KR102504389B1 - Novel Beauveria pseudobassiana strain and Composition for controlling Bemisia tabaci containing the same - Google Patents

Abstract

The novel Beauveria pseudobassiana strain deposited under accession number KCTC18861P can be usefully used for environmentally friendly control because it exhibits strong pathogenicity to insects belonging to the genus Bemisia in a general indoor plant growing environment.

Description

Novel Beauveria pseudobassiana strain and composition for controlling tobacco whitefly containing the same {Novel Beauveria pseudobassiana strain and Composition for controlling Bemisia tabaci containing the same}

The present invention relates to a novel Boveria pseudovasiana isolated from tobacco whitefly and a composition for controlling tobacco whitefly comprising the same.

Tobacco whitefly ( Bemisia tabaci ) is a major control pest that infects crops with feeding marks and phytopathogenic viruses. In particular, the excrement of tobacco powdery mildew causes soot disease of plants. Tobacco powdery mildew has been reported to damage more than 600 plant species, including tomatoes, peppers, beans, eggplants, and cucumbers.

Beauveria bassiana is known as a fungal pathogen as a method for biologically controlling tobacco whitefly. However, Boveria bassiana is not a regulator that affects the population because it is difficult to be infected with tobacco whitefly in the natural state, and the conditions for maximum pathogenicity to tobacco whitefly are low temperature (20 ℃ or less) and high humidity (96% or more). ), it is known that it is not effective in controlling tobacco powder. (Hoddle, Mark S. (1999). The Biology and Management of the Silverleaf Whitefly, Bemisia argentifolii Bellows and Perring (Homoptera: Aleyrodidae) on Greenhouse Grown Ornamentals) Also, control of tobacco whitefly using Beauveria pseudobassiana nothing is known about

Hoddle, Mark S. (1999). The Biology and Management of the Silverleaf Whitefly, Bemisia argentifolii Bellows and Perring (Homoptera: Aleyrodidae) on Greenhouse Grown Ornamentals

One embodiment provides a novel Boveria pseudovasiana strain having pathogenicity for insects belonging to the genus Bemisia.

One embodiment provides a composition for controlling insects belonging to the genus Bemisia comprising a novel strain of Boveria pseudovasiana having pathogenicity to insects belonging to the genus Bemisia.

One aspect provides a Beauveria pseudobassiana strain having pathogenicity for insects of the genus Bemisia and deposited under accession number KCTC18861P.

As previously known, the Boveria bassiana strain has a very weak pathogenicity to tobacco whitefly in a natural or indoor cultivation environment under conditions of a temperature of 20 ° C or less and a humidity of 96% or more, where the pathogenicity can be maximized. There was no, and it was difficult to use for eco-friendly control. In addition, Boveria pseudovasiana strains were not known for use in controlling tobacco powdery mildew. However, the present inventors collected dead bodies of tobacco powdery mildew caused by fungal infection in an indoor cultivation environment, and isolated the pathogenic mold therefrom to identify a novel strain of Boveria pseudovasiana that is highly contagious even in an indoor cultivation environment. According to one embodiment, the present strain was confirmed to have a strong infectivity to tobacco whitefly in an indoor cultivation facility environment (25 ° C. humidity 60%) and exhibit a mortality rate of 90% or more.

According to one embodiment, the strain is 20 to 30 ℃, 23 to 27 ℃, 20 to 25 ℃, 25 to 30 ℃, or 25 ℃ humidity conditions as a temperature condition 30 to 100%, 30 to 90%, 30 to 80%, 40 to 100%, 40 to 90%, 40 to 80%, 50 to 100%, 50 to 90%, 50 to 80%, 50 to 70%, 55 to 100%, 55 to 90%, 55 to 80%, 55 to 70%, 55 to 65%, or may exhibit a mortality rate of 90% or more for insects belonging to the genus Bemisia in an environment of 60% humidity. The present inventors confirmed that the tobacco whitefly and the KCTC18861P strain were brought into contact and maintained at 25° C. and/or humidity of 60%, resulting in a mortality rate of 90% or more. Under the same experimental conditions, the mortality rate by Boveria bassiana remained at 30%, so the control ability of the present strain was confirmed to be very good in a general indoor plant cultivation environment.

According to one embodiment, the RPB gene of the strain may include a nucleotide sequence consisting of SEQ ID NO: 1. The nucleotide sequence of SEQ ID NO: 1 may be part of a gene encoding RNA polymerase subunit II. As a result of confirming the homology of the sequence of SEQ ID NO: 1 with Blast, the degree of similarity was only 88% at the maximum, thus proving that this strain was a novel strain.

According to one embodiment, the insect of the genus Bemisia may be Bemisia argentifolii, Bemisia giffardi, or Bemisia tabaci. The Bemisia tabaci may also be referred to as 'tobacco powdery mildew'.

According to another aspect, a method for culturing the Boveria pseudovasiana strain is provided.

The culture medium of the Boveria pseudovasiana strain (KTCT18861P) is well known to those skilled in the art, and for example, it can be inoculated and cultured on a PDA solid medium, but is not limited thereto.

Incubation temperature of the strain may be 15 to 30 ℃, 20 to 30 ℃, or 25 ℃. The culture time required to spray the strain to obtain a control effect may be 3 to 10 days, or 5 to 7 days.

If 50 μl of the spore suspension of the strain is spread on a PDA solid medium and cultured, growth is promoted, so the culture time required for control can be shortened to less than 3 days.

According to another aspect, it provides an insecticide for insects belonging to the genus Bemisia containing the strain or a culture solution of the Boveria pseudovasiana.

The insecticide may include the strain as a cell or culture medium.

The insecticide may be in the form of granules, powders, liquids, wets, or encapsulated formulations. According to one embodiment it may be provided in the form of a spore suspension.

The insecticide may further include a surfactant, an extender, or a nutrient. Surfactants increase the water solubility of spores and are therefore useful for preparing spore suspensions. Examples of surfactants are polycarboxylate, sodium lignosulfonate, calcium lignosulfonate, sodium dialkylsulfosuccinate, sodium alkyl sulfonate, polyoxyethylene alkyl phenyl ether , sodium tripolyphosphate, sodium alkyl aryl sulfonate, polyoxyethylene alkyl phenyl ether, polyoxyethylene alkyl aryl phosphoric ester, poly Polyoxyethylene alkyl aryl ether, polyoxyethylene alkyl aryl polymer, polyoxyethylene alkyl aryl polymer special, polyoxyalkylone alkyl phenyl ether, polyoxyethylene It may be selected from the group consisting of polyoxyethylene nonyl phenyl ether, sodium sulfonate naphthalene formaldehyde, Triton 100, Tween 20, and Tween 80, but is not particularly limited thereto. Extenders and nutrients may be selected from the group consisting of soy flour, rice, wheat, ocher, diatomaceous earth, dextrin, glucose and starch.

The insect of the genus Bemisia may be Bemisia argentifolii, Bemisia giffardi, or Bemisia tabaci.

According to another aspect, the Beauveria pseudobassiana (Beauveria pseudobassiana) strain, culture medium, or pesticide containing the same provides a method for controlling insects of the genus Bemisia comprising the step of spraying insects, plants, or soil belonging to the genus Bemisia. do.

Spraying on the insect may be to directly spray the Beauveria pseudobassiana strain, culture medium, or insecticide for insects belonging to the genus Bemisia including the same by contacting the insect with the strain. When spraying on the plants and soil, since the strain of the present invention can survive for a certain period of time, it can contact insects belonging to the genus Bemisia even after spraying. For example, a method of spraying plants or soil may be sprayed on the surface of leaves, stems, or flowers of plants, the soil surface before plants are planted, and the soil surface where plants are planted. The plant may be a crop likely to be damaged by tobacco whitefly, and may be, for example, tomato, eggplant, tobacco, or paprika, but is not particularly limited.

The spraying may be sprayed using, for example, a manual sprayer or an automatic spraying device.

Since the Boveria pseudovasiana strain according to one embodiment has high killing power against insects belonging to the genus Bemisia, it can be used for environmentally friendly control.

Figure 1 shows the results of phylogenetically classifying the strains of the present invention.
Figure 2 shows the control effect of tobacco whitefly sprayed with the strain of the present invention.
Figure 3 shows the results of comparing the mortality rate of tobacco powder between Boveria pseudovasiana of the present invention and commercially available Boveria bassiana.
4 is a result confirming that the strain of the present invention exhibits strong infectivity and pathogenicity under indoor cultivation conditions of crops.

Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are intended to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

Example 1: Isolation and identification of fungal strains showing pathogenicity to tobacco whitefly

About 20 larvae of moldy tobacco powder were collected from the tomato facility cultivation house of the National Institute of Horticultural and Herbal Science. The white mold hyphae generated from the epidermis of the tobacco whitefly caterpillars were visually observed. Since no pathogenic fungus was sprayed in the house, it was expected that the house was infected with a highly contagious fungus and died naturally.

Fungi were isolated from the collected caterpillars, inoculated on PDA solid medium and water agar medium, and incubated at 25℃ to confirm the growth of fungi. When fungal hyphae developed, they were transplanted into a new PDA solid medium and subcultured.

The cultured strain was again inoculated into tobacco whitefly to confirm whether it had pathogenicity, and a fungal strain exhibiting pathogenicity was isolated and identified. Specifically, a spore suspension was prepared by adding and mixing 10 ul of a surfactant (tween 20) solution to improve the water solubility of 50 ml of sterile water and spores in a medium in which mold was cultured at 25 ° C. for 5 to 7 days. The spore suspension adjusted to a concentration of 1 × 10 ⁶ conidia/ml was spray-inoculated to tobacco whitefly. After spray inoculation, it was allowed to stand at 25 ° C., and tobacco powders killed by fungal infection were collected and pathogenic molds were isolated.

The morphological properties, gene sequences, and molecular phylogenetic relationships of the isolated fungal strains were analyzed. Morphologically, it was similar to previously reported Boveria pseudovasiana. For the molecular phylogenetic relatedness analysis, the elongation factor (EF-1) region gene sequence was analyzed, and the Beauveria genus fungus EF-1 gene sequence was collected among the biometric information of NCBI to create a faste format. They were aligned using the MEGA program, converted into MEGA format, and phylogenetic relationships were analyzed. The phylogenetic tree was completed by the phylogeny neighborhood joining method of the MEGA X program. Bootstrap values were repeated 1,000 times to increase the accuracy of the phylogenetic tree. As a result of the analysis, a novel Beauveria pseudobassiana was identified and classified as a new Clade reported for the first time worldwide. (See Figure 1)

fRPB2-7cF (5'-ATGGGYAARCAAGCYATGGG-3') and RPB2-3053bR (5'-TGRATYTTRTCRTCSACCAT-3') primer set to Beauveria pseudobassiana RNA polymerase subunit II (RPB) gene sequence Amplified and analyzed. The PCR reaction conditions were pre-denatured at 95°C for 5 minutes, followed by repeated amplification of the gene product by 35 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, and finally the reaction was completed at 72°C for 5 minutes. The nucleotide sequence of the amplification product was confirmed as the sequence of SEQ ID NO: 1, and no strain homologous thereto was found. (See Table 1 below)

SEQ ID Name Sequence (5' -> 3') One RPB GCGGGCCAAAATGCCATCGTCGCGATTGCGTGTTATTCTGGTTACAATCAGGAGGATTCCGTCATCATGAACCAAAGCAGCATCGATCGCGGCCTCTTCAGAAGTTTGTTCTTCCGTTCTTACTCTGATCAGGAGAAGAAGGTTGGGTTGAACTACACGGAGATCTTCGAAAAGCCGTTCCACCAAAGCACGCTGCGCATGAAACATGGTACGTATGACAAGCTTGATGAGGACGGGATCGTCGCTCCTGGCGTTCGTGTCTCTGGAGAAGATATAATCATCGGCAAAACTGCACCAATAGACCCGGAGACGCAAGATCTGGGCACGCGAACAACAGCACACCAGCGCCGTGATATCTCGACACCTCTGCGTAGTACTGAGAACGGTATTGTTGATCAGGTCATTGTTACTGTCAACGCCGACAACGTCAAATATGTCAAGGTTCGAGTCCGCACAACCAAGATCCCCCAAATCGGTGACAAATTCGCTTCGCGACATGGCCAAAAGGGAACGATTGGTGTCACATACCGACAGGAAGACATGCCGTTCACGAGAGAAGGTGTCACGCCTGATATCATCATCAATCCCCATGCTATTCCTTCTCGAATGACGATTGCTCATTTGATTGAATGTCTTCTAAGTAAAGTTTCGACTCTGGAAGGCATGGAAGGCGATGCTACTCCATTCACTGATGTTACTGTCGACTCTGTGTCAGACTTACTACGCAAGCACGGCTATCAGTCACGCGGCTTCGAGATCATGTACAACGGCCACACCGG 2 fRPB2-7cF ATGGGYAARCAAGCYATGGG 3 RPB2-3053bR TGRATYTTRTCRTCSACCAT

Based on the gene sequence and molecular phylogenetic relatedness analysis results, it was confirmed that the Boveria pseudovasiana strain of the present invention is a new strain, and was deposited with the Korea Research Institute of Bioscience and Biotechnology Biological Resource Center under accession number KCTC18861P.

Example 2: Pathogenicity assay of the novel Boveria pseudovasiana KCTC18861P strain

The novel Boveria Pseudovasiana KCTC18861P strain isolated in Example 1 was sprayed on adult tobacco grown indoors, and it was verified whether it could exhibit pathogenicity under normal conditions in a cultivation facility.

500 adults of tobacco whitefly (Bemisia tabasi) were released into a cucumber growing house and settled on cucumber leaves for 3 days. Boveria pseudovasiana of the present invention 10 ⁶ ~ conidia / ml, Boveria bassiana (shrimps, Farm Hannong) 10 ⁶ ~ conidia / ml, distilled water (untreated) 3 times each 5ml finely sprayed. Collect cucumber leaves on which Tobacco whitefly has settled, put them in a petri dish, and lethality of Tobacco whitefly adults after 5 days at 25±1℃, 60% humidity, and photoperiod conditions 12L:12D (12h light:12h dark) was observed. (See FIG. 2)

As a result of confirming the mortality rate after 5 days of mold contact, the mortality rate of the group contacted with the KCTC18861P strain of the present invention was the highest at 95.1%. On the other hand, it was 31% in the B. bassiana spray group and 15.2% in the distilled water spray group. (See Fig. 3)

In addition, according to FIG. 4, it was confirmed that the KCTC18861P strain of the present invention has a very high possibility of utilization because it is very active in infectivity and growth under general indoor cultivation conditions (25 ° C., 60% humidity) of crops.

As a result, it was confirmed that the novel KCTC18861 strain of the present invention has a strong infectivity to tobacco whitefly in an indoor cultivation facility environment (25 ° C., 60% humidity) and is highly likely to be used as a control agent.

Korea Research Institute of Bioscience and Biotechnology KCTC18861P 20201102

<110> Republic of Korea (Management: Rural Development Administration) <120> Novel Beauveria pseudobassiana strain and Composition for controlling Bemisia tabaci containing the same <130> RDA-P200036 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 779 <212> DNA <213> artificial sequence <220> <223> KCTC18861P RPB <400> 1 gcgggccaaa atgccatcgt cgcgattgcg tggtattctg gttacaatca ggaggattcc 60 gtcatcatga accaaagcag catcgatcgc ggcctcttca gaagtttgtt cttccgttct 120 tactctgatc aggagaagaa ggttgggttg aactacacgg agatcttcga aaagccgttc 180 caccaaagca cgctgcgcat gaaacatggt acgtatgaca agcttgatga ggacgggatc 240 gtcgctcctg gcgttcgtgt ctctggagaa gatataatca tcggcaaaac tgcaccaata 300 gacccggaga cgcaagatct gggcacgcga acaacagcac accagcgccg tgatatctcg 360 acacctctgc gtagtactga gaacggtatt gttgatcagg tcattgttac tgtcaacgcc 420 gacaacgtca aatatgtcaa ggttcgagtc cgcacaacca agatccccca aatcggtgac 480 aaattcgctt cgcgacatgg ccaaaaggga acgattggtg tcacataccg acaggaagac 540 atgccgttca cgagagaagg tgtcacgcct gatatcatca tcaatcccca tgctattcct 600 tctcgaatga cgattgctca tttgattgaa tgtcttctaa gtaaagtttc gactctggaa 660 ggcatggaag gcgatgctac tccattcact gatgttactg tcgactctgt gtcagactta 720 ctacgcaagc acggctatca gtcacgcggc ttcgagatca tgtacaacgg ccacaccgg 779 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> fRPB2-7cF <400> 2 atgggyaarc aagcyatggg 20 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> RPB2-3053bR <400> 3 tgratyttrt crtcsaccat 20

Claims (5)

As a Beauveria pseudobassiana strain having pathogenicity for insects of the genus Bemisia and deposited under accession number KCTC18861P,
The rpb gene of the strain includes a nucleotide sequence consisting of SEQ ID NO: 1,
The strain is a strain that exhibits a mortality rate of 90% or more for insects belonging to the genus Bemisia under a temperature condition of 25 to 30 ° C. and a humidity condition of 55 to 65%. delete According to claim 1,
The insect of the genus Bemisia is Bemisia argentifolii, Bemisia giffardi, or Bemisia tabaci,
strain. An insecticide for insects belonging to the genus Bemisia comprising the strain of claim 1 or its culture medium. Including the step of spraying the Beauveria pseudobassiana strain or its culture medium of claim 1 on insects, plants, or soil belonging to the genus Bemisia,
A method for controlling insects belonging to the genus Bemisia.

Images