KR102497785B1 - Recombinant microorganism and method for preparing copolymer comprising 2-hydroxybutyrate and lactate - Google Patents

Abstract

A recombinant microorganism producing a copolymer containing 2-hydroxybutyrate and lactate and a method for preparing the same, and a method for preparing a copolymer of 2-hydroxybutyrate and lactate using the same are provided.

Description

Recombinant microorganism and method for preparing copolymer comprising 2-hydroxybutyrate and lactate}

A recombinant microorganism producing a copolymer comprising 2-hydroxybutyrate and lactate as repeating units, a method for preparing the same, and a method for preparing a copolymer of 2-hydroxybutyrate and lactate using the same are provided.

Polyhydroxyalkanoate (PHA) is a substance that accumulates inside microorganisms to store energy and reducing ability when carbon sources are abundant in the absence of elements necessary for growth, such as nitrogen, oxygen, phosphorus, and magnesium. It is a natural polyester material. Since PHA exhibits biodegradability and biocompatibility while having physical properties similar to synthetic polymers derived from conventional petroleum, it is recognized as a material to replace existing synthetic plastics.

More than 150 types of PHA monomers are known, and most of them are 3-, 4-, 5- or 6-hydroxyalkanoate (HA), and representative PHA monomers that are being actively studied are Lactate (3-hydroxybutyrate: LA), 4-hydroxybutyrate (4HB), 3-hydroxypropionate (3HP), and medium chain length (6-12 carbon atoms) chain length: monomers having a hydroxyl group at the 3rd and 4th carbon positions, such as 3-hydroxyalkanoate of MCL).

An enzyme that plays a key role in synthesizing PHA in microorganisms is PHA synthase, which uses various hydroxyacyl-CoAs as substrates to synthesize polyesters containing the corresponding monomers. In addition, since the PHA synthase has substrate specificity among various hydroxyacyl-CoAs, the monomer composition of the polymer is controlled by the PHA synthetase. Therefore, in order to synthesize PHA, a metabolic pathway synthesizing and providing various hydroxyacyl-CoAs that can be used as substrates for PHA synthetase and a metabolic pathway for synthesizing polymers using the substrate and PHA synthetase are required.

On the other hand, in the case of monomers such as 2-hydroxybutyrate (2HB) having a hydroxyl group at the position of carbon number 2, there is a problem that it is not suitable for the substrate specificity of the PHA synthetase. In order to increase the biosynthesis of 2HB, which is useful as a monomer for various polymers and copolymers, it is necessary to introduce enzymes that increase the conversion efficiency of 2HB from precursors.

KR 10-1211767 B1

The present invention prepares a recombinant microorganism overexpressing an enzyme that increases the conversion efficiency of 2-hydroxybutyrate from a precursor of 2-hydroxybutyrate, a type of 2-hydroxyalkanoate, during the metabolic process of microorganisms. -Provides a technique for enhancing the biosynthesis of hydroxybutyrate and enhancing the synthesis efficiency of a polymer or copolymer containing 2-hydroxybutyrate, such as a copolymer containing 2-hydroxybutyrate and lactate.

One example provides a recombinant microorganism into which a gene encoding an enzyme for producing 2-hydroxybutyrate from 2-ketobutyrate is introduced.

Another example provides a composition for preparing 2-hydroxybutyrate, including the recombinant microorganism.

Another example provides a composition for preparing a copolymer containing 2-hydroxybutyrate and lactate as repeating units, including the recombinant microorganism. The composition may increase the yield of a copolymer containing 2-hydroxybutyrate and lactate as repeating units and/or increase the content ratio of 2-hydroxybutyrate in the copolymer.

Another example provides a method for producing 2-hydroxybutyrate, comprising culturing the recombinant microorganism.

Another example is a method for producing a copolymer comprising 2-hydroxybutyrate and lactate as repeating units or a copolymer comprising 2-hydroxybutyrate and lactate as repeating units, comprising culturing the recombinant microorganism. A method for increasing the 2-hydroxybutyrate content in

Another example provides a copolymer comprising 2-hydroxybutyrate and lactate as repeating units. The copolymer may be prepared by the above-described preparation method. The copolymer may have a 2-hydroxybutyrate content of about 15 mole % or greater, about 17 mole % or greater, about 20 mole % or greater, about 22 mole % or greater, or about 25 mole % or greater.

Lactate produced during microbial fermentation and 2-ketobutyrate (2KB) produced during amino acid metabolism are converted to 2-hydroxybutyrate (2HB), and 2-hydroxybutyrate- It was confirmed that the lactate copolymer [P(2HB-LA)] was biosynthesized.

In order to increase the content of 2-hydroxybutyrate, a monomer of the 2-hydroxybutyrate-lactate copolymer [P(2HB-LA)], the conversion efficiency of 2-hydroxybutyrate from its precursor, 2-ketobutyrate, is increased. It requires the introduction of enzymes that

Lactate dehydrogenase (D-lactate dehydrogenase; LdhA) is an enzyme that produces lactate (LA), a type of 2-hydroxyalkanoate (2HA). In order to screen for an enzyme that produces 2HA, such as LdhA, an enzyme suitable for the production of 2-hydroxybutyrate, a type of 2-hydroxyalkanoate, was obtained by conducting Blast (similar gene search) based on LdhA in Escherichia coli. Investigated, and when these enzymes were overexpressed, it was confirmed that the 2-hydroxybutyrate content in the 2-hydroxybutyrate-lactate copolymer increased. For example, D-3-phosphoglycerate dehydrogenase (SerA), Erythronate-4-phosphate dehydrogenase (PdxB), etc. have been screened as the enzymes, and when SerA is overexpressed, compared to when the enzyme is not overexpressed, 2-hydroxy Butyrate production increased by about 2.5 times or more by weight, the 2-hydroxybutyrate content ratio (mol%) in the 2-hydroxybutyrate-lactate copolymer increased by about 1.5 times or more, and when PdxB was overexpressed, the above Compared to the case where the enzyme was not overexpressed, the 2-hydroxybutyrate content ratio (mol%) in the 2-hydroxybutyrate-lactate copolymer increased by about 2 times or more (see Table 4).

Therefore, the present invention is to prepare a recombinant microorganism overexpressing an enzyme that increases the conversion efficiency of 2-hydroxybutyrate, a kind of 2-hydroxyalkanoate, from a precursor of 2-hydroxybutyrate during the metabolic process of the microorganism. Provides a technique for enhancing the biosynthesis of 2-hydroxybutyrate and enhancing the synthesis efficiency of a polymer or copolymer containing 2-hydroxybutyrate, such as a copolymer containing 2-hydroxybutyrate and lactate. .

One example provides a recombinant microorganism into which a gene encoding an enzyme for producing 2-hydroxybutyrate from 2-ketobutyrate is introduced. For example, the enzyme that produces 2-hydroxybutyrate from the 2-ketobutyrate is phosphoglycerate dehydrogenase (D-3-phosphoglycerate dehydrogenase; e.g., SerA), erythronate-4-phosphate dehydrogenase (Erythronate-4-phosphate dehydrogenase) phosphate dehydrogenase; eg, PdxB), or a combination thereof. The recombinant microorganism may contain an endogenous and/or exogenous (allogeneic or heterologous) CoA transferase encoding gene and PHA synthetase encoding gene.

The recombinant microorganism may be used to prepare 2-hydroxybutyrate or a copolymer containing 2-hydroxybutyrate and lactate as repeating units.

Another example provides a composition for preparing 2-hydroxybutyrate, including the recombinant microorganism. The recombinant microorganism for preparing the 2-hydroxybutyrate may be a gene encoding an enzyme for producing 2-hydroxybutyrate from 2-ketobutyrate.

Another example provides a composition for preparing a copolymer containing 2-hydroxybutyrate and lactate as repeating units, including the recombinant microorganism. The recombinant microorganism for producing a copolymer comprising 2-hydroxybutyrate and lactate as repeating units is a CoA transferase encoding gene and a gene encoding an enzyme that produces 2-hydroxybutyrate from 2-ketobutyrate It may be one containing (or introduced) a PHA synthetase encoding gene.

The composition may increase the yield of a copolymer containing 2-hydroxybutyrate and lactate as repeating units and/or increase the content ratio of 2-hydroxybutyrate in the copolymer.

Another example provides a method for producing 2-hydroxybutyrate, comprising culturing the recombinant microorganism.

Another example is a method for producing a copolymer comprising 2-hydroxybutyrate and lactate as repeating units or a copolymer comprising 2-hydroxybutyrate and lactate as repeating units, comprising culturing the recombinant microorganism. A method for increasing the 2-hydroxybutyrate content in

Another example provides a copolymer comprising 2-hydroxybutyrate and lactate as repeating units. The copolymer may be prepared by the above-described preparation method. The copolymer may have a 2-hydroxybutyrate content of about 15 mol% or more, about 17 mol% or more, about 20 mol% or more, about 22 mol% or more, or about 25 mol% or more (the upper limit is not particularly limited, but , but is not limited to about 60 mol% or less, about 50 mol% or less, about 40 mol% or less, or about 35 mol% or less; the same applies to the 2-hydroxybutyrate content in the copolymer below).

As used herein, the term “copolymer comprising 2-hydroxybutyrate and lactate as repeating units” or “2-hydroxybutyrate-lactate copolymer” refers to 2-hydroxybutyrate and lactate as monomers. Tate refers to a linear polyester containing repeating units polymerized through ester linkages. At this time, the polymerization sequence of each monomer is not particularly limited and may be repeated randomly.

The 2-hydroxybutyrate-lactate copolymer [P(2HB-LA)] is a coenzyme-A (CoA) transferase and polyhydroxy that transfers coenzyme-A (CoA) to 2-hydroxybutyrate and lactate monomers. It can be biosynthesized by PHA synthase that synthesizes polyhydroxyalkanoate (PHA).

The recombinant microorganism provided herein may contain a CoA transferase-encoding gene and a PHA synthetase-encoding gene in order to prepare a 2-hydroxybutyrate-lactate copolymer. Genes encoding the CoA transferase and PHA synthetase are introduced into microbial cells by a conventional gene recombinant method (eg, using a recombinant vector containing the CoA transferase encoding gene and the PHA synthetase encoding gene, respectively or together) there may be

In addition, the recombinant microorganism is 2-hydroxybutyrate in order to increase the production of 2-hydroxybutyrate, the production of 2-hydroxybutyrate-lactate copolymer, and / or the content of 2-hydroxybutyrate in the copolymer. It may be engineered to overexpress a gene encoding an enzyme that produces 2-hydroxybutyrate from the precursor 2-ketobutyrate. Overexpression of the gene encoding the enzyme for producing 2-hydroxybutyrate from the 2-ketobutyrate is an enzyme that produces 2-hydroxybutyrate from 2-ketobutyrate derived from the same organism as the recombinant microorganism, allogeneic, or heterologous It can be performed by a conventional genetic recombination method using a recombinant vector containing a gene encoding a.

In the recombinant microorganism, the CoA transferase encoding gene, the PHA synthetase encoding gene, and the gene encoding the enzyme for generating 2-hydroxybutyrate from 2-ketobutyrate are each included (inserted) in a separate recombinant vector, Two or more of these may be included (inserted) together in one vector and introduced into the microorganism (host microorganism to be recombined).

The CoA transferase may be, for example, a propionyl-CoA transferase. Propionyl-CoA transferase (EC 2.8.3.1) is an enzyme that catalyzes the chemical reaction of Scheme 1:

acetyl-CoA + propanoate ⇔ acetate + propanoyl-CoA (Scheme 1).

The enzyme and the gene encoding it may be derived from Clostridium propionicum .

For example, the gene encoding the propionyl-CoA transferase,

(a) the nucleotide sequence of SEQ ID NO: 1;

(b) a nucleotide sequence including a mutation of A1200G (meaning a mutation in which A, the 1200th base, is substituted with G; the same applies to the expression of nucleotide sequence mutation described below) in the nucleotide sequence of SEQ ID NO: 1;

(c) a nucleotide sequence comprising mutations of T78C, T669C, A1125G and T1158C in the nucleotide sequence of SEQ ID NO: 1;

(d) Including the mutation of A1200G in the nucleotide sequence of SEQ ID NO: 1, G335A in the amino acid sequence corresponding to SEQ ID NO: 1 (meaning a mutation in which the 335th amino acid Gly is substituted with Ala, in the expression of amino acid sequence mutations described below) the same applies) a nucleotide sequence encoding an amino acid sequence including a mutation;

(e) a nucleotide sequence encoding an amino acid sequence including A1200G mutation in the nucleotide sequence of SEQ ID NO: 1 and A243T mutation in the amino acid sequence corresponding to SEQ ID NO: 1;

(f) a base sequence encoding an amino acid sequence including T669C, A1125G and T1158C mutations in the base sequence of SEQ ID NO: 1 and D65G mutation in the amino acid sequence corresponding to SEQ ID NO: 1;

(g) a nucleotide sequence encoding an amino acid sequence including A1200G mutation in the nucleotide sequence of SEQ ID NO: 1 and D257N mutation in the amino acid sequence corresponding to SEQ ID NO: 1;

(h) a nucleotide sequence encoding an amino acid sequence including T669C, A1125G and T1158C mutations in the nucleotide sequence of SEQ ID NO: 1 and a D65N mutation in the amino acid sequence corresponding to SEQ ID NO: 1;

(i) a nucleotide sequence encoding an amino acid sequence including T669C, A1125G and T1158C mutations in the nucleotide sequence of SEQ ID NO: 1 and a T199I mutation in the amino acid sequence corresponding to SEQ ID NO: 1; and

(j) A base sequence encoding an amino acid sequence including T78C, T669C, A1125G and T1158C mutations in the base sequence of SEQ ID NO: 1 and a V193A mutation in the amino acid sequence corresponding to SEQ ID NO: 1

It may include a nucleotide sequence selected from the group consisting of, and the propionyl-CoA transferase may include an amino acid sequence encoded by the nucleotide sequence.

The polyhydroxyalkanoate (PHA) synthase is an enzyme that biosynthesizes polyhydroxyalkanoate using a thioester of CoA and hydroxy fatty acid as a substrate, and uses a fatty acid having 3 to 5 carbon atoms. It may be of a type (eg, derived from various bacteria such as Cupriavidus necator, Alcaligenes latus, etc.) and a type using a fatty acid having 6-14 carbon atoms (eg, derived from the genus Pseudomonas).

For example, the PHA synthetase and the gene encoding it may be a PHA synthetase (phaC) derived from a Pseudomonas sp. strain, for example, a Pseudomonas sp. 6-19 strain ( Pseudomonas sp. 6-19).

For example, the PHA synthase,

the amino acid sequence of SEQ ID NO: 4; or

L18H, V24A, K91R, M128V, E130D, N246S, S325T, S477R, S477H, S477F, S477Y, S477G, Q481M, Q481K, Q481R and A527S in the amino acid sequence of SEQ ID NO: 4. amino acid sequence

It may contain.

In another embodiment, the PHA synthetase,

In the amino acid sequence of SEQ ID NO: 4,

(i) S325T and Q481M;

(ii) E130D, S325T and Q481M;

(iii) E130D, S325T, S477R and Q481M;

(iv) E130D, S477F and Q481K; and

(v) L18H, V24A, K91R, M128V, E130D, N246S, S325T, S477G, Q481K and A527S

It may include an amino acid sequence including a mutation selected from the group consisting of, and the gene encoding the PHA synthetase may include a base sequence encoding the amino acid sequence.

The enzyme that produces 2-hydroxybutyrate from 2-ketobutyrate is phosphoglycerate dehydrogenase derived from the same entity (strain) as the recombinant microorganism (host microorganism to be recombinated) or homogeneous or heterogeneous microorganism, erythro It may be at least one selected from the group consisting of erythronate-4-phosphate dehydrogenase and the like. For example, the phosphoglycerate dehydrogenase is Escherichia coli (eg, Escherichia coli K12 strain) derived D-3-phosphoglycerate dehydrogenase, SerA (GenBank Accession No. NP_417388.1), and its encoding gene is Escherichia coli It may be site 3057178..3058410 in the K12 strain genome (NC_000913.3). The erythronate-4-phosphate dehydrogenase is Escherichia coli (e.g., Escherichia coli K12 strain) derived from erythronate-4-phosphate dehydrogenase, PdxB (GenBank Accession No. NP_416823.1), the coding gene of which is Escherichia coli It may be site 2436715..2437851 in the K12 strain genome (NC_000913.3).

The amino acid sequences of the phosphoglycerate dehydrogenase SerA (NP_417388.1) and erythronate-4-phosphate dehydrogenase PdxB (NP_416823.1) and the base sequences of the genes encoding the enzymes are summarized in Table 1 below:

designation explanation order SerA D-3-phosphoglycerate dehydrogenase derived from E. coli K12 MAKVSLEKDKIKFLLVEGVHQKALESLRAAGYTNIEFHKGALDDEQLKESIRDAHFIGLRSRTHLTEDVINAAEKLVAIGCFCIGTNQVDLDAAAKRGIPVFNAPFSNTRSVAELVIGELLLLLRGVPEANAKAHRGVWNKLAAGSFEARGKKLGIIGYGHIGTQLGILAESLGMYVYFYDIENKLPLGNATQVQHLSDLLNMSDVVSLHVPENPSTKNMMGAKEISLMKPGSLLINASRGTVVDIPALCDALASKHLAGAAIDVFPTEPATNSDPFTSPLCEFDNVLLTPHIGGSTQEAQENIGLEVAGKLIKYSDNGSTLSAVNFPEVSLPLHGGRRLMHIHENRPGVLTALNKIFAEQGVNIAAQYLQTSAQMGYVVIDIEADEDVAEKALQAMKAIPGTIRARLLY (서열번호 31) ATGGCAAAGGTATCGCTGGAGAAAGACAAGATTAAGTTTCTGCTGGTAGAAGGCGTGCACCAAAAGGCGCTGGAAAGCCTTCGTGCAGCTGGTTACACCAACATCGAATTTCACAAAGGCGCGCTGGATGATGAACAATTAAAAGAATCCATCCGCGATGCCCACTTCATCGGCCTGCGATCCCGTACCCATCTGACTGAAGACGTGATCAACGCCGCAGAAAAACTGGTCGCTATTGGCTGTTTCTGTATCGGAACAAACCAGGTTGATCTGGATGCGGCGGCAAAGCGCGGGATCCCGGTATTTAACGCACCGTTCTCAAATACGCGCTCTGTTGCGGAGCTGGTGATTGGCGAACTGCTGCTGCTATTGCGCGGCGTGCCGGAAGCCAATGCTAAAGCGCACCGTGGCGTGTGGAACAAACTGGCGGCGGGTTCTTTTGAAGCGCGCGGCAAAAAGCTGGGTATCATCGGCTACGGTCATATTGGTACGCAATTGGGCATTCTGGCTGAATCGCTGGGAATGTATGTTTACTTTTATGATATTGAAAATAAACTGCCGCTGGGCAACGCCACTCAGGTACAGCATCTTTCTGACCTGCTGAATATGAGCGATGTGGTGAGTCTGCATGTACCAGAGAATCCGTCCACCAAAAATATGATGGGCGCGAAAGAAATTTCACTAATGAAGCCCGGCTCGCTGCTGATTAATGCTTCGCGCGGTACTGTGGTGGATATTCCGGCGCTGTGTGATGCGCTGGCGAGCAAACATCTGGCGGGGGCGGCAATCGACGTATTCCCGACGGAACCGGCGACCAATAGCGATCCATTTACCTCTCCGCTGTGTGAATTCGACAACGTCCTTCTGACGCCACACATTGGCGGTTCGACTCAGGAAGCGCAGGAGAATATCGGCCTGGAAGTTGCGGGTAAATTGATCAAGTATTCTGACAATGGCTCAACGCTCTCTGCGGTGAACTTCCCGGAAGTCTCGCTGCCAC TGCACGGTGGGCGTCGTCTGATGCACATCCACGAAAACCGTCCGGGCGTGCTAACTGCGCTGAACAAAATCTTCGCCGAGCAGGGCGTCAACATCGCCGCGCAATATCTGCAAACTTCCGCCCAGATGGGTTATGTGGTTATTGATATTGAAGCCGACGAAGACGTTGCCGAAAAAGCGCTGCAGGCAATGAAAGCTATTCCGGGTACCATTCGCGCCCGTCTGCTGTACTAA (SEQ ID NO: 32) PdxB Erythronate-4-phosphate dehydrogenase from E. coli K12 MKILVDENMPYARDLFSRLGEVTAVPGRPIPVAQLADADALMVRSVTKVNESLLAGKPIKFVGTATAGTDHVDEAWLKQAGIGFSAAPGCNAIAVVEYVFSSLLMLAERDGFSLYDRTVGIVGVGNVGRRLQARLEALGIKTLLCDPPRADRGDEGDFRSLDELVQRADILTFHTPLFKDGPYKTLHLADEKLIRSLKPGAILINACRGAVVDNTALLTCLNEGQKLSVVLDVWEGEPELNVELLKKVDIGTSHIAGYTLEGKARGTTQVFEAYSKFIGHEQHVALDTLLPAPEFGRITLHGPLDQPTLKRLVHLVYDVRRDDAPLRKVAGIPGEFDKLRKNYLERREWSSLYVICDDASAASLLCKLGFNAVHHPAR (서열번호 33) GTGAAAATCCTTGTTGATGAAAATATGCCTTATGCCCGCGACTTATTTAGCCGTTTGGGTGAGGTGACCGCGGTTCCCGGGCGTCCAATCCCCGTCGCTCAACTGGCAGACGCGGATGCGCTGATGGTGCGTTCGGTCACGAAAGTGAATGAATCTTTGCTGGCAGGAAAACCCATTAAATTTGTTGGCACTGCCACTGCGGGGACCGACCATGTCGATGAAGCATGGTTGAAGCAGGCGGGAATTGGTTTTTCCGCTGCACCTGGCTGTAATGCGATTGCGGTGGTGGAATATGTTTTCTCCTCCCTGCTGATGCTTGCCGAACGCGATGGATTTTCACTGTACGACCGTACGGTGGGGATCGTGGGCGTTGGTAACGTTGGACGTCGATTGCAGGCGCGACTGGAAGCGTTAGGGATTAAAACCTTACTTTGCGATCCGCCTCGCGCCGACCGTGGGGATGAGGGTGATTTCCGCTCGCTGGATGAGTTAGTCCAGCGCGCGGATATTCTGACTTTCCATACGCCACTCTTTAAAGATGGTCCGTACAAAACGCTACATCTGGCGGATGAAAAACTGATCCGTAGCCTGAAGCCCGGAGCGATTCTGATTAACGCCTGCCGTGGCGCAGTCGTCGATAATACTGCGTTGCTGACCTGCCTGAATGAAGGCCAGAAGTTAAGCGTAGTGCTGGATGTCTGGGAAGGCGAACCGGAACTCAACGTCGAGCTGCTGAAAAAAGTGGATATCGGCACGTCGCATATCGCAGGCTATACCCTGGAAGGTAAAGCACGCGGTACTACGCAAGTGTTTGAAGCTTATAGCAAGTTTATTGGGCATGAACAGCACGTTGCGCTGGATACATTACTGCCTGCGCCAGAGTTTGGTCGCATTACGCTGCATGGCCCGCTCGATCAACCGACGCTGAAAAGGCTGGTGCATTTGGTGTATGATGTGCGCCGCGATGACGCACCGCTGCGTAAAGTCGCCGGGATACCGG (SEQ ID NO: 34)

The enzymes may contain additional mutations within the range of not altering the activity of the molecule as a whole. For example, amino acid exchanges in proteins and peptides that do not entirely alter the activity of the molecule are known in the art. For example, commonly occurring exchanges are amino acid residues Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thr/Phe , Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly, but not limited thereto. In some cases, the protein may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, or the like. In addition, it may include an enzyme protein in which structural stability to heat, pH, etc. or protein activity is increased by mutation or modification in the amino acid sequence.

In addition, the gene encoding the enzyme may include a nucleic acid molecule including a functionally equivalent codon or a codon encoding the same amino acid (due to codon degeneracy), or a codon encoding a biologically equivalent amino acid. there is. The nucleic acid molecule can be isolated or prepared using standard molecular biology techniques, such as chemical synthesis or recombinant methods, or commercially available ones.

"Vector" refers to a genetic construct comprising essential regulatory elements operably linked to express a gene insert encoding a protein of interest in a cell of an individual, and a means for introducing a nucleic acid sequence encoding a protein of interest into a host cell. becomes The vector may be at least one selected from the group consisting of various vectors such as plasmid, adenovirus vector, retrovirus vector and adeno-associated virus vector, bacteriophage vector, cosmid vector, and YAC (Yeast Artificial Chromosome) vector. there is. In one example, the plasmid vector is pBlue (e.g., pBluescript II KS(+)), pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, It may be one or more species selected from the group consisting of pGEX series, pET series, pUC19, etc., and the bacteriophage vector may be one or more species selected from the group consisting of lambda gt4 lambda B, lambda-Charon, lambda Δz1, and M13. The viral vector may be SV40 or the like, but is not limited thereto.

A "recombinant vector" includes a cloning vector and an expression vector containing an exogenous gene of interest. A cloning vector is a replicon that includes an origin of replication, for example, an origin of replication of a plasmid, phage or cosmid, and to which another DNA fragment is attached to which the attached fragment can be replicated. Expression vectors have been developed for use in synthesizing proteins.

In the present specification, the vector is not particularly limited as long as it can express and produce the desired enzyme gene in various host cells such as prokaryotic or eukaryotic cells, but the gene inserted into the vector and transferred is not incorporated into the genome of the host cell. It is preferable to reversibly fuse so that gene expression is stably maintained for a long time in the cell.

Such vectors contain transcriptional and translational expression control sequences that allow expression of the gene of interest in the host of choice. Expression control sequences may include a promoter to effect transcription, any operator sequence to regulate such transcription, a sequence encoding a suitable mRNA ribosome binding site, and/or a sequence to control termination of transcription and translation. . For example, regulatory sequences suitable for prokaryotes may include a promoter, optionally an operator sequence, and/or a ribosome binding site. Regulatory sequences suitable for eukaryotic cells may include promoters, terminators and/or polyadenylation signals. The initiation codon and stop codon are generally considered to be part of the nucleic acid sequence encoding the protein of interest, and must be functional in the subject when the genetic construct is administered and must be in frame with the coding sequence. The vector's promoter may be constitutive or inducible. Also, in the case of an expression vector capable of replication, an origin of replication may be included. In addition, an enhancer, an untranslated region at the 5' end and 3' end of the gene of interest, a selectable marker (eg, antibiotic resistance marker), or a replicable unit may be appropriately included. Vectors can replicate autonomously or integrate into the host genomic DNA.

Examples of useful expression control sequences include the early and late promoters of adenovirus, monkey virus 40 (SV40), mouse mammary tumor virus (MMTV) promoter, long terminal repeat (LTR) promoter of HIV, molone virus, cytomegalovirus viral (CMV) promoter, Epstein virus (EBV) promoter, Rouss sarcoma virus (RSV) promoter, RNA polymerase II promoter, β-actin promoter, human hemoglobin promoter and human muscle creatine promoter, lac system, trp system, TAC or TRC system, T3 and T7 promoters, major operator and promoter regions of phage lambda, regulatory regions of fd code proteins, promoters for phosphoglycerate kinase (PGK) or other glycolytic enzymes, promoters for phosphatases , such as Pho5, promoters of the yeast alpha-mating system, and other sequences of constitutive and inducible properties known to regulate expression of genes in prokaryotic or eukaryotic cells or viruses thereof, and various combinations thereof. .

In order to increase the expression level of the transgene in cells, the gene of interest and transcriptional and translational expression control sequences must be operably linked to each other. Generally, "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading frame. For example, DNA for a pre-sequence or secretion leader can be operably linked to DNA for a polypeptide when expressed as a pre-protein that participates in secretion of the protein, and the promoter or enhancer is can be operably linked to a coding sequence if it affects transcription of the sequence, or the ribosome binding site can be operably linked to a coding sequence if it affects transcription of the sequence, or the ribosome binding site can facilitate translation When arranged to do so, it can be operably linked to a coding sequence. Linkage of these sequences can be performed by ligation (linkage) at convenient restriction enzyme sites, and if such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used. can be performed by

Those skilled in the art can consider various vectors suitable for the present invention, expression control, considering the properties of the host cell, the copy number of the vector, the ability to control the copy number, and the expression of other proteins encoded by the vector, such as antibiotic markers. Sequence, host, etc. can be selected.

The recombinant microorganism provided herein may be obtained by transforming a host microbial cell using the recombinant vector.

The term "transformation" means introducing a target gene into a host microorganism so that the gene becomes replicable as an extrachromosomal factor or by completion of chromosomal integration.

Microorganisms that can be used as host microorganisms may be selected from the group consisting of prokaryotic cells and eukaryotic cells, and typically, microorganisms with high efficiency of DNA introduction and high expression efficiency of the introduced DNA may be used as host microorganisms. The host microorganism is a specific example, Escherichia coli (e.g., E. coli DH5a, E. coli JM101 , E. coli K12, E. coli W3110, E. coli X1776, E. coli B and E. coli XL1-Blue), including Escherichia, Pseudomonas, Bacillus, Streptomyces, Erwinia, Serratia, Providencia, Corynebacterium, Leptospira, Salmonella, Brevi Genus bacteria, genus Hypomonas, genus Chromobacterium, genus Nocadia, known eukaryotic and prokaryotic hosts such as fungi or yeast may be exemplified, but are not limited thereto. Once transformed into a suitable host, the vector can replicate and function independently of the host genome or, in some cases, can integrate into the genome itself.

In addition, for the purpose of the present invention, the host cell may be a microorganism having a pathway for biosynthesizing hydroxyacyl-CoA from a carbon source.

Transformation methods include suitable standard techniques as known in the art, for example, electroporation, electroinjection, microinjection, calcium phosphate co-precipitation. precipitation), calcium chloride/rubidium chloride method, retroviral infection, DEAE-dextran, cationic liposome method, polyethylene glycol-mediated uptake, gene gun (gene gun) may be used, but is not limited thereto. At this time, the circular vector can be cut with an appropriate restriction enzyme and introduced in the form of a linear vector.

2-hydroxybutyrate-lactate copolymer can be produced by culturing the transformed recombinant microorganism.

By culturing the recombinant microorganism into which the recombinant vector is introduced in an appropriate medium, the 2-hydroxybutyrate-lactate copolymer can be effectively produced. At this time, the medium and culture conditions used may be appropriately selected and used according to the type of recombinant microorganism. Conditions such as temperature, medium pH, and incubation time may be appropriately adjusted so as to be suitable for cell growth and copolymer production during culture. Examples of the culture method include, but are not limited to, batch, continuous and fed-batch culture.

In one embodiment, the culture may be performed in a medium containing 2-hydroxybutyrate or a precursor thereof, and lactate or a precursor thereof. The precursor of 2-hydroxybutyrate and/or lactate may be any material that can be converted into 2-hydroxybutyrate and/or lactate in the metabolic process of microorganisms, and examples thereof include 2-ketobutyrate, glucose, and the like. can In addition, if the recombinant microorganism is capable of biosynthesizing lactate from a carbon source such as glucose, the copolymer can be prepared by supplying a conventional carbon source without separately adding lactate and/or a precursor thereof. In addition, if the recombinant microorganism can biosynthesize 2-ketobutyrate, 2-hydroxybutyrate, etc. from a nitrogen source (amino acid) such as threonine, it is possible to biosynthesize 2-hydroxybutyrate and/or a precursor thereof without separately adding a conventional nitrogen source (amino acid). ), the above copolymer can be prepared by supplying.

In addition to this, the medium used for culture must suitably satisfy the requirements of a particular strain. The medium may contain various carbon sources, nitrogen sources, phosphorus and trace element components. Carbon sources in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, and palmitic acid, stearic acid, and linoleic acid. At least one selected from the group consisting of fatty acids, glycerol, alcohols such as ethanol, and organic acids such as acetic acid may be exemplified, but is not limited thereto. These materials may be used individually or as a mixture. Nitrogen sources in the medium include amino acids, peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. However, it is not limited thereto. Nitrogen sources may also be used individually or as a mixture. Persons in the medium include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt. In addition, the culture medium may include metal salts such as magnesium sulfate or iron sulfate necessary for growth, or may include essential growth substances such as amino acids and vitamins, but is not limited thereto. The above raw materials may be added in a batchwise or continuous manner by a method suitable for the culture during the cultivation process.

In addition, if necessary, the pH of the culture may be adjusted using a basic compound such as sodium hydroxide, potassium hydroxide, or ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner. In addition, antifoaming agents such as fatty acid polyglycol esters may be used to suppress foam formation. Oxygen or oxygen-containing gas (eg, air) may be injected into the culture to maintain an aerobic state, and the temperature of the culture may be usually 20 ° C to 45 ° C, preferably 25 ° C to 40 ° C. Cultivation may be continued until the maximum yield of the desired polymer is obtained.

In the method for preparing the 2-hydroxybutyrate-lactate copolymer provided in the present invention, after culturing the recombinant microorganism, the produced 2-hydroxybutyrate-lactate copolymer is recovered from the culture (or separated or purified). ) may be further included.

The 2-hydroxybutyrate-lactate copolymer produced from recombinant microorganisms can be isolated from cells or culture media by a method widely known in the art. Examples of methods for recovering 2-hydroxybutyrate-lactate copolymer include centrifugation, ultrasonic disruption, filtration, ion exchange chromatography, high performance liquid chromatography (HPLC), gas chromatography: GC) and the like, but it is not limited to these examples.

The present invention provides a technique for efficiently producing 2-hydroxybutyrate and a copolymer containing 2-hydroxybutyrate and lactate as repeating units, and by using the technique, 2-hydroxybutyrate production and / or the 2-hydroxybutyrate content in the 2-hydroxybutyrate-lactate copolymer can be increased.

Figure 1 shows the construction process and cleavage map of the pPs619C1310-CpPCT540 vector.
Figure 2 shows the cleavage map of the pPs619C1249.18H-CPPCT540 vector.
Figure 3 shows the cleavage map of the pSTV28- ser A vector.
Figure 4 shows a cleavage map of the pSTV28- pdx B vector.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the present invention is not limited by the following examples.

Example 1. 2- hydroxybutyrate - lactate Preparation of recombinant vectors for copolymer production

1-1. Preparation of pPs619C1310-CPPCT540 recombinant vector

For the propionyl-CoA transferase gene (pct), a variant of propionyl-CoA transferase (CP-PCT) derived from Clostridium propionicum was used, and the PHA synthase gene was MBEL of Pseudomonas. A variant of PHA synthetase derived from 6-19 (KCTC 11027BP) was used. The vector used at this time is pBluescript II (Stratagene Co., USA).

First, in order to isolate the PHA synthase (phaC1Ps6-19) gene, the entire DNA of Pseudomonas genus MBEL 6-19 (KCTC 11027BP) was extracted, and based on the phaC1Ps6-19 gene sequence (SEQ ID NO: 3), primers [5 '-GAGAGACAATCAAATCATGAGTAACAAGAGTAACG-3' (SEQ ID NO: 5), 5'-CACTCATGCAAGCGTCACCGTTCGTGCACGTAC-3' (SEQ ID NO: 6)] were prepared, and PCR was performed using the extracted total DNA as a template. The obtained PCR product was subjected to electrophoresis to identify a 1.7 kb gene fragment corresponding to the phaC1Ps6-19 gene, and the phaC1Ps6-19 gene was obtained.

To express the phaC1Ps6-19 synthetase, a DNA fragment containing the PHB-producing operon from Ralstonia eutropha H16 in the pSYL105 vector (Lee et al., Biotech. Bioeng., 1994, 44:1337-1347) was transcribed with BamHI/EcoRI. The pReCAB recombinant vector was prepared by cutting and inserting into the BamHI/EcoRI recognition site of pBluescript II (Stratagene Co., USA). In the pReCAB vector, PHA synthetase (phaCRE) and monomer feeder enzymes (phaARE and phaBRE) are constitutively expressed by the PHB operon promoter. In order to create a phaC1Ps6-19 synthetase gene fragment containing only one BstBI/SbfI recognition site at each end, the BstBI locus originally present was removed without amino acid conversion using SDM (site directed mutagenesis), and the BstBI/SbfI recognition site To add primers [5'-ATGCCCGGAGCCGGTTCGAA-3' (SEQ ID NO: 7), 5'-CGTTACTCTTGTTACTCATGATTTGATTGTCTCTC-3' (SEQ ID NO: 8), 5'-GAGAGACAATCAAATCATGAGTAACAAGAGTAACG-3' (SEQ ID NO: 9), 5-CACTCATGCAAGCGTCACCGTTCGTGCACGTAC-3 '(SEQ ID NO: 10), 5'-GTACGTGCACGAACGGTGACGCTTGCATGAGTG-3' (SEQ ID NO: 11), 5'-AACGGGAGGGAACCTGCAGG-3' (SEQ ID NO: 12)]. The pReCAB vector was digested with BstBI/SbfI to remove R.eutropha H16 PHA synthase (phaCRE), and then the phaC1Ps6-19 gene obtained above was inserted into the BstBI/SbfI recognition site to prepare pPs619C1-ReAB recombinant vector.

Three amino acid positions that affect short chain length (SCL) activity were found through amino acid sequence alignment analysis, and primers [5'-CTGACCTTGCTGGTGACCGTGCTTGATACCACC-3' (SEQ ID NO: 13), 5-GGTGGTATCAAGCACGGTCACCAGCAAGGTCAG-3' (SEQ ID NO: 14) , 5'-CGAGCAGCGGGCATATCATGAGCATCCTGAACCCGC-3' (SEQ ID NO: 15), 5'-GCGGGTTCAGGATGCTCATGATATGCCCGCTGCTCG-3' (SEQ ID NO: 16), 5'-ATCAACCTCATGACCGATGCGATGGCGCCGACC-3' (SEQ ID NO: 17), 5'-GGTCGGCGCCATCGCATCGGTCAT3'GAGGTTGAT 18)], pPs619C1300-ReAB containing phaC1Ps6-19300, which is a phaC1Ps6-19 synthase variant including E130D, S325T and Q481M, was prepared.

In order to construct a constitutive expression system in the form of an operon in which propionyl-CoA transferase is co-expressed, propionyl-CoA transferase (CP-PCT) derived from Clostridium propionicum was used. used CP-PCT is a fragment obtained by PCR of chromosomal DNA of Clostridium propionicum using primers [5'-GGAATTCATGAGAAAGGTTCCCATTATTACCGCAGATGA-3' (SEQ ID NO: 19), 5'-GCTCTAGATTAGGACTTCATTTCCTTCAGACCCATTAAGCCTTCTG-3' (SEQ ID NO: 20)] used At this time, the NdeI site originally present in the wild-type CP-PCT was removed using the SDM method for ease of cloning, and a primer [5'-AGGCCTGCAGGCGGATAACAATTTCACACAGG-3' (SEQ ID NO: 21) was added to add the SbfI/NdeI recognition site. , 5'-GCCCATATGTCTAGATTAGGACTTCATTTCC-3' (SEQ ID NO: 22)] was used to perform overlapping PCR. The pPs619C1300-ReAB vector was digested with SbfI/NdeI to remove Ralstonia eutrophus H16-derived monomer supply enzymes (phaARE and phaBRE), and then the PCR cloned CP-PCT gene was inserted into the SbfI/NdeI recognition site to obtain pPs619C1300-CPPCT recombinant vector was manufactured.

Next, in order to introduce random mutagenesis into the CP-PCT gene, pPs619C1300-CPPCT prepared above was used as a template, and primers [5'-CGCCGGCAGGCCTGCAGG-3' (SEQ ID NO: 23), 5'-GGCAGGTCAGCCCATATGTC -3' (SEQ ID NO: 24)] was used to perform Error-prone PCR under conditions where Mn2+ was added and there was a difference in concentration of dNTPs. Thereafter, PCR was performed under normal conditions using the primers to amplify the PCR fragment containing the random mutation. After removing the wild type CP-PCT by digesting the pPs619C1300-CPPCT vector with SbfI/NdeI, a ligation mixture was created by inserting the amplified mutant PCR fragment into the SbfI/NdeI recognition site, and introduced into E. coli JM109 to obtain ~105 scale A CP-PCT library was constructed. The CP-PCT library prepared above was grown for 3 days in a polymer detection medium (LB agar, glucose 20 g/L, LA 1 g/L, Nile red 0.5 μg/ml), and then screened to determine whether polymers were produced. About 80 candidates were selected for the first time. These candidates were cultured in liquid for 4 days (LB agar, glucose 20g/L, LA 1g/L, ampicillin 100mg/L, 37°C) under conditions where polymers were produced, and through FACS (Florescence Activated Cell Sorting) analysis, 2 individuals, That is, CP-PCT Variant 512 (including nucleic acid substitution A1200G) and CP-PCT Variant 522 (including nucleic acid substitution T78C, T669C, A1125G, and T1158C) were selected. Based on the first selected mutants (CP-PCT Variant 512, CP-PCT Variant 522), random mutation was performed again by the error-prone PCR method to obtain various CP-PCT variants, and Among them, CP-PCT Variant 540 (including Val193Ala and silent mutations T78C, T669C, A1125G, T1158C) was selected for the second round to prepare a pPs619C1300-CPPCT540 vector.

In addition, based on the phaC1Ps6-19 synthase variant (phaC1Ps6-19300) prepared above, primers [5'-GAATTCGTGCTGTCGAGCCGCGGGCATATC-3' (SEQ ID NO: 25), 5'-GATATGCCCGCGGCTCGACAGCACGAATTC-3' (SEQ ID NO: 26), 5' -GGGCATATCAAGAGCATCCTGAACCCGC-3' (SEQ ID NO: 27), 5'-GCGGGTTCAGGATGCTCTTGATATGCCC-3' (SEQ ID NO: 28)] derived from Pseudomonas genus MBEL 6-19 with mutated amino acid sequences of E130D, S477F and Q481K using the SDM method A pPs619C1310-CPPCT540 vector containing a PHA synthetase variant (phaC1Ps6-19310) was constructed (FIG. 1).

1-2. Preparation of pPs619C1249.18H-CPPCT540 recombinant vector

Using the pPs619C1310-CPPCT540 vector prepared in 1-1 as a template and primers [5'-ATGCCCGGAGCCGGTT'CGAA-3' (SEQ ID NO: 29) and 5'-GAAATTGTTATCCGCCTGCAGG-3' (SEQ ID NO: 30)], error- prone PCR was performed. After performing error-prone PCR, PCR was performed again using the above primers to amplify the PCR fragment containing the mutation, and then the amplified mutation was inserted into the BstBI/SbfI site of the pPs619C1310-CPPCT540 vector to construct a library for variants. did The prepared mutant library was transformed into E.coli XL-1Blue and cultured for 3 days in PHB detection medium (LB agar, glucose 20g/L, Nile red 0.5μg/ml). The variant finally selected through the screening process after culturing was pPs619C1249.18H having an amino acid sequence in which L18H, V24A, K91R, M128V, E130D, N246S, S325T, S477G, Q481K and A527S were mutated. In this way, the recombinant vector pPs619C1249.18H-CPPCT540 vector was prepared (FIG. 2).

Example 2. Preparation of strains for preparing 2-hydroxybutyrate-lactate copolymer

2.1. serA or pdxB Gene overexpression ( overexpression ) Recombinant vector construction for

Escherichia coli K12 strain-derived D-3-phosphoglycerate dehydrogenase gene (serA) (SEQ ID NO: 32) or Escherichia coli By inserting the K12-derived erythronate-4-phosphate dehydrogenase gene (pdxB) (SEQ ID NO: 34) into the pSTV28 vector (Addgene), the vector pSTV28-serA for overexpression of serA (see Fig. 3) and the vector pSTV28- pdxB for overexpression of pdx B ( See Figure 4) was produced respectively. The construction process of the vector is schematically shown in FIGS. 3 and 4, and the primer sequences used for each cloning are shown in Table 2 below:

primer Sequence (5'→3') sequence number pdxB-sac-F GCGCGCGAGCTCGTGAAAATCCTTGTTGATGA 35 pdxB-sph-R GCGCGCGCATGCTTAACGTGCCGGATGATGAA 36 serA-sac-F GCGCGCGAGCTCATGGCAAAGGTATCGCTGGA 37 SerA-sph-R GCGCGCGCATGCTTAGTACAGCAGACGGGCGC 38

2.2. 2- hydroxybutyrate - lactate Production of recombinant strains for copolymer production

E. coli Introducing the vector pPs619C1249.18H-CPPCT540 constructed in Example 1.2 and the vector pSTV28- ser A or pSTV28- pdx B constructed in Example 2.1 into XL1-blue (Stratagene, USA) by electroporation to prepare a recombinant strain for preparing 2HB-LA copolymer.

Example 3. Preparation of 2-hydroxybutyrate-lactate copolymer

The recombinant strain prepared in Example 2.2 was mixed with 3 mL of LB medium containing 100 mg/L ampicillin and 30 mg/L chloramphenicol [Bacto ^TM Triptone (BD) 10 g/L, Bacto ^TM yeast extract ( BD) 5 g/L, NaCL (amresco) 10 g/L] for 12 hours in seed culture.

100 ml of the obtained whole culture medium was added to 100 ml MR medium (per medium 1 L Glucose 10g, KH ₂ PO ₄ 6.67g, (NH ₄ )2HPO ₄ 4g, MgSO ₄ 7H ₂ O 0.8g, citric acid 0.8g, and trace metal solution 5mL, wherein the trace metal solution is 5M HCl 5mL per 1L. , FeSO ₄ ?7H ₂ O 10g, CaCl ₂ 2g, ZnSO ₄ ?7H ₂ O 2.2g, MnSO ₄ 4H ₂ O 0.5g, CuSO ₄ 5H ₂ O 1g, (NH ₄ )6Mo ₇ O ₂ 4H ₂ O 0.1 g, and Na ₂ B ₄ O ₂ 10H ₂ O 0.02g containing) was inoculated and main culture was performed at 30 ° C. for 4 days with stirring at 250 rpm.

The culture solution was centrifuged at 4°C and 4000 rpm for 10 minutes to recover cells, washed twice with a sufficient amount of distilled water, and then dried at 80°C for 12 hours. After quantifying the removed cells, they were reacted with methanol at 100 °C under a sulfuric acid catalyst using chloroform as a solvent. This was mixed by adding distilled water in a volume corresponding to half of chloroform at room temperature, and then allowed to stand until separated into two layers. Among the two layers, the chloroform layer in which the methylated polymer monomers were dissolved was sampled and the components of the polymer were analyzed by gas chromatography (GC). Benzoate was used as an internal standard. The GC analysis conditions used at this time are shown in Table 3 below.

GC analysis conditions Item Quality Model Hewlett Packard 6890N Detector Flame ionization detector (FID) Column Alltech Capillary AT ^TM -WAX, 30m, 0.53mm liquid phase 100% Polyethylene Glycol Inj.port temp/Det.port temp 250℃/ 250℃ Carrier gas He Total flow 3ml/min septum purge went flow 1ml/min Column head pressure 29 kPa Injection port mode Splitless Injection volume/solvent 1 μl/chloroform Initial temp./Time 80℃/5min Final temp./Time 230℃/5min Ramp of temp. 7.5℃/min

The results obtained from the GC analysis are shown in Table 4 below:

Strain (with 619C1_249 + CPPCT_540) 2-ketobutyrate (2g/L) 2HB (mg/L) LA mol % 2HB mol % P(2HB-LA) content (wt%) Control (XB) - 0.07 98.0 2.0 5.2 + 1.03 85.3 14.7 10.1 XB+ serA + 2.50 78.4 21.6 15.5 XB+ pdxB + 0.43 71.7 28.3 2.0

(XB: Transformant into which pPs619C1249.18H-CPPCT540 was introduced

XB + serA : pPs619C1249.18H-CPPCT540 + pSTV28-transformant into which ser A was introduced

XB + pdxB : pPs619C1249.18H-CPPCT540 + pSTV28-transformant into which pdx B was introduced)

As shown in Table 4, as a result of culture by adding 2-ketobutyrate (2 g / L) as a substrate to serA overexpressing E. coli, the production of 2-hydroxybutyrate increased by about 2.5 times compared to the control group, and P (2HB -LA) The total production of copolymers also increased by about 1.5 times. In addition, as a result of culture by adding 2-ketobutyrate (2 g/L) as a substrate to pdxB-overexpressing E. coli, the content of 2-hydroxybutyrate in the P(2HB-LA) copolymer was increased by about 2 times compared to the control group. .

<110> LG CHEM, LTD. <120> Recombinant microorganism and method for preparing copolymer comprising 2-hydroxybutyrate and lactate <130> DPP20173751KR <160> 38 <170> KopatentIn 3.0 <210> 1 <211> 1575 <212> DNA <213> Clostridium propionicum <220> < 221> gene <222> (1)..(1575) <223> popionyl-CoA transferase <400> 1 atgagaaagg ttcccattat taccgcagat gaggctgcaa agcttattaa agacggtgat 60 acagttacaa caagtggttt cgttggaaat gcaatccctg aggctcttga tagagctgta 120 gaaaaaagat tcttagaaac aggcgaaccc aaaaacatta cctatgttta ttgtggttct 180 caaggtaaca gagacggaag aggtgctgag cactttgctc atgaaggcct tttaaaacgt 240 tacatcgctg gtcactgggc tacagttcct gctttgggta aaatggctat ggaaaataaa 300 atggaagcat ataatgtatc tcagggtgca ttgtgtcatt tgttccgtga tatagcttct 360 cataagccag gcgtatttac aaaggtaggt atcggtactt tcattgaccc cagaaatggc 420 ggcggtaaag taaatgatat taccaaagaa gatattgttg aattggtaga gattaagggt 480 caggaatatt tattctaccc tgcttttcct attcatgtag ctcttattcg tggtacttac 540 gctgatgaaa gcggaaatat cacatttgag aaagaagttg ctcctctgga aggaacttca 600 gtatgccagg ctgttaaaaa cagtggcggt atcgttgtag ttcaggttga aagagtagta 660 aaagctggta ctcttgaccc tcgtcatgta aaagttccag gaatttatgt tgactatgtt 720 gttgttgctg acccagaaga tcatcagcaa tctttagatt gtgaatatga tcctgcatta 780 tcaggcgagc atagaagacc tgaagttgtt ggagaaccac ttcctttgag tgcaaagaaa 840 gttattggtc gtcgtggtgc cattgaatta gaaaaagatg ttgctgtaaa tttaggtgtt 900 ggtgcgcctg aatatgtagc aagtgttgct gatgaagaag gtatcgttga ttttatgact 960 ttaactgctg aaagtggtgc tattggtggt gttcctgctg gtggcgttcg ctttggtgct 1020 tcttataatg cggatgcatt gatcgatcaa ggttatcaat tcgattacta tgatggcggc 1080 ggcttagacc tttgctattt aggcttagct gaatgcgatg aaaaaggcaa tatcaacgtt 1140 tcaagatttg gccctcgtat cgctggttgt ggtggtttca tcaacattac acagaataca 1200 cctaaggtat tcttctgtgg tactttcaca gcaggtggct taaaggttaa aattgaagat 1260 ggcaaggtta ttattgttca agaaggcaag cagaaaaaat tcttgaaagc tgttgagcag 1320 attacattca atggtgacgt tgcacttgct aataagcaac aagtaactta tattacagaa 1380 agatgcgtat tccttttgaa ggaagatggt ttgcacttat ctgaaattgc acctggtatt 1440 gatttgcaga cacagattct tgacgttatg gattttgcac ctattattga cagagatgca 1500 aacggccaaa tcaaattgat ggacgctgct ttgtttgcag aaggcttaat gggtctgaag 1560 gaaatgaagt cctaa 1575 <210> 2 <211> 524 <212> PRT <213> Clostridium propionicum <220> <221> PEPTIDE <222> (1)..(524) <223> propionyl-CoA transferase <400> 2 Met Arg Lys Val Pro Ile Ile Thr Ala Asp Glu Ala Ala Lys Leu Ile 1 5 10 15 Lys Asp Gly Asp Thr Val Thr Thr Ser Gly Phe Val Gly Asn Ala Ile 20 25 30 Pro Glu Ala Leu Asp Arg Ala Val Glu Lys Arg Phe Leu Glu Thr Gly 35 40 45 Glu Pro Lys Asn Ile Thr Tyr Val Tyr Cys Gly Ser Gln Gly Asn Arg 50 55 60 Asp Gly Arg Gly Ala Glu His Phe Ala His Glu Gly Leu Leu Lys Arg 65 70 75 80 Tyr Ile Ala Gly His Trp Ala Thr Val Pro Ala Leu Gly Lys Met Ala 85 90 95 Met Glu Asn Lys Met Glu Ala Tyr Asn Val Ser Gln Gly Ala Leu Cys 100 105 110 His Leu Phe Arg Asp Ile Ala Ser His Lys Pro Gly Val Phe Thr Lys 115 120 125 Val Gly Ile Gly Thr Phe Ile Asp Pro Arg Asn Gly Gly Gly Lys Val 130 135 140 Asn Asp Ile Thr Lys Glu Asp Ile Val Glu Leu Val Glu Ile Lys Gly 145 150 155 160 Gln Glu Tyr Leu Phe Tyr Pro Ala Phe Pro Ile His Val Ala Leu Ile 165 170 175 Arg Gly Thr Tyr Ala Asp Glu Ser Gly Asn Ile Thr Phe Glu Lys Glu 180 185 190 Val Ala Pro Leu Glu Gly Thr Ser Val Cys Gln Ala Val Lys Asn Ser 195 200 205 Gly Gly Ile Val Val Val Gln Val Glu Arg Val Val Lys Ala Gly Thr 210 215 220 Leu Asp Pro Arg His Val Lys Val Pro Gly Ile Tyr Val Asp Tyr Val 225 230 235 240 Val Val Ala Asp Pro Glu Asp His Gln Gln Ser Leu Asp Cys Glu Tyr 245 250 255 Asp Pro Ala Leu Ser Gly Glu His Arg Arg Pro Glu Val Val Gly Glu 260 265 270 Pro Leu Pro Leu Ser Ala Lys Lys Val Ile Gly Arg Arg Gly Ala Ile 275 280 285 Glu Leu Glu Lys Asp Val Ala Val Asn Leu Gly Val Gly Ala Pro Glu 290 295 300 Tyr Val Ala Ser Val Ala Asp Glu Glu Gly Ile Val Asp Phe Met Thr 305 310 315 320 Leu Thr Ala Glu Ser Gly Ala Ile Gly Gly Val Pro Ala Gly Gly Val 325 330 335 Arg Phe Gly Ala Ser Tyr Asn Ala Asp Ala Leu Ile Asp Gln Gly Tyr 340 345 350 Gln Phe Asp Tyr Tyr Asp Gly Gly Gly Leu Asp Leu Cys Tyr Leu Gly 355 360 365 Leu Ala Glu Cys Asp Glu Lys Gly Asn Ile Asn Val Ser Arg Phe Gly 370 375 380 Pro Arg Ile Ala Gly Cys Gly Gly Phe Ile Asn Ile Thr Gln Asn Thr 385 390 395 400 Pro Lys Val Phe Phe Cys Gly Thr Phe Thr Ala Gly Gly Leu Lys Val 405 410 415 Lys Ile Glu Asp Gly Lys Val Ile Ile Val Gln Glu Gly Lys Gln Lys 420 425 430 Lys Phe Leu Lys Ala Val Glu Gln Ile Thr Phe Asn Gly Asp Val Ala 435 440 445 Leu Ala Asn Lys Gln Gln Val Thr Tyr Ile Thr Glu Arg Cys Val Phe 450 455 460 Leu Leu Lys Glu Asp Gly Leu His Leu Ser Glu Ile Ala Pro Gly Ile 465 470 475 480 Asp Leu Gln Thr Gln Ile Leu Asp Val Met Asp Phe Ala Pro Ile Ile 485 490 495 Asp Arg Asp Ala Asn Gly Gln Ile Lys Leu Met Asp Ala Ala Leu Phe 500 505 510 Ala Glu Gly Leu Met Gly Leu Lys Glu Met Lys Ser 515 520 <210> 3 <211> 1677 <212> DNA <213> Pseudomonas sp. 6-19 <220> <221> gene <222> (1)..(1677) <223> PHA synthase <400> 3 atgagtaaca agagtaacga tgagttgaag tatcaagcct ctgaaaacac cttggggctt 60 aatcctgtcg ttgggctgcg tggaaaggat ctactggctt ctgctcgaat ggtgcttagg 120 caggccatca agcaaccggt gcacagcgtc aaacatgtcg cgcactttgg tcttgaactc 180 aagaacgtac tgctgggtaa atccgggctg caaccgacca gcgatgaccg tcgcttcgcc 240 gatccggcct ggagccagaa cccgctctat aaacgttatt tgcaaaccta cctggcgtgg 300 cgcaaggaac tccacgactg gatcgatgaa agtaacctcg cccccaagga tgtggcgcgt 360 gggcacttcg tgatcaacct catgaccgaa gcgatggcgc cgaccaacac cgcggccaac 420 ccggcggcag tcaaacgctt ttttgaaacc ggtggcaaaa gcctgctcga cggcctctcg 480 cacctggcca aggatctggt acacaacggc ggcatgccga gccaggtcaa catgggtgca 540 ttcgaggtcg gcaagagcct gggcgtgacc gaaggcgcgg tggtgtttcg caacgatgtg 600 ctggaactga tccagtacaa gccgaccacc gagcaggtat acgaacgccc gctgctggtg 660 gtgccgccgc agatcaacaa gttctacgtt ttcgacctga gcccggacaa gagcctggcg 720 cggttctgcc tgcgcaacaa cgtgcaaacg ttcatcgtca gctggcgaaa tcccaccaag 780 gaacagcgag agtggggcct gt cgacctac atcgaagccc tcaaggaagc ggttgacgtc 840 gttaccgcga tcaccggcag caaagacgtg aacatgctcg gggcctgctc cggcggcatc 900 acttgcactg cgctgctggg ccattacgcg gcgattggcg aaaacaaggt caacgccctg 960 accttgctgg tgagcgtgct tgataccacc ctcgacagcg acgtcgccct gttcgtcaat 1020 gaacagaccc ttgaagccgc caagcgccac tcgtaccagg ccggcgtact ggaaggccgc 1080 gacatggcga aggtcttcgc ctggatgcgc cccaacgatc tgatctggaa ctactgggtc 1140 aacaattacc tgctaggcaa cgaaccgccg gtgttcgaca tcctgttctg gaacaacgac 1200 accacacggt tgcccgcggc gttccacggc gacctgatcg aactgttcaa aaataaccca 1260 ctgattcgcc cgaatgcact ggaagtgtgc ggcaccccca tcgacctcaa gcaggtgacg 1320 gccgacatct tttccctggc cggcaccaac gaccacatca ccccgtggaa gtcctgctac 1380 aagtcggcgc aactgtttgg cggcaacgtt gaattcgtgc tgtcgagcag cgggcatatc 1440 cagagcatcc tgaacccgcc gggcaatccg aaatcgcgct acatgaccag caccgaagtg 1500 gcggaaaatg ccgatgaatg gcaagcgaat gccaccaagc atacagattc ctggtggctg 1560 cactggcagg cctggcaggc ccaacgctcg ggcgagctga aaaagtcccc gacaaaactg 1620 ggcagcaagg cgtatccggc aggtgaagcg gcgccaggca cgtacgtgca cgaacgg 1677 <210> 4 <211> 559 <212> PRT <213> Pseudomonas sp. 6-19 <220> <221> PEPTIDE <222> (1)..(559) <223> PHA synthase <400> 4 Met Ser Asn Lys Ser Asn Asp Glu Leu Lys Tyr Gln Ala Ser Glu Asn 1 5 10 15 Thr Leu Gly Leu Asn Pro Val Val Gly Leu Arg Gly Lys Asp Leu Leu 20 25 30 Ala Ser Ala Arg Met Val Leu Arg Gln Ala Ile Lys Gln Pro Val His 35 40 45 Ser Val Lys His Val Ala His Phe Gly Leu Glu Leu Lys Asn Val Leu 50 55 60 Leu Gly Lys Ser Gly Leu Gln Pro Thr Ser Asp Asp Arg Arg Phe Ala 65 70 75 80 Asp Pro Ala Trp Ser Gln Asn Pro Leu Tyr Lys Arg Tyr Leu Gln Thr 85 90 95 Tyr Leu Ala Trp Arg Lys Glu Leu His Asp Trp Ile Asp Glu Ser Asn 100 105 110 Leu Ala Pro Lys Asp Val Ala Arg Gly His Phe Val Ile Asn Leu Met 115 120 125 Thr Glu Ala Met Ala Pro Thr Asn Thr Ala Ala Asn Pro Ala Ala Val 130 135 140 Lys Arg Phe Phe Glu Thr Gly Gly Lys Ser Leu Leu Asp Gly Leu Ser 145 150 155 160 His Leu Ala Lys Asp Leu Val His Asn Gly Gly Met Pro Ser Gln Val 165 170 175 Asn Met Gly Ala Phe Glu Val Gly Lys Ser Leu Gly Val Thr Glu Gly 180 185 190 Ala Val Val Phe Arg Asn Asp Val Leu Glu Leu Ile Gln Tyr Lys Pro 195 200 205 Thr Thr Glu Gln Val Tyr Glu Arg Pro Leu Leu Val Val Pro Pro Gln 210 215 220 Ile Asn Lys Phe Tyr Val Phe Asp Leu Ser Pro Asp Lys Ser Leu Ala 225 230 235 240 Arg Phe Cys Leu Arg Asn Asn Val Gln Thr Phe Ile Val Ser Trp Arg 245 250 255 Asn Pro Thr Lys Glu Gln Arg Glu Trp Gly Leu Ser Thr Tyr Ile Glu 260 265 270 Ala Leu Lys Glu Ala Val Asp Val Val Thr Ala Ile Thr Gly Ser Lys 275 280 285 Asp Val Asn Met Leu Gly Ala Cys Ser Gly Gly Ile Thr Cys Thr Ala 290 295 300 Leu Leu Gly His Tyr Ala Ala Ile Gly Glu Asn Lys Val Asn Ala Leu 305 310 315 320 Thr Leu Leu Val Ser Val Leu Asp Thr Thr Leu Asp Ser Asp Val Ala 325 330 335 Leu Phe Val Asn Glu Gln Thr Leu Glu Ala Ala Lys Arg His Ser Tyr 340 345 350 Gln Ala Gly Val Leu Glu Gly Arg Asp Met Ala Lys Val Phe Ala Trp 355 360 365 Met Arg Pro Asn Asp Leu Ile Trp Asn Tyr Trp Val Asn Asn Tyr Leu 370 375 380 Leu Gly Asn Glu Pro Pro Val Phe Asp Ile Leu Phe Trp Asn Asn Asp 385 390 395 400 Thr Thr Arg Leu Pro Ala Ala Phe His Gly Asp Leu Ile Glu Leu Phe 405 410 415 Lys Asn Asn Pro Leu Ile Arg Pro Asn Ala Leu Glu Val Cys Gly Thr 420 425 430 Pro Ile Asp Leu Lys Gln Val Thr Ala Asp Ile Phe Ser Leu Ala Gly 435 440 445 Thr Asn Asp His Ile Thr Pro Trp Lys Ser Cys Tyr Lys Ser Ala Gln 450 455 460 Leu Phe Gly Gly Asn Val Glu Phe Val Leu Ser Ser Ser Gly His Ile 465 470 475 480 Gln Ser Ile Leu Asn Pro Pro Gly Asn Pro Lys Ser Arg Tyr Met Thr 485 490 495 Ser Thr Glu Val Ala Glu Asn Ala Asp Glu Trp Gln Ala Asn Ala Thr 500 505 510 Lys His Thr Asp Ser Trp Trp Leu His Trp Gln Ala Trp Gln Ala Gln 515 520 525 Arg Ser Gly Glu Leu Lys Lys Ser Pro Thr Lys Leu Gly Ser Lys Ala 530 535 540 Tyr Pro Ala Gly Glu Ala Ala Pro Gly Thr Tyr Val His Glu Arg 545 550 555 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <223 > primer <400> 5 gagagacaat caaatcatga gtaacaagag taacg 35 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 cactcatgca agcgtcaccg ttcgtgcacg tac 33 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 atgcccggag ccggttcgaa 20 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <220> <223 > primer <400> 8 cgttactctt gttactcatg atttgattgt ctctc 35 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gagagacaat caaatcatga gtaacaagag taacg 35 <210> 10 <211 > 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 cactcatgca agcgtcaccg ttcgtgcacg tac 33 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gtacgtgcac gaacggtgac gcttgcatga gtg 33 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 aacgggaggg aacctgcagg 20 <210> 13 <211> 33 < 212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ctgaccttgc tggtgaccgt gcttgatacc acc 33 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400 > 14 ggtggtatca agcacggtca ccagcaaggt cag 33 <210> 15 <211> 36 <212> DNA <213> Artificial Sequence <220> < 223> primer <400> 15 cgagcagcgg gcatatcatg agcatcctga acccgc 36 <210> 16 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 gcgggttcag gatgctcatg atatgcccgc tgctcg 36 <210> 17 < 211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 atcaacctca tgaccgatgc gatggcgccg acc 33 <210> 18 <211> 33 <212> DNA <213> Artificial Sequence <220> <223 > primer <400> 18 ggtcggcgcc atcgcatcgg tcatgaggtt gat 33 <210> 19 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 ggaattcatg agaaaggttc ccattattac cgcagatga 39 <210> 20 <211 > 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 gctctagatt aggacttcat ttccttcaga cccattaagc cttctg 46 <210> 21 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 aggcctgcag gcggataaca atttcacaca gg 32 <210> 22 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 gcccatatgt ctagattagg acttcatttc c 31 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 cgccggcagg cctgcagg 18 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 ggcaggtcag cccatatgtc 20 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 gaattcgtgc tgtcgagccg cgggcatatc 30 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 gatatgcccg cggctcgaca gcacgaattc 30 <210 > 27 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 gggcatatca agagcatcct gaacccgc 28 <210> 28 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 gcgggttcag gatgctcttg atatgccc 28 <210> 29 <211> 20 <212> D NA <213> Artificial Sequence <220> <223> primer <400> 29 atgcccggag ccggttcgaa 20 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 gaaattgtta tccgcctgca gg 22 <210> 31 <211> 410 <212> PRT <213> Artificial Sequence <220> <223> E. coli K12 derived D-3-phosphoglycerate dehydrogenase (SerA) <400> 31 Met Ala Lys Val Ser Leu Glu Lys Asp Lys Ile Lys Phe Leu Leu Val 1 5 10 15 Glu Gly Val His Gln Lys Ala Leu Glu Ser Leu Arg Ala Ala Gly Tyr 20 25 30 Thr Asn Ile Glu Phe His Lys Gly Ala Leu Asp Asp Glu Gln Leu Lys 35 40 45 Glu Ser Ile Arg Asp Ala His Phe Ile Gly Leu Arg Ser Arg Thr His 50 55 60 Leu Thr Glu Asp Val Ile Asn Ala Ala Glu Lys Leu Val Ala Ile Gly 65 70 75 80 Cys Phe Cys Ile Gly Thr Asn Gln Val Asp Leu Asp Ala Ala Ala Lys 85 90 95 Arg Gly Ile Pro Val Phe Asn Ala Pro Phe Ser Asn Thr Arg Ser Val 100 105 110 Ala Glu Leu Val Ile Gly Glu Leu Leu Leu Leu Leu Leu Arg Gly Val Pro 115 120 12 5 Glu Ala Asn Ala Lys Ala His Arg Gly Val Trp Asn Lys Leu Ala Ala 130 135 140 Gly Ser Phe Glu Ala Arg Gly Lys Lys Leu Gly Ile Ile Gly Tyr Gly 145 150 155 160 His Ile Gly Thr Gln Leu Gly Ile Leu Ala Glu Ser Leu Gly Met Tyr 165 170 175 Val Tyr Phe Tyr Asp Ile Glu Asn Lys Leu Pro Leu Gly Asn Ala Thr 180 185 190 Gln Val Gln His Leu Ser Asp Leu Leu Asn Met Ser Asp Val Val Ser 195 200 205 Leu His Val Pro Glu Asn Pro Ser Thr Lys Asn Met Met Gly Ala Lys 210 215 220 Glu Ile Ser Leu Met Lys Pro Gly Ser Leu Leu Ile Asn Ala Ser Arg 225 230 235 240 Gly Thr Val Val Asp Ile Pro Ala Leu Cys Asp Ala Leu Ala Ser Lys 245 250 255 His Leu Ala Gly Ala Ala Ile Asp Val Phe Pro Thr Glu Pro Ala Thr 260 265 270 Asn Ser Asp Pro Phe Thr Ser Pro Leu Cys Glu Phe Asp Asn Val Leu 275 280 285 Leu Thr Pro His Ile Gly Gly Ser Thr Gln Glu Ala Gln Glu Asn Ile 290 295 300 Gly Leu Glu Val Ala Gly Lys Leu Ile Lys Tyr Ser Asp Asn Gly Ser 305 310 315 320 Thr Leu Ser Ala Val Asn Phe Pro Glu Val Ser Leu Pro Leu His Gly 325 330 335 Gly Arg Arg Leu Met His Ile His Glu Asn Arg Pro Gly Val Leu Thr 340 345 350 Ala Leu Asn Lys Ile Phe Ala Glu Gln Gly Val Asn Ile Ala Ala Gln 355 360 365 Tyr Leu Gln Thr Ser Ala Gln Met Gly Tyr Val Val Ile Asp Ile Glu 370 375 380 Ala Asp Glu Asp Val Ala Glu Lys Ala Leu Gln Ala Met Lys Ala Ile 385 390 395 400 Pro Gly Thr Ile Arg Ala Arg Leu Leu Tyr 405 410 <210> 32 <211> 1233 <212> DNA <213> Artificial Sequence <220> <223> serA gene <400> 32 atggcaaagg tatcgctgga gaaagacaag attaagtttc tgctggtaga aggcgtgcac 60 caaaaggcgc tggaaagcct tcgtgcagct ggttacacca acatcgaatt tcacaaaggc 120 gcgctggatg atgaacaatt aaaagaatcc atccgcgatg cccacttcat cggcctgcga 180 tcccgtaccc atctgactga agacgtgatc aacgccgcag aaaaactggt cgctattggc 240 tgtttctgta tcggaacaaa ccaggttgat ctggatgcgg cggcaaagcg cgggatcccg 300 gtatttaacg caccgttctc aaatacgcgc tctgttgcgg agctggtgat tggcgaactg 360 ctgctgctat tgcgcggcgt gccggaagcc aatgctaaag cgcaccgtgg cgtgtggaac 420 aaactggcgg cgggttcttt tgaagcgcgc ggcaaaaagc tgggtatcat cggctacggt 480 catattggta cgcaattggg cattctggct gaatcgctg g gaatgtatgt ttacttttat 540 gatattgaaa ataaactgcc gctgggcaac gccactcagg tacagcatct ttctgacctg 600 ctgaatatga gcgatgtggt gagtctgcat gtaccagaga atccgtccac caaaaatatg 660 atgggcgcga aagaaatttc actaatgaag cccggctcgc tgctgattaa tgcttcgcgc 720 ggtactgtgg tggatattcc ggcgctgtgt gatgcgctgg cgagcaaaca tctggcgggg 780 gcggcaatcg acgtattccc gacggaaccg gcgaccaata gcgatccatt tacctctccg 840 ctgtgtgaat tcgacaacgt ccttctgacg ccacacattg gcggttcgac tcaggaagcg 900 caggagaata tcggcctgga agttgcgggt aaattgatca agtattctga caatggctca 960 acgctctctg cggtgaactt cccggaagtc tcgctgccac tgcacggtgg gcgtcgtctg 1020 atgcacatcc acgaaaaccg tccgggcgtg ctaactgcgc tgaacaaaat cttcgccgag 1080 cagggcgtca acatcgccgc gcaatatctg caaacttccg cccagatggg ttatgtggtt 1140 attgatattg aagccgacga agacgttgcc gaaaaagcgc tgcaggcaat gaaagctatt 1200 ccgggtacca ttcgcgcccg tctgctgtac taa 1233 <210> 33 <211> 378 <212> PRT <213 > Artificial Sequence <220> <223> E. coli K12 derived Erythronate-4-phosphate dehydrogenase (PdxB) <400> 33 Met Lys Ile Leu Val Asp Glu Asn Met Pro Tyr Ala Arg Asp Leu Phe 1 5 10 15 Ser Arg Leu Gly Glu Val Thr Ala Val Pro Gly Arg Pro Ile Pro Val 20 25 30 Ala Gln Leu Ala Asp Ala Asp Ala Leu Met Val Arg Ser Val Thr Thr Lys 35 40 45 Val Asn Glu Ser Leu Leu Ala Gly Lys Pro Ile Lys Phe Val Gly Thr 50 55 60 Ala Thr Ala Gly Thr Asp His Val Asp Glu Ala Trp Leu Lys Gln Ala 65 70 75 80 Gly Ile Gly Phe Ser Ala Ala Pro Gly Cys Asn Ala Ile Ala Val Val 85 90 95 Glu Tyr Val Phe Ser Ser Leu Leu Met Leu Ala Glu Arg Asp Gly Phe 100 105 110 Ser Leu Tyr Asp Arg Thr Val Gly Ile Val Gly Val Gly Asn Val Gly 115 120 125 Arg Arg Leu Gln Ala Arg Leu Glu Ala Leu Gly Ile Lys Thr Leu Leu 130 135 140 Cys Asp Pro Pro Arg Ala Asp Arg Gly Asp Glu Gly Asp Phe Arg Ser 145 150 155 160 Leu Asp Glu Leu Val Gln Arg Ala Asp Ile Leu Thr Phe His Thr Pro 165 170 175 Leu Phe Lys Asp Gly Pro Tyr Lys Thr Leu His Leu Ala Asp Glu Lys 180 185 190 Leu Ile Arg Ser Leu Lys Pro Gly Ala Ile Leu Ile Asn Ala Cys Arg 195 200 205 Gly Ala Val Val Asp Asn Thr Ala Leu Leu Thr Cys Leu Asn Glu Gly 210 215 220 Gln Lys Leu Ser Val Val Leu Asp Val Trp Glu Gly Glu Pro Glu Leu 225 230 235 240 Asn Val Glu Leu Leu Lys Lys Val Asp Ile Gly Thr Ser His Ile Ala 245 250 255 Gly Tyr Thr Leu Glu Gly Lys Ala Arg Gly Thr Thr Gln Val Phe Glu 260 265 270 Ala Tyr Ser Lys Phe Ile Gly His Glu Gln His Val Ala Leu Asp Thr 275 280 285 Leu Leu Pro Ala Pro Glu Phe Gly Arg Ile Thr Leu His Gly Pro Leu 290 295 300 Asp Gln Pro Thr Leu Lys Arg Leu Val His Leu Val Tyr Asp Val Arg 305 310 315 320 Arg Asp Asp Ala Pro Leu Arg Lys Val Ala Gly Ile Pro Gly Glu Phe 325 330 335 Asp Lys Leu Arg Lys Asn Tyr Leu Glu Arg Arg Glu Trp Ser Ser Leu 340 345 350 Tyr Val Ile Cys Asp Asp Ala Ser Ala Ala Ser Leu Leu Cys Lys Leu 355 360 365 Gly Phe Asn Ala Val His Pro Ala Arg 370 375 <210> 34 <211> 1137 <212> DNA <213> Artificial Sequence <220> <223> pdxB gene <400> 34 gtgaaaatcc ttgttgatga aaatatgcct tatgcccgcg acttatttag ccgtttgggt 60 gaggtgaccg cggttcccgg gcgtccaatc cccgtcgctc aactggcaga cgcggatgcg 120 ctgatggtgc gttcggtcac gaaagtgaat gaatctttgc tggcaggaaa acccattaaa 180 tttgttggca ctgccactgc ggggaccgac catgtcgatg aagcatggtt gaagcaggcg 240 ggaattggtt tttccgctgc acctggctgt aatgcgattg cggtggtgga atatgttttc 300 tcctccctgc tgatgcttgc cgaacgcgat ggattttcac tgtacgaccg tacggtgggg 360 atcgtgggcg ttggtaacgt tggacgtcga ttgcaggcgc gactggaagc gttagggatt 420 aaaaccttac tttgcgatcc gcctcgcgcc gaccgtgggg atgagggtga tttccgctcg 480 ctggatgagt tagtccagcg cgcggatatt ctgactttcc atacgccact ctttaaagat 540 ggtccgtaca aaacgctaca tctggcggat gaaaaactga tccgtagcct gaagcccgga 600 gcgattctga ttaacgcctg ccgtggcgca gtcgtcgata atactgcgtt gctgacctgc 660 ctgaatgaag gccagaagtt aagcgtagtg ctggatgtct gggaaggcga accggaactc 720 aacgtcgagc tgctgaaaaa agtggatatc ggcacgtcgc atatcgcagg ctataccctg 780 gaaggtaaag cacgcggtac tacgcaagtg tttgaagctt atagcaagtt tattgggcat 840 gaacagcacg ttgcgctgga tacattactg cctgcgccag agtttggtcg cattacgctg 900 catggcccgc tcgatcaacc gacgctgaaa aggctggtgc atttggtgta tgatgtgcgc 960 cgcgatgacg caccgctgcg taaagtcgcc gggataccgg gtgagttcga taaactgcgc 1020 aaaaactatc ttgagcgccg tgaatggtca tctctgtatg taatttgtga tgacgccagt 1080 gcggcatcat tgctgtgtaa actgggtttt aacgccgttc atcatccggc acgttaa 1137 <210> 35 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> pdxB-sac-F primer <400> 35 gcgcgcgagc tcgtgaaaat ccttgttgat ga 32 <210> 36 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> pdxB-sph-R primer <400> 36 gcgcgcgcat gcttaacgtg ccggatgatg aa 32 <210> 37 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> serA-sac-F primer <400> 37 gcgcgcgagc tcatggcaaa ggtatcgctg ga 32 <210> 38 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> SerA-sph-R primer<400> 38 gcgcgcgcat gcttagtaca gcagacgggc gc 32

Claims (18)

Transformed with a recombinant vector containing a phosphoglycerate dehydrogenase encoding gene,
A gene encoding a propionyl-CoA transferase and a gene encoding a polyhydroxyalkanoate synthetase;
The gene encoding the propionyl-CoA transferase includes mutations of T78C, T669C, A1125G and T1158C in the nucleotide sequence of SEQ ID NO: 1, and encodes an amino acid sequence including a mutation of V193A in the amino acid sequence corresponding to SEQ ID NO: 1 Contains a nucleotide sequence,
The polyhydroxyalkanoate synthetase encoding gene is
A base sequence encoding an amino acid sequence including L18H, V24A, K91R, M128V, E130D, N246S, S325T, S477G, Q481K and A527S mutations in the amino acid sequence of SEQ ID NO: 4,
recombinant microorganisms. The method of claim 1, wherein the phosphoglycerate dehydrogenase encoding gene is Escherichia coli A recombinant microorganism, which is a derived D-3-phosphoglycerate dehydrogenase gene (serA). delete The recombinant microorganism according to claim 1, wherein the recombinant microorganism is Escherichia coli. The recombinant microorganism according to claim 1, wherein the propionyl-CoA transferase encoding gene is derived from Clostridium propionicum . The recombinant microorganism according to claim 1, wherein the polyhydroxyalkanoate synthetase encoding gene is phaC derived from a strain of the genus Pseudomonas. delete delete delete The recombinant microorganism according to any one of claims 1, 2 and 4 to 6, wherein the recombinant microorganism produces a copolymer comprising 2-hydroxybutyrate and lactate as repeating units. . The recombinant microorganism according to claim 10, wherein the copolymer comprising 2-hydroxybutyrate and lactate as repeating units has a 2-hydroxybutyrate content of 15 mol% or more and 50 mol% or less. A method for preparing a copolymer comprising 2-hydroxybutyrate and lactate as repeating units, comprising culturing the recombinant microorganism according to any one of claims 1, 2, and 4 to 6. delete delete delete delete delete delete

Images