KR102461933B1 - Gene delivery system for reconstruction or regeneration of chondrocytic tissue and method for differentiation to chondrocytes using the same - Google Patents

Abstract

The present invention provides a plasmid vector comprising a SOX5 gene, a SOX6 gene, and a SOX9 gene on nanoparticles of a biodegradable polymer; And it provides a gene delivery system for cartilage tissue reconstruction or regeneration obtained by combining dexamethasone, and a method for differentiation of mesenchymal stem cells into chondrocytes using the same. In addition, the present invention provides a pharmaceutical composition for cartilage tissue reconstruction or regeneration comprising the mesenchymal stem cells transfected with the gene delivery agent, that is, a cell therapeutic agent.

Description

Gene delivery system for reconstruction or regeneration of chondrocytic tissue and method for differentiation to chondrocytes using the same

The present invention relates to a gene delivery system for cartilage tissue reconstruction or regeneration and a method for differentiation into chondrocytes using the same. More specifically, the present invention provides a plasmid vector comprising a SOX5 gene, a SOX6 gene, and a SOX9 gene on nanoparticles of a biodegradable polymer; And it relates to a gene delivery system for cartilage tissue reconstruction or regeneration obtained by combining dexamethasone, and a method for differentiation of mesenchymal stem cells into chondrocytes using the same. In addition, the present invention relates to a pharmaceutical composition for cartilage tissue reconstruction or regeneration comprising mesenchymal stem cells transfected with the gene delivery agent, that is, a cell therapeutic agent.

Various factors such as genes and proteins are involved in stem cell differentiation and have high potential for clinical approaches. Several types of genes have been used in this regard. Plasmid DNA (pDNA) has been used for gene delivery in cancer, stem cell differentiation, and several genomic diseases. For gene therapy, two types of gene delivery systems are being used for safe and stable delivery. A carrier system using a viral vector has a very high transfection efficiency and is therefore widely used for gene delivery. However, viral vectors have several drawbacks, namely strong immunogenicity, host inflammatory response, recombination in manufacturing, and carcinogenicity, which limits their use in clinical applications (Okada Y, et al. Adenovirus mediated IL-10). gene transfer to the airway of the rat lung for prevention of lung allograft rejection. Immuno 2006;16(2):95-8; Ye L, et al. Adeno-Associated Virus Vector Mediated Delivery of the HBV Genome Induces Chronic Hepatitis B Virus Infection and Liver Fibrosis in Mice. PLoS One 2015;10(6):e0130052). Despite the relatively low transfection efficiency, non-viral vector systems for gene therapy can overcome several shortcomings of viral vector systems (Saha S, et al. Evaluating the potential for undesired genomic effects of the piggyBac transposon system) Nucleic Acids Res 2015;43(3):1770-82;Dinda SC, et al. Nanobiotechnology-based drug delivery in brain targeting.C urr Pharm Biotechnol 2013;14(15):1264-74). Cationic polymers are widely used for gene delivery (Durymanov MO, et al. Application of vasoactive and matrix-modifying drugs can improve polyplex delivery to tumors upon intravenous administration. J Control Release 2016;232:20-28; Yang Y, et al. Polymer Nanoparticles Modified with Photo- and pH-Dual-Responsive Polypeptides for Enhanced and Targeted Cancer Therapy. Pharm 2016;13(5):1508-19; Ma C, et al. Water-Soluble Cationic Polyphosphazenes Grafted with Cyclic Polyamine and Imidazole as an Effective Gene Delivery Vector. Bioconjug Chem 2016;27(4):1005-12; Cong Y, et al. One-step Conjugation of Glycyrrhetinic Acid to Cationic Polymers for High-performance Gene Delivery to Cultured Liver Cell. Sci Rep 2016;6:21891). Cationic vectors containing genes are easy to construct and inexpensive. Among cationic polymers, polyethylenimine (PEI) has been used variously as a strong gene carrier, and its length (molecular weight: 1.8-25 KDa) and shape (straight-chain or branched-chain form) are various (Lipka J, et al. Biokinetic studies of non-complexed siRNA versus nano-sized PEI F25-LMW/siRNA polyplexes following intratracheal instillation into mice . substitution on polyethylenimine for plasmid DNA delivery: Optimal substitution is critical for effective delivery. Biomater 2016;33:213-24; Park JS, et al. Receptor-mediated gene delivery into human mesenchymal stem cells using hyaluronic acid-shielded polyethylenimine/pDNA nanogels. Carbohydr Polym 2016;136:791-802).

Chondrogenesis is regulated by a complex molecular network including the SOX5, SOX6, and SOX9 genes. SOX9 acts as the most important transcription factor required for chondrocyte differentiation (Liu CF, et al. The transcription factors SOX9 and SOX5/SOX6 cooperate genome-wide through super-enhancers to drive chondrogenesis. Nucleic Acids Res 2015;43(17) ):8183-203). Nevertheless, SOX9 alone is insufficient, and SOX5 and SOX6 are also required to induce chondrocyte differentiation (Szenasi T, et al. Hmgb1 can facilitate activation of the matrilin-1 gene promoter by Sox9 and L-Sox5/Sox6 in Early steps of chondrogenesis.Biochim Biophys Act 2013;1829(10): 1075-91 ). SOX5 and SOX6 significantly enhance the transcriptional activity of SOX9 by securing binding of SOX9 to chondrocyte-specific enhancer elements in type II collagen (COL II), aggrecan, and other chondrocyte genes. Lefebvre V, et al. A new long form of Sox5 (L-Sox5), Sox6 and Sox9 are coexpressed in chondrogenesis and cooperatively activate the type II collagen gene. EMBO J 1998;17(19):5718-33 Aza-Carmona M, et al. SHOX interacts with the chondrogenic transcription factors SOX5 and SOX6 to activate the aggrecan enhancer. Hum Mol Genet 2011;20(8):1547-59; Im GI, et al. of SOX trio to enhance chondrogenesis in adipose stem cells. Osteoarthritis Cartilage 2011;19(4):449-57).

The present inventors have previously tested the ability of a multiple-gene delivery system to induce chondrocyte differentiation of human mesenchymal stem cells (Park JS, et al. Chondrogenesis of human mesenchymal). stem cells mediated by the combination of SOX trio SOX5, 6, and 9 genes complexed with PEI-modified PLGA nanoparticles. Biomaterials 2011;32(14):3679-88). In addition, the present inventors have stimulated chondrocyte differentiation by delivering SOX5, SOX6, and SOX9 alone or in combination to hMSCs. Compared to that, it has been reported that chondrocyte differentiation of hMSCs is enhanced (Yang HN, et al. Chondrogenesis of mesenchymal stem cells and dedifferentiated chondrocytes by transfection with SOX Trio genes. Biomaterials 2011;32(30):7695-704).

The present inventors conducted various studies to develop a method for simultaneously and effectively delivering SOX5, SOX6, and SOX9 genes into cells in order to increase the efficiency of differentiation from adult stem cells, including mesenchymal stem cells, into chondrocytes. The present inventors have found that the combination of SOX5, SOX6, and SOX9 can promote differentiation into chondrocytes, but when a plurality of these genes are delivered into cells by a conventional method, the expression of each gene is regulated and controlled (control). ), and to overcome this problem, various gene delivery systems were tested. Surprisingly, the present inventors have found that it is possible to construct a polycistronic plasmid vector by inserting all of the SOX5, SOX6, and SOX9 genes into a single plasmid. It was found that not only the gene delivery system prepared in the complex form was efficiently uptaked into the mesenchymal stem cells, but also the mesenchymal stem cells into which the gene delivery agent was introduced could be differentiated into chondrocytes with high differentiation efficiency.

Accordingly, the present invention provides a plasmid vector comprising a SOX5 gene, a SOX6 gene, and a SOX9 gene; And it aims to provide a gene delivery system for cartilage tissue reconstruction or regeneration, having a form of nanoparticles bound to dexamethasone.

Another object of the present invention is to provide a method for differentiation of mesenchymal stem cells into chondrocytes using the gene delivery system.

Another object of the present invention is to provide a pharmaceutical composition for cartilage tissue reconstruction or regeneration, comprising mesenchymal stem cells into which the gene delivery system is introduced.

According to an aspect of the present invention, a plasmid vector comprising a SOX5 gene, a SOX6 gene, and a SOX9 gene on nanoparticles of a biodegradable polymer; And a gene delivery system for cartilage tissue reconstruction or regeneration obtained by binding dexamethasone is provided.

In the gene delivery system of the present invention, the binding of the nanoparticles of the biodegradable polymer to dexamethasone is (a) dissolving the nanoparticles and dexamethasone of the biodegradable polymer having a carboxyl group in a water-immiscible organic solvent; (b) adding an aqueous polyvinyl alcohol solution to the solution obtained in step (a), followed by sonication to form an emulsion; and (c) adding the emulsion obtained in step (b) to an aqueous solution containing isopropanol and polyvinyl alcohol, and stirring and drying.

The binding of the biodegradable polymer to the nanoparticles and the plasmid vector is performed by reacting the nanoparticles of the biodegradable polymer having a carboxyl group to which dexamethasone is bound with polyethyleneimine, and then the SOX5 gene, the SOX6 gene, and the plasmid comprising the SOX9 gene It can be carried out by reacting the vector.

The biodegradable polymer is polylactic acid, a co-polymer of lactic acid and glycolic acid, polycaprolactone, a co-polymer of lactide and 1,4-dioxan-2-one, a co-polymer of caprolactone and glycolic acid, caprolactone It may be selected from the group consisting of co-polymers of lactone and lactic acid, polyorthoesters, polyanhydrides, polyphosphoramides, polyamino acids, and block co-polymers of polyurethane and polyethylene glycol, preferably may be a co-polymer of lactic acid and glycolic acid [poly(lactic-co-glycolic acid)].

The SOX5 gene, the SOX6 gene, and the plasmid vector containing the SOX9 gene may be bound in a ratio of 0.5 to 10 mg with respect to 1 g of the biodegradable polymer, and the dexamethasone is contained in a ratio of 5 to 20 mg with respect to 1 g of the biodegradable polymer. range can be combined.

According to another aspect of the present invention, there is provided a method for differentiation of mesenchymal stem cells into chondrocytes, comprising transfecting the mesenchymal stem cells with the gene delivery system. The transfection may be performed by culturing the mesenchymal stem cells in a serum-free medium containing the gene carrier.

According to another aspect of the present invention, there is provided a pharmaceutical composition for cartilage tissue reconstruction or regeneration comprising mesenchymal stem cells transfected with the gene delivery agent.

It was found by the present invention that a polycistronic plasmid vector can be constructed by inserting all of the SOX5, SOX6, and SOX9 genes into a single plasmid. In addition, the gene delivery system prepared in the form of a nanocomposite according to the present invention with the polygenic plasmid vector together with dexamethasone is effectively uptaken into the mesenchymal stem cells, as well as mesenchymal stem cells into which the gene delivery agent is introduced. It was found by the present invention that can be differentiated into chondrocytes with high differentiation efficiency. Accordingly, the gene delivery system can be usefully used for the differentiation of mesenchymal stem cells into chondrocytes, and further, the mesenchymal stem cells into which the gene delivery system is introduced are useful as a pharmaceutical composition for cartilage tissue reconstruction or regeneration, that is, as a cell therapeutic agent. can be used

1 shows the size distribution, SEM image, and ζ-potential of polygenic SOX pDNA-coated DEX-loaded NPs.
1A shows dynamic light scattering and SEM images. a, d: DEX-loaded NPs, b, e: PEI-modified DEX-loaded NPs, c, f: polygenic SOX pDNA-coated DEX-loaded NPs. Scale bar: 500 nm.
1B shows the ζ-potential analysis result. a: pDNA (polygenic SOX gene alone), b: PEI, c: DEX-loaded NPs, d: PEI-modified DEX-loaded NPs, e: polygenic SOX pDNA-coated DEX-loaded NPs.
2 shows the construction of a polygenic plasmid containing three SOX genes and confirmation by restriction enzyme digestion. Fig. 2A is a genetic map of the polygenic SOX plasmid, Fig. 2B shows the confirmation of polygenic SOX gene function, and Fig. 2C is a single SOX gene and cells transformed with the polygenic SOX gene represents the expression level in .
Figure 3 shows the cellular uptake of polygenic SOX genes by hMSCs in vitro, as measured by FACS and confocal laser microscopy.
3A shows the results of FACS analysis. a: Dose-dependent intracellular uptake of polygenic SOX gene. b: Time-dependent intracellular entry of the polygenic SOX gene.
3B shows the results of confocal laser microscopy. a: control cells, b: cells treated with TRITC-conjugated DEX-loaded NPs for 6 hours. Bars: 20 μm. b-1: Detection of TRITC-conjugated DEX-loaded NPs in the cytoplasm of hMSCs. b-2: Early endosome staining of hMSCs. b-3: Merged images Bars: 20 μm.
3C shows the result of measuring the intracellular influx of TRITC-conjugated DEX-loaded NPs through the cell membrane. a: 0.5 h, b: 1 h, c: 4 h, and d: 6 h Bars: 20 μm.
4 shows Western blot analysis and immunohistological analysis of hMSCs transformed with polygenic SOX pDNA-coated DEX-loaded NPs.
4A shows the results of Western blot analysis of hMSCs transformed with polygenic SOX pDNA-coated DEX-loaded NPs.
4B shows the results of immunohistological analysis of hMSCs transfected with single gene or polygenic SOX pDNA-coated DEX-loaded NPs. ad: SOX5 single gene, eh) SOX6 single gene, il: SOX9 single gene. mp: polygenic SOX gene. Emerald, red, and green represent SOX5, SOX6, and SOX9 proteins, respectively. Bars: 20 μm.
Figure 5 shows chondrocyte differentiation of hMSCs transfected with polygenic SOX pDNA-coated DEX-loaded NPs.
5A shows the results of RT-PCR analysis.
5B shows the detection results of mature chondrocyte-related marker genes by RT-PCR. a: control, b: mock pDNA-coated DEX-loaded NPs, c: polygenic SOX plasmid bound using PEI, d: polygenic SOX pDNA-coated DEX-loaded NPs.
5C shows the results of GAG/DNA analysis.
5D shows the results of histological analysis of hMSCs transfected with the polygenic SOX plasmid. a, e, i: control; b, f, j: mock pDNA-coated DEX-loaded NPs; c, g, k: polygenic SOX plasmid linked using PEI; d, h, l: polygenic SOX pDNA-coated DEX-loaded NPs. ad: Alcian blue staining, eh: Safranin-O staining, il: Masson trichrome staining.
Figure 5E is an enlarged image of Masson's trichrome staining. a: control, b: mock pDNA-coated DEX-loaded NPs, c: polygenic SOX plasmid bound using PEI, d: polygenic SOX pDNA-coated DEX-loaded NPs. Bars: 20 μm.
6 shows chondrocyte differentiation of hMSCs transfected with polygenic SOX pDNAcoated DEX-loaded NPs in 3D culture.
6A shows the results of RT-PCR analysis of specific marker genes associated with mature chondrocytes. a: control, b: mock pDNA-coated DEX-loaded NPs, c: polygenic SOX plasmid bound using PEI, d: polygenic SOX pDNA-coated DEX-loaded NPs.
6B shows the results of quantitative analysis of specific marker genes related to mature chondrocytes by real-time qPCR. a: SOX9, b: COMP, c: COL II, d: aggrecan.
7 shows GAG analysis and histological analysis of chondrocyte differentiation of hMSCs transfected with polygenic SOX pDNAcoated DEX-loaded NPs in 3D culture.
7A shows the results of GAG/DNA analysis. *P<0.01;**P<0.001.
7B shows the results of histological analysis of hMSCs transfected with the polygenic SOX plasmid. a, e: control; b, f: mock pDNA-coated DEX-loaded NPs; c, g: polygenic SOX plasmid bound using PEI; d, h: polygenic SOX pDNA-coated DEX-loaded NPs. ad: safranin-O staining; eh: Alcian blue dyeing; m, n: Magnified images of safranin-O and alcian blue staining of cells treated with polygenic SOX pDNA-coated DEX-loaded NPs. Bar: 10 μm.
Figure 8 shows Western blot analysis and immunohistological analysis of chondrocyte differentiation of hMSCs transfected with polygenic SOX pDNAcoated DEX-loaded NPs in 3D culture.
8A shows the results of Western blot analysis. a: control, b: mock pDNA-coated DEX-loaded NPs, c: polygenic SOX plasmid bound using PEI, d: polygenic SOX pDNA-coated DEX-loaded NPs.
FIG. 8B shows the results of immunohistological analysis of hMSCs transfected with the polygenic SOX plasmid. a, e, i: control; b, f, j: mock pDNA-coated DEX-loaded NPs; c, g, k: polygenic SOX plasmid linked using PEI; d, h, l: polygenic SOX pDNA-coated DEX-loaded NPs. ad: COL II, eh: SOX9, il: Merged images. Bars: 20 μm.
9 shows a schematic diagram of polygenic SOX pDNA-coated DEX-loaded NPs. Upon transfection, nanoparticle polyplexes enter hMSCs by endocytosis, exit the endosome, and localize in the cytoplasm to induce differentiation of hMSCs.
10 and 11 show Western blot analysis and immunohistological analysis of 293T and HeLa cells transformed with polygenic SOX pDNA-coated DEX-loaded NPs, respectively.
12 shows the results obtained by measuring the cytotoxicity of the delivery vehicle bound to pDNA.
Figure 13 shows Alcian Blue and Safranin-O staining of chondrocytes representing mature chondrocytes in hMSCs treated with polygenic SOX plasmid or polygenic SOX pDNA-coated DEX-loaded NPs bound using PEI. It shows the results of observation. In Figures A and B, a is Non-transfected hMSCs, b is pDNA Complexed PEI coated DEX-NPs-treated hMSCs, c is poly SOX-Trio Complexed PEI-treated hMSCs, d is poly SOX-Trio Complexed PEI coated DEX-NPs Treated hMSCs are shown respectively.
14 shows the results of observing the production of proteoglycans and polysaccharides, which are ECM components of cartilage tissue, in hMSCs treated with polygenic SOX pDNA-coated DEX-loaded NPs through H&E staining. In FIG. 14, a is Non-transfected hMSCs, b is pDNA Complexed PEI coated DEX-NPs-treated hMSCs, c is poly SOX-Trio Complexed PEI-treated hMSCs, d is poly SOX-Trio Complexed PEI coated DEX-NPs-treated hMSCs represent each.
15 shows the results of observing cell pellets by DAB staining when hMSCs were treated with polygenic SOX plasmids bound using polygenic SOX trio pDNA-coated DEX-loaded NPs or PEI.

The present invention provides a plasmid vector comprising a SOX5 gene, a SOX6 gene, and a SOX9 gene on nanoparticles of a biodegradable polymer; And it provides a gene delivery system for cartilage tissue reconstruction or regeneration obtained by binding dexamethasone.

The gene delivery system according to the present invention uses nanoparticles of a biodegradable polymer as a carrier, and a plasmid vector inducing differentiation (ie, a plasmid vector including SOX5 gene, SOX6 gene, and SOX9 gene) and dexamethasone bind to the surface of the nanoparticles is formed In the "nanoparticle", the shape is usually spherical, that is, a nanosphere, but is not particularly limited. Also, the size of the nanoparticles may be, for example, in the range of 10 to 300 nm, preferably 50 to 150 nm.

The biodegradable polymer is polylactic acid, a co-polymer of lactic acid and glycolic acid, polycaprolactone, a co-polymer of lactide and 1,4-dioxan-2-one, a co-polymer of caprolactone and glycolic acid, caprolactone Co-polymers of lactone and lactic acid, poly(ortho esters), polyanhydrides, polyphosphoramides, polyamino acids [poly(amino acids)], and polyurethane and polyethylene It may be selected from the group consisting of a block copolymer of glycol (polyurethane-PEG block copolymer), and preferably a copolymer of lactic acid and glycolic acid [poly(lactic-co-glycolic acid), PLGA].

In the gene delivery system of the present invention, the binding of the nanoparticles of the biodegradable polymer to dexamethasone may be performed using a water-in-oil-in-water solvent evaporation method. For example, the binding of the nanoparticles of the biodegradable polymer to dexamethasone is (a) nanoparticles of a biodegradable polymer having a carboxyl group (for example, nanoparticles composed of a co-polymer of lactic acid and glycolic acid) and dexamethasone dissolving in a water-immiscible organic solvent; (b) adding an aqueous polyvinyl alcohol solution to the solution obtained in step (a), followed by sonication to form an emulsion; and (c) adding the emulsion obtained in step (b) to an aqueous solution containing isopropanol and polyvinyl alcohol, and stirring and drying. In step (a), the dexamethasone may be used in a ratio of 5 to 20 mg, preferably about 10 mg, based on 1 g of the nanoparticles of the biodegradable polymer having the carboxyl group. In addition, the water-immiscible organic solvent may be methylene chloride, chloroform, or the like, and the dissolution may be performed by sonication and/or stirring. In step (b), the concentration of polyvinyl alcohol in the aqueous polyvinyl alcohol solution may be about 2% (w/v), and the amount used is about 0.5 times the amount of methylene chloride used in step (a). It may be used in an amount, but is not limited thereto. The aqueous solution containing isopropanol and polyvinyl alcohol of step (c) may be, for example, about 1% (w/v) polyvinyl alcohol aqueous solution containing about 2% isopropanol, the amount used in step (a) It can be used in an amount of about 2 to 4 times the amount of methylene chloride, but is not limited thereto.

In addition, the plasmid vector can be constructed by a genetic engineering method using appropriate primers and restriction enzymes. For example, cDNA is synthesized from total RNA of SW1353 chondrosarcoma cell line using reverse transcriptase and oligo dT primer, and then polymerase chain reaction (PCR) is performed using hSOX5-specific primer. , The PCR product was conjugated to a conventional vector (eg pcDNA3.1/hyg vector) using an appropriate restriction enzyme to construct a plasmid vector containing the hSOX5 gene, followed by hSOX6-specific primers and hSOX9-specific primers A polycistronic SOX plasmid expression vector can be prepared by additionally carrying out a polymerase chain reaction using the plasmid, and then conjugating the PCR product using an appropriate restriction enzyme.

SOX5 gene, SOX6 gene, and SOX9 gene, preferably human SOX5 gene (hSOX5 gene), human SOX6 gene (hSOX6 gene), and human SOX9 gene (hSOX9 gene) are all known from Gene Bank et al. It is known to play an important role in inducing and maintaining the expression of collagen type II, an important marker of differentiated cartilage tissue. The hSOX5 gene is known to exist seven variants (veriants), and the hSOX6 gene is known to exist four variants (veriants). The gene delivery system of the present invention can use these mutant genes without limitation. hSOX9 is a transcription factor belonging to the SRY-type family of high mobility group (HMG) box proteins. SOX9 expression initiates in the prechondrogenic mesenchymal and is maintained at high levels in fully differentiated chondrocytes.

The binding of the biodegradable polymer to the nanoparticles and the plasmid vector is a biodegradable polymer nanoparticle having a carboxyl group to which dexamethasone is bound (for example, a co-polymer of lactic acid and glycolic acid as nanoparticles composed of dexamethasone bound nanoparticles) with polyethyleneimine, and then reacting with a plasmid vector including the SOX5 gene, SOX6 gene, and SOX9 gene.

When the nanoparticles of a biodegradable polymer having a carboxyl group bound to dexamethasone obtained as described above are reacted with polyethyleneimine, the surface charge of the nanoparticles is changed and converted into cations, and an electrostatic bond with the plasmid vector is formed. be able to The amount of the polyethyleneimine used is not particularly limited, but may be used in a ratio of 0.5 to 5 μg with respect to 500 μg of nanoparticles of a biodegradable polymer having a carboxyl group. The reaction between the nanoparticles of the biodegradable polymer obtained by the reaction with the polyethyleneimine and the plasmid vector may be performed in an aqueous medium (eg, distilled water, etc.).

In the gene delivery system of the present invention, the amount of each of the plasmid vector and dexamethasone containing the SOX5 gene, SOX6 gene, and SOX9 gene may be determined in consideration of the selective differentiation efficiency into chondrocytes by the gene delivery system. Preferably, the SOX5 gene, the SOX6 gene, and the plasmid vector containing the SOX9 gene may be bound in a ratio of 0.5 to 10 mg with respect to 1 g of the biodegradable polymer, and the dexamethasone is 5 to with respect to 1 g of the biodegradable polymer. It can be combined in the range of 20 mg ratio.

The gene delivery system according to the present invention is effectively introduced into mesenchymal stem cells by endocytosis, exits the endosome, and is localized in the cytoplasm to induce differentiation of hMSCs. This is shown in a schematic diagram as shown in FIG. 9 . Therefore, the gene delivery system according to the present invention can be usefully used as a gene delivery vehicle for cartilage tissue reconstruction and regeneration.

In addition, the gene delivery system according to the present invention can be usefully used to selectively differentiate mesenchymal stem cells into chondrocytes. Accordingly, the present invention provides a method for differentiation of mesenchymal stem cells into chondrocytes, comprising transfecting the mesenchymal stem cells with the gene delivery system.

The mesenchymal stem cells can be obtained from various tissues such as synovial membrane, umbilical cord blood, bone marrow, placenta, alveolar bone, and fat (adipose tissue), and can be isolated relatively easily than other tissues among various origins. The use of bone marrow-derived mesenchymal stem cells may be advantageous.

In the differentiation method according to the present invention, the transfection may be performed by culturing the mesenchymal stem cells in a serum-free medium containing the gene delivery system. For example, it may be performed by culturing the mesenchymal stem cells in a serum-free medium containing the gene carrier for about 6 hours to induce the influx of the gene carrier into cells. The treatment in the serum-free medium is a conventional cell culture medium, for example, using a medium such as MSCGM basal medium (Lonza Walkersville Inc.), 37° C., 5% CO ₂ It can be performed under culture conditions. In addition, cells obtained from culture in serum-free medium, i.e., cells transfected with a gene delivery agent, are treated with a conventional method, for example, trypsin-EDTA (GIBCO, USA) to make single cells, and then pellet culture can be performed. have. The pellet culture is performed by inoculating the single cells in a serum-containing medium (for example, α-MEM medium containing FBS and antibiotics), floating them in the culture medium, and centrifuging to form a pellet on the bottom of the culture tube, It can be carried out by culturing in a culture condition of 37° C., 5% CO ₂ . The pellet culture may be performed for about 3 weeks while changing the medium every 3 to 4 days.

The gene delivery system in the form of a nanocomposite according to the present invention can also be used as a cell therapeutic agent for cartilage tissue reconstruction or regeneration together with mesenchymal stem cells. Accordingly, the present invention provides a pharmaceutical composition for cartilage tissue reconstruction or regeneration, ie, a cell therapeutic agent, comprising the mesenchymal stem cells transfected with the gene delivery system.

The mesenchymal stem cells into which the gene delivery system has been introduced can be obtained as described above. That is, it can be obtained by culturing and transfecting mesenchymal stem cells in a serum-free medium containing the gene delivery system. Cultivation in the serum-free medium may be performed as described above.

The pharmaceutical composition of the present invention contains the mesenchymal stem cells transfected with the gene delivery agent as described above, and may contain a pharmaceutically acceptable carrier, and may contain a solution, suspension, emulsion, freeze-drying agent, etc. according to a conventional method. It may be formulated as a parenteral formulation (eg, injection, etc.). The pharmaceutically acceptable carrier may include an aqueous diluent or solvent such as phosphate buffered saline, purified water, or sterile water. If necessary, conventional additives such as solubilizing agents, isotonic agents, suspending agents, emulsifying agents, stabilizing agents and preservatives may be included. In addition, the pharmaceutical composition according to the present invention can be prepared in the form of a construct for cartilage tissue reconstruction or regeneration using a conventional support such as BD Matrigel™ Matrix (BD biosciences).

In the pharmaceutical composition of the present invention, the dose of the mesenchymal stem cells transfected with the gene delivery agent varies depending on the patient's condition and weight, the degree of disease, the dosage form, the route of administration, and the duration, but for example, the gene The mesenchymal stem cells transfected with the carrier may be administered at a dose of about 5 X 10 ⁶ cells, for example, in the form of an injection, upon single administration. The administration may be administered once or several times a day, if necessary. In addition, the unit preparation of the pharmaceutical composition of the present invention may contain the mesenchymal stem cells transfected with the gene carrier of about 5 X 10 ⁶ cells.

Hereinafter, the present invention will be described in more detail through examples. However, the following examples are intended to illustrate the present invention and do not limit the scope of the present invention.

1. Materials and test methods

(1) Preparation of nanoparticles

Nanoparticles were prepared using a water-in-oil-in-water solvent evaporation method. Specifically, 4 g of a co-polymer of lactic acid and glycolic acid [poly(lactic-co-glycolic acid), PLGA] (weight average molecular weight 33 kDa) (Boehringer Ingelheim, Germany), 40 mg of dexamethasone (DEX) , and 2 mg of tetramethylrhodamine isothiocyanate (TRITC) (Sigma-Aldrich, St. Louis, MO) with 20 mL of methylene chloride for 30 s in a sonicator (Bandelin electronic UW 70). /HD 70, tip: MS 72/D, Berlin, Germany) was sonicated to dissolve. 10 mL of a 2% (w/v) polyvinyl alcohol (PVA; Sigma-Aldrich) solution was added and then sonicated again for 20 seconds to form an emulsion. The obtained emulsion was added to 50 mL of a 1% (w/v) PVA aqueous solution containing 2% isopropanol, stirred at 600 rpm for 1 hour, and then dried under reduced pressure to load TRITC and dexamethasone-loaded PLGA nanoparticles (TRITC-DEX NPs). or DEX-loaded NPs) were prepared.

50 mg of TRITC-DEX NPs were dissolved in 10 ml of distilled water and filtered with a 0.22 μm syringe filter to remove particles having a size of 0.22 μm or more. 5 μg of polyethyleneimine was added to 0.2 ml of the solution containing the obtained nanoparticles, and reacted for 20 seconds to obtain polyethyleneimine-modified nanoparticles (PEI-modified DEX-loaded NPs). In addition, 2 µg of polycistronic SOX genes (pDNA) was added to the obtained reaction mixture, and after reaction for 20 minutes, nanoparticles (polycistronic SOX genes)-complexed (pDNA) to which pDNA (polycistronic SOX genes) were bound and also modified with polyethyleneimine (polycistronic SOX genes)-complexed, PEI-modified DEX-loaded NPs) were obtained.

(2) TRITC - DEX NPs Characterization

The size of the nanoparticles was measured using a Zeta-sizer Nano ZS apparatus (Malvern, Southborough, MA). Specifically, nanoparticles were suspended in deionized water at a concentration of 0.5 mg/mL. Mean hydrodynamic diameter was measured through cumulative analysis. The zeta (ζ)-potential was measured based on the electrophoretic mobility of nanoparticles in the liquid phase, which was evaluated in an automatic mode using folded capillary cells.

DEX-loaded NPs, PEI-modified DEX-loaded NPs, and polycistronic SOX genes (pDNA)-complexed, PEI-modified DEX-loaded NPs were coated with platinum, and their results were analyzed by scanning electron microscopy (SEM). The average particle diameter and shape were observed.

(3) polygenic SOX plasmid ( polycistronic SOX plasmid ) Construction of expression vectors

Total RNA (3 ug) of SW1353 chondrosarcoma cell line was synthesized using reverse transcriptase and oligo dT primer (1 ul) to synthesize cDNA. hSOX5-specific primer [forward: 5'-CATACTAGTGCTAGCGCCACCATGCTTACTGACCCTGATTTAC-3' (SEQ ID NO: 1), reverse: 5'-CATGGATCCGGTACCTGGACCTGGATTGCTTTCTACATCCCCAGCCAGTTTGAGTACATGATTCAAAGTTTAAGAGTTTGTTTGACATAAGAGAGTTTGTTTGACAGGAGCGACAATTT 95 °C using polymerase 95 ° C After 35 cycles of °C/30 sec, 60 °C/30 sec, 72 °C/2 min, and 72 °C/10 min), the PCR product was cut with SpeI/BamHI and pcDNA3.1/hyg vector with NheI/BamHI It was cut and ligated (pcDNA3.1/hyg-hSOX5-2A). In order to link the hSOX6 gene with the hSOX5 gene using 2A, the hSOX6-specific primer [forward: 5'-CATAGATCTGGATCCATGGGAAGAATGTCTTCCAAGCAAGCCAC-3' (SEQ ID NO: 3), reverse: 5'-CATGCGGCCGCTGGTTGAACTGAACTGAACT using the 4' Polymerase chain reaction using cDNA derived from the SW1353 cartilage cancer cell line (35 cycles of 95 °C/2 min, 95 °C/30 sec, 60 °C/3 sec, 72 °C/2 min, and 72 °C/10 min) After carrying out, the PCR product was cut with BglII/NotI, and the prepared pcDNA3.1/hyg-hSOX5-2A vector was cut and spliced with BglII/NotI (pcDNA3.1/hyg-hSOX5-2A-hSOX6-2A). Finally, using the hSOX9-specific primer [forward: 5'-CATGCGGCCGCTATGCCAAAGAAAAAGCGAAAGGTCAATCTCCTGGACCCCTTCATG-3' (SEQ ID NO: 5), reverse: 5'-CATTCTAGATCATCTCGGCCATCGTCGCCCTTC-3' (SEQ ID NO: 6)], MGC-14364 clone (ATCC) as a template After conducting a polymerase chain reaction (95 °C/2 min, 95 °C/30 sec, 60 °C/3 sec, 35 cycles of 72 °C/2 min, and 72 °C/10 min), the PCR product was NotI/XbaI The prepared pcDNA3.1/hyg-hSOX5-2A-hSOX6-2A vector was cut with NotI/XbaI and spliced to construct a polycistronic SOX plasmid expression vector (pcDNA3.1/hyg-hSOX5-2A). -hSOX6-2A-hSOX9NLS).

(4) polygenic SOX gene combined TRITC - DEX NPs intracellular Cellular uptake

(4-1) Cell culture

hMSCs were purchased from Lonza Walkersville Inc. (Walkersville, Cat#: PT-2501). hMSCs were cultured at 37° C. in a humidified 5% CO ₂ incubator in MSCGM basal medium (Cat#: PT-3001; Lonza Walkersville Inc.). Cells were maintained at 37° C. in 5% CO ₂ and 95% ambient air, and the medium was changed every 2 days and subcultured. Experiments were performed using cells of passage 5-7 and TRITC-DEX NPs in serum-free medium at 37° C. and 5% CO ₂ .

293T cells (American Type Culture Collection, Manassas, VA) were cultured in RPMI-1640 medium (Hyclone, Logan, UT), and HeLa cells were cultured in Dulbecco's Modified Eagle's Medium (low glucose) at 37° C. and 5% CO ₂ .

(4-2) intracellular entry

For flow cytometry, hMSCs were seeded in 6-well plates (3 × 10 ⁵ cells per well), incubated at 37° C. in 5% CO ₂ , washed twice, and with 2 mL of serum-free medium for 1 h. Together, they were pre-incubated at 37°C. hMSCs were incubated with 0.2 mg/mL pDNA (empty vector)-bound TRITC-DEX NPs (pDNA (empty vector)-complexed TRITC-DEX NPs) for 0.5-6 hours. In addition, hMSCs were incubated with various concentrations (0.01-0.2 mg/mL) of pDNA (empty vector)-conjugated TRITC-DEX NPs for 6 hours. Thereafter, the cells were washed with 1 mL of phosphate-buffered saline (PBS), pH 7.4 to remove free nanoparticles, suspended in PBS, and a 583/26-nm laser was installed. Analysis was performed using the Guava EasyCyte System (Guava Technologies, Hayward, CA). Data represent mean fluorescence signal of 10,000 cells.

For confocal imaging, hMSCs were seeded into 35-mm glass plates (2 × 10 ⁵ cells/well). Cells were pre-cultured in serum-free medium at 37°C for 1 h, and then in the presence of pDNA (empty vector)-conjugated TRITC-DEX NPs (final particle concentration 0.2 mg/mL) for 0.5-6 h. Fluorescence is transmitted in three channels: FITC (for DiO cell-labeling solution, CellLight® Early Endosomes-GFP, and Alexa Fluor® 488 Goat Anti-Rabbit IgG (H+L); excitation 488 nm; emission ) 518 nm), TRITC (for TRITC-DEX NPs; excitation, 558 nm; emission, 583 nm), and 4,6-diamidino-2-phenylindole (DAPI) (for DAPI label; excitation 358 nm) , emission 461 nm).

(5) transfection ( Transfection )

hMSCs were placed in a 6-well plate (2 × 10 ⁵ cells/well), incubated at 37° C. in 5% CO ₂ , washed twice with cold PBS, and pre-incubated at 37° C. for 20 minutes. The medium was replaced with 2 mL of Opti-MEM medium, and the cells were treated with polycistronic SOX genes (pDNA)-complexed, PEI-modified DEX-loaded NPs for 6 hours. Thereafter, the medium was replaced by adding 2 mL per well of a medium containing fetal bovine serum (FBS), and incubated for an additional 24 hours. Transfection efficiency was calculated by Western blotting and fluorescence confocal microscopy (LSM 880, Zeiss).

(6) Glycosaminoglycan ( glycosaminoglycans , GAG) biochemical analysis of production

Extract samples and negative controls, wash with 2.5 mL of PBS, homogenize with a pellet grinder (Fisher Scientific, MA), and then 500 µL papain digestion buffer (0.05 M sodium acetate, 5 mM L- cysteine HCl, and 10 mM EDTA, pH 5.5) at 65° C. for 3 h. Thereafter, the specimens were treated with a cycle of freeze/thaw/sonication (30 min at -80°C, 30 min at room temperature, and 3 min sonication) to completely remove the DNA from the cytoplasm. extracted. DNA and GAG analysis was performed three times for each experimental group and control group. Cell number was determined by measuring double-stranded DNA content using a PicoGreen assay (Molecular Probes, Eugene, OR) according to the manufacturer's instructions. The fluorescence of the material alone was determined by subtracting the fluorescence of the negative and cell-free control group from the fluorescence of the experimental group. Similarly, GAG content was determined by dimethylmethylene blue dye assay. That is, 50 μL of papain-digested sample was incubated with 2 mL of the staining reagent, and the reaction was observed at 520 nm on a spectrophotometer, and shark chondroitin sulfate C (Sigma) was used as a standard material. was used as The total content of GAG was corrected for the total content of DNA.

(7) pellet culture

To prepare each pellet, aliquots of 1 × 10 ⁶ cells in 2 mL of defined medium were centrifuged at 1,200 rpm for 3 minutes in a 15-mL conical tube. The pellet was divided into 4 and cultured in complete medium (containing 10% FBS and 1% antibiotic) at 37° C. in 5% CO ₂ for 21 days. The medium was changed once every 3 days.

(8) RT- PCR

RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Total RNA (0.5 μg) was reverse transcribed according to the manufacturer's protocol (Invitrogen) in a 20-μL reaction using MMLV reverse transcriptase and random hexamers. PCR was performed using 2× LaboPass G-Taq PCR Master Mix (Cosmogenetech, Seoul, Korea) under the following conditions: 94°C for 5 minutes, then denatured at 94°C for 30 seconds, annealed at 57°C for 45 seconds, and 72 35 cycles of extension for 45 seconds at °C. The PCR product was confirmed on a 1.5% agarose gel and visualized under UV light after staining with ethidium bromide.

In addition, specific gene expression was measured by real-time RT-PCR in ExiCycler (Bioneer, Daejeon, Korea). Specifically, 1 μL of each cDNA was amplified in 20-μL PCR assay solution containing 2.0 mM MgCl ₂ , 20 pM of each primer, and 1× Takara PCR Master Mix (Takara, Otsu, Japan). Samples were subjected to the following conditions in an ExiCycler: initial denaturation at 94°C for 10 minutes, followed by 45 cycles of 94°C for 40 seconds, 58°C for 30 seconds, and 72°C for 30 seconds. Relative quantitative analysis was performed using the 2-delta delta cycle-threshold method. In order to confirm the amplification of a specific transcript, the sample was cooled to 40°C at the end of each PCR, and then slowly heated to 95°C while continuously measuring fluorescence to prepare melting curve profiles. Each primer sequence used in the PCR is shown in Table 1 below.

SEQ ID NO: order Agrecan 7 sense 5'-CCTTGGAGGTCGTGGTGAAAGG-3' 8 antisense 5'-AGGTGAACTTCTCTGGCGACGT-3' COLII 9 sense 5'-CCCAGAAACAACACAATCCG-3' 10 antisense 5'-CTGAAGGGAGGTCTTCTGGC-3' COMP 11 sense 5'-AACGCTGAAGTCACGCTCAC-3' 12 antisense 5'-GGTAGCCAAAGATGAAGCCC-3' SOX9 13 sense 5'-TTCATGAAGATGACCGACGA-3' 14 antisense 5'-CACACCATGAAGGCGTTCAT-3' GAPDH 15 sense 5'-CGCTGAGTACGTCGTGGAGT-3' 16 antisense 5'-ATGATGTTCTGGAGAGCCCC-3' Fibronectin 17 sense 5'-TCGAGGAGGAAATTCCAATG-3' 18 antisense 5'-ACACACGTGCACCTCATCAT-3' N-cadherin 19 sense 5'-GGACAGTTCCTGAGGGATCA-3' 20 antisense 5'-GGATTGCCTTCCATGTCTGT-3'

(9) western blot analysis

Total protein was extracted from cells according to standard protocols. Protein extracts were resuspended in 100-200 μL of RIPA buffer and then analyzed by electrophoresis on an 8-12% (w/v) acrylamide SDS-PAGE gel. Western blot analysis was performed using a semidry system. Blots were obtained at room temperature with primary antibodies [anti-SOX5 (abcam, cat. #; ab94396, 1:1000), anti-SOX6 (santa, cat. #; sc-20092, 1:500), anti-SOX9 (millipore, cat. #; AB5535, 1:3000), anti-COMP (abcam, cat. #; ab171854, 1:1000), anti-Aggrecan (abcam, cat. #; ab3778, 1:500), anti-β-actin (Sigma, cat. #; a5441, 1:10000)] (1:3000) and horseradish peroxidase-conjugated secondary antibody (1:5000; Bio-Rad Laboratories, Hercules, CA). ) was used to detect binding. Binding was detected on film via enhanced chemiluminescence (Amersham Pharmacia, USA).

(10) Histology and immunohistochemistry immunohistochemistry )

Samples were harvested 21 days after cells were treated with different types of nanoparticles. hMSCs transfected with pDNA (empty vector), pDNA (empty vector)-conjugated TRITC-DEX NPs, pDNA (polycistronic SOX genes)-complexed PEI, and pDNA (polycistronic SOX genes)-complexed, PEI-modified, DEX-loaded NPs was fixed in 4% paraformaldehyde. Specifically, samples obtained at each time point were embedded in an OCT compound (TISSUE-TEKs 4583, Sakura Finetek Inc. USA) and then frozen. The test article was cut into 10 μm-thick pieces at -20°C, and then the nucleus and cytoplasm were stained with hematoxylin and eosin (H&E), respectively. In addition, for histological analysis, cryosections (10 μm) were stained with Alcian blue, Safranin-O, and Masson's trichrome. Immunohistochemical analysis was performed by adding specific antibodies [COL II (Millipore, Temecula, CA) and SOX9 (Millipore)] (1:200) in a humidified environment. Samples were then washed with Tris-buffered saline and Alexa Fluor 488-conjugated goat anti-rabbit immunoglobulin G and Alexa Fluor 555-conjugated donkey Incubated with anti-mouse immunoglobulin G (Alexa Fluor 555-conjugated donkey anti-mouse immunoglobulin G (Thermo Fisher Scientific, MA), washed 3 times with PBS, and incubated with DAPI (1:500) for 5 min. The samples were then measured using a Zeiss LSM 880 confocal microscope (Carl Zeiss, Gottingen, Germany).

In another experiment, the pieces were stained with the Histostain-SP kit (AEC, Broad Spectrum, Bulk; Invitrogen). The fragments were incubated with primary antibody (anti-SOX-9, Millipore) for 1 h at room temperature, washed 3 times with PBS containing 0.1% bovine serum albumin, and biotinylated for 1 h. After treatment with the biotinylated second antibody (Histostain-SP kit, Reagent 1B), incubation was performed, and then washed 3 times with PBS. Signals were developed using AEC solution according to the manufacturer's instructions.

(12) Statistical analysis

Differences between experimental groups were evaluated using ANOVA. A p-value < 0.01 was considered statistically significant.

2. Results and Discussion

The size and shape of the nanoparticles was monitored by dynamic light scattering and SEM analysis ( FIG. 1A ). The size of nanoparticles increased with coating with PEI and PEI/pDNA (Fig. 1A b, c). DEX-loaded NPs, PEI-modified DEX-loaded NPs, and PEI/pDNA-coated DEX-loaded NPs had diameters of 130, 150, and 165 nm, respectively. This shows that DEX-loaded NPs are easily coated with PEI and PEI/pDNA. In SEM, DEX-loaded NPs had a blurry appearance when coated with PEI or PEI/pDNA (Fig. 1 e, f). When DEX-loaded NPs are combined with PEI or PEI/pDNA, the size of the nanoparticles increases, making them relatively less dense. This also shows that DEX-loaded NPs were coated with PEI or PEI/pDNA for gene delivery.

To further analyze the properties of DEX-loaded NPs coated with PEI or PEI/pDNA, their ζ-potential was measured (Fig. 1B). pDNA (polycistronic SOX genes) and DEX-loaded NPs were negative (Fig. 1B a, c). The negative ζ-potential of DEX-loaded NPs became positive after PEI coating (Fig. 1B b, d, e). This result is due to PEI having a positively charged backbone.

In a previous study, SOX5, SOX6, and SOX9 were separately delivered to promote chondrocyte differentiation (Park JS, et al. Biomaterials 2011;32(14):3679-88; and Yang HN, et al. Biomaterials 2011;32(30):7695-704). The combination of SOX5, SOX6, and SOX9 promoted chondrocyte differentiation, but it was difficult to regulate and control each single gene. For efficient gene delivery, the present inventors constructed a polycistronic plasmid containing these three SOX genes. The structure of this plasmid is shown in Fig. 2A. Proper positioning of the three genes was confirmed by restriction enzyme digestion (Fig. 2B). The expression levels of these genes in hMSCs were confirmed by RT-PCR and real-time qPCR ( FIGS. 2B and 2C ). The polygenic SOX gene (Poly) and each SOX gene were used to confirm the expression level of the gene (FIG. 2C). The expression level was significantly increased when the polygenic SOX gene was transformed into hMSCs.

To confirm the intracellular uptake of DEX-loaded NPs, hMSCs treated with TRITC-conjugated DEX-loaded NPs (ie, TRITC-DEX NPs) were analyzed by FACS (FIG. 3A). As the amount of TRITC-DEX NPs increased, the red fluorescence shifted to the right (Fig. 3A a). Intracellular uptake was measured over time ( FIG. 3A b ). Intracellular uptake increased with time and reached about 98% after 6 hours. Therefore, hMSCs retained TRITC-DEX NPs in the cytoplasm. In the course of their entry, TRITC-DEX NPs were located near the nucleus ( FIG. 3B b ). They enter the cell, are encapsulated in endosomes, and then exit from the endosomes (Fig. 3B b-1-3). This shows that TRITC-DEX NPs are introduced through endocytosis and are located in the cytoplasm to deliver specific substances. To further analyze the intracellular entry characteristics of TRITC-DEX NPs, the membranes of hMSCs were stained ( FIG. 3C ). Initially, no red particles were observed in hMSCs treated with TRITC-DEX NPs (Fig. 3C a). At later time points, red particles were observed near the cell membrane (Fig. 3C b, c), and then migrated to the nucleus (Fig. 3C d). These results indicate that DEX-loaded PLGA NPs can deliver specific drugs to the vicinity of the nucleus of hMSCs.

To confirm the transfer of the polygenic SOX gene to hMSCs, 293T cells and HeLa cells, protein expression was analyzed by Western blotting ( FIG. 4A ). Exogenous SOX5, SOX6, and SOX9 proteins migrated at 150 KDa (red arrow). The endogenous SOX5, SOX6, and SOX9 proteins migrated at 110, 130, and 90 KDa, respectively. Thus, the polygenic SOX gene was transfected into hMSCs and translated into proteins. To confirm the transfer of the polygenic SOX gene to hMSCs, 293T cells and HeLa cells, specific monoclonal antibodies labeled with Cy5.5 (SOX5), TRITC (SOX6), and FITC (SOX9) after 2 days of culture was used for immunohistochemical analysis (FIG. 4B). Although control hMSCs slightly expressed SOX9 protein, hMSCs transfected with each gene were highly labeled by each of the corresponding anti-SOX antibodies (Fig. 4B a, f, k). Therefore, SOX9 protein and mRNA were present in the cytoplasm and nucleus of hMSCs. The SOX9 protein was labeled by the monoclonal antibody and appeared in green (Fig. 4B c, g). In contrast to the transfer of single genes, hMSCs treated with polygenic plasmids displayed three colors representing SOX5 (Cy5.5), SOX6 (RITC), and SOX9 (FITC) (Fig. 4B m). , n, o). Therefore, transfection of the polygenic SOX gene induced SOX5, SOX6, and SOX9 protein expression, thus emeralds, red, and green representing SOX5, SOX6, and SOX9, respectively, were evident in the cytoplasm of hMSCs. The same results were observed in 293T and HeLa cells ( FIGS. 10 and 11 ).

To confirm the chondrocyte differentiation of hMSCs using the polygenic SOX gene, delivery vehicles were used in an in vitro culture system. Before analyzing chondrocyte differentiation, the cytotoxicity of the pDNA-conjugated delivery vehicle was measured ( FIG. 12 ). No cytotoxicity was observed when lower doses (ie 5 μg) were used.

Early, intermediate, and late chondrocytes and marker genes were first detected by RT-PCR (FIG. 5A). In the initial stage, a fibronectin marker gene was expressed, and then the expression of the marker gene was decreased. In the metaphase, specific marker genes that were not expressed in the early stage were expressed on days 5 and 7. Finally, COL II, the most important marker gene for chondrocytes, was expressed. Therefore, the viability and stability of hMSCs in the early and metaphase stages were not affected by the addition of the polygenic SOX gene. hMSCs differentiated into chondrocytes upon delivery of the polygenic SOX gene.

Levels of specific marker genes associated with chondrocyte maturation were analyzed by RT-PCR in vitro ( FIG. 5B ). Genes associated with chondrocyte differentiation were expressed upon delivery of polygenic SOX pDNA-coated DEX-loaded NPs. COL II was highly expressed upon transfection of these nanoparticles. hMSCs transfected with only the polygenic SOX plasmid bound using PEI showed increased expression of genes such as COL II. However, COMP and aggrecan gene expression was lower in these cells compared to hMSCs transformed with polygenic SOX pDNA-coated DEX-loaded NPs.

GAG, a very important component of mature chondrocytes, was tested in a two-dimensional culture system (Fig. 5C). GAG content corrected for DNA content was highest in hMSCs treated with polygenic SOX pDNA-coated DEX-loaded NPs. Therefore, dexamethasone as well as polygenic SOX gene are important factors for chondrocyte differentiation of hMSCs.

To detect extracellular matrix (ECM), including cartilage tissue formation, histological analysis of specific ECM components such as proteoglycan and polysaccharides was performed (Fig. 5D). Orange and blue labels according to safranin-O and Alcian blue staining, respectively, were evident upon treatment of polygenic SOX pDNA-coated DEX-loaded NPs (Fig. 5D d, h). The staining was also evident upon treatment with the polygenic SOX plasmid bound using PEI. However, for the control treatment and for the mock-coated DEX-loaded NPs treatment, no specific ECM component was detected by Alcian Blue and Safranin-O staining (Fig. 5D a, b, e, f). Therefore, hMSCs that were not transfected with the SOX gene did not undergo chondrocyte differentiation, whereas transformation of the polygenic SOX plasmid coupled with PEI or DEX-loaded NPs stimulated differentiation into chondrocytes.

By magnifying images of Masson's trichrome staining, cell formation typical of lacunae representing mature chondrocytes was treated with polygenic SOX plasmids or polygenic SOX pDNA-coated DEX-loaded NPs bound using PEI. hMSCs (red arrow) (Fig. 5E c, d). In these images, collagen fibers surrounded the cells upon treatment with polygenic SOX pDNA-coated DEX-loaded NPs (yellow arrows) ( FIG. 5E d ). Therefore, polygenic SOX pDNA-coated DEX-loaded NPs induced hMSCs to differentiate. These results are consistent with enlarged images of alcian blue and safranin-O staining (Fig. 13A, B). hMSCs transfected with polygenic SOX pDNA-coated DEX-loaded NPs showed clear staining and clear lacunae formation in these images (Fig. 13A, B, D).

In a three-dimensional (3D) culture system, hMSCs treated with polygenic SOX pDNA-coated DEX-loaded NPs were evaluated by RT-PCR (Fig. 6A). Typical marker genes, SOX9, COL II, aggrecan, and COMP, were highly expressed in these hMSCs, and COL II expression was clearly observed. However, the specific marker gene for bone formation, type I collagen (COL I), was not expressed in these hMSCs. Therefore, transfection of polygenic SOX pDNA-coated DEX-loaded PLGA nanoparticles induces chondrocyte differentiation of hMSCs, but not osteocytic differentiation.

Real-time qPCR was performed to quantitatively analyze the expression level. Upon transfection of the polygenic SOX gene, the COL II gene was highly expressed, whereas other delivery vehicles and mock genes did not affect gene expression ( FIG. 6B ). The expression levels of marker genes including COMP and aggrecan were significantly higher in hMSCs transformed with polygenic SOX pDNA-coated DEX-loaded NPs compared to other groups. Therefore, it can be seen that polygenic SOX pDNA-coated DEX-loaded NPs effectively induce chondrocyte differentiation of hMSCs.

In order to confirm the formation of cartilage tissue due to chondrocyte differentiation of the transfected hMSCs, GAG, a major component of the tissue, was evaluated ( FIG. 7A ). The exact GAG content of various hMSCs was measured, and the free GAG content was calculated and corrected for the total DNA content. In this way, the GAG/DNA content (corrected GAG content) of hMSCs treated with different methods was determined. hMSCs treated with polygenic SOX pDNA-coated DEX-loaded NPs had a high content, whereas control and mock-transfected hMSCs had a lower content. Therefore, it can be seen that polygenic SOX pDNA-coated DEX-loaded NPs become chondrocytes by causing chondrocyte differentiation of hMSCs.

The morphological and functional changes of hMSCs treated with polygenic SOX pDNA-coated DEX-loaded NPs were histologically analyzed (Fig. 7B). hMSCs treated with polygenic SOX pDNA-coated DEX-loaded NPs, as visualized by blue and orange labeling with Alcian blue and safranin-O staining, respectively, proteoglycans and polysaccharides, which are ECM components of cartilage tissue. was created. In addition, treatment with polygenic SOX pDNA-coated DEX-loaded NPs increased the number of cells stained with H&E ( FIG. 14 ). However, control and mock-treated hMSCs were not very dense and did not appear to stain widely around the matrix ( FIG. 7 ). In addition, chondrocyte formation was observed not only in the cell periphery but also in the central region (Fig. 7B m, n).

The production of specific proteins such as SOX9, COL II, aggrecan, and COMP is important for chondrocyte formation. Specific proteins isolated from hMSCs treated with polygenic SOX pDNA-coated DEX-loaded NPs were evaluated by Western blotting ( FIG. 8A ). SOX9, COL II, aggrecan, and COMP were highly expressed in hMSCs treated with polygenic SOX pDNA-coated DEX-loaded NPs. However, these cells did not express COL I, an osteocytic differentiation marker protein. Therefore, transfection of polygenic SOX pDNA-coated DEX-loaded NPs induces chondrocyte differentiation of hMSCs. In contrast, control and mock-treated hMSCs did not display high levels of these proteins.

The production of cartilage-specific proteins COL II and SOX9 by hMSCs treated with polygenic SOX pDNA-coated DEX-loaded NPs was evaluated to determine chondrocyte differentiation of these hMSCs. In 3D culture of these hMSCs, the cell pellet was clearly stained by COL II and SOX9 antibodies (Fig. 8B d, h). COL II was widely distributed, and SOX9 was located around the cartilaginous cavities (white arrows) (Fig. 8B m, n). When hMSCs were not treated with polygenic SOX pDNA-coated DEX-loaded NPs or polygenic SOX plasmids bound using PEI alone, cell pellets were not stained for COL II and SOX9. COL II was clearly detected by DAB staining (FIG. 15). Therefore, hMSCs that are not transfected with the polygenic SOX gene do not differentiate into chondrocytes and remain undifferentiated.

3. Conclusion

In this study, a polygenic plasmid containing three SOX genes was constructed, and its ability to induce chondrocyte differentiation of hMSCs was confirmed. Polygenic SOX pDNA-coated DEX-loaded NPs are safely and stably introduced into cells and are suitable as a gene delivery system for enhancing gene expression in hMSCs. The exogenous polygenic SOX5, SOX6, and SOX9 genes induced chondrocyte differentiation of hMSCs in 3D culture systems as well as in vitro culture systems.

<110> College of Medicine Pochon CHA University Industry-Academic Cooperation Foundation <120> Gene delivery system for reconstruction or regeneration of chondrocytic tissue and method for differentiation to chondrocytes using the same <130> PN0788 <160> 20 <170> KopatentIn 1.71 <210> 1 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 1 catactagtg ctagcgccac catgcttact gaccctgatt tac 43 <210> 2 <211> 123 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 2 catggatccg gtacctggac ctggattgct ttctacatcc ccagccagtt tgagtaaatc 60 aaagttaaga gtttgtttga caggagcgac aattttctcg aggttggctt gtcctgcaat 120 atg 123 <210> 3 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 3 catagatctg gatccatggg aagaatgtct tccaagcaag ccac 44 <210> 4 <211> 119 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 4 catgcggccg ctggacctgg attgctttct acatccccag ccagtttgag taaatcaaag 60 ttaagagttt gtttgacagg agcgacaatt ttaccggtgt tggcactgac agcctccgg 119 <210> 5 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 5 catgcggccg ctatgccaaa gaaaaagcga aaggtcaatc tcctggaccc cttcatg 57 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 6 cattctagat catctcggcc atcgtcgccc ttc 33 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 7 ccttggaggt cgtggtgaaa gg 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 8 aggtgaactt ctctggcgac gt 22 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 9 cccagaaaca acacaatccg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 10 ctgaagggag gtcttctggc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 11 aacgctgaag tcacgctcac 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 12 ggtagccaaa gatgaagccc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 13 ttcatgaaga tgaccgacga 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 14 cacaccatga aggcgttcat 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 15 cgctgagtac gtcgtggagt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 16 atgatgttct ggagagcccc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 17 tcgaggagga aattccaatg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 18 acacacgtgc acctcatcat 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 19 ggacagttcc tgagggatca 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 20 ggattgcctt ccatgtctgt 20

Claims (10)

a plasmid vector comprising a SOX5 gene, a SOX6 gene, and a SOX9 gene on nanoparticles of a co-polymer of lactic acid and glycolic acid; And obtained by binding dexamethasone, a gene delivery system for cartilage tissue reconstruction or regeneration. The method according to claim 1, wherein the binding of the nanoparticles of the co-polymer of lactic acid and glycolic acid with dexamethasone comprises (a) dissolving the nanoparticles of the co-polymer of lactic acid and glycolic acid and dexamethasone in a water-immiscible organic solvent. step; (b) adding an aqueous polyvinyl alcohol solution to the solution obtained in step (a), followed by sonication to form an emulsion; and (c) adding the emulsion obtained in step (b) to an aqueous solution containing isopropanol and polyvinyl alcohol, followed by stirring and drying. The method according to claim 1, wherein the binding of the nanoparticles of the co-polymer of lactic acid and glycolic acid with the plasmid vector is performed after reacting the nanoparticles of the co-polymer of lactic acid and glycolic acid with dexamethasone with polyethyleneimine. A gene delivery system characterized in that it is carried out by reacting a plasmid vector comprising a SOX5 gene, a SOX6 gene, and a SOX9 gene. delete delete The gene delivery system according to claim 1, wherein the plasmid vector comprising the SOX5 gene, the SOX6 gene, and the SOX9 gene is bound in the range of 0.5 to 10 mg with respect to 1 g of the co-polymer of lactic acid and glycolic acid. The gene delivery system according to claim 1, wherein the dexamethasone is bound in a ratio of 5 to 20 mg based on 1 g of the co-polymer of lactic acid and glycolic acid. The differentiation of mesenchymal stem cells into chondrocytes, comprising transfecting the bone marrow-derived mesenchymal stem cells with the gene delivery agent according to any one of claims 1 to 3, 6, and 7 Way. The differentiation method according to claim 8, wherein the transfection is performed by culturing bone marrow-derived mesenchymal stem cells in a serum-free medium containing the gene carrier. delete

Images