KR102457212B1 - Lactobacillus plantarum KCC-32 and composition comprising the same - Google Patents

Abstract

The present invention relates to a novel Lactobacillus plantarum strain KCC-32 (KACC92135P) and a composition using the same, and more particularly, the Lactobacillus plantarum KCC-32 (KACC92135P) lipogenesis inhibitory activity To provide a composition for inhibiting the production of various fats as probiotics using Plant silage produced by using the strain of the present invention can suppress unnecessary fat production in livestock, thereby increasing the quality of livestock. In addition, the strain of the present invention can be used as an effective antibacterial composition by inhibiting the growth of harmful bacteria in silage.

Description

Lactobacillus plantarum KCC-32 and a composition comprising the same {Lactobacillus plantarum KCC-32 and composition comprising the same}

The present invention relates to a novel Lactobacillus plantarum strain and a composition comprising the same, and more particularly, to a novel Lactobacillus plantarum strain excellent in antibacterial effect and adipogenesis inhibitory activity, and to silage with improved quality using the same it's about

Probiotics are living microorganisms that provide beneficial effects on the health of the host by maintaining and promoting intestinal microbial growth. These probiotics serve a variety of physiological functions, such as aiding digestion, inhibiting pathogens, and anti-tumor activity. Probiotics are known as antimicrobial agents, and various probiotic strains have been reported to enhance the immune response activity of natural killer cells. In addition, probiotics have gastric acid resistance, bile salt resistance, and adhesion to epithelial cells, and regulate pathogen binding through competition.

Probiotic strains are known to be safe given their widespread use as fermented foods. In order for a probiotic to remain in the intestine for a long time and to have a beneficial health effect on the host, the adhesion of the probiotic to the intestinal mucosa can be an important factor. Among various probiotic strains, Lactobacillus plantarum is known to have excellent intestinal mucosal adhesion. However, intestinal adhesion is a major factor for the pathogenicity of pathogenic bacteria, and the intestinal mucosa is an important site for bacterial adhesion and colonization.

Recently, interest in probiotics for promoting human health has increased, and probiotics play an important role in the regulation of inflammation, energy metabolism and body weight homeostasis. The accumulation of excess fat in the body leads to diseases such as obesity and cardiovascular disease. The prevalence of obesity doubled between 1980 and 2014, as reported by the WHO that obesity is spreading worldwide. Furthermore, childhood obesity is a global problem. According to recent statistics, 4.2 million children under the age of 5 are reported to be obese. Therefore, there is a need to develop novel microorganisms that can be safely used as probiotics or antibacterial agents in food or feed, and have an effect of inhibiting fat production.

The present invention provides a novel Lactobacillus plantarum KCC-32 (KACC92135P) strain in order to solve the above technical problems.

In addition, the present invention provides a composition for inhibiting adipogenesis comprising the strain.

In addition, the present invention provides a microbial additive for the production of plant silage containing a novel Lactobacillus plantarum ( Lactobacillus plantarum ) KCC-32 (KACC92135P) strain.

In addition, the present invention provides a method for producing plant silage comprising a novel Lactobacillus plantarum KCC-32 (KACC92135P) strain.

The novel strain of the present invention may be prepared as a composition for inhibiting lipogenesis, and the composition for inhibiting lipogenesis may be used in various forms such as food, cosmetics, pharmaceuticals, health food, and beverages.

In addition, the present invention provides a feed additive comprising a novel Lactobacillus plantarum ( Lactobacillus plantarum ) KCC-32 (KACC92135P) strain.

In order to achieve the above technical problem, the present invention provides a novel Lactobacillus plantarum ( Lactobacillus plantarum ) KCC-32 (KACC92135P) strain.

The Lactobacillus plantarum ( Lactobacillus plantarum ) KCC-32 (KACC92135P) strain was deposited with the Agricultural Gene Resource Center of the National Academy of Agricultural Sciences on July 5, 2016, and was given an accession number KACC92135P.

The inventors of the present invention discovered that, while studying the activity of a novel Lactobacillus plantarum KCC-32 strain, the extracellular secretion of the KCC-32 strain significantly inhibited adipocyte differentiation into 3T3-L1 cells. completed. The 3T3-L1 cells are a cell line derived from mouse 3T3 cells and have a fibroblast-like morphology, and can be differentiated into adipocyte-like morphology under appropriate conditions.

The inventors of the present invention comprising the steps of isolating the Lactobacillus plantarum strain from animal excrement; assaying the activity of the extracellular secretion of the isolated Lactobacillus plantarum strain; Identification of the Lactobacillus plantarum strain, which is the isolated novel microorganism; And through the step of testing the probiotic properties using the isolated Lactobacillus plantarum strain, Lactobacillus plantarum KCC-32 (KACC92135P) strain, a novel microorganism with excellent adipogenesis inhibitory activity, was obtained.

According to an embodiment of the present invention, the Lactobacillus plantarum KCC-32 (KACC92135P) strain according to the present invention inhibits the differentiation of 3T3-L1 cells into adipocytes, thereby exhibiting adipogenesis inhibitory activity. .

More specifically, the Lactobacillus plantarum KCC-32 (KACC92135P) strain according to the present invention or a composition for inhibiting adipogenesis comprising the same is a group consisting of PPARγ2, C/EBPa, FAS, and adiponectin By significantly suppressing the expression of any one or more adipogenic genes selected from, it is possible to effectively suppress adipogenesis.

Due to the excellent effect of inhibiting lipogenesis, the strain can be used for the preparation of a composition for inhibiting lipogenesis. In particular, due to its excellent probiotic effect, food, medicine, cosmetics, health food, etc. containing various lipogenesis inhibiting compositions, etc. can be used in the manufacture of

Food, pharmaceutical, cosmetic, health food, etc. containing the composition for inhibiting fat production of the present invention may be manufactured through a method generally practiced in the industry.

The inventors of the present invention have found through experiments that the novel strain of the present invention is non-toxic and has excellent adipogenesis inhibitory activity, and can be used as an excellent probiotic. When the strain of the present invention is added during silage production and fed to livestock, the quality of livestock can be improved by suppressing unnecessary fat production in livestock due to the excellent adipogenesis inhibitory activity of the strain of the present invention.

In addition, the present invention provides an antibacterial composition comprising a Lactobacillus plantarum KCC-32 (KACC92135P) strain. The antibacterial composition can inhibit the growth of harmful bacteria by the antibacterial effect of the KCC-32 strain. The harmful bacteria are Fusarium Oxysporum , Aspergillus clavatus , Penicillium chrysogenum , Scopulariopsis brevicaulis ) And Aspergillus Flavus ( Aspergillus Flavus ) It may be any one or more selected from the group consisting of, etc., but is not limited thereto. The antibacterial composition may be used in food, cosmetics, pharmaceuticals or feed, etc., but may be preferably used in feed, and can significantly improve the quality of feed by inhibiting the growth of harmful bacteria.

In addition, when the KCC-32 strain of the present invention is treated in silage, the content of lactic acid and acetic acid in the silage is significantly increased, and the pH is reduced accordingly, and the KCC-32 strain can be utilized as an excellent feed lactic acid bacteria additive.

The present invention provides a microbial additive for plant silage fermentation comprising the Lactobacillus plantarum KCC-32 (KACC92135P) strain. In addition, the present invention provides an antimicrobial additive comprising the Lactobacillus plantarum KCC-32 (KACC92135P) strain. Preferably, the microbial additive for silage fermentation or antibacterial may be used for silage. When the KCC-32 strain of the present invention is treated on silage, it is possible to effectively inhibit the growth of harmful bacteria in the silage and improve the quality of the silage.

The plant subject to which the microbial additive for plant silage fermentation is added may be, for example, rice straw, ryegrass, whole barley, whole rice, rye or corn, but is not limited thereto, and used as feed for livestock Any plant that can be used may be used, but it is preferably used for Italian ryegrass or whole barley.

The microbial additive for plant silage fermentation or antibacterial may be added in the form of a culture stock solution containing the Lactobacillus plantarum KCC-32 (KACC92135P) strain, or a diluted solution of the culture stock solution.

The present invention also provides a method for producing plant silage, characterized in that the Lactobacillus plantarum KCC-32 (KACC92135P) strain is added to the plant.

In the present invention, the method for producing plant silage is a general method used in the art, and may include, for example, a plurality of fermentation steps for fermentation of plants. The plurality of fermentation steps may include, for example, a fermentation step of anaerobic acetic acid bacteria and a subsequent fermentation step of lactic acid bacteria, and may be performed under appropriate conditions by those skilled in the art.

The present invention also provides a feed additive comprising the Lactobacillus plantarum KCC-32 (KACC92135P) strain. The feed additive of the present invention may be prepared by a method generally used in the industry.

The novel strain of the present invention is non-toxic and has excellent adipogenesis-inhibiting activity and can be used as an excellent probiotic, and this novel strain is prepared as a feed additive and added to silage due to its excellent adipogenesis-inhibiting activity. It can improve the quality of livestock by inhibiting the production of fat.

In addition, the present invention provides a food composition or cosmetic composition for inhibiting adipogenesis, comprising an extracellular secretion isolated from Lactobacillus plantarum KCC-32 (KACC92135P) strain, and exhibiting adipogenesis inhibitory activity. The food composition or cosmetic composition may be usefully used as a functional food composition or cosmetic composition that effectively suppresses the generation of unnecessary fat.

Lactobacillus plantarum KCC-32 according to the present invention has excellent adipogenesis inhibitory activity. Various compositions for inhibiting fat production can be prepared using the strain according to the present invention. Plant silage produced using the strain of the present invention can increase the quality and productivity of livestock by suppressing unnecessary fat production in livestock. Since the composition for inhibiting fat production of the present invention is non-toxic and has an excellent probiotic effect, it can be used in various forms such as food, medicine, cosmetics, and health food. In addition, the strain of the present invention can be used as an effective antibacterial composition by inhibiting the growth of harmful bacteria in silage.

1 shows A: antifungal activity of KCC-32; B: resistance to various pHs of KCC-32; C: resistance to induced gastric juice of KCC-32; D: Shows resistance to bile salts of KCC-32. The results are presented as the mean of 3 replicates ± STD.
2 shows A: hydrophobicity analysis of KCC-32; B: Shows the results of self-aggregation analysis of KCC-32. The results are presented as the mean of 3 replicates ± STD.
3 shows the results of cytotoxicity analysis of the fermentation product of KCC-32. The results are presented as the mean of 3 replicates ± STD.
4 is a result of microscopic observation of fat accumulation in 3T3-L1 adipocytes at 20X magnification. A: control adipocytes; B: Adipocytes treated with 250 μg of FP.
5 is a result of microscopic observation of oil red O-stained adipocytes at 20X magnification. A: control adipocytes; B: adipocytes treated with 250 μg of FP; C: Quantification of lipid staining. The results are presented as mean±SEM of 3 replicates. ^* P<0.05 with control adipocyte differentiation on day 10.
6 is a general and real time PCR expression analysis of an adipogenic gene; A:PPARμ; B: C/EBPa; C: FAS; D: Adiponectin. The results are presented as mean±SEM of 3 replicates. ^* P<0.05 with control adipocyte differentiation on day 10.
7 shows A: control adipocytes; B: adipocytes treated with troglitazone (5 μM); C: adipocytes treated with FP (250 μg/ml); D: A comparison result of real-time PCR expression analysis of PPARγ is shown. The results are presented as mean±SEM of 3 replicates. ^* P<0.05 with control adipocyte differentiation on day 10.

Hereinafter, examples and the like will be described in detail to help the understanding of the present invention. However, the embodiments according to the present invention may be modified in various other forms, and the scope of the present invention should not be construed as being limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

Experimental method

collection of samples

Animal fecal samples were collected in Cheonan, Korea. One gram of the sample was serially diluted with sterile water. Samples were poured into Petri dishes' MRS medium, and plates were incubated at 37°C for 24-48 hours. Isolates were randomly selected and screened for antibacterial and probiotics. A single strain named KCC-32 exhibited antibacterial and probiotic properties and was used for further experiments.

Biochemical and physiological analysis

After culturing the Lactobacillus KCC-32 strain overnight, it was used to analyze biochemical and physiological properties. A Megazyme Assay Kit (Bray, Co. WIcklow, Ireland) was used for quantification of fermentable acids. API 50 CH and API-ZYM kit (Marcy-I' Etoile, France) were used for the analysis of carbohydrate fermentation and enzyme production.

Antibacterial test and antifungal analysis of KCC-32

Antimicrobial screening was performed via the disc diffusion method described in Valan Arasu M et al. Fungal strains such as Fusarium Oxysporum, Aspergillus clavatus, Penicillium chrysogenum, Scopulariopsis brevicaulis and Aspergillus Flavus were obtained from KACC in Jeonju, Korea. Antifungal screening was performed using a microdilution method slightly modified by Ilavenil et al.

16s rRNA sequencing and gene bank deposits

16s rRNA gene sequencing was performed by Solgent Co. Genomic DNA of Lactobacillus KCC-32 was isolated and purified using the QIAquick® kit (Qiagen Ltd., Crawley, UK). Amplicons were analyzed using consensus primers 27 F (5' AGA GTT TGA TCG TGG CTC AG 3') and 1492 R (3' GCT TAC CTT GTT ACG ACT T 5'). The aligned 16s rRNA sequence of LAB KCC-32 was BLAST analyzed with the database of the NCBI gene bank. The obtained 16s rRNA sequence of KCC-32 was deposited with the NCBI gene bank under the accession number KP091748.1.

Probiotic analysis method of KCC-32

How to Assay Resistance to Low pH

Resistance to low pH of Lactobacillus KCC-32 was tested by the method described in Tambekar and Bhutada. The resistance of the KCC-32 strain to stimulated gastric juice was tested by the method described in Charteris WP et al.

Bile tolerance assay method

A fresh culture of KCC-32 was inoculated with sterile MRS medium containing 0.5% sodium deoxycholate and 0.3% bile salts such as oxgall (DCA Sigma, St Louis, MO, USA) and cultured at 37°C. did. Aliquots were collected at different time intervals (24 and 48 h) and absorbance was measured at 600 nm. MRS medium without bile salt medium was used as a control. Experimental results are expressed as the percentage of growth of bacteria measured by optical density at 600 nm in the presence of bile salts compared to the control.

Methods for self-aggregation and hydrophobicity analysis

Aggregation of cell membranes with interaction surfaces was tested with slight modifications in Del Re et al . The hydrophobicity of KCC-32 and CB was analyzed through the method described by Rosenberg et al 1980. Self-aggregation is calculated according to the following equation:

1-(At/A0) x 100,

Where At is the absorbance at time t=1, 2 or 3, A0 represents the absorbance when t=0.

Hydrophobicity is calculated using the following formula:

Hydrophobicity % = (OD initial - OD final) / OD initial X 100

Adipocyte differentiation test method

Method of Preparation of Cell-Free Supernatant

Lactobacillus KCC-32 was cultured in MRS medium at 37° C. for 48 hours, providing sufficient time for extracellular secondary metabolite production. The cultured bacterial cells were then centrifuged at 5000 g for 15 minutes; The bacterial strains in the supernatant were removed using a 0.22 μm bacterial filter. After freeze-drying the cell-free supernatant, various concentrations (200 μg, 500 μg, 1 mg, 2 mg and 3 mg/ml) were prepared for further experiments on 3T3-L1 cells.

Culturing method of 3T3-L1 adipocytes

Mouse 3T3-L1 progenitor adipocytes were obtained from the American Type Culture Collection (ATCC, USA). Additional steps are described in Choi et al. This was done with some modifications to the protocol described in 2007. 3T3-L1 progenitor adipocytes were placed in 6 well plates at a concentration of 3×10 ⁴ cells/well. Adipocyte differentiation was initiated after 100% confluence was achieved (ie after 3 days). DMEM medium containing 10% fetal bovine serum (FBS), 0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 0.25 μM dexamethasone, and 1 μg/ml insulin was used for induction of adipocyte differentiation. After 48 hours the medium was changed again with only 10% (FBS) and 1 μg/ml insulin. After 48 hours, the medium was changed back to containing only 10% FBS. To elucidate the role of FECS in adipogenesis, DMEM medium containing progenitor adipocytes containing 10% FBS was added to different concentrations of FECS (250 μg, 500 μg, 1 mg, 2 mg and 3 mg/ml).

Cell proliferation assay method

Water soluble tetrazolium (WST) for analysis of cell proliferation; 2(2-methoxy-4-nitrophenyl)-3(-nitrophenyl)-5-(2,4-disulfophenyl)-2-H-tetrazolium monosodium salt (2(2-methoxy-4- nitrophenyl)-3(-nitrophenyl)-5-(2, 4-disulfophenyl)-2-H-tetrazolium monosodium salt) was used. Progenitor adipocytes were seeded at a density of 1× ^{10 5} cells/well in 96 wells. 3T3-L1 cells were treated with various concentrations (250 μg, 500 μg, 1 mg, 2 mg and 3 mg/ml) of lyophilized extracellular secretion (FECS) of KCC-32. The 96 well plate was then stored in a CO ₂ incubator maintained at 37° C. at 5% CO ₂ concentration for 24 hours. After incubation, the cultures were treated with WST reagent and incubated for 2-4 hours. Cell viability was then measured at 450 nm using a spectral count ELISA reader.

Oil red staining method for fat determination

After adipocyte differentiation with KCC-32 FP (250 μg/ml, day 10), cells were fixed with 10% formalin for 1 hour and then alcohol washed twice with 60% isopropanol. The cells were then stained with 0.35% Oil Red O for 10 min at room temperature and washed twice with distilled water. Stained cells were photographed using an EVOS® XL microscope. Additionally, oil red staining was removed from adipocytes using 100% isopropanol and quantified at an optical density of 490 nm.

Method for qPCR measurement of adipogenic transcription factors

Total RNA was extracted using RNA adipose tissue mini kit (Qiagen, USA). RNA was then quantified using a UVS-99 micro volume UV/Vis spectrophotometer-ACT gene. The cDNA was then synthesized according to the manufacturer's instructions (First Strand Synthesis System for Superscript III RT-PCR-Invitrogen Life Technology). qPCR experiments were performed using an ABI 7500 Real-Time PCR system. Expression of specific genes was determined using SYBR Green real-time PCR master mix. Then, 20 μl reaction contains 10 μl SYBR green (Applied biosystems, Foster City, CA), 1 μl cDNA, 1 μl 10 pmole forward (FP) and reverse primer (RP). Each primer is as follows. PPARγ2-FP: gtgctccagaagatgacagac; RP: ggtgggactttcctgctaa, C/EBPa- FP: gcaggaggaagatacaggaag; RP: acagactcaaatcccaaca, Adiponectin-FP: ccgttctcttcacctacgac; RP: tccccatccccatacac, FAS- FP: cccagcccataagagttaca; RP: atcgggaagtcagcacaa. General PCR (Gene Amp PCR system 9700) was performed with slight modifications to the protocol of the Maxime PCR mix kit (i-Taq) manufacturer. The protocol was held at 94°C for 5 minutes, 95°C for 45 seconds, 57-59°C for 45 seconds, 29-35 cycles of 72°C for 1 minute, 72°C and 4°C for 5 minutes. Finally, the PCR amplified product was dissolved in a 1.2% agarose gel, and DNA was identified using Safe View nucleic acid staining (ABM- applied biological material). DNA expression was normalized to the GADPH transcription signal.

Statistical analysis method

All numerical data were obtained through three independent experiments. Experimental results are expressed as mean ± standard error of the mean (SEM). Statistical differences between control and experimental group adipocytes were analyzed through SPS/16 software hypothesis testing method including analysis of variance (one ANOVA). Differences in significant experimental values of less than 0.05 were considered to indicate statistical significance.

Experiment result

Identification and molecular characterization

A total of 15 bacterial strains were isolated from animal feces in this experiment. Among these isolated strains, one strain exhibited an antifungal effect against all tested fungi, and the strain was named KCC-32. 16srRNA of KCC-32 strain was sequenced, and sequence information was compared using the NCBI database. As a result of BLAST, the identified Lactobacillus KCC-32 strain showed more than 99% homology with other L. plantarum strains. The 16srRNA sequence was deposited in the NCBI Genbank database with accession number KP091748.1.

Physiological and biochemical properties

Various biochemical and probiotic experiments were performed on the identified KCC-32 strain. After culturing the KCC-32 strain for 48 hours, the culture was observed under a microscope. KCC-32 strain is cream-colored, rod-shaped and gram-positive. The KCC-32 strain was shown to ferment various carbohydrates (Table 1). In addition, the KCC-32 strain was shown to produce various intracellular and extracellular enzymes (Table 2).

number Carbohydrate name KCC-32 One Glycerol - 2 Erythritol + 3 D-Arabinose + 4 L-Arabinose + 5 D-Ribose + 6 D-Xylose + 7 L-Xylose + 8 D-Adonitol - 9 Methyl-βD-Xylopyranoside - 10 D-Galactose - 11 D-Glucose + 12 D-Fructose + 13 D-Mannose - 14 L-Sorbose + 15 L-Rhamnose + 16 Dulcitol + 17 Inositol + 18 D-Mannitol + 19 D-Sorbitol + 20 Methyl-αD-Mannopyranoside + 21 Methyl-αD-Glucopyranoside + 22 N-Acetylglucosamine - 23 Amygdalin + 24 Arbutin - 25 Esculinferric citrate + 26 Salicin + 27 D-Cellobiose + 28 D-Maltose - 29 D-Lactose + 30 D-Melibiose + 31 D-Saccharose - 32 D-Trehalose + 33 Inulin + 34 D-Melezitose + 35 D-Raffinose + 36 Amidon - 37 Glycogen + 38 Xylitol + 39 Gentiobiose + 40 D-Turanose + 41 D-Lyxose + 42 D-Tagatose + 43 D-Fucose - 44 L-Fucose - 45 D-Arabitol - 46 L-Arabitol - 47 Potassium gluconate + 48 Potassium2-keto gluconate - 49 potassium 5-keto gluconate +

+: positive reaction, -: negative reaction

extracellular enzymes KCC-32 One Alkaline phosphatase ++ 2 Esterase (C ₄ ) ++ 3 Esterase lipase (C ₈ ) +++ 4 Lipase (C ₁₄ ) ++ 5 Leucine arylamidase +++ 6 Valine arylamidase ++ 7 Cystine arylamidase ++ 8 trypsin ++ 9 -Chymotrypsin +++ 10 Acid phosphatase + 11 Naphthol-AS-biphosphohydrolase ++ 12 -Galactosidase + 13 -Galactosidase ++ 14 -Glucuronidase +++ 15 -Glucosidase ++ 16 -Glucosidase ++ 17 N-Acetyl--glucosaminidase ++ 18 -Mannosidase ++ 19 -Fucosidase ++

+: weak production, ++: moderate production, +++: strong production

Antibiotic resistance and antibacterial effect test

Lactobacillus KCC-32 strain showed sensitivity to common antibiotics tested, such as kanamycin and chloramphenicol (Table 3). The fermentation product of KCC-32 was measured as the maximum production amount for each of lactic acid, acetic acid and succinic acid (Table 4). KCC-32 strain is Fusarium Oxysporum, Aspergillus clavatus , Penicillium chrysogenum , Scopulariopsis brevicaulis And it showed inhibitory activity against toxin-producing fungi such as Aspergillus Flavus (FIG. 1A).

number Antibiotic name Concentration (μg) KCC-32 One Chloramphenicol (C) 50 S 2 Kanamycin (K) 30 S 3 Nitrofurantoin (NIT) 50 R 4 Tetracycline (TE) 100 S 5 Streptomycin (S) 25 S 6 Sulphafurazole (SF) 300 S 7 Colistin methane sulphonate (CL) 100 R 8 Dicloxacillin (D/C) One R 9 Ampicillin (AMP) 10 S 10 Amikacin (AK) 30 S 11 Gentamicin (GEN) 10 S 12 Cefoxitin (CX) 30 R 13 Cefalexin (CN) 30 S 14 Cefuroxime (CXM) 30 S 15 Co-Trimoxazole (COT) 25 R

< 8mm: Moderate=M, > 10mm: Susceptibility=S, R=Resistant

mountain Concentration (μg/ml) lactic acid 127.23±1.25 acetic acid 28.3±1.04 succinic acid 7.29±1.08

Growth ability of KCC-32 strain against low pH and bile salts

The viability of KCC-32 was tested in the intestinal environment such as low pH or bile salts. As a result of the experiment, the KCC-32 strain was able to survive at low pH (FIG. 1B), and it was shown to have resistance to gastric juice stress at pH 2 and 3 (FIG. 1C). No viable cells were found below pH 2. In addition, the KCC-32 strain showed resistance to toxic bile salts such as udum (0.3%) and sodium deoxycholate (0.5%) ( FIG. 1D ).

Self-aggregation and cell surface hydrophobicity analysis of KCC-32 strain

Self-aggregation and hydrophobicity experiments were performed to determine the ability of bacterial strains to form colonies in the gut. In this experiment, the KCC-32 strain showed strong self-aggregation activity, and the self-aggregation rate increased with time ( FIG. 2A ). Cell surface hydrophobicity experiments were performed using chloroform and xylene. As a result of the experiment, the KCC-32 strain showed a strong hydrophobicity to 59.07% of xylene (FIG. 2B).

Analysis of the effect of FP on 3T3-L1 adipocyte differentiation

Adipocytes were treated with various concentrations of FP of KCC-32 (250 μg, 500 μg, 1 mg, 2 mg, 3 mg/ml) for 24 hours. FP of KCC-32 significantly reduced the proliferation of adipocytes at an initial concentration of 250 μg/ml compared to normal control adipocytes, and continued cell growth up to a maximum concentration of 3 mg/ml ( FIG. 3 ). Based on the adipocyte proliferation assay, a concentration of 250 μg/ml was chosen for further experiments.

Role of Fp of KCC-32 in adipocyte fat accumulation

Adipocytes treated with FP of KCC-32 (250 μg/ml) showed fewer lipid droplets than control adipocytes (Fig. 4A-B). Adipocytes stained with Oil Red O showed a reduced number of stained adipocytes in FP-treated adipocytes compared to control adipocytes on day 10 of adipocyte differentiation (Fig. 5A-B). This experiment relates to the inhibition of fat accumulation in the cytoplasmic region of adipocytes. In addition, the results of fat measurement with 100% isopropanol showed that the accumulation of lipids in ES-treated adipocytes was inhibited ( FIG. 5C ).

qPCR expression analysis of adipocyte gene expression

The mRNA expression profiles of adipogenic genes involved in adipocyte differentiation as well as adipogenic accumulation were analyzed on day 10 of differentiation in control and adipocytes treated with FP of KCC-32. Adipogenic genes including PPARγ2 and C/EBPa were significantly down-regulated in FP-treated adipocytes of KCC-32 compared to normal adipocytes ( FIGS. 6A-B ). Down-regulation of the expression of major adipogenic genes markedly down-regulates the expression of adipogenic genes, including FAS and adiponectin (Fig. 6C-D). The results of general PCR analysis for each gene were consistent with the results of real-time PCR. The results of general PCR are shown in the upper part of the figure for each gene (FIGS. 6A-D). In addition, adipocytes treated with FP of KCC-32 significantly suppressed PPARγ expression compared to adipocytes treated with PPARγ against troglitazone (5 μM) on day 10 of adipocyte differentiation. Likewise, oil red staining was shown to significantly increase lipid droplets in troglitazone-treated adipocytes compared to FP-treated adipocytes (Fig. 7A-D). These results indicate that FP of KCC-32 effectively inhibits adipogenic differentiation in 3T3-L1 adipocytes.

Measurement of changes in pH and organic acid content of silage during treatment with KCC-32 strain

When the Lactobacillus KCC-32 strain was treated in Italian ryegrass silage, the pH and the content of organic acid were compared with the control group and are shown in Table 5 below.

treatment group pH Lactic Acid (DM ¹⁾ %) acetic acid
(DM%) butyric acid
(DM%) Flieg's
score control 4.82 3.106 0.327 0.971 58 L. Plantarun KCC-32 3.85 4.891 0.417 0.061 88

¹⁾ DM: Dry matter

When looking at the results shown in Table 5, the pH in the silage was significantly reduced in the KCC-32 inoculation group compared to the control group (non-inoculation group), and the content of lactic acid was significantly increased. In addition, the acetic acid content in the silage increased in the KCC-32 inoculation, and the butyric acid content decreased. When evaluating the grade of Italian ryegrass silage in the experimental group, the grade of the uninoculated group was normal, while the grade of the KCC-32 treatment group was improved to excellent. From these results, it was confirmed that the KCC-32 strain has the potential to be used as an excellent lactic acid bacteria additive in the production of silage.

[references]

1. Ilavenil S, Vijayakumar M, Kim DH, Valan Arasu M, Park HS, Ravikumar S, Choi KC. Assessment of probiotic, antifungal and cholesterol lowering properties of Pediococcus pentosaceus KCC-23 isolated from Italian ryegrass. J Sci Food Agric 2016; 96(2):593-601.

2. Valan Arasu M, Jung W, Ilavenil S, Jane M, Kim DH, Lee KD, et al . Isolation and characterization of antifungal compound from Lactobacillus plantarum KCC-10 from forage silage with potential beneficial properties. J Appl Microbiol 2013; 15 (5):11721185.

3. Tambekar DH. and Bhutada SA. Studies on antimicrobial activity and characteristics of bacteriocins produced by Lactobacillus strains isolated from milk of domestic animals. Int. J. Microbiol 2010; 8 (2):1-6.

4. Charteris WP, Kelly PM, Morelli L, Collins JK. Development and application of an in-vitro methodology to determine the transit tolerance of potentially probiotic Lactobacillus and Bifidobacterium species in the upper human gastrointestinal tract. J. Appl. Microbiol 1998; 84 (5):759-768.

5. Del Re B, Sgorbati B, Miglioli M, Palenzona D. Adhesion, auto-aggregation and hydrophobicity of 13 strains of Bifidobacterium longum. Lett. Appl. Microbiol 2000; 31(6): 438-442.

6. Rosenberg M, Gutnic, D, Rosenberg E. Adherence of bacteria to hydrocarbons: a simple method for measuring cell surface hydrophobicity. FEMS Microbiol . Lett 1980; 9(1):29-33.

7. Choi KC, Lee SY, Yoo HJ, Ryu OH, Lee KW, Kim SM, Baik SH, Choi KM. Effect of PPAR-delta agonist on the expression of visfatin, adiponectin, and resistin in rat adipose tissue and 3T3-L1 adipocytes. Biochem Biophys Res Commun 2007; 357 (1):62-67.

Agricultural Biotechnology Research Institute KACC92135P 20160705

Claims (22)

delete delete delete delete Lactobacillus plantarum ( Lactobacillus plantarum ) Contains the freeze-dried extracellular secretion of KCC-32 (KACC92135P) strain,
Fusarium Oxysporum , Aspergillus clavatus , Penicillium chrysogenum , Scopulariopsis brevicaulis and Aspergillus pla Booth ( Aspergillus Flavus ) Antibacterial composition for any one pathogen selected from the group consisting of. Lactobacillus plantarum ( Lactobacillus plantarum ) Feed composition comprising the freeze-dried extracellular secretion of KCC-32 (KACC92135P) strain. Lactobacillus plantarum ( Lactobacillus plantarum ) Microbial additive for silage fermentation comprising the freeze-dried extracellular secretion of KCC-32 (KACC92135P) strain. Lactobacillus plantarum ( Lactobacillus plantarum ) Silage production method, characterized in that the addition of the freeze-dried extracellular secretion of the KCC-32 (KACC92135P) strain to the fermentation step of the plant. The method according to claim 8, wherein the silage is whole barley or Italian ryegrass silage. Lactobacillus plantarum ( Lactobacillus plantarum ) Food composition for inhibiting adipogenesis comprising the freeze-dried extracellular secretion of KCC-32 (KACC92135P) strain. Lactobacillus plantarum ( Lactobacillus plantarum ) Cosmetic composition for inhibiting adipogenesis comprising the freeze-dried extracellular secretion of KCC-32 (KACC92135P) strain. Lactobacillus plantarum ( Lactobacillus plantarum ) Containing the freeze-dried extracellular secretion of KCC-32 (KACC92135P) strain,
The concentration of the lyophilized extracellular secretion of the Lactobacillus plantarum KCC-32 (KACC92135P) strain is 250 μg/ml to 3 mg/ml,
Aspergillus flavus ( Aspergillus Flavus ) Antibacterial composition for pathogens. The composition for feed comprising the composition for antibacterial of claim 12. A microbial additive for silage fermentation comprising the antimicrobial composition of claim 12 . The method for producing silage, characterized in that the antibacterial composition of claim 12 is added to the fermentation step of the plant. 16. The method of claim 15,
The silage is a method for producing silage, characterized in that the silage is whole barley or Italian ryegrass silage. A food composition for inhibiting fat production comprising the antimicrobial composition of claim 12 . A cosmetic composition for inhibiting fat production comprising the antibacterial composition of claim 12 .
Lactobacillus plantarum ( Lactobacillus plantarum ) Anti-obesity composition for inhibiting adipogenesis comprising the lyophilized extracellular secretion of KCC-32 (KACC92135P) strain. 20. The method of claim 19,
The composition is an anti-obesity composition for suppressing adipogenesis, characterized in that it suppresses the expression of any one or more adipogenic genes selected from the group consisting of PPARγ2, C/EBPa, FAS, and adiponectin. 20. The method of claim 19,
The composition is an anti-obesity composition for inhibiting adipogenesis, characterized in that it inhibits the differentiation of 3T3-L1 cells into adipocytes. 20. The method of claim 19,
The composition is an anti-obesity composition for inhibiting fat production, characterized in that it is used in the preparation of a food composition, a cosmetic composition or a pharmaceutical composition.

Images