KR102511145B1 - Trichoderma hazianum 18-067 and Its Use - Google Patents

Abstract

The present invention relates to Trichoderma harzianum 18-067 strain with accession number KCTC18862P and a composition for controlling plant pathogens using the same. Using the strain of the present invention, it is possible to produce eco-friendly crops without using chemical agents.

Description

Trichoderma hazianum 18-067 and its use {Trichoderma hazianum 18-067 and Its Use}

The present invention relates to Trichoderma hagianum 18-067 and uses thereof.

Pesticides and fertilizers, products of modern science, have greatly contributed to liberating mankind from starvation by increasing agricultural productivity. However, social interest in negative aspects such as toxicity to humans and animals and environmental pollution due to misuse and abuse of pesticides and fertilizers and residuals, rather than positive aspects of synthetic pesticides and fertilizers, has recently increased significantly. In addition, with the arrival of the well-being era in which the quality of human life is important, the use of synthetic pesticides is reduced or the demand for eco-friendly agricultural products grown without the use of pesticides is increasing. However, when crops are grown without using pesticides in actual fields, it is very difficult to harvest agricultural products because plant diseases cannot be controlled. Therefore, there is an urgent need for alternatives that can control plant diseases without using synthetic pesticides.

Republic of Korea Registration No. 10-1279027 (2013.07.02)

One aspect is to provide a Trichoderma harzianum 18-067 strain with accession number KCTC18862P.

Another aspect is to provide a composition for controlling plant pathogens containing at least one selected from the group consisting of Trichoderma haziaum 18-067 strain, spores, and culture medium as an active ingredient.

One aspect is to provide a Trichoderma harzianum 18-067 strain with accession number KCTC18862P.

The Trichodelma hagianum was isolated from the seed of the plant, and was consigned to the Korea Research Institute of Bioscience and Biotechnology because it has 98% homology with the previously known Trichodelma hagianum.

According to one embodiment, the strain may have antibacterial activity against plant pathogens.

According to one embodiment, the plant pathogen may be at least one selected from the group consisting of stemphyllium vesicarium , glomerella cingulate , and Sclerotinia rolfsii . It is not limited.

The plant pathogen may infect garlic, onion, pepper, tomato, etc., but is not limited thereto.

According to one embodiment, the plant disease caused by the plant pathogen may be one or more selected from the group including anthracnose, white silk, and leaf blight, but is not limited thereto.

Another aspect is to provide a composition for controlling plant pathogens containing at least one selected from the group consisting of Trichoderma haziaum 18-067 strain, spores, and culture medium as an active ingredient.

The culture solution may be one containing the Trichoderma haziaum 18-067 strain by culturing the 18-067 strain in a specific medium, and the culture obtained by culturing the same, It may contain a concentrate.

The composition for controlling plant pathogens is sprayed on the soil, leaves, stems, flowers or fruits of crops, and can be used by diluting the composition in water. etc. may be further included. In addition, the spraying period can further increase the control effect by pre-processing the plant pathogens proliferatively.

Another aspect is to provide a method for controlling plant pathogens by treating Trichoderma harzianum 18-067.

The Trichoderma harzianum 18-067 strain itself, its culture, or a composition containing an extract of the culture is used to inhibit plant disease in the environment (eg, soil, water) or on the surface of a growing plant Various plant diseases can be biologically controlled by spraying or drenching the amount that can be done. At this time, if necessary, it can be used as a composition for controlling plant diseases by mixing with a carrier commonly used in the field of agrochemicals and formulating into powder, pellets, granules or solutions. Water, white carbon, kaolin, etc. may be used as the carrier, and the culture may be a liquid culture or a solid culture.

The Trichodelma hagianum 18-067 strain of the present invention can control various plant pathogens. Therefore, using the strain of the present invention, it is possible to produce environmentally friendly crops without using chemicals.

1, A is Trichodelma hagianum 18-067, B is Trichodelma hamatum 16-137, C is Trichodelma genus 16-137, and D is untreated. This is the result. (Left side of the character standard: white silk disease treatment)
In FIG. 2, A is Trichodelma hagianum 18-067, B is Trichodelma hamatum 16-137, and C is Trichodelma genus 16-137, and the result of the mycelial growth inhibitory effect of anthracnose through replacement culture. (Right side of text standard: anthrax treatment)
3, A is Trichodelma hagianum 18-067, B is Trichodelma hamatum 16-137, C is Trichodelma genus 16-137, and D is untreated. Mycelial growth of leaf blight bacteria isolated from onions through replacement culture This is the result of the suppression effect. (Right side of the character standard: onion leaf blight treatment)
4, A is Trichodelma hagianum 18-067, B is Trichodelma hamatum 16-137, C is Trichodelma genus 16-137, and D is untreated. Mycelial growth of leaf blight bacteria isolated from garlic through replacement culture This is the result of the suppression effect. (Right side of text standard: Garlic leaf blight treatment)

Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are intended to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

Example 1. Trichodelma hagianum ( Trichoderma harzianum ) Isolation and identification of strain 18-067

In order to isolate and select strains having a control effect on plant diseases, peach seeds infected with white fungus were collected as samples and isolated from farmland in Jeollabuk-do. In order to identify the isolated fungi, mycological and molecular biological characteristics were assayed. In order to find out by molecular biological characteristics, the ITS gene sequence of Table 1 below was analyzed.

Trichodelma hagianum ITS (637 bp) SEQ ID NO: 1 AGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCTAAAACTCTTATTGTATACCCCCTCGCGGGTTTTTTTATAATCTGAGCCTTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTCCCTTAGCGGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAT

As a result of the experiment, the fungus isolated from the seeds infected with white mold was identified as a new strain showing 98% homology with previously known strains among Trichodelma hagianum, and was entrusted to the Korea Research Institute of Bioscience and Biotechnology.

Example 2. Vegetable crop white silkworm ( Sclerotinia rolfsii ) Evaluation of mycelial growth inhibitory effect

Dual culture was performed to test the mycelial growth inhibitory effect of the isolated Trichodelma hagianum 18-067 against white silkworm in vegetable crops. As for the silkworm disease, a strain of Sclerotinia rolfsii possessed by the Rural Development Administration was used. To compare the excellence of mycelial growth inhibitory effect. Trichoderma hanatum 16-137 and Trichoderma sp. 16-137 owned by the Rural Development Administration were used as comparison groups. Trichoderma hamatum ( Trichoderma hanatum ) 16-137, Trichoderma genus ( Trichoderma sp.) and Tridelma hagianum 18-067 strains were each transplanted to PDA (potato dextrose agar) medium and cultured at 25 ° C. for 7 days Then, it was removed with a cork borer with a diameter of 5 mm and transferred to one side of a new PDA medium. The other side was treated with white silkworm in the same way. The culture medium with strains on both sides was cultured in an incubator at 25 ° C for 7 days, and the effect of inhibiting the mycelial growth of the white silk fungus by the Trichodelma hagianum strain was confirmed. All experiments were performed 3 times.

As shown in FIG. 1, in the case of Trichodelma genus 16-137 (FIG. 1C), the degree of inhibition of the mycelium of Mycobacterium whiteis was very insufficient. In the case of Trichodelma hamatum 16-137 (FIG. 1B), the growth of mycelium of white silkworm was inhibited to a diameter of about 20 to 30 mm. However, in the case of Trichoma hagianum 18-067 (FIG. 1A), it was confirmed that the diameter of the hyphae of the white silk fungus was less than 10 to 20 mm, which was significantly suppressed compared to the control group.

Example 3. Evaluation of vegetable crop anthracnose mycelial growth inhibitory effect

In the same manner as in Example 2, the mycelial growth inhibitory effect was tested through replacement culture. For anthrax, Glomerella cingulate possessed by the Rural Development Administration was used.

As shown in Figure 2, in the case of Trichodelma genus 16-137 (Figure 2C), the diameter of the hyphae of Glumerella singulata was less than 30 mm, and in the case of Trichodelma hamatum 16-137 (Figure 2B) It was confirmed that the diameter of Glumerella singulata was 5 to 15 mm. On the other hand, it was confirmed that Trichodelma hagianum 18-067 (FIG. 2A) inhibited mycelial growth to such an extent that the diameter of Glumerella singulata hyphae could not be measured.

Example 4. Onion leaf blight mycelial growth inhibitory effect evaluation

Substitution culture was performed in the same manner as in Example 2 above. The leaf blight bacteria used in the experiment were isolated and cultured from onions infected with stemphylium vesicarium .

As shown in FIG. 3, in the case of Trichodelma genus 16-137 (FIG. 3C), the onion leaf blight mycelium had a diameter of about 5 to 40 mm. In the case of Trichodelma hamatum 16-137 (FIG. 3B), Trichodelma hamatum 16-137 covered the entire petri dish, but about 10 mm of the part where the onion leaf blight was infected could not inhibit mycelia. did On the other hand, Trichodelma hagianum (FIG. 3A) 18-067 was confirmed to inhibit the onion leaf blight mycelium because it completely covered the onion leaf blight to the toothed part.

Example 5. Evaluation of garlic leaf blight mycelial growth inhibitory effect

In the same manner as in Example 2, the mycelial growth inhibitory effect was tested through replacement culture. The leaf blight bacteria used in the experiment were isolated and cultured from garlic infected with leaf blight bacteria ( stemphylium vesicarium ).

As shown in Figure 4, in the case of Trichodelma genus 16-137 (FIG. 4C), when the hyphae of the garlic leaf blight were replaced with the hyphae of Trichodelma genus 16-137, the mycelia of the garlic leaf blight It was confirmed that the mycelia of the genus Cordelma 16-137 grew while covering them. In the case of Trichodelma hamatum 16-137 (FIG. 4B), the mycelia of the garlic leaf blight covered the rest of the circle except for the circle of about 10 to 20 mm occupied by the mycelium of the garlic leaf blight. It was confirmed that the mycelial growth of the fungus was inhibited. On the other hand, Trichodelma hagianum 18-067 (FIG. 4A) invades and grows to a portion of about 5 to 7 mm where the mycelium of the garlic leaf blight has grown, so it was confirmed that the growth of the garlic leaf blight mycelium was inhibited. .

Korea Research Institute of Bioscience and Biotechnology KCTC18862P 20201126

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Trichoderma hazianum 18-067 and Its Use <130> RDA-P200039 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 637 <212> DNA <213> Trichoderma harzianum <400> 1 agaggaagta aaagtcgtaa caaggtctcc gttggtgaac cagcggaggg atcattaccg 60 agtttacaac tcccaaaccc aatgtgaacg ttaccaaact gttgcctcgg cgggatctct 120 gccccgggg cgtcgcagcc ccggaccaag gcgcccgccg gaggaccaac ctaaaactct 180 tattgtatac cccctcgcgg gtttttttat aatctgagcc tttctcggcg cctctcgtag 240 gcgtttcgaa aatgaatcaa aactttcaac aacggatctc ttggttctgg catcgatgaa 300 gaacgcagcg aaatgcgata agtaatgtga attgcagaat tcagtgaatc atcgaatctt 360 tgaacgcaca ttgcgcccgc cagtattctg gcgggcatgc ctgtccgagc gtcatttcaa 420 ccctcgaacc cctccggggg gtcggcgttg gggatcggcc ctcccttagc gggtggccgt 480 ctccgaaata cagtggcggt ctcgccgcag cctctcctgc gcagtagttt gcacactcgc 540 atcgggagcg cggcgcgtcc acagccgtta aacacccaac ttctgaaatg ttgacctcgg 600 atcaggtagg aatacccgct gaacttaagc atatcat 637

Claims (5)

As a Trichoderma harzianum 18-067 strain having an ITS gene comprising the nucleotide sequence of SEQ ID NO: 1, accession number KCTC18862P,
The strain is a plant disease caused by plant pathogens, which has a control effect on white silk disease or leaf blight, Trichoderma harzianum 18-067 strain.
delete The method of claim 1, wherein the plant disease is a plant disease caused by Sclerotinia rolfsii when the plant disease is a white silk disease, and when the plant disease is a leaf blight, it is a plant disease caused by S temphylium vesicarium That is, Trichoderma hajianum ( Trichoderma harzianum ) 18-067 strain.
delete Any one of claims 1 or 3 according to any one of Trichoderma haziaum ( Trichoderma haziaum ) 18-067 strain, spores of the strain, containing at least one selected from the group consisting of the culture medium of the strain as an active ingredient , A composition for controlling plant pathogens.

Images