aptamer, baby spinach aptamer, mbaby spinach aptamer, broccoli aptamer, mango aptamer, A binding material-polynucleotide conjugate selected from the group consisting of malachite green aptamers, blue fluorescent RNA (BFR) aptamers, and sulforhodamine B aptamers.
A composition for detecting a target substance comprising the binding substance-polynucleotide conjugate of any one of claims 1 to 7.
The method of claim 10,
The composition further comprises a polymerase capable of synthesizing a light-up aptamer and a fluorophore molecule that reacts with the light-up aptamer to emit fluorescence, the composition for detecting a target substance.
The method of claim 10,
The composition further comprises a capture antibody capable of binding to the target material, a composition for detecting a target material.
The method of claim 11,
The light-up aptamer and fluorophore molecules; Spinach aptamer and DFHBI (3,5-difluoro-4-hydroxybenzylidene imidazolinone); spinach aptamer and DFHBI-1T; spinach2 aptamer and DFHBI; spinach2 aptamer and DFHBI-1T; baby spinach aptamer and DFHBI; baby spinach aptamer and DFHBI-1T, mbaby spinach aptamer and DFHBI; mbaby spinach aptamer and DFHBI-1T; broccoli aptamer and DFHBI; broccoli aptamer and DFHBI-1T; Mango aptamer and thiazole orange T01; Mango Aptamer and Thiazole Orange T03; malachite green aptamers and malachite green; BFR aptamers and Hoechst; And sulforhodamine B aptamer and sulforhodamine B (sulforhodamine B); that will be selected from the group consisting of, a target material detection composition.
Reacting the binding material-polynucleotide conjugate of any one of claims 1 to 7 with a sample;
removing a conjugate that is not bound to the sample from a reaction product of the binding material-polynucleotide conjugate and the sample;
Reacting the conjugate of the binding material-polynucleotide conjugate and the sample by treating a polymerase capable of synthesizing a light-up aptamer and a fluorophore molecule that reacts with the light-up aptamer to emit fluorescence; and
A method of detecting a target substance from a sample, comprising: measuring a fluorescence signal from a reaction product of the binding material-polynucleotide conjugate and the sample, the polymerase, and the fluorophore molecule.

Images