KR102451145B1

KR102451145B1 - Composition for Preventing or Treating Viral Infections Comprising Rottlerin as an active ingredient

Info

Publication number: KR102451145B1
Application number: KR1020210093159A
Authority: KR
Inventors: 송주연
Original assignee: 큐벳 주식회사
Priority date: 2021-04-08
Filing date: 2021-07-15
Publication date: 2022-10-06

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating viral infections, containing rottlerin as an active ingredient. A pharmaceutical composition for preventing or treating viral infections, containing rottlerin as an active ingredient, of the present invention, can be effectively used in the treatment of viral infections caused by coronavirus, porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine circovirus type 2, porcine reproductive and respiratory syndrome virus or the like.

Description

A pharmaceutical composition for preventing or treating viral infections comprising rotlerin as an active ingredient {Composition for Preventing or Treating Viral Infections Comprising Rottlerin as an active ingredient}

본 발명은 로틀레린(Rottlerin)을 유효성분으로 포함하는 바이러스 감염증의 예방 또는 치료용 약제학적 조성물에 관한 것이다.The present invention relates to a pharmaceutical composition for preventing or treating a viral infection comprising rottlerin as an active ingredient.

2000년 이후 지난 20년 동안 동물에서 유래한 새로운 코로나바이러스가 사람에게 감염을 일으킨 후 사람에서 사람으로 전파되어 급성 호흡곤란증후군과 높은 치사율을 나타낸 유행이 두 번 있었다. 박쥐에서 유래한 새로운 코로나바이러스로 밝혀진 중증급성호흡기증후군(severe acute respiratory syndrome; SARS)는 2002년 11월부터 2003년 7월까지 중국에서 시작하여 29개국에서 8,096명의 확진 환자와 774명(9.6%)의 사망자를 발생시켰다. 우리나라에서는 2003년 4월 3일에 첫 SARS 의심 환자가 신고되었고 2003년 6월 15일까지 추정사례 3례, 의심사례 총 17례가 확인되었고, 2004년에 SARS-CoV 감염이 마지막으로 보고된 후 현재까지 전 세계에서 더 이상 보고가 없다.Since 2000, in the past 20 years, there have been two outbreaks of a novel coronavirus originating from animals that infects humans and then spreads from person to person, resulting in acute respiratory distress syndrome and high mortality. Severe acute respiratory syndrome (SARS), which was identified as a novel coronavirus derived from bats, started in China from November 2002 to July 2003, and in 29 countries, 8,096 confirmed patients and 774 (9.6%) caused the deaths of In Korea, the first suspected SARS patient was reported on April 3, 2003, and by June 15, 2003, a total of 17 suspected cases and 3 suspected cases were confirmed. To date, there are no further reports from all over the world.

중동호흡기증후군(Middle East respiratory syndrome; MERS)은 2012년 6월에 사우디 아라비아에서 급성 호흡곤란증후군과 다발성 장기 부전이 발생한 환자에서 발견되었다. MERS-CoV가 처음 보고된 후 2012년 4월부터 2019년 12월까지 27개국에서 2,499명이 MERS-CoV로 확진되었으며 858명(34.4%)이 사망하였다. 우리나라에서는 2015년 5월에서 7월까지 사우디아라비아에서 귀국한 후 발병한 환자와 연관하여 총 186명의 환자가 발생하였고 이중에서 38명(20.4%)이 사망하였다.Middle East respiratory syndrome (MERS) was discovered in Saudi Arabia in June 2012 in a patient with acute respiratory distress syndrome and multiple organ failure. From April 2012 to December 2019 after MERS-CoV was first reported, 2,499 people in 27 countries were confirmed with MERS-CoV, and 858 people (34.4%) died. In Korea, from May to July 2015, a total of 186 patients were related to patients who developed after returning from Saudi Arabia, and 38 (20.4%) of them died.

이번 코로나바이러스 감염증은 SARS-CoV-2(Severe Acute Respiratory Syndrome-Coronavirus-2)에 의하여 발생하는 질병이다. SARS-CoV에 의한 감염의 가장 흔한 증상은 열이며, 근육통, 오한, 피로감과 같은 전신 증상으로 시작하여 발병 수일 후부터 일주일 경에 마른 기침, 호흡곤란이 발생함. 콧물이나 인후통과 같은 상기도 감염 증상은 드물며 병의 후반기에 수양성 설사가 10-25%에서 발생하였다. 환자의 20-30%는 집중치료가 필요하였으며 사망률은 약 10%로 발병 3주째에 주로 발생하였고, 60세 이상 환자의 경우 치명률이 50% 이상이였다. COVID-19의 잠복기의 중앙값은 5.1일이며, 2-14일로 알려져 있다. 가족 내에서 발생한 사례를 분석하였을 때 노출 후 3-7일 경에 열과 호흡기 증상이 발생하였다. 현재 코로나 바이러스에 대한 치료제는 개발된 바 없으나 클로로퀸(chloroquine)과 렘데시비르(Remdesivir)가 효과가 있는 것으로 알려져 있으나 클로로퀸은 면역억제 효과로 인하여 임상시험으로 이어지지 못하였다. 렘데시비르는 세포실험을 통하여 3.7 μM 농도에서 지속처리시 약 70 %이상의 항바이러스능을 확인하여 임상시험을 시작하였으나 통상적으로 세포실험 단계에서 99 % 이상의 효과를 확인하는 항바이러스제에 비하여 효능을 기대하기 어려웠다. 따라서, 코로나 바이러스에 효과적인 치료제의 개발이 필요성이 있다. This coronavirus infection is a disease caused by Severe Acute Respiratory Syndrome-Coronavirus-2 (SARS-CoV-2). The most common symptom of SARS-CoV infection is fever, which starts with systemic symptoms such as muscle pain, chills, and fatigue, followed by dry cough and shortness of breath within a few days after the onset of the disease. Symptoms of upper respiratory tract infection such as runny nose or sore throat are rare, and watery diarrhea occurred in 10-25% of patients in the late stages of the disease. 20-30% of the patients required intensive care, and the mortality rate was about 10%, mainly occurring at the 3rd week of onset. The median incubation period for COVID-19 is 5.1 days, which is known to be 2-14 days. When analyzing cases that occurred within the family, fever and respiratory symptoms occurred 3-7 days after exposure. Currently, no treatment for coronavirus has been developed, but chloroquine and remdesivir are known to be effective. Remdesivir started clinical trials by confirming about 70% or more of antiviral activity when continuous treatment at a concentration of 3.7 μM through a cell test. It was difficult to do. Therefore, there is a need to develop an effective therapeutic agent for coronavirus.

돼지생식기호흡기증후군(PRRS: Porcine Reproductive and Respiratory Syndrome)은 1986년 미국에서 1990년 유럽에서 처음으로 발견되었다. 이후 1991년에 네덜란드 중앙수의연구소에 Wensvoort박사가 돼지 폐포 대식세포를 이용하여 원인 바이러스를 처음으로 분리하여, 바이러스(PRRSV)에 의한 질병인 것임을 밝혔고, 해당 연구소가 위치한 지명을 따서 Lelystad virus라고 명명되었다. 그 후 Lelystad virus는 SIRS(swine infertility and respiratory syndrome) 바이러스, PEARS(porcine epidemic abortions and respiratory syndrome) 바이러스, blue-eared pig disease 바이러스 등의 이름으로 불렸으나 1992년 국제적으로 PRRS(porcine reproductive and respiratory syndrome) 바이러스라 명하기로 하였다. 자돈이나 육성돈이 상기 바이러스에 의해 돼지생식기호흡기증후군에 걸리면 기침, 호흡곤란, 폐렴 등 호흡기 증상을 보이며, 모돈의 경우 임신말기에 유사산 및 조산을 나타내고 허약자돈을 분만하게 되고, 웅돈에서는 정액 성상의 이상을 일으키는 것으로 알려져 있는 등, 병명 그대로 번식장애와 호흡기 증상으로 인한 성장부진에 특징이 있다. 돼지생식기호흡기증후군을 예방하기 위한 백신으로 약독화 백신과 사독백신이 알려져 있으나, 약독화 백신은 질병을 야기할 수 있는 단점이 있으며, 사독 백신은 생산비가 비싸며 개체마다 각각 접종을 해야 하는 경제적 문제점이 있다. 또한, PRRS 바이러스는 세포 내에서 복제하여 바이러스가 증식하는 특징이 있기 때문에, 돼지생식기호흡기증후군에 대한 적절한 치료제가 알려져 있지 않다.Porcine Reproductive and Respiratory Syndrome (PRRS) was first discovered in the United States in 1986 and in Europe in 1990. Then, in 1991, Dr. Wensvoort at the Central Veterinary Research Institute in the Netherlands isolated the causative virus for the first time using porcine alveolar macrophages and revealed that it was a disease caused by a virus (PRRSV). . After that, Lelystad virus was called swine infertility and respiratory syndrome (SIRS) virus, porcine epidemic abortions and respiratory syndrome (PEARS) virus, blue-eared pig disease virus, etc. It was called a virus. When piglets or growing pigs contract swine reproductive and respiratory syndrome due to the above virus, respiratory symptoms such as cough, shortness of breath, and pneumonia are shown. It is known to cause abnormalities, and as the name suggests, it is characterized by growth retardation due to reproductive disorders and respiratory symptoms. Attenuated vaccines and dead poison vaccines are known as vaccines for preventing porcine reproductive and respiratory syndrome, but attenuated vaccines have the disadvantage of causing disease. have. In addition, since the PRRS virus has a characteristic of replicating and propagating in cells, an appropriate therapeutic agent for porcine reproductive and respiratory syndrome is not known.

돼지 유행성 설사병(Porcine Epidemic Diarrhea, PED)은 자돈에서 급성 장염과 수양성 설사를 유발하며 특히 어린 자돈에 있어서는 폐사율이 100%에 달하는 질환이다. 이 질환은 1970년 중반 벨기에와 영국에서 첫 발생 보고된 이후 양돈산업에 막대한 경제적 피해를 유발한 대표적인 양돈 질병 중 하나로 1990년대 이후 중국과 일본 등 아시아권 국가에서 발생하였으며, 한국에서는 1992년 최초 보고된 이후 지속적으로 발생하고 있다. 2007년도 이후로는 태국, 베트남, 필리핀 등 동남아시아 국가에서도 발생하여 많은 양돈 농가들이 경제적 피해를 입고 있다. PED는 2013년 이전까지 주로 아시아 국가와 일부 유럽국가에서만 발생하는 질병이었으나 2013년 5월 이후 미국에서 최초의 PED가 급성으로 발생하여 미국 전역으로 퍼졌으며 감염된 포유자돈에서의 높은 폐사율을 보였다. 이렇듯 PED 바이러스는 병원성이 높고 양돈 산업에 경제적 피해를 유발하는 바, 적합한 백신 개발도 필요하나, 적절한 치료제도 필요한 실정이다. Porcine Epidemic Diarrhea (PED) is a disease that causes acute enteritis and watery diarrhea in piglets, and has a mortality rate of 100%, especially in young piglets. Since the disease was first reported in Belgium and England in the mid-1970s, it is one of the representative pig diseases that caused enormous economic damage to the pig industry. is continuously occurring. Since 2007, outbreaks have also occurred in Southeast Asian countries such as Thailand, Vietnam, and the Philippines, causing economic damage to many pig farms. Until 2013, PED was a disease that mainly occurred in Asian countries and some European countries, but after May 2013, the first PED occurred acutely in the United States and spread throughout the United States, showing a high mortality rate in infected piglets. As such, the PED virus is highly pathogenic and causes economic damage to the pig industry, so it is necessary to develop a suitable vaccine, but also an appropriate treatment.

고양이 코로나바이러스 (Feline Corona Virus, FCoV)는 고양이 내에서 통상적으로 발견되는, 코로나바이러스 과, 외피보유 양성 가닥 RNA 바이러스 군에 속한다. 자연에서, FCoV는 2종의 별개의 생물형으로서 존재한다: 고양이 장 코로나바이러스 (Feline Enteric Corona virus, FECV) 및 FECV의 돌연변이 형태인 고양이 감염성 복막염 바이러스 (Feline Infectious Peritonitis virus, FIPV). FECV 감염은 고양이에서 보편화되어 있고, 전세계적으로 고양이의 40-80%가 바이러스를 배출하는 것으로 추정된다. FECV는 고양이에서 위장 상피 세포를 만성적으로 감염시키고, 전형적으로 분변-경구 경로를 통해 전달된다. 고양이에서 FECV 감염은 주로 무증상이고, 일부 고양이는 설사, 구토, 식욕 상실 및 열을 경험한다. FIPV 생물형은 FECV에서 바이러스 3c 프로테아제 유전자를 불활성화시키는, 단일 뉴클레오티드 다형성 또는 결실 후에 발생하나, 바이러스 스파이크 단백질 내의 돌연변이와 또한 관련된다. 3c 프로테아제의 불활성화는 세포향성을 변경시켜, 바이러스가 대식세포 내에서 복제되게 하여 FIPV의 전신 전파 및 고양이 감염성 복막염 (FIP)의 발병을 용이하게 한다. FIP는 고양이에서 진행성 면역 관련 질환이다. FIP 질환은 "습성(wet)" 또는 "건성(dry)" FIP의 형태를 취할 수 있다. 습성 FIP는 복강 및/또는 흉강 내로의 유체의 삼출을 유발하는 내장 장막 및 망의 염증과 연관된다. 건성 FIP는 실질성 기관, 예컨대 간, 중추신경계 또는 안구의 육아종성 침범을 특징으로 한다. 습성 또는 건성 형태의 FIP 의 발병은 예외 없이 치명적이다. FIP는 고양이 밀도가 높은 환경 예컨대 다묘 가정, 캐터리, 보호소, 및 고양이 구조 시설에서의 주요 문제이다. 상기 질환은 FIPV 생물형에 대한 돌연변이의 가능성을 증가시키는 보다 높은 수준의 FECV 복제, 뿐만 아니라 이들 돌연변이를 보유하는 바이러스에 대한 감소된 저항성으로 인해, 보다 어린 고양이(<3세), 특히 새끼 고양이에서 가장 보편적이다. FIP는 2세 미만 고양이에서의 주요 사망 원인이고, 전세계적으로 0.3 내지 1%의 고양이를 사망시키는 것으로 추정된다. 현재 FIP의 치료를 위해 승인된 백신 또는 효과적인 항바이러스 요법은 존재하지 않는다. 따라서, 고양이에서 FIP를 치료하는 제제 개발에 대한 필요성이 존재한다. Feline Corona Virus (FCoV) belongs to the family of coronaviruses, enveloped positive strand RNA viruses, commonly found in cats. In nature, FCoV exists as two distinct biotypes: Feline Enteric Corona virus (FECV) and Feline Infectious Peritonitis virus (FIPV), a mutant form of FECV. FECV infection is prevalent in cats, and it is estimated that 40-80% of cats worldwide shed the virus. FECV chronically infects gastrointestinal epithelial cells in cats and is typically transmitted via the fecal-oral route. FECV infection in cats is mostly asymptomatic, and some cats experience diarrhea, vomiting, loss of appetite, and fever. The FIPV biotype occurs after a single nucleotide polymorphism or deletion, which inactivates the viral 3c protease gene in FECV, but is also associated with mutations in the viral spike protein. Inactivation of 3c protease alters cytotropism, allowing the virus to replicate within macrophages, facilitating systemic dissemination of FIPV and the pathogenesis of feline infectious peritonitis (FIP). FIP is a progressive immune-related disease in cats. FIP disease can take the form of “wet” or “dry” FIP. Wet FIP is associated with inflammation of the visceral serosal and reticulum leading to exudation of fluid into the abdominal and/or thoracic cavities. Dry FIP is characterized by granulomatous involvement of parenchymal organs, such as the liver, central nervous system, or eye. The development of the wet or dry form of FIP is invariably fatal. FIP is a major problem in cat-dense environments such as multi-cat homes, catteries, shelters, and cat rescue facilities. The disease occurs in younger cats (<3 years), especially kittens, due to higher levels of FECV replication that increases the likelihood of mutations to the FIPV biotype, as well as reduced resistance to viruses carrying these mutations. the most common FIP is the leading cause of death in cats under 2 years of age and is estimated to kill 0.3-1% of cats worldwide. There is currently no approved vaccine or effective antiviral therapy for the treatment of FIP. Therefore, a need exists for the development of formulations to treat FIP in cats.

Nico Van Rooijen, Annemarie Sanders. Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. Journal of Immunological Methods 174 (1994) 83-93Nico Van Rooijen, Annemarie Sanders. Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. Journal of Immunological Methods 174 (1994) 83-93

본 발명자들은 바이러스에 효과적으로 작용할 수 있는 치료제를 개발하고자 예의 연구 노력하였다. 그 결과, 로틀레린을 포함하는 조성물의 경우 여러가지 종류의 바이러스에 대하여 우수한 항바이러스 효과를 발휘한다는 점을 규명함으로써, 본 발명을 완성하게 되었다. The present inventors made intensive research efforts to develop a therapeutic agent that can effectively act on viruses. As a result, the present invention was completed by identifying that the composition containing rotlerin exhibits excellent antiviral effects against various types of viruses.

따라서, 본 발명의 목적은 로틀레린을 유효성분으로 포함하는 바이러스 감염증의 예방 또는 치료용 약제학적 조성물을 제공하는 것이다. Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating viral infections comprising rotlerin as an active ingredient.

본 발명의 다른 목적은 로틀레린을 포함하는 바이러스 감염증의 예방 또는 개선용 사료 첨가제를 제공하는 것이다.Another object of the present invention is to provide a feed additive for preventing or improving viral infection containing rotlerin.

본 발명의 또 다른 목적은 상기 약제학적 조성물을 대상에 투여하는 단계를 포함하는 바이러스 감염증의 치료 방법을 제공하는 것이다. Another object of the present invention is to provide a method of treating a viral infection comprising administering the pharmaceutical composition to a subject.

본 발명의 일 양태에 따르면, 본 발명은 로틀레린을 유효성분으로 포함하는 바이러스 감염증의 예방 또는 치료용 약제학적 조성물을 제공한다.According to one aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating viral infection comprising rotlerin as an active ingredient.

로틀레린은 나무인 말로터스 필리펜시스(Mallotus philippensis)에서 분리 추출된 폴리페놀 천연 추출물에서 분리되는 화합물이다. 상기 로틀레린 화합물을 포함하는 천연 추출물은 다음과 같은 방법으로 추출될 수 있으나 이에 제한되지 않으며, 하기 방법 이외에 당업계에 널리 알려진 추출방법에 의해 추출되거나, 구입하여 사용될 수 있다:Lotlerin is a compound isolated from natural polyphenol extracts isolated from the tree Mallotus philippensis. The natural extract containing the rotlerin compound may be extracted by the following method, but is not limited thereto, and may be extracted by an extraction method well known in the art in addition to the following method, or may be purchased and used:

말로터스 필리펜시스 열매 분말을 70-99 % 에틸 알코올에 침지하여 3-9시간 동안 반응 후 필터를 통하여 여과한다. 로틀레린은 에틸 알코올에 녹지 않으므로, 필터를 통과하지 못한 잔류물을 건조 후 에틸 아세테이트로 2-8 시간 동안 연속 교반하여 2-6 회 추출한다. 2-6 회 추출 후 남은 잔류물에 1-7 ℃ 70-99 % 알코올로 세척하고 에틸 아세테이트로 결정화한다. 상기 방법으로 제조된 결정은 로틀레린을 지표성분으로 포함한다.The malotus philippensis fruit powder is immersed in 70-99% ethyl alcohol, reacted for 3-9 hours, and filtered through a filter. Since rotlerin is not soluble in ethyl alcohol, the residue that has not passed through the filter is dried and extracted 2-6 times by continuously stirring with ethyl acetate for 2-8 hours. The residue remaining after 2-6 extractions is washed with 70-99% alcohol at 1-7°C and crystallized with ethyl acetate. The crystals prepared by the above method include rotlerin as an indicator component.

본 발명의 일 구현예에 있어서, 상기 로틀레린은 로틀레린 결정일 수 있다. 상기 로틀레린 결정은 미세 입자의 형태를 띈다.In one embodiment of the present invention, the rotlerin may be rotlerin crystals. The rotlerin crystals take the form of fine particles.

본 발명의 일 구현예에 있어서, 상기 로틀레린을 포함하는 미세 입자는 로틀레린을 포함하는 추출물 또는 로틀레린 화합물의 결정을 초음파로 분쇄한 것이다.In one embodiment of the present invention, the fine particles containing rotlerin are obtained by ultrasonically pulverizing an extract containing lotlerin or crystals of a lotlerin compound.

본 발명의 일 구현예에 있어서, 상기 로틀레린을 포함하는 추출물 또는 로틀레린 화합물의 결정은 로틀레린 순도가 적어도 90%, 91%, 92%, 93%, 94%, 또는 95%이다. In one embodiment of the present invention, the rotlerin-containing extract or the crystal of the rotlerin compound has a purity of at least 90%, 91%, 92%, 93%, 94%, or 95% of rotlerin.

본 발명의 일 구현예에 있어서, 상기 로틀레린을 포함하는 미세 입자는 입자 크기가 200 nm 이하인 것이다. 보다 구체적으로, 상기 로틀레린을 포함하는 미세 입자는 입자 크기가 10 nm 내지 200 nm, 20 nm 내지 200 nm, 30 nm 내지 200 nm, 40 nm 내지 200 nm, 50 nm 내지 200 nm, 60 nm 내지 200 nm, 70 nm 내지 200 nm, 80 nm 내지 200 nm, 90 nm 내지 200 nm, 100 nm 내지 200 nm, 10 nm 내지 150 nm, 20 nm 내지 150 nm, 30 nm 내지 150 nm, 40 nm 내지 150 nm, 50 nm 내지 150 nm, 60 nm 내지 150 nm, 70 nm 내지 150 nm, 80 nm 내지 150 nm, 90 nm 내지 150 nm, 100 nm 내지 150 nm, 10 nm 내지 125 nm, 20 nm 내지 125 nm, 30 nm 내지 125 nm, 40 nm 내지 125 nm, 50 nm 내지 125 nm, 60 nm 내지 125 nm, 70 nm 내지 125 nm, 80 nm 내지 125 nm, 90 nm 내지 125 nm, 또는 100 nm 내지 125 nm인 것이다. In one embodiment of the present invention, the fine particles comprising rotlerin have a particle size of 200 nm or less. More specifically, the fine particles comprising rotlerin have a particle size of 10 nm to 200 nm, 20 nm to 200 nm, 30 nm to 200 nm, 40 nm to 200 nm, 50 nm to 200 nm, 60 nm to 200 nm. nm, 70 nm to 200 nm, 80 nm to 200 nm, 90 nm to 200 nm, 100 nm to 200 nm, 10 nm to 150 nm, 20 nm to 150 nm, 30 nm to 150 nm, 40 nm to 150 nm, 50 nm to 150 nm, 60 nm to 150 nm, 70 nm to 150 nm, 80 nm to 150 nm, 90 nm to 150 nm, 100 nm to 150 nm, 10 nm to 125 nm, 20 nm to 125 nm, 30 nm to 125 nm, 40 nm to 125 nm, 50 nm to 125 nm, 60 nm to 125 nm, 70 nm to 125 nm, 80 nm to 125 nm, 90 nm to 125 nm, or 100 nm to 125 nm.

본 발명의 일 구현예에 있어서, 상기 로틀레린을 포함하는 미세 입자는 PDA(polydopamine)로 코팅되는 것이다.In one embodiment of the present invention, the fine particles including rotlerin are coated with PDA (polydopamine).

상기 로틀레린을 포함하는 미세 입자를 PDA로 코팅하는 경우 생산공정이 단순해지고, 다양한 세포 표면에 대한 입자의 부착력이 강해지며, 생체 적합성이 높아진다. 또한, 로틀레린을 포함하는 미세 입자의 위산 등에 대한 저항성과 약물의 전달 효율이 증가된다. PDA 코팅된 미세 입자는 아미노산, 펩타이드, 키토산 또는 아미노 잔기를 포함하는 화학물질로 손쉽게 수식 가능하며 입자의 성질을 쉽게 변화시킬 수 있다는 장점이 있다.When the microparticles containing rotlerin are coated with PDA, the production process is simplified, the adhesion of the particles to various cell surfaces is increased, and biocompatibility is increased. In addition, resistance to gastric acid and the like of microparticles containing rotlerin and drug delivery efficiency are increased. The PDA-coated microparticles have the advantage that they can be easily modified with chemicals including amino acids, peptides, chitosan, or amino residues, and the properties of the particles can be easily changed.

상기 로틀레린을 포함하는 미세입자를 PDA로 코팅하는 것은 도파민 염산염(dopamine hydrochloride) 수용액과 트리스 염기(Tris base) 수용액을 30-100:1 (v/v)씩 첨가하고 상온에서 반응하는 단계를 통해 코팅되는 것이다. Coating the microparticles containing rotlerin with PDA is performed by adding an aqueous dopamine hydrochloride solution and an aqueous solution of Tris base 30-100:1 (v/v) at a time and reacting at room temperature. will be coated.

본 발명의 구체적인 구현예에 있어서, 상기 도파민 염산염 수용액은 3-20 mg/ml 농도이고, 상기 트리스 염기 수용액은 2-15 mg/ml의 농도일 수 있다.In a specific embodiment of the present invention, the aqueous dopamine hydrochloride solution may have a concentration of 3-20 mg/ml, and the aqueous Tris base solution may have a concentration of 2-15 mg/ml.

본 발명의 일 구현예에 있어서, 상기 로틀레린은 리포좀에 포함될 수 있다. In one embodiment of the present invention, the rotlerin may be contained in a liposome.

본 명세서 상의 용어 리포좀이란 활성 약물을 봉입할 수 있는 인지질 이중막을 의미한다.As used herein, the term liposome refers to a phospholipid bilayer capable of encapsulating an active drug.

본 발명의 일 구현예에 있어서, 상기 리포좀의 크기는 1 내지 500 nm인 것이다. 보다 구체적으로, 상기 리포좀의 크기는 1 내지 300 nm, 1 내지 200 nm, 1 내지 150 nm, 1 내지 120 nm, 1 내지 100 nm, 1 내지 90 nm, 1 내지 80 nm, 1 내지 70 nm, 10 내지 500 nm, 10 내지 300 nm, 10 내지 200 nm, 10 내지 150 nm, 10 내지 120 nm, 10 내지 100 nm, 10 내지 90 nm, 10 내지 80 nm, 10 내지 70 nm, 30 내지 500 nm, 30 내지 300 nm, 30 내지 200 nm, 30 내지 150 nm, 30 내지 120 nm, 30 내지 100 nm, 30 내지 90 nm, 30 내지 80 nm, 30 내지 70 nm, 50 내지 500 nm, 50 내지 300 nm, 50 내지 200 nm, 50 내지 150 nm, 50 내지 120 nm, 50 내지 100 nm, 50 내지 90 nm, 50 내지 80 nm, 50 내지 70 nm, 60 내지 500 nm, 60 내지 300 nm, 60 내지 200 nm, 60 내지 150 nm, 60 내지 120 nm, 60 내지 100 nm, 60 내지 90 nm, 60 내지 80 nm, 60 내지 70 nm, 61 내지 70 nm, 63 내지 70 nm, 64 내지 70 nm, 60 내지 69 nm, 61 내지 69 nm, 63 내지 69 nm, 64 내지 69 nm, 60 내지 68 nm, 61 내지 68 nm, 63 내지 68 nm, 64 내지 68 nm, 또는 65 내지 67 nm인 것이다. In one embodiment of the present invention, the size of the liposome is 1 to 500 nm. More specifically, the size of the liposome is 1-300 nm, 1-200 nm, 1-150 nm, 1-120 nm, 1-100 nm, 1-90 nm, 1-80 nm, 1-70 nm, 10 to 500 nm, 10-300 nm, 10-200 nm, 10-150 nm, 10-120 nm, 10-100 nm, 10-90 nm, 10-80 nm, 10-70 nm, 30-500 nm, 30 to 300 nm, 30 to 200 nm, 30 to 150 nm, 30 to 120 nm, 30 to 100 nm, 30 to 90 nm, 30 to 80 nm, 30 to 70 nm, 50 to 500 nm, 50 to 300 nm, 50 to 200 nm, 50 to 150 nm, 50 to 120 nm, 50 to 100 nm, 50 to 90 nm, 50 to 80 nm, 50 to 70 nm, 60 to 500 nm, 60 to 300 nm, 60 to 200 nm, 60 to 150 nm, 60 to 120 nm, 60 to 100 nm, 60 to 90 nm, 60 to 80 nm, 60 to 70 nm, 61 to 70 nm, 63 to 70 nm, 64 to 70 nm, 60 to 69 nm, 61 to 69 nm, 63 to 69 nm, 64 to 69 nm, 60 to 68 nm, 61 to 68 nm, 63 to 68 nm, 64 to 68 nm, or 65 to 67 nm.

본 발명의 일 구현예에 있어서, 상기 리포좀은 포스파티딜콜린 및 스테롤계 화합물을 포함하는 것이다. In one embodiment of the present invention, the liposome contains phosphatidylcholine and a sterol-based compound.

본 발명의 일 구현예에 있어서, 상기 포스파티딜콜린 및 스테롤계 화합물은 이의 몰비가 0.1-15:1인 것이다. 보다 구체적으로, 상기 포스파티딜콜린 및 스테롤계 화합물은 이의 몰비가 0.1-15:1, 0.2-15:1, 0.3-15:1, 0.4-15:1, 0.5-15:1, 0.6-15:1, 0.7-15:1, 0.8-15:1, 0.9-15:1, 1-15:1, 1.1-15:1, 1.2-15:1, 1.3-15:1, 1.4-15:1, 1.5-15:1, 1.6-15:1, 1.7-15:1, 1.8-15:1, 1.9-15:1, 2-15:1, 2.1-15:1, 2.2-15:1, 2.3-15:1, 2.4-15:1, 2.5-15:1, 2.6-15:1, 2.7-15:1, 2.8-15:1, 2.9-15:1, 3-15:1, 3.5-15:1, 4-15:1, 4.5-15:1, 5-15:1, 6-15:1, 7-15:1, 8-15:1, 9-15:1, 10-15:1, 11-15:1, 12-15:1, 13-15:1, 14-15:1, 0.1-12:1, 0.2-12:1, 0.3-12:1, 0.4-12:1, 0.5-12:1, 0.6-12:1, 0.7-12:1, 0.8-12:1, 0.9-12:1, 1-12:1, 1.1-12:1, 1.2-12:1, 1.3-12:1, 1.4-12:1, 1.5-12:1, 1.6-12:1, 1.7-12:1, 1.8-12:1, 1.9-12:1, 2-12:1, 2.1-12:1, 2.2-12:1, 2.3-12:1, 2.4-12:1, 2.5-12:1, 2.6-12:1, 2.7-12:1, 2.8-12:1, 2.9-12:1, 3-12:1, 3.5-12:1, 4-12:1, 4.5-12:1, 5-12:1, 6-12:1, 7-12:1, 8-12:1, 9-12:1, 10-12:1, 11-12:1, 0.1-10:1, 0.2-10:1, 0.3-10:1, 0.4-10:1, 0.5-10:1, 0.6-10:1, 0.7-10:1, 0.8-10:1, 0.9-10:1, 1-10:1, 1.1-10:1, 1.2-10:1, 1.3-10:1, 1.4-10:1, 1.5-10:1, 1.6-10:1, 1.7-10:1, 1.8-10:1, 1.9-10:1, 2-10:1, 2.1-10:1, 2.2-10:1, 2.3-10:1, 2.4-10:1, 2.5-10:1, 2.6-10:1, 2.7-10:1, 2.8-10:1, 2.9-10:1, 3-10:1, 3.5-10:1, 4-10:1, 4.5-10:1, 5-10:1, 6-10:1, 7-10:1, 8-10:1, 9-10:1, 0.1-8:1, 0.2-8:1, 0.3-8:1, 0.4-8:1, 0.5-8:1, 0.6-8:1, 0.7-8:1, 0.8-8:1, 0.9-8:1, 1-8:1, 1.1-8:1, 1.2-8:1, 1.3-8:1, 1.4-8:1, 1.5-8:1, 1.6-8:1, 1.7-8:1, 1.8-8:1, 1.9-8:1, 2-8:1, 2.1-8:1, 2.2-8:1, 2.3-8:1, 2.4-8:1, 2.5-8:1, 2.6-8:1, 2.7-8:1, 2.8-8:1, 2.9-8:1, 3-8:1, 3.5-8:1, 4-8:1, 4.5-8:1, 5-8:1, 6-8:1, 7-8:1, 0.1-7:1, 0.2-7:1, 0.3-7:1, 0.4-7:1, 0.5-7:1, 0.6-7:1, 0.7-7:1, 0.8-7:1, 0.9-7:1, 1-7:1, 1.1-7:1, 1.2-7:1, 1.3-7:1, 1.4-7:1, 1.5-7:1, 1.6-7:1, 1.7-7:1, 1.8-7:1, 1.9-7:1, 2-7:1, 2.1-7:1, 2.2-7:1, 2.3-7:1, 2.4-7:1, 2.5-7:1, 2.6-7:1, 2.7-7:1, 2.8-7:1, 2.9-7:1, 3-7:1, 3.5-7:1, 4-7:1, 4.5-7:1, 5-7:1, 6-7:1, 0.1-6:1, 0.2-6:1, 0.3-6:1, 0.4-6:1, 0.5-6:1, 0.6-6:1, 0.7-6:1, 0.8-6:1, 0.9-6:1, 1-6:1, 1.1-6:1, 1.2-6:1, 1.3-6:1, 1.4-6:1, 1.5-6:1, 1.6-6:1, 1.7-6:1, 1.8-6:1, 1.9-6:1, 2-6:1, 2.1-6:1, 2.2-6:1, 2.3-6:1, 2.4-6:1, 2.5-6:1, 2.6-6:1, 2.7-6:1, 2.8-6:1, 2.9-6:1, 3-6:1, 3.5-6:1, 4-6:1, 4.5-6:1, 5-6:1, 0.1-5:1, 0.2-5:1, 0.3-5:1, 0.4-5:1, 0.5-5:1, 0.6-5:1, 0.7-5:1, 0.8-5:1, 0.9-5:1, 1-5:1, 1.1-5:1, 1.2-5:1, 1.3-5:1, 1.4-5:1, 1.5-5:1, 1.6-5:1, 1.7-5:1, 1.8-5:1, 1.9-5:1, 2-5:1, 2.1-5:1, 2.2-5:1, 2.3-5:1, 2.4-5:1, 2.5-5:1, 2.6-5:1, 2.7-5:1, 2.8-5:1, 2.9-5:1, 3-5:1, 3.5-5:1, 4-5:1, 4.5-5:1, 0.1:1, 0.2:1, 0.3:1, 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2:1, 2.1:1, 2.2:1, 2.3:1, 2.4:1, 2.5:1, 2.6:1, 2.7:1, 2.8:1, 2.9:1, 3:1, 3.5:1, 4:1, 4.5:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 또는 15:1인 것이다. In one embodiment of the present invention, the molar ratio of the phosphatidylcholine and the sterol-based compound is 0.1-15:1. More specifically, the phosphatidylcholine and the sterol-based compound have a molar ratio thereof of 0.1-15:1, 0.2-15:1, 0.3-15:1, 0.4-15:1, 0.5-15:1, 0.6-15:1, 0.7-15:1, 0.8-15:1, 0.9-15:1, 1-15:1, 1.1-15:1, 1.2-15:1, 1.3-15:1, 1.4-15:1, 1.5- 15:1, 1.6-15:1, 1.7-15:1, 1.8-15:1, 1.9-15:1, 2-15:1, 2.1-15:1, 2.2-15:1, 2.3-15: 1, 2.4-15:1, 2.5-15:1, 2.6-15:1, 2.7-15:1, 2.8-15:1, 2.9-15:1, 3-15:1, 3.5-15:1, 4-15:1, 4.5-15:1, 5-15:1, 6-15:1, 7-15:1, 8-15:1, 9-15:1, 10-15:1, 11- 15:1, 12-15:1, 13-15:1, 14-15:1, 0.1-12:1, 0.2-12:1, 0.3-12:1, 0.4-12:1, 0.5-12: 1, 0.6-12:1, 0.7-12:1, 0.8-12:1, 0.9-12:1, 1-12:1, 1.1-12:1, 1.2-12:1, 1.3-12:1, 1.4-12:1, 1.5-12:1, 1.6-12:1, 1.7-12:1, 1.8-12:1, 1.9-12:1, 2-12:1, 2.1-12:1, 2.2- 12:1, 2.3-12:1, 2.4-12:1, 2.5-12:1, 2.6-12:1, 2.7-12:1, 2.8-12:1, 2.9-12:1, 3-12: 1, 3.5-12:1, 4-12:1, 4.5-12:1, 5-12:1, 6-12:1, 7-12:1, 8-12:1, 9-12:1, 10-12:1, 11-12:1, 0.1-10:1, 0.2-10:1, 0.3-10:1, 0.4-10:1, 0.5-10:1, 0.6-10:1, 0.7- 10:1, 0.8-10:1, 0.9-10:1, 1-10:1, 1.1-10:1, 1.2-10:1, 1.3-10:1, 1.4-10:1, 1.5-10: 1, 1.6-10:1, 1.7-10:1, 1.8-1 0:1, 1.9-10:1, 2-10:1, 2.1-10:1, 2.2-10:1, 2.3-10:1, 2.4-10:1, 2.5-10:1, 2.6-10: 1, 2.7-10:1, 2.8-10:1, 2.9-10:1, 3-10:1, 3.5-10:1, 4-10:1, 4.5-10:1, 5-10:1, 6-10:1, 7-10:1, 8-10:1, 9-10:1, 0.1-8:1, 0.2-8:1, 0.3-8:1, 0.4-8:1, 0.5- 8:1, 0.6-8:1, 0.7-8:1, 0.8-8:1, 0.9-8:1, 1-8:1, 1.1-8:1, 1.2-8:1, 1.3-8: 1, 1.4-8:1, 1.5-8:1, 1.6-8:1, 1.7-8:1, 1.8-8:1, 1.9-8:1, 2-8:1, 2.1-8:1, 2.2-8:1, 2.3-8:1, 2.4-8:1, 2.5-8:1, 2.6-8:1, 2.7-8:1, 2.8-8:1, 2.9-8:1, 3- 8:1, 3.5-8:1, 4-8:1, 4.5-8:1, 5-8:1, 6-8:1, 7-8:1, 0.1-7:1, 0.2-7: 1, 0.3-7:1, 0.4-7:1, 0.5-7:1, 0.6-7:1, 0.7-7:1, 0.8-7:1, 0.9-7:1, 1-7:1, 1.1-7:1, 1.2-7:1, 1.3-7:1, 1.4-7:1, 1.5-7:1, 1.6-7:1, 1.7-7:1, 1.8-7:1, 1.9- 7:1, 2-7:1, 2.1-7:1, 2.2-7:1, 2.3-7:1, 2.4-7:1, 2.5-7:1, 2.6-7:1, 2.7-7: 1, 2.8-7:1, 2.9-7:1, 3-7:1, 3.5-7:1, 4-7:1, 4.5-7:1, 5-7:1, 6-7:1, 0.1-6:1, 0.2-6:1, 0.3-6:1, 0.4-6:1, 0.5-6:1, 0.6-6:1, 0.7-6:1, 0.8-6:1, 0.9- 6:1, 1-6:1, 1.1-6:1, 1.2-6:1, 1.3-6:1, 1.4-6:1, 1.5-6:1, 1.6-6:1, 1.7-6: 1, 1.8-6:1, 1.9-6:1, 2-6:1, 2.1-6:1, 2.2-6:1, 2.3- 6:1, 2.4-6:1, 2.5-6:1, 2.6-6:1, 2.7-6:1, 2.8-6:1, 2.9-6:1, 3-6:1, 3.5-6: 1, 4-6:1, 4.5-6:1, 5-6:1, 0.1-5:1, 0.2-5:1, 0.3-5:1, 0.4-5:1, 0.5-5:1, 0.6-5:1, 0.7-5:1, 0.8-5:1, 0.9-5:1, 1-5:1, 1.1-5:1, 1.2-5:1, 1.3-5:1, 1.4- 5:1, 1.5-5:1, 1.6-5:1, 1.7-5:1, 1.8-5:1, 1.9-5:1, 2-5:1, 2.1-5:1, 2.2-5: 1, 2.3-5:1, 2.4-5:1, 2.5-5:1, 2.6-5:1, 2.7-5:1, 2.8-5:1, 2.9-5:1, 3-5:1, 3.5-5:1, 4-5:1, 4.5-5:1, 0.1:1, 0.2:1, 0.3:1, 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2:1, 2.1: 1, 2.2:1, 2.3:1, 2.4:1, 2.5:1, 2.6:1, 2.7:1, 2.8:1, 2.9:1, 3:1, 3.5:1, 4:1, 4.5:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or 15:1.

본 발명의 일 구현예에 있어서, 상기 포스파티딜콜린 및 스테롤계 화합물을 포함하는 지질 및 로틀레린은 중량비가 0.1-150:1인 것이다. 보다 구체적으로 지질 및 로틀레린은 이의 중량비가 0.1-150:1, 0.2-150:1, 0.3-150:1, 0.4-150:1, 0.5-150:1, 0.6-150:1, 0.7-150:1, 0.8-150:1, 0.9-150:1, 1-150:1, 1.5-150:1, 2-150:1, 3-150:1, 4-150:1, 5-150:1, 6-150:1, 7-150:1, 8-150:1, 9-150:1, 10-150:1, 15-150:1, 20-150:1, 25-150:1, 30-150:1, 35-150:1, 40-150:1, 45-150:1, 50-150:1, 55-150:1, 60-150:1, 70-150:1, 80-150:1, 90-150:1, 95-150:1, 100-150:1, 110-150:1, 115-150:1, 120-150:1, 125-150:1, 130-150:1, 135-150:1, 140-150:1, 145-150:1, 0.1-140:1, 0.2-140:1, 0.3-140:1, 0.4-140:1, 0.5-140:1, 0.6-140:1, 0.7-140:1, 0.8-140:1, 0.9-140:1, 1-140:1, 1.5-140:1, 2-140:1, 3-140:1, 4-140:1, 5-140:1, 6-140:1, 7-140:1, 8-140:1, 9-140:1, 10-140:1, 15-140:1, 20-140:1, 25-140:1, 30-140:1, 35-140:1, 40-140:1, 45-140:1, 50-140:1, 55-140:1, 60-140:1, 70-140:1, 80-140:1, 90-140:1, 95-140:1, 100-140:1, 110-140:1, 115-140:1, 120-140:1, 125-140:1, 130-140:1, 135-140:1, 0.1-130:1, 0.2-130:1, 0.3-130:1, 0.4-130:1, 0.5-130:1, 0.6-130:1, 0.7-130:1, 0.8-130:1, 0.9-130:1, 1-130:1, 1.5-130:1, 2-130:1, 3-130:1, 4-130:1, 5-130:1, 6-130:1, 7-130:1, 8-130:1, 9-130:1, 10-130:1, 15-130:1, 20-130:1, 25-130:1, 30-130:1, 35-130:1, 40-130:1, 45-130:1, 50-130:1, 55-130:1, 60-130:1, 70-130:1, 80-130:1, 90-130:1, 95-130:1, 100-130:1, 110-130:1, 115-130:1, 120-130:1, 125-130:1, 0.1-120:1, 0.2-120:1, 0.3-120:1, 0.4-120:1, 0.5-120:1, 0.6-120:1, 0.7-120:1, 0.8-120:1, 0.9-120:1, 1-120:1, 1.5-120:1, 2-120:1, 3-120:1, 4-120:1, 5-120:1, 6-120:1, 7-120:1, 8-120:1, 9-120:1, 10-120:1, 15-120:1, 20-120:1, 25-120:1, 30-120:1, 35-120:1, 40-120:1, 45-120:1, 50-120:1, 55-120:1, 60-120:1, 70-120:1, 80-120:1, 90-120:1, 95-120:1, 100-120:1, 110-120:1, 115-120:1, 0.1-110:1, 0.2-110:1, 0.3-110:1, 0.4-110:1, 0.5-110:1, 0.6-110:1, 0.7-110:1, 0.8-110:1, 0.9-110:1, 1-110:1, 1.5-110:1, 2-110:1, 3-110:1, 4-110:1, 5-110:1, 6-110:1, 7-110:1, 8-110:1, 9-110:1, 10-110:1, 15-110:1, 20-110:1, 25-110:1, 30-110:1, 35-110:1, 40-110:1, 45-110:1, 50-110:1, 55-110:1, 60-110:1, 70-110:1, 80-110:1, 90-110:1, 95-110:1, 100-110:1, 0.1-105:1, 0.2-105:1, 0.3-105:1, 0.4-105:1, 0.5-105:1, 0.6-105:1, 0.7-105:1, 0.8-105:1, 0.9-105:1, 1-105:1, 1.5-105:1, 2-105:1, 3-105:1, 4-105:1, 5-105:1, 6-105:1, 7-105:1, 8-105:1, 9-105:1, 10-105:1, 15-105:1, 20-105:1, 25-105:1, 30-105:1, 35-105:1, 40-105:1, 45-105:1, 50-105:1, 55-105:1, 60-105:1, 70-105:1, 80-105:1, 90-105:1, 95-105:1, 100-105:1, 0.1-100:1, 0.2-100:1, 0.3-100:1, 0.4-100:1, 0.5-100:1, 0.6-100:1, 0.7-100:1, 0.8-100:1, 0.9-100:1, 1-100:1, 1.5-100:1, 2-100:1, 3-100:1, 4-100:1, 5-100:1, 6-100:1, 7-100:1, 8-100:1, 9-100:1, 10-100:1, 15-100:1, 20-100:1, 25-100:1, 30-100:1, 35-100:1, 40-100:1, 45-100:1, 50-100:1, 55-100:1, 60-100:1, 70-100:1, 80-100:1, 90-100:1, 95-100:1, 0.1-95:1, 0.2-95:1, 0.3-95:1, 0.4-95:1, 0.5-95:1, 0.6-95:1, 0.7-95:1, 0.8-95:1, 0.9-95:1, 1-95:1, 1.5-95:1, 2-95:1, 3-95:1, 4-95:1, 5-95:1, 6-95:1, 7-95:1, 8-95:1, 9-95:1, 10-95:1, 15-95:1, 20-95:1, 25-95:1, 30-95:1, 35-95:1, 40-95:1, 45-95:1, 50-95:1, 55-95:1, 60-95:1, 70-95:1, 80-95:1, 또는 90-95:1 이나, 이에 한정되는 것은 아니다.In one embodiment of the present invention, the weight ratio of the lipid and rotlerin comprising the phosphatidylcholine and the sterol-based compound is 0.1-150:1. More specifically, lipid and rotlerin have a weight ratio of 0.1-150:1, 0.2-150:1, 0.3-150:1, 0.4-150:1, 0.5-150:1, 0.6-150:1, 0.7-150 :1, 0.8-150:1, 0.9-150:1, 1-150:1, 1.5-150:1, 2-150:1, 3-150:1, 4-150:1, 5-150:1 , 6-150:1, 7-150:1, 8-150:1, 9-150:1, 10-150:1, 15-150:1, 20-150:1, 25-150:1, 30 -150:1, 35-150:1, 40-150:1, 45-150:1, 50-150:1, 55-150:1, 60-150:1, 70-150:1, 80-150 :1, 90-150:1, 95-150:1, 100-150:1, 110-150:1, 115-150:1, 120-150:1, 125-150:1, 130-150:1 , 135-150:1, 140-150:1, 145-150:1, 0.1-140:1, 0.2-140:1, 0.3-140:1, 0.4-140:1, 0.5-140:1, 0.6 -140:1, 0.7-140:1, 0.8-140:1, 0.9-140:1, 1-140:1, 1.5-140:1, 2-140:1, 3-140:1, 4-140 :1, 5-140:1, 6-140:1, 7-140:1, 8-140:1, 9-140:1, 10-140:1, 15-140:1, 20-140:1 , 25-140:1, 30-140:1, 35-140:1, 40-140:1, 45-140:1, 50-140:1, 55-140:1, 60-140:1, 70 -140:1, 80-140:1, 90-140:1, 95-140:1, 100-140:1, 110-140:1, 115-140:1, 120-140:1, 125-140 :1, 130-140:1, 135-140:1, 0.1-130:1, 0.2-130:1, 0.3-130:1, 0.4-130:1, 0.5-130:1, 0.6-130:1 , 0.7-130:1, 0.8-130:1, 0.9-130:1, 1-130:1, 1.5-13 0:1, 2-130:1, 3-130:1, 4-130:1, 5-130:1, 6-130:1, 7-130:1, 8-130:1, 9-130: 1, 10-130:1, 15-130:1, 20-130:1, 25-130:1, 30-130:1, 35-130:1, 40-130:1, 45-130:1, 50-130:1, 55-130:1, 60-130:1, 70-130:1, 80-130:1, 90-130:1, 95-130:1, 100-130:1, 110- 130:1, 115-130:1, 120-130:1, 125-130:1, 0.1-120:1, 0.2-120:1, 0.3-120:1, 0.4-120:1, 0.5-120: 1, 0.6-120:1, 0.7-120:1, 0.8-120:1, 0.9-120:1, 1-120:1, 1.5-120:1, 2-120:1, 3-120:1, 4-120:1, 5-120:1, 6-120:1, 7-120:1, 8-120:1, 9-120:1, 10-120:1, 15-120:1, 20- 120:1, 25-120:1, 30-120:1, 35-120:1, 40-120:1, 45-120:1, 50-120:1, 55-120:1, 60-120: 1, 70-120:1, 80-120:1, 90-120:1, 95-120:1, 100-120:1, 110-120:1, 115-120:1, 0.1-110:1, 0.2-110:1, 0.3-110:1, 0.4-110:1, 0.5-110:1, 0.6-110:1, 0.7-110:1, 0.8-110:1, 0.9-110:1, 1- 110:1, 1.5-110:1, 2-110:1, 3-110:1, 4-110:1, 5-110:1, 6-110:1, 7-110:1, 8-110: 1, 9-110:1, 10-110:1, 15-110:1, 20-110:1, 25-110:1, 30-110:1, 35-110:1, 40-110:1, 45-110:1, 50-110:1, 55-110:1, 60-110:1, 70-110:1, 80-110:1, 90-110:1, 95-110:1, 100 -110:1, 0.1-105:1, 0.2-105:1, 0.3-105:1, 0.4-105:1, 0.5-105:1, 0.6-105:1, 0.7-105:1, 0.8-105 :1, 0.9-105:1, 1-105:1, 1.5-105:1, 2-105:1, 3-105:1, 4-105:1, 5-105:1, 6-105:1 , 7-105:1, 8-105:1, 9-105:1, 10-105:1, 15-105:1, 20-105:1, 25-105:1, 30-105:1, 35 -105:1, 40-105:1, 45-105:1, 50-105:1, 55-105:1, 60-105:1, 70-105:1, 80-105:1, 90-105 :1, 95-105:1, 100-105:1, 0.1-100:1, 0.2-100:1, 0.3-100:1, 0.4-100:1, 0.5-100:1, 0.6-100:1 , 0.7-100:1, 0.8-100:1, 0.9-100:1, 1-100:1, 1.5-100:1, 2-100:1, 3-100:1, 4-100:1, 5 -100:1, 6-100:1, 7-100:1, 8-100:1, 9-100:1, 10-100:1, 15-100:1, 20-100:1, 25-100 :1, 30-100:1, 35-100:1, 40-100:1, 45-100:1, 50-100:1, 55-100:1, 60-100:1, 70-100:1 , 80-100:1, 90-100:1, 95-100:1, 0.1-95:1, 0.2-95:1, 0.3-95:1, 0.4-95:1, 0.5-95:1, 0.6 -95:1, 0.7-95:1, 0.8-95:1, 0.9-95:1, 1-95:1, 1.5-95:1, 2-95:1, 3-95:1, 4-95 :1, 5-95:1, 6-95:1, 7-95:1, 8-95:1, 9-95:1, 10-95:1, 15-95:1, 20-95:1 , 25-95:1, 30-95:1, 35-95:1, 40-95:1, 45-95:1, 50-95:1, 55-95:1, 60-95:1, 70 -95:1, 80-95:1, or 90-95:1 However, the present invention is not limited thereto.

본 발명의 일 구현예에 있어서, 상기 포스파티딜콜린은 수소화된 대두 포스파티딜콜린(hydrogenated soy phosphatidylcholine, HSPC), 1,2-디미리스토일-sn-글리세로-3-포스포콜린(1,2-Dimyristoyl-sn-Glycero-3-Phosphocholine, DMPC), 1,2-디헥사노일-sn-글리세로-3-포스포콜린(1,2-dihexanoyl-sn-glycero-3-phosphocholine, DHPC), 1,2-디헵타노일-sn-글리세로-3-포스포콜린(1,2-diheptanoyl-sn-glycero-3-phosphocholine), 1,2-디옥타노일-sn-글리세로-3-포스포콜린(1,2-dioctanoyl-sn-glycero-3-phosphocholine, 1,2-dinonanoyl-sn-glycero-3-phosphocholine), 1,2-디데카노일-sn-글리세로-3-포스포콜린(1,2-didecanoyl-sn-glycero-3-phosphocholine), 1,2-디운데카노일-sn-글리세로-3-포스포콜린(1,2-diundecanoyl-sn-glycero-3-phosphocholine), 1,2-디라우로일-sn-글리세로-3-포스포콜린(1,2-dilauroyl-snglycero-3-phosphocholine, DLPC), 1,2-디트리데카노일-sn-글리세로-3-포스포콜린(1,2-ditridecanoyl-snglycero-3-phosphocholine), 1,2-디펜타데카노일-sn-글리세로-3-포스포콜린(1,2-dipentadecanoyl-sn-glycero-3-phosphocholine), 1,2-디팔미토일-sn-글리세로-3-포스포콜린(1,2-dipalmitoyl-sn-glycero-3-phosphocholine, DPPC), 1,2-디헵타데카노일-sn-글리세로-3-포스포콜린(1,2-diheptadecanoyl-sn-glycero-3-phosphocholine) 및 1,2-디스테아로일-sn-글리세로-3-포스포콜린(1,2-distearoyl-sn-glycero-3-phosphocholine, DSPC)으로 이루어지는 군으로부터 선택되는 것이다. In one embodiment of the present invention, the phosphatidylcholine is hydrogenated soy phosphatidylcholine (HSPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (1,2-Dimyristoyl- sn-Glycero-3-Phosphocholine, DMPC), 1,2-dihexanoyl-sn-glycero-3-phosphocholine (1,2-dihexanoyl-sn-glycero-3-phosphocholine, DHPC), 1,2 -diheptanoyl-sn-glycero-3-phosphocholine (1,2-diheptanoyl-sn-glycero-3-phosphocholine), 1,2-dioctanoyl-sn-glycero-3-phosphocholine ( 1,2-dioctanoyl-sn-glycero-3-phosphocholine, 1,2-dinonanoyl-sn-glycero-3-phosphocholine), 1,2-didecanoyl-sn-glycero-3-phosphocholine (1, 2-didecanoyl-sn-glycero-3-phosphocholine), 1,2-diundecanoyl-sn-glycero-3-phosphocholine (1,2-diundecanoyl-sn-glycero-3-phosphocholine), 1, 2-dilauroyl-sn-glycero-3-phosphocholine (1,2-dilauroyl-snglycero-3-phosphocholine, DLPC), 1,2-ditridecanoyl-sn-glycero-3-phospho Forcholine (1,2-ditridecanoyl-snglycero-3-phosphocholine), 1,2-dipentadecanoyl-sn-glycero-3-phosphocholine (1,2-dipentadecanoyl-sn-glycero-3-phosphocholine) , 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (1,2-dipalmitoyl-sn-glycero-3-phosphocholine, DPPC), 1,2-diheptadecanoyl-sn-glycero -3-phosphocholine (1,2-diheptadecanoyl-sn-glycero-3-phosphocholine) and 1,2-distearoyl-sn-glycero-3-phosphocholine (1,2-diste aroyl-sn-glycero-3-phosphocholine, DSPC).

본 발명의 실시예에 따르면, 상기 포스파티딜콜린은 수소화된 대두 포스파티딜콜린(hydrogenated soy phosphatidylcholine, HSPC)이다. According to an embodiment of the present invention, the phosphatidylcholine is hydrogenated soy phosphatidylcholine (HSPC).

본 발명의 일 구현예에 있어서, 상기 스테롤계 화합물은 콜레스테롤, 3b-[N-(N',N'-디메틸아미노에탄)-카바밀}콜레스테롤(3b-[N-(N',N'-dimethylaminoethane)-cabamyl]cholesterol, DC-Chol), 스티그마스테롤(stigmasterol), 캄페스테롤(campesterol), 시토스테롤(sitosterol), 에르고스테롤(ergosterol), 라노스테롤(lanosterol), 디노스테롤(dinosterol), 고르고스테롤(gorgosterol), 아베나스테롤(avenasterol), 사린고스테롤(saringosterol), 퓨코스테롤(fucosterol), 콜레스테릴 헤미석시네이트(cholesteryl hemisuccinate), 콜레스테릴 벤조에이트(cholesteryl benzoate), 콜레스테릴 올레이트(cholesteryl oleate), 콜레스테릴 올레일 카보네이트(cholesteryl oleyl carbonate), 콜레스테릴 이소스테아레이트(cholesteryl isostearate), 콜레스테릴 리놀레이트(cholesteryl linoleate), 콜레스테릴 아세테이트(cholesteryl acetate), 콜레스테릴 팔미테이트(cholesteryl palmitate), 콜레스테릴 스테아레이트(cholesteryl stearate), 콜레스테릴 클로라이드(Cholesteryl chloride), 콜레스테릴 노나노에이트(Cholesteryl nonanoate) 및 콜레스테릴 아라키도네이트(Cholesteryl arachidonate)로 이루어지는 군으로부터 선택되는 것이다. In one embodiment of the present invention, the sterol-based compound is cholesterol, 3b-[N-(N',N'-dimethylaminoethane)-carbamyl}cholesterol (3b-[N-(N',N'-) dimethylaminoethane)-cabamyl]cholesterol, DC-Chol), stigmasterol, campesterol, sitosterol, ergosterol, lanosterol, dinosterol, gorgosterol ( gogosterol), avenasterol, saringosterol, fucosterol, cholesteryl hemisuccinate, cholesteryl benzoate, cholesteryl ol cholesteryl oleate, cholesteryl oleyl carbonate, cholesteryl isostearate, cholesteryl linoleate, cholesteryl acetate, cholester consisting of cholesteryl palmitate, cholesteryl stearate, cholesteryl chloride, cholesteryl nonanoate and cholesteryl arachidonate is selected from the group.

본 발명의 일 구현예에 있어서, 상기 바이러스는 버니아비리데(Bunyaviridae) 과, 아테리비리데(Arteriviridae) 과, 코로나비리데(Coronaviridae) 과, 필로비리데(Filoviridae) 과, 플라비비리데(Flaviviridae) 과, 헤파드나비리데(Hepadnaviridae) 과, 오르소믹소비리데(Orthomyxoviridae) 과, 폭스비리데(Poxviridae) 과, 랍도비리데(Rhabdoviridae) 과, 레트로비리데(Retroviridae) 과, 토가비리데(Togaviridae) 과 및 헤르페스비리데(Herpesviridae) 과로 이루어지는 군으로부터 선택되는 과에 속하는 바이러스인 것이다. In one embodiment of the present invention, the virus is a Bunyaviridae family, Arteriviridae family, Coronaviridae family, Filoviridae family, Flaviviridae ( Flaviviridae), Hepadnaviridae, Orthomyxoviridae, Poxviridae, Rhabdoviridae, Retroviridae, Togaviridae It is a virus belonging to the family selected from the group consisting of the family Togaviridae and the family Herpesviridae.

보다 구체적으로 상기 바이러스는 버니아비리데(Bunyaviridae) 과에 속하는 시놈브레한타바이러스(Sin Nombre Hantavirus) 등; 아테리비리데(Arteriviridae) 과에 속하는 돼지생식기호흡기증후군 바이러스 등; 코로나비리데(Coronaviridae)과에 속하는 다양한 급성 호흡기 증후군에 관여하는 코로나바이러스(Coronavirus) 등; 필로비리데(Filoviridae)과에 속하는 에볼라 바이러스(Ebola virus), 마르버그 바이러스(Marburg virus) 등; 플라비비리데(Flaviviridae) 과에 속하는 웨스트 나일 바이러스(West Nile virus), 엘로우 피버 바이러스(Yellow Fever virus), 뎅기 피버 바이러스(Dengue Fever virus), C형 간염 바이러스(Hepatitis C virus) 등; 헤파드나비리데(Hepadnaviridae) 과에 속하는 B형 간염 바이러스(Hepatitis B) 등; 오르소믹소비리데(Orthomyxoviridae) 과에 속하는 인플루엔자 바이러스(Influenza virus) 등; 폭스비리데(Poxviridae) 과에 속하는 스몰폭스 바이러스(Smallpox virus), 백시니아 바이러스(Vaccinia virus), 몰루스컴 콘타지오섬 바이러스(Molluscum contagiosum virus), 멍키폭스 바이러스(Monkeypox virus) 등; 랍도비리데(Rhabdoviridae) 과에 속하는 수포성 구내염 바이러스(Vesicular stomatitis virus) 등; 레트로비리데(Retroviridae) 과에 속하는 HIV(Human Immunodeficiency virus) 등; 토가비리데(Togaviridae) 과에 속하는 치컹구니아 바이러스(Chikungunya virus) 등; 헤르페스비리데(Herpesviridae) 과에 속하는 헤르페스 심플렉스 1 바이러스(Herpes Simplex 1 virus), 헤르페스 심플렉스 2 바이러스(Herpes Simplex 2 virus), 수도래이비스 바이러스(Pseudorabies virus), 인간 헤르페스바이러스(Human Herpes virus, HHV) 등이 될 수 있다. More specifically, the virus may include Sin Nombre Hantavirus, etc. belonging to the Bunyaviridae family; Porcine reproductive and respiratory syndrome virus, etc. belonging to the Arteriviridae family; Coronaviruses involved in various acute respiratory syndromes belonging to the Coronaviridae family, and the like; Ebola virus, Marburg virus, etc. belonging to the family Filoviridae; West Nile virus, Yellow Fever virus, Dengue Fever virus, Hepatitis C virus, etc. belonging to the Flaviviridae family; Hepatitis B belonging to the family Hepadnaviridae and the like; Influenza virus belonging to the family Orthomyxoviridae and the like; Smallpox virus, Vaccinia virus, Molluscum contagiosum virus, Monkeypox virus, etc. belonging to the family Poxviridae; Vesicular stomatitis virus belonging to the family Rhabdoviridae and the like; HIV (Human Immunodeficiency virus), etc. belonging to the retroviridae family; Chikungunya virus belonging to the family Togaviridae and the like; Herpes Simplex 1 virus, Herpes Simplex 2 virus, Pseudorabies virus, Human Herpes virus, belonging to the Herpesviridae family; HHV) and the like.

본 발명의 일 구현예에 있어서, 상기 바이러스 감염증이란 바이러스가 동물이나 인간의 몸 안에 침입하여 기관이나 조직에서 증식한 결과로 생기는 질병으로, 그 예로는 버니아비리데 과의 바이러스의 감염에 의하여 발병되는 신증후근성출혈열(유행성출혈열); 아테리비리데과의 바이러스 감염에 의하여 발병되는 돼지생식기호흡기 증후군; 코로나비리데 과의 바이러스의 감염에 의하여 발병되는 코감기 등 호흡기 질환 또는 코로나바이러스 감염증; 플라비비리데 과의 바이러스의 감염에 의하여 발병되는 C형 간염; 헤파드나비리데 과의 바이러스의 감염에 의하여 발병되는 B형 간염; 헤르페스비리데 과의 바이러스의 감염에 의하여 발병되는 대상포진; 오르소믹소비리데 과의 바이러스의 감염에 의하여 발병되는 독감 또는 인플루엔자 바이러스 감염증; 폭스비리데 과의 바이러스의 감염에 의하여 발병되는 천연두; 랍도비리데 과의 바이러스의 감염에 의하여 발병되는 광견병 또는 수포성 구내염; 레트로비리데과의 바이러스의 감염에 의하여 발병되는 후천성 면역결핍증 등이 될 수 있고, 다른 예로서, 오르소믹소비리데과에 속하는 인플루엔자 바이러스의 감염에 의하여 발병되는 독감 또는 인플루엔자 바이러스 감염증이 있다. In one embodiment of the present invention, the viral infection is a disease caused by a virus invading into an animal or human body and multiplying in an organ or tissue, for example, it is caused by infection with a virus of the family Verniaviridae. Nephrotic Syndrome Hemorrhagic Fever (epidemic hemorrhagic fever); porcine reproductive and respiratory syndrome caused by viral infection of the family Ateribiridae; Respiratory diseases such as nasal cold or coronavirus infection caused by infection with a virus of the coronaviride family; hepatitis C caused by infection with a virus of the family Flaviviridae; hepatitis B caused by infection with a virus of the family Hepadnaviridae; herpes zoster caused by infection with a virus of the herpesviridae family; influenza or influenza virus infection caused by infection with a virus of the family Orthomyxoviridae; smallpox caused by infection with a virus of the family poxviridae; Rabies or bullous stomatitis caused by infection with a virus of the family Rhabdoviridae; It may be acquired immunodeficiency syndrome or the like caused by infection with a virus of the family Retroviridae, and as another example, there is influenza or influenza virus infection caused by infection with an influenza virus belonging to the family Orthomyxoviridae.

본 발명의 일 구현예에 있어서, 상기 바이러스 감염증은 돼지생식기호흡기 증후군, 돼지 유행성 설사, 돼지 전염성 위장염, 돼지 혈구 응집성 뇌척수염 및 돼지 호흡기 코로나 바이러스 감염증으로 이루어지는 군에서 선택되는 것이다. In one embodiment of the present invention, the viral infection is selected from the group consisting of porcine reproductive and respiratory syndrome, porcine epidemic diarrhea, swine infectious gastroenteritis, porcine hemagglutinating encephalomyelitis, and porcine respiratory coronavirus infection.

본 발명의 일 구현예에 있어서, 상기 바이러스는 돼지생식기호흡기증후군 바이러스 또는 코로나 바이러스인 것이다. In one embodiment of the present invention, the virus is a porcine reproductive and respiratory syndrome virus or corona virus.

본 명세서상의 용어 "돼지생식기호흡기증후군"은 양성-가닥(positive-strand) RNA 바이러스로, 아테리비리데 (Arteriviridae)에 속하는 바이러스인 돼지생식기호흡기증후군 바이러스에 의해 발생하는 질병을 의미한다. 돼지생식기호흡기증후군 바이러스는 약 15 kb의 RNA 게놈을 가지고 있으며, 9개의 ORFs(open reading frames)을 코딩한다. 주된 구조 단백질(major structure protein)로 ORF 5, 6, 7이 코딩하는 GP5, M, N이 있다. GP5 단백질은 25 kDa의 외피 단백질로서 강력한 중화능을 유도한다. M 단백질은 18 kDa의 매트릭스 단백질로서 세포성 면역반응을 유도한다. As used herein, the term “porcine reproductive and respiratory syndrome” refers to a disease caused by a positive-strand RNA virus, which is a virus belonging to Arteriviridae. The porcine reproductive and respiratory syndrome virus has an RNA genome of about 15 kb and encodes 9 open reading frames (ORFs). There are GP5, M, and N encoded by ORFs 5, 6, and 7 as major structural proteins. GP5 protein is a 25 kDa envelope protein and induces strong neutralizing ability. The M protein is an 18 kDa matrix protein that induces a cellular immune response.

본 명세서 상의 용어 "코로나 바이러스"는 코로나바이러스과(Coronaviridae)의 코로나바이러스아과(Coronavirinae)에 속하는 RNA 바이러스로, 사람과 동물의 호흡기와 소화기계 감염을 유발하는 바이러스를 의미한다. 코로나바이러스의 스파이크 단백질(spike protein)은 숙주 및 조직 친화성(tropism)을 결정하며 수용체 결합 단백을 통해 숙주 세포막과 결합하여 세포 내로 침투한다. As used herein, the term "coronavirus" refers to an RNA virus belonging to the coronavirus subfamily (Coronavirinae) of the coronavirus family (Coronaviridae), and refers to a virus that causes respiratory and digestive system infections in humans and animals. The spike protein of the coronavirus determines host and tissue tropism, binds to the host cell membrane through a receptor-binding protein, and penetrates into the cell.

본 발명의 일 구현예에 있어서, 상기 코로나 바이러스는 코로나-19 바이러스(SARS-CoV-2), 돼지 유행성 설사 바이러스(porcine epidemic diarrhea virus: PEDV), 돼지 전염성 위장염 바이러스(transmissible gastroenteritis virus: TGEV), 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus: PHEV), 돼지 델타 코로나바이러스(Porcine deltacoronavirus: PDCoV), 개 코로나 바이러스(canine coronavirus: CCoV), 고양이 코로나 바이러스(feline coronavirus: FCoV, 또는 전염성복막염 바이러스), 우코로나 바이러스(bovine coronavirus: BCoV), 말코로나 바이러스(equine coronavirus: EqCoV), 쥐코로나 바이러스(murine coronavirus: MuCoV), 및 닭 전염성기관지염 바이러스(Infectious Bronchitis virus, IBV)fh 이루어진 군으로부터 선택된 바이러스이나, 이에 한정되는 것은 아니다. In one embodiment of the present invention, the coronavirus is Corona-19 virus (SARS-CoV-2), porcine epidemic diarrhea virus (PEDV), swine infectious gastroenteritis virus (TGEV), porcine hemagglutinating encephalomyelitis virus (PHEV), porcine deltacoronavirus (PDCoV), canine coronavirus (CCoV), feline coronavirus (FCoV, or infectious peritonitis virus), A virus selected from the group consisting of bovine coronavirus (BCoV), equine coronavirus (EqCoV), murine coronavirus (MuCoV), and chicken infectious bronchitis virus (IBV)fh, The present invention is not limited thereto.

본 발명의 실시예에 따르면, 상기 코로나 바이러스는 코로나-19 바이러스(SARS-CoV-2), 고양이 코로나 바이러스 또는 돼지 유행성 설사 바이러스(porcine epidemic diarrhea virus: PEDV)인 것이다. According to an embodiment of the present invention, the coronavirus is Corona-19 virus (SARS-CoV-2), feline coronavirus or porcine epidemic diarrhea virus (PEDV).

본 발명의 일 구현예에 있어서, 상기 조성물은 렘데시비르를 추가적으로 포함하는 것이다.In one embodiment of the present invention, the composition further comprises remdesivir.

본 발명의 실시예에 따르면, 본 발명의 조성물과 렘데시비르를 병용 투여하는 경우 본 발명의 조성물을 투여하는 것보다 우수한 항 바이러스 효과를 나타낸다. According to an embodiment of the present invention, when the composition of the present invention and remdesivir are administered in combination, the antiviral effect is superior to that of the composition of the present invention.

본 발명의 약제학적 조성물은 유효성분인 상기 조성물 외에 약제학적으로 허용되는 담체를 포함할 수 있다.The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier in addition to the composition as an active ingredient.

본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like. it's not going to be

본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like, in addition to the above components. Suitable pharmaceutically acceptable carriers and agents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 예컨대 척추강 내 투여, 정맥내 투여, 피하 투여, 피내 투여, 근육내 투여, 복강내 투여, 흉골 내 투여, 종양 내 투여, 비내 투여, 뇌내 투여, 두개골 내 투여, 폐내 투여 및 직장내 투여 등으로 투여할 수 있으나 이에 한정되는 것은 아니다.The pharmaceutical composition of the present invention may be administered orally or parenterally, for example, intrathecal administration, intravenous administration, subcutaneous administration, intradermal administration, intramuscular administration, intraperitoneal administration, intrasternal administration, intratumoral administration, intranasal administration , intracerebral administration, intracranial administration, intrapulmonary administration, rectal administration, etc., but is not limited thereto.

본 발명의 일 구현예에 있어서, 상기 약제학적 조성물은 비내 투여되는 것이다. In one embodiment of the present invention, the pharmaceutical composition is administered intranasally.

본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여방식, 대상의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 수의사 및 의사는 소망하는 치료 또는 예방에 효과적인 투여량(약제학적 유효량)을 용이하게 결정 및 처방할 수 있다. A suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration mode, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and reaction sensitivity of the subject, Ordinarily skilled veterinarians and physicians can readily determine and prescribe an effective dosage (a pharmaceutically effective amount) for the desired treatment or prophylaxis.

본 발명의 일 구현예에 있어서, 상기 약제학적 조성물의 투여량은 0.0001-100 mg/kg이다. In one embodiment of the present invention, the dosage of the pharmaceutical composition is 0.0001-100 mg/kg.

보다 구체적으로, 상기 약제학적 조성물의 투여량은 0.001-100 mg/kg, 0.005-100 mg/kg, 0.01-100 mg/kg, 0.1-100 mg/kg, 1-100 mg/kg, 5-100 mg/kg, 10-100 mg/kg, 0.001-50 mg/kg, 0.005-50 mg/kg, 0.01-50 mg/kg, 0.1-50 mg/kg, 1-50 mg/kg, 5-50 mg/kg, 10-50 mg/kg, 0.001-10 mg/kg, 0.005-10 mg/kg, 0.01-10 mg/kg, 0.1-10 mg/kg, 1-10 mg/kg, 5-10 mg/kg, 0.001-1 mg/kg, 0.005-1 mg/kg, 0.01-1 mg/kg, 0.1-1 mg/kg, 0.001-0.5 mg/kg, 0.005-0.5 mg/kg, 0.01-0.5 mg/kg, 0.1-0.5 mg/kg, 0.001-0.1 mg/kg, 0.005-0.1 mg/kg, 0.01-0.1 mg/kg, 0.001-0.05 mg/kg, 0.005-0.05 mg/kg, 또는 0.01-0.05 mg/kg이나 이에 한정되는 것은 아니다. More specifically, the dosage of the pharmaceutical composition is 0.001-100 mg/kg, 0.005-100 mg/kg, 0.01-100 mg/kg, 0.1-100 mg/kg, 1-100 mg/kg, 5-100 mg/kg, 10-100 mg/kg, 0.001-50 mg/kg, 0.005-50 mg/kg, 0.01-50 mg/kg, 0.1-50 mg/kg, 1-50 mg/kg, 5-50 mg /kg, 10-50 mg/kg, 0.001-10 mg/kg, 0.005-10 mg/kg, 0.01-10 mg/kg, 0.1-10 mg/kg, 1-10 mg/kg, 5-10 mg/kg kg, 0.001-1 mg/kg, 0.005-1 mg/kg, 0.01-1 mg/kg, 0.1-1 mg/kg, 0.001-0.5 mg/kg, 0.005-0.5 mg/kg, 0.01-0.5 mg/kg , 0.1-0.5 mg/kg, 0.001-0.1 mg/kg, 0.005-0.1 mg/kg, 0.01-0.1 mg/kg, 0.001-0.05 mg/kg, 0.005-0.05 mg/kg, or 0.01-0.05 mg/kg However, the present invention is not limited thereto.

본 명세서에서 용어 "약제학적 유효량"은 상술한 질환을 예방 또는 치료하는 데 충분한 양을 의미한다.As used herein, the term “pharmaceutically effective amount” refers to an amount sufficient to prevent or treat the above-mentioned diseases.

본 명세서에서 용어 “예방”은 질환 또는 질환 상태의 방지 또는 보호적인 치료를 의미한다. 본 명세서에서 용어 “치료”는 질환 상태의 감소, 억제, 진정 또는 근절을 의미한다. 상기 "치료"는 바이러스 유전자의 복제를 억제하거나, 바이러스 입자의 제조를 위한 구조단백질 또는 비구조 단백질의 생산을 억제함으로써 달성될 수 있으나, 이에 한정되는 것은 아니다.As used herein, the term “prevention” refers to the prevention or protective treatment of a disease or disease state. As used herein, the term “treatment” refers to reduction, suppression, sedation or eradication of a disease state. The "treatment" may be achieved by inhibiting the replication of viral genes or inhibiting the production of structural proteins or non-structural proteins for the production of viral particles, but is not limited thereto.

본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 내복약, 주사제 등 다양하게 제조될 수 있고, 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 산제, 좌제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.The pharmaceutical composition of the present invention is prepared in a unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person of ordinary skill in the art to which the present invention pertains. or may be prepared by incorporation into a multi-dose container. At this time, the dosage form may be prepared in various ways such as oral medicine, injection, etc., in the form of a solution, suspension or emulsion in oil or aqueous medium, or in the form of an extract, powder, suppository, powder, granule, tablet or capsule, dispersant or stable Additional topics may be included.

본 발명의 다른 양태에 따르면, 본 발명은 로틀레린을 포함하는 바이러스 감염증의 예방 또는 개선용 사료 첨가제를 제공한다. According to another aspect of the present invention, the present invention provides a feed additive for preventing or improving viral infection containing rotlerin.

본 명세서 상의 용어 "사료 첨가제"는 사료에 첨가되는 물질을 의미한다. 사료 첨가제는 대상 동물의 생산성 향상 및 건강 증진 목적으로 사용될 수 있으나, 이에 제한되지 않는다.As used herein, the term “feed additive” refers to a substance added to feed. The feed additive may be used for the purpose of improving productivity and health of the target animal, but is not limited thereto.

본 명세서 상의 용어 "개선"은 바이러스 감염증의 증상을 감소시키는 모든 행위를 의미한다. 상기 "개선"은 바이러스 유전자의 복제를 억제하거나, 바이러스 입자의 제조를 위한 구조단백질 또는 비구조 단백질의 생산을 억제함으로써 달성될 수 있으나, 이에 한정되는 것은 아니다.As used herein, the term “improvement” refers to any action that reduces the symptoms of a viral infection. The "improvement" may be achieved by inhibiting the replication of viral genes or inhibiting the production of structural proteins or non-structural proteins for the production of viral particles, but is not limited thereto.

본 발명의 또 다른 양태에 따르면, 본 발명은 상술한 약제학적 조성물을 대상에 투여하는 단계를 포함하는 바이러스 감염증의 치료 방법을 제공한다. According to another aspect of the present invention, the present invention provides a method of treating a viral infection comprising administering the above-described pharmaceutical composition to a subject.

본 명세서에서 사용된 용어, "투여" 또는 "투여하다"는 본 발명의 조성물의 치료적, 또는 예방적 유효량을 상기 대상 질환을 겪거나, 겪을 가능성이 있는 대상에 직접적으로 투여함으로써 대상의 체내에서 동일한 양이 형성되도록 하는 것을 말한다. As used herein, the term “administration” or “administering” refers to a therapeutically or prophylactically effective amount of a composition of the present invention by directly administering to a subject suffering from, or likely to suffer from, the subject disease in the body of the subject. This means that the same amount is formed.

상기 조성물의 "치료적 유효량"은 조성물을 투여하고자 하는 대상에게 치료적 또는 예방적 효과를 제공하기에 충분한 조성물의 함량을 의미하며, 이에 "예방적 유효량"을 포함하는 의미이다.The "therapeutically effective amount" of the composition means an amount of the composition sufficient to provide a therapeutic or prophylactic effect to a subject to whom the composition is administered, and includes a "prophylactically effective amount".

본 발명의 일 구현예에 있어서, 상기 대상은 인간, 마우스, 랫트, 기니아 피그, 개, 고양이, 말, 소, 돼지, 원숭이, 침팬지, 비비 및 붉은털 원숭이 등을 포함하는 포유류; 또는 닭, 오리, 칠면조, 메추리 등의 가금류이나, 이에 한정되는 것은 아니다.In one embodiment of the present invention, the subject is mammals including humans, mice, rats, guinea pigs, dogs, cats, horses, cattle, pigs, monkeys, chimpanzees, baboons and rhesus monkeys; Or poultry such as chicken, duck, turkey, quail, but is not limited thereto.

본 발명의 치료 방법은 상술한 로틀레린을 포함하는 약제학적 조성물을 대상에게 투여하는 단계를 포함하기 때문에, 조성물에 대해 중복되는 내용은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다. Since the treatment method of the present invention includes the step of administering to the subject the pharmaceutical composition comprising rotlerin, overlapping contents of the composition will be omitted in order to avoid excessive complexity of the present specification.

본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:

(a) 본 발명은 로틀레린을 유효성분으로 포함하는 바이러스 감염증의 예방 또는 치료용 약제학적 조성물을 제공한다. (a) The present invention provides a pharmaceutical composition for preventing or treating a viral infection comprising rotlerin as an active ingredient.

(b) 본 발명은 로틀레린을 포함하는 바이러스 감염증의 예방 또는 개선용 사료 첨가제를 제공한다.(b) The present invention provides a feed additive for preventing or improving viral infection containing rotlerin.

(c) 본 발명의 로틀레린을 유효성분으로 포함하는 바이러스 감염증의 예방 또는 치료용 약제학적 조성물를 이용하는 경우, 코로나 바이러스 또는 돼지생식기호흡기 증후군 바이러스 등에 의한 바이러스 감염증을 치료하는데 유용하게 사용할 수 있다. (c) When using the pharmaceutical composition for preventing or treating viral infections containing rotlerin as an active ingredient of the present invention, it can be usefully used to treat viral infections caused by coronavirus or porcine reproductive and respiratory syndrome virus.

도 1은 항바이러스제(미세 입자)의 세포독성을 확인한 결과를 나타낸다.
도 2는 항바이러스제(미세 입자)의 제형별 항바이러스 효능을 평가한 결과를 나타낸다.
도 3은 항바이러스제(미세 입자)의 농도별 항바이러스 효능을 바이러스 접종 48시간 후에 측정한 결과를 나타낸다.
도 4는 항바이러스제(미세 입자)의 농도별 항바이러스 효능을 바이러스 접종 72시간 후에 측정한 결과를 나타낸다.
도 5는 항바이러스제(미세 입자)의 접종 시간별 항바이러스 효능을 바이러스 접종 48시간 후에 측정한 결과를 나타낸다.
도 6은 항바이러스제(미세 입자)의 접종 시간별 항바이러스 효능을 바이러스 접종 72시간 후에 측정한 결과를 나타낸다.
도 7은 항바이러스제(미세 입자) 및 렘데시비르의 병용투여 효능을 평가한 결과를 나타낸다.
도 8은 항바이러스제(미세 입자) 및 렘데시비르의 병용투여 효능을 면역염색을 통해 확인한 결과를 나타낸다.
도 9는 항바이러스제(리포좀)의 세포독성을 확인한 결과를 나타낸다.
도 10은 항바이러스제(리포좀)의 접종 시간별 항바이러스 효능을 평가하기 위한 실험 설계를 나타낸다.
도 11은 항바이러스제(리포좀)의 접종 시간별 항바이러스 효능을 바이러스 접종 48시간 후에 측정한 결과를 나타낸다.
도 12는 항바이러스제(리포좀)의 접종 농도별 항바이러스 효능을 바이러스 접종 48시간 후에 측정한 결과를 나타낸다.
도 13은 항바이러스제(리포좀)의 항바이러스 효능을 면역염색을 통해 확인한 결과를 나타낸다.
도 14는 qRT-PCR을 통해 확인한 항바이러스제(리포좀)이 PRRSV의 인터널리제이션(internalization)에 미치는 효과를 확인한 결과를 나타낸다.
도 15는 qRT-PCR을 통해 확인한 항바이러스제(리포좀)의 동물 실험 효능 평가 결과를 나타낸다.
도 16은 적정(titration)을 통해 확인한 항바이러스제(리포좀)의 동물 실험 효능 평가 결과를 나타낸다.
도 17은 실험군에서 확인한 폐병변지수 결과를 나타낸다.
도 18은 임상 증상 스코어를 통해 확인한 항바이러스제(리포좀)의 동물 실험 효능 평가 결과를 나타낸다.
도 19는 돼지 유행성 설사병 바이러스에 대한 항바이러스제의 효과를 확인하기 위한 실험에서 처리한 바이러스 농도 및 항바이러스제 농도를 나타낸다.
도 20은 돼지 유행성 설사병 바이러스에 대한 항바이러스제의 효과를 확인하기 위해 수행한 MTT assay 결과를 나타낸다.
도 21은 돼지 유행성 설사병 바이러스에 대한 항바이러스제의 효과를 확인하기 위해 수행한 형광면역염색 결과를 나타낸다.
도 22는 고양이 코로나 바이러스에 대한 항바이러스제의 효과를 확인하기 위해 수행한 PCR 결과를 나타낸다.
도 23은 인플루엔자 바이러스에 대한 항바이러스제의 효과를 확인하기 위하여 나타낸 real-time PCR 결과를 나타낸다. 1 shows the results of confirming the cytotoxicity of the antiviral agent (fine particles).
Figure 2 shows the results of evaluating the antiviral efficacy of each formulation of the antiviral agent (fine particles).
Figure 3 shows the results of measuring the antiviral efficacy for each concentration of the antiviral agent (fine particles) 48 hours after virus inoculation.
Figure 4 shows the results of measuring the antiviral efficacy for each concentration of the antiviral agent (fine particles) 72 hours after virus inoculation.
5 shows the results of measuring the antiviral efficacy for each inoculation time of the antiviral agent (fine particles) 48 hours after virus inoculation.
6 shows the results of measuring the antiviral efficacy for each inoculation time of the antiviral agent (fine particles) 72 hours after virus inoculation.
7 shows the results of evaluating the efficacy of co-administration of an antiviral agent (fine particles) and remdesivir.
8 shows the results of confirming the efficacy of co-administration of an antiviral agent (fine particles) and remdesivir through immunostaining.
9 shows the results of confirming the cytotoxicity of the antiviral agent (liposome).
10 shows an experimental design for evaluating the antiviral efficacy of an antiviral agent (liposome) at each inoculation time.
11 shows the results of measuring the antiviral efficacy for each inoculation time of the antiviral agent (liposome) 48 hours after virus inoculation.
12 shows the results of measuring the antiviral efficacy by inoculation concentration of the antiviral agent (liposome) 48 hours after virus inoculation.
13 shows the results of confirming the antiviral efficacy of the antiviral agent (liposome) through immunostaining.
14 shows the results of confirming the effect of the antiviral agent (liposome) confirmed through qRT-PCR on the internalization of PRRSV.
15 shows the results of evaluating the efficacy of an antiviral agent (liposome) in an animal experiment confirmed through qRT-PCR.
16 shows the results of evaluating the efficacy of an antiviral agent (liposome) in an animal experiment confirmed through titration.
17 shows the results of the lung lesion index confirmed in the experimental group.
18 shows the results of evaluating the efficacy of an antiviral agent (liposome) in an animal experiment confirmed through clinical symptom scores.
19 shows the virus concentration and the antiviral agent concentration treated in an experiment to confirm the effect of the antiviral agent on the swine epidemic diarrhea virus.
20 shows the results of the MTT assay performed to confirm the effect of the antiviral agent on the swine epidemic diarrhea virus.
21 shows the results of fluorescence immunostaining performed to confirm the effect of the antiviral agent on the swine epidemic diarrhea virus.
22 shows the PCR results performed to confirm the effect of the antiviral agent on the cat coronavirus.
23 shows the real-time PCR results shown to confirm the effect of the antiviral agent on the influenza virus.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

실시예Example

본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 "%"는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량) %, 고체/액체는 (중량/부피) %, 그리고 액체/액체는 (부피/부피) %이다.Throughout this specification, "%" used to indicate the concentration of a specific substance is (weight/weight) % for solid/solid, (weight/volume) % for solid/liquid, and Liquid/liquid is (vol/vol) %.

제조예 1: 로틀레린을 포함하는 항바이러스제의 제조(미세 입자)Preparation Example 1: Preparation of antiviral agent containing rotlerin (fine particles)

본 발명에서 사용한 로틀레린은, 제형에 따라 로틀레린 결정(R0), 로틀레린 결정을 초음파 분쇄한 시료(R1), 로틀레린 결정을 PDA로 코팅한 시료(R3)로 분류하였다. The rotlerin used in the present invention was classified into rotlerin crystals (R0), a sample obtained by sonicating rotlerin crystals (R1), and a sample coated with rotlerin crystals with PDA (R3) according to the formulation.

상기 로틀레린(R0) 결정 시료는 ICC (Indofine Chemical Company Inc., N.J. US)에서 구입한 것으로 순도가 95% 이상이었다.The rotlerin (R0) crystal sample was purchased from ICC (Indofine Chemical Company Inc., N.J. US) and had a purity of 95% or more.

로틀레린 결정(R0) 시료를 10 mM농도로 DMSO 용매에 희석하였고, 이를 증류수와 1:50(부피비)의 비율로 혼입 후 0℃ 조건에서 40% 증폭 강도로 10분간 초음파 분쇄를 진행하였다. 제조된 미세 입자는 100,000 rpm에서 1시간 동안 원심분리 후 증류수로 세척하여 불순물을 제거하고 재차 현탁하여 4 ℃의 온도 조건에서 보관하였다.A sample of rotlerin crystal (R0) was diluted in DMSO solvent to a concentration of 10 mM, mixed with distilled water at a ratio of 1:50 (volume ratio), and then sonicated for 10 minutes at 0° C. at 40% amplification intensity. The prepared fine particles were centrifuged at 100,000 rpm for 1 hour, washed with distilled water to remove impurities, suspended again, and stored at a temperature of 4°C.

상기 방법으로 제조된 로틀레린 미세 입자(R1)는 PDA(polydopamine) 코팅을 위하여 10 mg/ml 농도의 도파민 염산염(dopamine hydrochloride) 수용액과 6 mg/ml의 트리스 염기(Tris base) 수용액을 100:1 (v/v)씩 첨가하고 상온에서 갈변하여 중합반응이 완료될 때까지 반응하였다. The rotlerin microparticles (R1) prepared by the above method were mixed with an aqueous solution of dopamine hydrochloride at a concentration of 10 mg/ml and an aqueous solution of 6 mg/ml of Tris base at a concentration of 100:1 for PDA (polydopamine) coating. (v/v) was added and reacted until the polymerization reaction was completed by browning at room temperature.

반응이 끝난 PDA 코팅-로틀레린 미세 입자(R3)는 100,000 rpm에서 1시간 동안 원심분리 후 증류수로 세척하여 불순물을 제거하고 0.2 μm 필터를 통하여 PDA 코팅-로틀레린 미세 입자(R3)만을 분리하여 정제 후 4 ℃의 온도 조건에서 보관하였다.After the reaction was completed, the PDA-coated-rotlerin microparticles (R3) were centrifuged at 100,000 rpm for 1 hour, washed with distilled water to remove impurities, and only the PDA-coated-rotlerin microparticles (R3) were separated and purified through a 0.2 μm filter. After that, it was stored at a temperature condition of 4 °C.

제조예 2: 로틀레린을 포함하는 항바이러스제의 제조(리포좀)Preparation Example 2: Preparation of antiviral agent containing rotlerin (liposome)

로틀레린을 포함하는 리포좀을 박막 수화법(thin-film hydration method)으로 제조하였다. 보다 구체적으로, 0.86 g의 수소화 된 대두 포스파티딜콜린 (hydrogenated soy phosphatidylcholine, HSPC), 0.08 g 콜레스테롤 (포스파티딜콜린:콜레스테롤=5:1 mol/mol) 및 10 mg 로틀레린 (로틀레린:지질=1:94 wt/wt)을 메탄올-클로로포름 용액(1:2 v/v)에 용해한 후, 지질 혼합물을 건조시켜 회전 증발농축기(56℃, 252 rpm, 294mbar; Rotavapor R-100, Buchi, USA)를 활용하여 박막을 얻었다. 지질막을 PBS로 수화(62, 252 rpm)시키고 실온에서 2시간 동안 방치하였다. Liposomes containing rotlerin were prepared by a thin-film hydration method. More specifically, 0.86 g of hydrogenated soy phosphatidylcholine (HSPC), 0.08 g cholesterol (phosphatidylcholine:cholesterol=5:1 mol/mol) and 10 mg rotlerin (rotlerin:lipid=1:94 wt/mol) wt) was dissolved in methanol-chloroform solution (1:2 v/v), the lipid mixture was dried, and the thin film was formed using a rotary evaporator (56℃, 252 rpm, 294mbar; Rotavapor R-100, Buchi, USA). got it The lipid membrane was hydrated with PBS (62, 252 rpm) and left at room temperature for 2 hours.

제조된 리포좀은 VC505기기(sonics & materials, Connecticut, USA)를 사용하여 진폭 23% 조건에서 5분간 소니케이션(sonication) 처리(8s on/2s off)하여 리포좀의 사이즈를 줄이고 MWCO 2000 투석막(Thermo scientific, USA)을 사용하여 투석하였다. The prepared liposome was reduced in size of the liposome by sonication treatment (8s on/2s off) for 5 minutes at an amplitude of 23% using a VC505 device (sonics & materials, Connecticut, USA) and a MWCO 2000 dialysis membrane (Thermo scientific , USA) was used for dialysis.

제조된 로틀레린 포함 리포좀은 DLS (dynamic light scattering)장비를 사용하여 크기를 측정한 결과 66 ± 10 nm의 크기를 보였고, 분광계(spectrometer)에서 420 nm 파장으로 분석시 약 500 μg/ml 농도로 확인되었으며, pH는 7.4 ± 0.1로 조정되었다. As a result of measuring the size of the prepared rotlerin-containing liposome using DLS (dynamic light scattering) equipment, it showed a size of 66 ± 10 nm. and the pH was adjusted to 7.4 ± 0.1.

실시예 1: 제조예 1에서 제조된 항바이러스제(미세 입자)의 세포독성 확인 Example 1: Confirmation of cytotoxicity of the antiviral agent (fine particles) prepared in Preparation Example 1

제조예 1에서 제조된 항바이러스제의 세포독성을 확인하기 위하여 수용성 테트라졸륨염 어세이를 진행하였다. MARC-145 세포주 및 돼지 폐 마크로파지 세포에 로틀레린 미세 입자(R1)를 농도별로 첨가하고 1일 동안 배양한 후 수용성 테트라졸륨염을 첨가하고 4시간 동안 배양하였다. 이후 450 nm에서 흡광도를 측정하여 세포의 생존 정도를 확인하였다.In order to confirm the cytotoxicity of the antiviral agent prepared in Preparation Example 1, a water-soluble tetrazolium salt assay was performed. Lotlerin microparticles (R1) were added by concentration to the MARC-145 cell line and pig lung macrophage cells and cultured for 1 day, followed by the addition of a water-soluble tetrazolium salt and incubated for 4 hours. Thereafter, the absorbance was measured at 450 nm to determine the degree of cell viability.

본 발명에서 사용된 항바이러스제(초음파 분쇄 로틀레린 미세 입자, R1)의 세포독성 시험 결과 10 μM까지는 세포생존력을 96.5% 이상으로 유지하였다(도 1).As a result of the cytotoxicity test of the antiviral agent used in the present invention (ultrasonic microparticles of rotlerin, R1), the cell viability was maintained at 96.5% or more up to 10 μM ( FIG. 1 ).

따라서 본 발명의 효능을 평가하기 위하여 5-10 μM 이하의 농도를 사용하였다. Therefore, in order to evaluate the efficacy of the present invention, a concentration of 5-10 μM or less was used.

실시예 2: 제조예 1에서 제조된 항바이러스제(미세 입자)의 항바이러스 효능 평가Example 2: Evaluation of the antiviral efficacy of the antiviral agent (fine particles) prepared in Preparation Example 1

제조예 1에서 제조된 항바이러스제(R0, R1, R3)의 효능을 평가하기 위해COVID-19 바이러스주 NCCP43330(L strain; 고병원성)를 표준 바이러스주로 사용하였다. In order to evaluate the efficacy of the antiviral agents (R0, R1, R3) prepared in Preparation Example 1, the COVID-19 strain NCCP43330 (L strain; highly pathogenic) was used as a standard strain.

표준 바이러스 현탁액 100 μL를 10⁴ 개/웰 농도로 VERO-E6 세포가 배양된 세포단층에 0.1 MOI(multiplicity of infection) 농도로 첨가한 뒤 각 시험 물질에 따라 농도별 (0, 0.312, 0.625, 1.25, 2.5, 5, 10 μM), 시간별 (-24, -12, -2, 0, 2, 12, 24 시간, 바이러스 접종 시점을 0 시로 기준함)로 시험물질을 첨가하였다. 각 실험 군은 3배수로 진행하였다.100 μL of standard virus suspension was added at a concentration of 10 ⁴ cells/well to a cell monolayer in which VERO-E6 cells were cultured at a concentration of 0.1 MOI (multiplicity of infection), and the concentration (0, 0.312, 0.625, 1.25 , 2.5, 5, 10 μM) and hourly (-24, -12, -2, 0, 2, 12, 24 hours, the time of virus inoculation was based on 0 hours). Each experimental group was performed in triplicate.

바이러스를 접종한 플레이트는 37 ℃ 이산화탄소 포함 조건에서 48시간, 72시간 동안 배양하였다. The plate inoculated with the virus was incubated for 48 hours and 72 hours under conditions containing carbon dioxide at 37 °C.

바이러스 배양이 완료된 플레이트는 시간별로 상층액을 채취하였고, 바이러스 RNA를 추출하여 다음의 프라이머, 프로브 세트를 이용하여 qRT-PCR을 실시하였다.After the virus culture was completed, the supernatant was collected by time, and viral RNA was extracted and qRT-PCR was performed using the following primer and probe sets.

- SARS-CoV2-nsp10-F: TTGTGATCAACTCCGCGAAC (서열번호 1)- SARS-CoV2-nsp10-F: TTGTGATCAACTCCGCGAAC (SEQ ID NO: 1)

- SARS-CoV2-nsp10-R: TAAGACGGGCTGCACTTACA (서열번호 2)- SARS-CoV2-nsp10-R: TAAGACGGGCTGCACTTACA (SEQ ID NO: 2)

- SARS-CoV2-nsp10-P: 6FAM-CCATGCTTCAGTCAGCTGATGCACA-BHQ1 (서열번호 3)- SARS-CoV2-nsp10-P: 6FAM-CCATGCTTCAGTCAGCTGATGCACA-BHQ1 (SEQ ID NO: 3)

qRT-PCR이 끝난 시료는 기존의 농도별 시료를 통하여 구해진 스탠다드 커브 공식에 따라 log10(바이러스 역가)=(-0.3109*Ct)+12.813 계산식을 통하여 바이러스의 역가를 확인하였다. For the sample after qRT-PCR, the virus titer was confirmed through the log10 (viral titer)=(-0.3109*Ct)+12.813 formula according to the standard curve formula obtained from the existing samples for each concentration.

실시예 2-1. 항바이러스제(미세 입자)의 제형별 항바이러스 효능 평가Example 2-1. Evaluation of antiviral efficacy by formulation of antiviral agents (fine particles)

항바이러스제의 R0(결정), R1(미세 입자), R3(PDA 코팅 미세 입자) 제형에 따른 항바이러스 효과를 평가하기 위하여 각 유효물질을 5 μM 농도로 바이러스(0.1 MOI)와 함께 접종하였으며, COVID-19 바이러스만을 처리한 군을 양성대조군으로 설정하였으며, 아무 물질도 처리하지 않은 군을 음성대조군으로 설정하였다. In order to evaluate the antiviral effect according to the R0 (crystal), R1 (fine particle), R3 (PDA-coated fine particle) formulation of the antiviral agent, each active substance was inoculated with the virus (0.1 MOI) at a concentration of 5 μM, and COVID The group treated with only -19 virus was set as a positive control group, and the group that was not treated with any substance was set as a negative control group.

접종 48시간 후 R0는 4.5, R1은 4.6, R3는 4.8 log copy로 양성 그룹의 6.8 log copy에 비하여 약 2 log 감소(99%)하였다. 48 hours after inoculation, R0 was 4.5, R1 was 4.6, and R3 was 4.8 log copy, which was reduced by about 2 log (99%) compared to 6.8 log copy of the positive group.

접종 24시간 후에도 양성 2.99 log copy보다 R0와 R1은 0.9, 0.8 log copy로 2 log이상 감소하였으므로 1.5 log copy인 R3보다 초기 바이러스 억제가 높은 것을 확인하였다(도 2). Even 24 hours after inoculation, R0 and R1 decreased by more than 2 log to 0.9 and 0.8 log copy than positive 2.99 log copy, so it was confirmed that the initial virus suppression was higher than R3, which was 1.5 log copy (Fig. 2).

실시예 2-2. 항바이러스제(미세 입자)의 농도별 항바이러스 효능 평가Example 2-2. Evaluation of antiviral efficacy by concentration of antiviral agent (fine particles)

항바이러스제의 R0(결정), R1(미세 입자), R3(PDA 코팅 미세 입자)의 농도에 따른 항바이러스 효과를 평가하기 위하여 각 유효물질을 10 μM 농도부터 2-fold로 희석하여 최소농도 0.3 μM까지 바이러스(0.1 MOI)와 함께 접종하였다. To evaluate the antiviral effect according to the concentration of R0 (crystal), R1 (fine particle), and R3 (PDA-coated fine particle) of the antiviral agent, each active substance is diluted 2-fold from the concentration of 10 μM to a minimum concentration of 0.3 μM up to the time of inoculation with the virus (0.1 MOI).

시험 결과, 접종 48시간 후에 각 제형은 2.5 μM 접종부터 바이러스 카피수가 2 log이상 감소하였고 최대 2.9 log까지 감소하였다(도 3). As a result of the test, 48 hours after inoculation, each formulation decreased by 2 log or more from 2.5 μM inoculation to a maximum of 2.9 log ( FIG. 3 ).

접종 72시간 후에는 원액을 제외하고(1.7 log) 바이러스 카피수가 2 log이상 감소하였으며, R3가 10 μM농도에서 최대 3.8 log 감소하였다(도 4). After 72 hours of inoculation, except for the stock solution (1.7 log), the number of virus copies was reduced by 2 log or more, and R3 was reduced by a maximum of 3.8 log at a concentration of 10 μM (FIG. 4).

실시예 2-3. 항바이러스제(미세 입자)의 접종 시간별 항바이러스 효능 평가Example 2-3. Evaluation of antiviral efficacy by inoculation time of antiviral agents (fine particles)

각 제형의 접종 시간별 항바이러스 효과를 평가하기 위하여 바이러스 접종 24시간 전, 12시간 전, 2시간 전, 0시간, 2시간 후, 12시간 후에 각 제형의 항바이러스제를 5 μM의 농도로 처리하였다. 그 후 바이러스 접종 48시간, 72시간 후 바이러스의 카피수를 측정하였다. In order to evaluate the antiviral effect by inoculation time of each formulation, the antiviral agent of each formulation was treated at a concentration of 5 μM 24 hours before, 12 hours, 2 hours, 0 hours, 2 hours, and 12 hours after virus inoculation. Thereafter, the number of copies of the virus was measured 48 hours and 72 hours after virus inoculation.

바이러스 접종(0시) 2시간 전에 항바이러스제를 접종한 경우, 바이러스 접종 후 48시간이 되는 시점의 바이러스 카피수가 모든 군에서 2 log 이상이 감소됨을 확인할 수 있었다(도 5). 이는 5 μM 농도의 항바이러스제가 최소 24시간동안 지속된다는 것을 의미한다. When the antiviral agent was inoculated 2 hours before virus inoculation (0 o'clock), it was confirmed that the virus copy number at 48 hours after virus inoculation was reduced by 2 log or more in all groups (FIG. 5). This means that the antiviral agent at a concentration of 5 μM lasts for at least 24 hours.

바이러스 접종 72시간 후에는 비교적 불규칙한 결과를 보였으나 바이러스접종후 48시간의 결과와 마찬가지로 바이러스 접종 후 2시간 이내에 항바이러스 제를 처리한 군에서 바이러스 카피수가 2 log 이상 감소하였다(도 6).After 72 hours of virus inoculation, relatively irregular results were shown, but the number of virus copies decreased by 2 log or more in the group treated with the antiviral agent within 2 hours after virus inoculation, similar to the results of 48 hours after virus inoculation (FIG. 6).

실시예 3: 제조예 1에서 제조된 항바이러스제(미세 입자) 및 렘데시비르의 병용투여 효능 평가Example 3: Evaluation of the efficacy of co-administration of the antiviral agent (fine particles) prepared in Preparation Example 1 and remdesivir

본 발명의 항바이러스제(로틀레린 초음파 분쇄 미세 입자, R1)와 렘데시비르와 병용투여 효능 검증을 위해, 렘데시비르를 0, 0.125, 0.25, 0.5, 1 μM의 농도에서 항바이러스제(R1) (0.312, 0.625, 1.25, 2.5, 5 μM)와 함께 투여하였고 48시간 이후 세포배양액에서 바이러스의 유전체를 분석하였다. To verify the efficacy of co-administration of the antiviral agent of the present invention (rotlerin sonication fine particles, R1) and remdesivir, remdesivir was administered as an antiviral agent (R1) ( 0.312, 0.625, 1.25, 2.5, 5 μM), and the genome of the virus was analyzed in the cell culture medium after 48 hours.

항바이러스제(R1)의 농도가 0.625 μM과 1.25 μM인 경우, 렘데시비르를 단독으로 사용하였을 때보다 바이러스의 유전체가 유의미하게 감소하였다. 렘데시비르 미첨가시 1.25 μM의 항바이러스제(R1)의 바이러스 억제능은 44 %에 그쳤으나, 0.5 μM이상의 렘데시비르 존재 하에 항바이러스제(R1)를 처리시 80 % 이상의 항바이러스 효과를 확인할 수 있었다. 렘데시비르가 1 μM로 처리되는 경우, 항바이러스제(R1)가 2.5 μM로 처리되는 경우 99 %이상의 항바이러스 효능을 나타내었다(도 7). When the concentrations of the antiviral agent (R1) were 0.625 μM and 1.25 μM, the genome of the virus was significantly reduced compared to when remdesivir was used alone. When remdesivir was not added, the antiviral agent (R1) at 1.25 μM had only 44% antiviral activity, but when the antiviral agent (R1) was treated in the presence of 0.5 μM or more of remdesivir, more than 80% of the antiviral effect was confirmed. When remdesivir was treated with 1 μM, when the antiviral agent (R1) was treated with 2.5 μM, it exhibited an antiviral efficacy of 99% or more ( FIG. 7 ).

상기 결과는 렘데시비르의 용량 의존적으로 항바이러스제(R1)의 효과도 상승하는 것을 나타낸다.The above results indicate that the effect of the antiviral agent (R1) also increases in a dose-dependent manner of remdesivir.

또한, 본 발명의 항바이러스제(로틀레린 초음파 분쇄 미세 입자, R1)와 렘데시비르와 병용투여 효능을 anti-SARS-CoV-2의 단일 클론 항체(Genetex, Cat No. GTX632269)와 그 2차 항체인 goat anti-mouse IgG GFP-접합 항체(Invitrogen, Catalog # A-11001)를 사용하여 면역형광 분석을 수행하였다. 결과는 도 8에 나타내었다.In addition, the efficacy of co-administration of the antiviral agent of the present invention (Rotlerin sonicated fine particles, R1) and remdesivir was demonstrated by the anti-SARS-CoV-2 monoclonal antibody (Genetex, Cat No. GTX632269) and its secondary antibody. Immunofluorescence analysis was performed using a goat anti-mouse IgG GFP-conjugated antibody (Invitrogen, Catalog # A-11001). The results are shown in FIG. 8 .

그 결과, 양성대조군에서는 강한 다수의 녹색 형광(SARS-CoV-2의 뉴클레오캡시드)이 관찰되었고, 렘데시비르를 단독으로 처리한 군에서는 녹색 형광이 감소된 것이 관찰되었으며, 렘데시비르와 미세입자(R1)를 함께 처리한 군은 녹색 형광이 현저하게 감소된 것이 관찰되었다(도 8). As a result, a large number of strong green fluorescence (nucleocapsid of SARS-CoV-2) was observed in the positive control group, and a decrease in green fluorescence was observed in the group treated with remdesivir alone. In the group treated with the particle (R1), it was observed that green fluorescence was significantly reduced (FIG. 8).

상기 결과는 항바이러스제(미세 입자, R1)와 렘데시비르를 병용투여하는 것이 렘데시비르를 단독으로 처리한 군보다 효과가 우수한 것을 나타낸다. The above results indicate that co-administration of an antiviral agent (fine particles, R1) and remdesivir is more effective than the group treated with remdesivir alone.

실시예 4: 제조예 2에서 제조된 항바이러스제(리포좀)의 세포독성 확인Example 4: Confirmation of cytotoxicity of the antiviral agent (liposome) prepared in Preparation Example 2

세포 생존율은 EZ-Cytox cell viability assay kit (Daeil lab service, Korea)를 이용한 WST (수용성 테트라졸륨염) 분석법으로 측정하였다. 보다 구체적으로, 돼지 폐포 대식세포 (PAM) 및 MARC-145 세포를 각각 1x10⁶ 및 3x10⁵/ml의 농도로 96-웰 플레이트에 시딩하였다. 시딩 1 내지 2 일 후 항바이러스제(리포좀)를 0.3125, 1.25, 5, 10 μM 로 처리하였다. 세포는 37

, 5 % CO₂에서 24 시간 동안 배양하였다. 그 후, 10 μl의 EZ-Cytox를 첨가하고 37

, 5 % CO₂에서 4 시간 동안 배양하였다. 450nm에서의 광학 밀도는 배경 신호를 측정하기 위한 기준으로서 620nm와 함께 판독되었다.Cell viability was measured by WST (water-soluble tetrazolium salt) assay using EZ-Cytox cell viability assay kit (Daeil lab service, Korea). More specifically, porcine alveolar macrophages (PAM) and MARC-145 cells were seeded in 96-well plates at concentrations of 1× ^{10 6} and 3×10 ⁵ /ml, respectively. After 1 to 2 days of seeding, antiviral agents (liposomes) were treated with 0.3125, 1.25, 5, and 10 μM. cells are 37

, 5% CO ₂ was incubated for 24 hours. After that, 10 μl of EZ-Cytox was added and 37

, 5% CO ₂ was incubated for 4 hours. The optical density at 450 nm was read with 620 nm as a reference for measuring the background signal.

로틀레린이 담지된 리포좀의 농도에 따른 세포독성을 평가한 결과 5 μM 농도까지 세포 독성을 보이지 않았다(도 9).As a result of evaluating the cytotoxicity according to the concentration of the rotlerin-supported liposome, it did not show cytotoxicity up to a concentration of 5 μM ( FIG. 9 ).

실시예 5: 제조예 2에서 제조된 항바이러스제(리포좀)의 항바이러스 효능 평가Example 5: Evaluation of antiviral efficacy of the antiviral agent (liposome) prepared in Preparation Example 2

시험바이러스는 PRRSV 바이러스주 FL12를 표준 바이러스주로 사용하였다.As the test virus, PRRSV strain FL12 was used as a standard strain.

시험바이러스 현탁액 100 μL를 10⁴ 개/웰 농도로 MARK-145 세포가 배양된 세포단층에 0.1 MOI 농도로 첨가한 뒤 각 시험에 따라 농도별, 시간별로 시험물질을 첨가하였고, 각 실험 군은 3배수로 진행하였다.100 μL of the test virus suspension was added to the cell monolayer cultured with MARK-145 cells at a concentration of 10 ⁴ cells/well at a concentration of 0.1 MOI, and then the test substance was added by concentration and time according to each test. Drainage was carried out.

PRRSV 바이러스를 접종한 플레이트를 37 ℃ 이산화탄소 포함 조건에서 48시간, 72시간 동안 배양하였다. 바이러스가 배양이 완료된 플레이트는 시간별로 상층액을 채취하였고, -70 ℃에서 보관하였다. 각 세포 배양 상층액은 96 웰 플레이트에서 TCID₅₀ 법을 사용하여 바이러스의 역가를 확인하였다. The plate inoculated with the PRRSV virus was incubated for 48 hours and 72 hours at 37 °C in carbon dioxide containing conditions. After the virus culture was completed, the supernatant was collected by time and stored at -70 °C. Each cell culture supernatant was tested for virus titer in a 96-well plate using the TCID ₅₀ method.

실시예 5-1. 항바이러스제(리포좀)의 접종시간별 항바이러스 효능Example 5-1. Antiviral efficacy by inoculation time of antiviral agent (liposome)

로틀레린 리포좀의 접종 시간별 항바이러스 효과를 평가하기 위하여 PRRS 바이러스 접종 1시간 전, 1시간 후, 3시간 후, 5시간 후, 9시간 후, 24시간 후에 각각 항바이러스제(로틀레린 리포좀)를 처리하여 바이러스 접종 48시간 후 시점의 바이러스 역가를 측정하였다 (도 10). In order to evaluate the antiviral effect of rotlerin liposomes for each inoculation time, 1 hour before, 1 hour, 3 hours, 5 hours, 9 hours, and 24 hours after PRRS virus inoculation, each antiviral agent (Rotlerin liposome) was treated. Virus titers were measured 48 hours after virus inoculation ( FIG. 10 ).

실험 결과, PRRS 바이러스 접종 1시간 전에 로틀레린 리포좀을 처리한 군과 바이러스 접종 1시간 후에 로틀레린 리포좀을 처리한 군에서 99% (2 log) 이상 바이러스의 역가가 감소하였다 (도 11).As a result, the virus titer was reduced by more than 99% (2 log) in the group treated with rotlerin liposome 1 hour before PRRS virus inoculation and in the group treated with rotlerin liposome 1 hour after virus inoculation (FIG. 11).

상기 결과는 본 발명의 항바이러스제(로틀레린 리포좀)가 항바이러스 효과를 나타내며, 특히 감염 전 또는 직후에 처리하는 경우 우수한 감염 예방 또는 치료 효과를 발휘하는 것을 나타낸다. The above results indicate that the antiviral agent (rotlerin liposome) of the present invention exhibits an antiviral effect, and particularly exhibits an excellent infection prevention or treatment effect when treated before or immediately after infection.

실시예 5-2. 항바이러스제(리포좀)의 접종 농도별 항바이러스 효능Example 5-2. Antiviral efficacy by inoculation concentration of antiviral agent (liposome)

로틀레린 리포좀의 접종 농도별 항바이러스 효과를 평가하기 위하여 0.3125, 1.25, 5 μM의 항바이러스제(로틀레린 리포좀)를 처리하여 PRRSV 접종 48시간 후에 바이러스 역가를 측정하였다. To evaluate the antiviral effect of rotlerin liposomes by inoculation concentration, 0.3125, 1.25, and 5 μM of antiviral agents (rotlerin liposomes) were treated to measure the virus titer 48 hours after PRRSV inoculation.

시험 결과, 항바이러스제를 5 μM 처리한 군에서 48 시간 이후 99% 이상의 바이러스의 역가가 감소함을 나타내었다 (도 12). As a result of the test, it was shown that the virus titer was reduced by more than 99% after 48 hours in the group treated with 5 μM of the antiviral agent ( FIG. 12 ).

상기 결과는 본 발명의 항바이러스제(로틀레린 리포좀)가 항바이러스 효과를 나타내며, 특히 농도 의존적으로 우수한 효과를 발휘하는 것을 나타낸다. The above results indicate that the antiviral agent (rotlerin liposome) of the present invention exhibits an antiviral effect, and particularly exhibits an excellent effect in a concentration-dependent manner.

실시예 5-3. 형광면역염색을 통해 확인한 항바이러스제(리포좀)의 항바이러스 효능Example 5-3. Antiviral efficacy of antiviral agent (liposome) confirmed through fluorescence immunostaining

로틀레린, 또는 로틀레린 리포좀의 PRRSV 바이러스 단백질 발현 억제 효과를 평가하기 위하여 5 μM의 로틀레린 리포좀 및 10 μM의 로틀레린을 처리하여 접종 48시간 후에 PRRSV 바이러스 뉴클레오캡시드에 대한 1차 항체 및 Alexa 488 2차 항체를 사용하여 형광면역염색을 진행하였다.In order to evaluate the inhibitory effect of rotlerin or rotlerin liposome on PRRSV virus protein expression, a primary antibody against PRRSV virus nucleocapsid and Alexa 488 were treated with 5 μM rotlerin liposome and 10 μM rotlerin 48 hours after inoculation. Fluorescence immunostaining was performed using a secondary antibody.

형광면역염색법을 이용한 분석을 통해 로틀레린 또는 로틀레린이 담지된 리포좀을 처리한 세포에서 바이러스의 단백질이 검출되지 않음을 확인하였다(도 13).It was confirmed that viral proteins were not detected in cells treated with rotlerin or liposomes loaded with rotlerin through an analysis using fluorescence immunostaining (FIG. 13).

상기 결과는 본 발명의 로틀레린 리포좀이 일반 로틀레린 보다 같은 농도 대비우수한 항바이러스 효과를 발휘하는 것을 나타낸다.The above results indicate that the rotlerin liposome of the present invention exhibits superior antiviral effect compared to the same concentration as that of general rotlerin.

실시예 6: 제조예 2에서 제조된 항바이러스제(로틀레린 리포좀)의 PRRS 바이러스 인터널리제이션(internalization)에 미치는 효능 평가Example 6: Efficacy evaluation of the antiviral agent (rotlerin liposome) prepared in Preparation Example 2 on PRRS virus internalization

실시예 6-1. qRT-PCR을 통해 확인한 항바이러스제(로틀레린 리포좀)의 PRRS 바이러스 인터널리제이션(internalization)에 미치는 효능 평가Example 6-1. Efficacy evaluation of the antiviral agent (rotlerin liposome) confirmed through qRT-PCR on PRRS virus internalization

항바이러스제(로틀레린 리포좀)의 PRRSV의 인터널리제이션(internalization)에 미치는 영향을 확인하기 위해 인터널리제이션 실험을 수행하였다. An internalization experiment was performed to confirm the effect of the antiviral agent (rotlerin liposome) on the internalization of PRRSV.

1.5 x 10⁵ 개/웰 농도로 MARK-145 세포를 24 웰 플레이트에 시딩하고 2일간 배양 후, CD163 항체 또는 항바이러스제(로틀레린 리포좀)을 2시간동안 37 ℃에서 처리하였다. 그 후 세포를 세척하고, 세포를 0.03 MOI 농도의 PRRSV FL12로 감염 및 항바이러스제(로틀레린 리포좀)을 1시간 동안 37 ℃에서 처리하였다. 세척 후, 세포는 추가적으로 항바이러스제(로틀레린 리포좀)을 처리한 후 2시간동안 37 ℃에서 처리하였다. 마지막으로, 세포외 바이러스를 제거하기 위해 45분동안 4 ℃에서 Pro K(Proteinase K, Takara, Korea)를 처리하였다. MARK-145 cells at a concentration of 1.5 x 10 ⁵ cells/well were seeded in 24-well plates and cultured for 2 days, followed by treatment with CD163 antibody or antiviral agent (rotlerin liposome) at 37°C for 2 hours. Thereafter, the cells were washed, and the cells were infected with PRRSV FL12 at a concentration of 0.03 MOI and treated with an antiviral agent (rotlerin liposome) at 37° C. for 1 hour. After washing, the cells were additionally treated with an antiviral agent (rotlerin liposome) and then treated at 37° C. for 2 hours. Finally, to remove extracellular virus, Pro K (Proteinase K, Takara, Korea) was treated at 4 °C for 45 minutes.

PRRSV의 수용체로 알려진 CD163 항체를 처리한 그룹은 항바이러스 효과에 대한 양성대조군으로 사용하였다.The group treated with the CD163 antibody known as the PRRSV receptor was used as a positive control for antiviral effect.

실험결과, 로틀레린 리포좀을 처리한 그룹에서 CD163 항체를 처리한 그룹보다는 낮은 효과를 보였으나 유의미하게 세포내 바이러스의 역가가 감소하였다 (도 14) (*: p<0.05, **: p<0.01, ***: P<0.001, ***: P<0.0001). 상기 결과는 본 발명의 항바이러스제(로틀레린 리포좀)가 PRRSV의 인터널리제이션를 감소시키는 것을 나타낸다. As a result, the rotlerin liposome-treated group showed a lower effect than the CD163 antibody-treated group, but the intracellular virus titer was significantly decreased ( FIG. 14 ) (*: p<0.05, **: p<0.01) , ***: P<0.001, ***: P<0.0001). The above results indicate that the antiviral agent (rotlerin liposome) of the present invention reduces the internalization of PRRSV.

실시예 7: 제조예 2에서 제조된 동물 모델을 통해 확인한 항바이러스제(리포좀)의 PRRSV에 대한 항바이러스 효능Example 7: Antiviral efficacy against PRRSV of the antiviral agent (liposome) confirmed through the animal model prepared in Preparation Example 2

목적동물에 대한 유효성 평가는 4주령의 돼지를 사용하여 시험하였다. 총 15마리의 돼지를 사용하였으며 각 군은 양성 PRRSV FL12 투여군, 로틀레린 리포좀 100 μg 투여군(R-L 100 μg), 로틀레린 리포좀 1 mg 투여군(R-L 1 mg), 로틀레린 원료물질 1 mg 투여군(R 1 mg)으로 분류하였으며 각 4마리씩 사용하였다 (로틀레린 리포좀 100 μg 투여군은 3마리).Efficacy evaluation for the target animal was tested using pigs of 4 weeks of age. A total of 15 pigs were used, and each group was a group administered with positive PRRSV FL12, a group administered with rotlerin liposome 100 μg (R-L 100 μg), a group administered with rotlerin liposome 1 mg (R-L 1 mg), and a group administered with rotlerin raw material 1 mg (R 1). mg), and 4 mice were used each (3 mice in the rotlerin liposome 100 μg group).

각 그룹의 돼지는 10⁵ TCID₅₀/ml의 FL12 바이러스를 접종하였으며 접종 후 각 치료제를 비강내에 스프레이 형태로 2 ml 분무하여 투여하였다. Pigs in each group were inoculated with FL12 virus of 10 ⁵ TCID ₅₀ /ml, and after inoculation, each treatment was administered by spraying 2 ml of each treatment in the form of a nasal spray.

돼지는 1, 3, 7, 14, 19 일에 혈청을 분리하였고 접종 19 일차에 안락사 및 부검을 실시하였다. 각 돼지의 폐 조직을 채취하고 병변을 평가하여 폐 병변 지수를 산출하였다. Pigs were separated from serum on days 1, 3, 7, 14, and 19, and euthanized and necropsied on day 19 of inoculation. Lung tissue from each pig was collected and lesions were evaluated to calculate a lung lesion index.

군army FL12FL12 R-L 100 μgR-L 100 μg R-L 1 mgR-L 1 mg R 1 mgR 1 mg 동물의 수number of animals 44 33 44 44 로틀레린-리포좀 용량Lotlerin-Liposome Dose -- 100 μg100 μg 1 mg1 mg -- 로틀레린 용량Rotlerin Dosage -- -- -- 1 mg1 mg PRRSVPRRSV 10⁵ TCID₅₀/ml10 ⁵ TCID ₅₀ /ml 10⁵ TCID₅₀/ml10 ⁵ TCID ₅₀ /ml 10⁵ TCID₅₀/ml10 ⁵ TCID ₅₀ /ml 10⁵ TCID₅₀/ml10 ⁵ TCID ₅₀ /ml

실시예 7-1. 채혈된 혈청을 통해 확인한 항바이러스제(리포좀)의 PRRSV 치료효과Example 7-1. PRRSV treatment effect of antiviral agent (liposome) confirmed through blood collected serum

qRT-PCR로 확인한 viremia의 경우, 로틀레린 리포좀(R-L) 1 mg 군은 7 일차를 제외하고 FL12군보다 유의적으로 viremia가 감소하였다. 로틀레린 리포좀(R-L) 100 μg 군은 14 일차, 19 일차에 FL12군보다 유의적으로 viremia가 감소하였다. AUC(area under curve)를 FL12군과 비교했을 때, AUC는 로틀레린 리포좀(R-L) 1 mg 군 및 로틀레린(R) 1 mg 군에서 유의적으로 감소하였다(p ≤ 0.05) (도 15).In the case of viremia confirmed by qRT-PCR, the rotlerin liposome (R-L) 1 mg group significantly decreased viremia than the FL12 group except for the 7th day. The rotlerin liposome (R-L) 100 μg group significantly reduced viremia on days 14 and 19 compared to the FL12 group. When the area under curve (AUC) was compared with the FL12 group, the AUC was significantly decreased in the rotlerin liposome (R-L) 1 mg group and the rotlerin (R) 1 mg group (p ≤ 0.05) ( FIG. 15 ).

Titration으로 확인한 viremia의 경우, 로틀레린 리포좀(R-L) 1 mg 군은 7 일차를 제외하고 FL12군보다 유의적으로 viremia가 감소하였으며, 로틀레린 리포좀(R-L) 100 μg 군은 3 일차, 14 일차 및 19 일차에 FL12군보다 유의적으로 viremia가 감소하였다(도 16).In the case of viremia confirmed by titration, the rotlerin liposome (R-L) 1 mg group significantly decreased viremia than the FL12 group except on the 7th day, and the rotlerin liposome (R-L) 100 μg group on the 3rd, 14th and 19th days On the first day, viremia was significantly reduced compared to the FL12 group (FIG. 16).

돼지의 PRRSV 항체의 경우, 일자별로 항체가 차이는 유의적이지 않았으나, 14 일차에 모든 군에서 평균 항체가 양성이였다.In the case of porcine PRRSV antibody, the difference in antibody levels by day was not significant, but on day 14, the mean antibody levels were positive in all groups.

실시예 7-2. 부검을 통해 확인한 항바이러스제(리포좀)의 치료효과Example 7-2. The therapeutic effect of antiviral agents (liposomes) confirmed through autopsy

19 일차에 돼지를 부검하였을 시 폐의 육안 병변을 분석하여 폐병변지수(lung lesion score)를 확인하였고 로틀레린 리포좀(R-L) 100 μg 군 및 1 mg 군에서 미세폐병변이 감소하였다(도 17). At the autopsy of pigs on the 19th day, gross lesions of the lungs were analyzed to confirm the lung lesion score, and micropulmonary lesions were reduced in the rotlerin liposome (R-L) 100 μg group and 1 mg group (FIG. 17).

폐병변지수는 전체 폐를 엽별로 다음과 같이 점수를 두고 병변이 있을 경우 점수를 매겨 0부터 100까지 측정하였다: (배쪽 오른쪽 앞엽, 5; 배쪽 오른쪽 중간엽, 5; 배쪽 오른쪽 뒤엽, 12.5; 배쪽 왼쪽 앞엽, 5; 배쪽 왼쪽 중간엽, 5; 배쪽 왼쪽 뒤엽, 12.5; 덧엽, 5; 등쪽 오른쪽 앞엽, 5; 등쪽 오른쪽 중간엽, 5; 등쪽 오른쪽 뒤엽, 15; 등쪽 왼쪽 앞엽, 5; 등쪽 왼쪽 중간엽, 5; 등쪽 왼쪽 뒤엽, 15). The lung lesion index was measured from 0 to 100 by scoring the entire lung for each lobe as follows, and scoring any lesions: (ventral right anterior lobe, 5; ventral right middle lobe, 5; ventral right posterior lobe, 12.5; ventral left) anterior lobe, 5; ventral left medial lobe, 5; ventral left lobe, 12.5; lateral lobe, 5; dorsal right anterior lobe, 5; dorsal right medial lobe, 5; dorsal right posterior lobe, 15; dorsal left anterior lobe, 5; dorsal left medial lobe , 5; dorsal left posterior lobe, 15).

미세폐병변은 간질성 폐렴의 정도에 따라 0부터 4까지 다음과 같이 측정하였다: (0, 병변 없음; 1, 미약한 또는 절반 미만의 병변; 2, 보통의 또는 절반의 병변; 3, 중등도의 퍼진 또는 절반 초과의 병변; 4, 심각한 또는 꽉 찬 병변).Micropulmonary lesions were measured from 0 to 4 according to the severity of interstitial pneumonia as follows: (0, no lesion; 1, mild or less than half lesion; 2, moderate or half lesion; 3, moderate severity) spread or more than half of the lesion; 4, severe or full lesion).

실시예 7-3. 임상증상 관찰을 통해 확인한 항바이러스제(리포좀)의 치료효과Example 7-3. Therapeutic effects of antiviral agents (liposomes) confirmed through observation of clinical symptoms

로틀레린 리포좀(R-L) 100 μg 군은 17, 18일차에 임상증상 스코어가 유의적으로 감소하였다. 로틀레린 리포좀(R-L) 1 mg 군은 8, 16, 17, 18일차에 임상증상 스코어가 유의적으로 감소하였다. 로틀레린(R) 1 mg 군은 8, 16, 17, 18 일차에 임상증상 스코어가 유의적으로 감소하였다(도 18).In the rotlerin liposome (R-L) 100 μg group, clinical symptom scores significantly decreased on days 17 and 18. In the rotlerin liposome (R-L) 1 mg group, clinical symptom scores significantly decreased on days 8, 16, 17, and 18. In the rotlerin (R) 1 mg group, the clinical symptom score significantly decreased on days 8, 16, 17, and 18 ( FIG. 18 ).

임상증상 스코어링은 각각의 돼지에 대해 다음과 같이 점수를 두고 매일 측정하였다: 0, 정상; 1, 스트레스가 있을 때 미약한 호흡곤란 또는 빈호흡; 2, 쉴 때 미약한 호흡곤란 또는 빈호흡; 3, 스트레스가 있을 때 중등도의 호흡곤란 또는 빈호흡; 4, 쉴 때 중등도의 호흡곤란 또는 빈호흡; 5, 스트레스가 있을 때 심각한 호흡곤란 또는 빈호흡; 6, 쉴 때 심각한 호흡곤란 또는 빈호흡.Clinical symptom scoring was measured daily for each pig, scoring as follows: 0, normal; 1, mild dyspnea or tachypnea when stressed; 2, weak dyspnea or tachypnea at rest; 3, moderate dyspnea or tachypnea when stressed; 4, moderate dyspnea or tachypnea at rest; 5, severe shortness of breath or tachypnea when stressed; 6, severe dyspnea or tachypnea at rest.

상기 결과는 본 발명의 항바이러스제(리포좀)가 우수한 항바이러스 효과를 발휘하는 것을 나타낸다.The above results indicate that the antiviral agent (liposome) of the present invention exerts an excellent antiviral effect.

실시예 8: 항바이러스제(미세 입자, 리포좀)의 돼지 유행성 설사병(PED) 바이러스에 대한 효능 평가Example 8: Efficacy evaluation of antiviral agents (fine particles, liposomes) against porcine epidemic diarrhea (PED) virus

본 발명의 돼지 유행성 설사병 바이러스에 대한 효능을 MTT assay, 면역염색을 통해 확인하였다. 시험 바이러스로는 돼지 유행성 설사병 바이러스인 SGP-M1 및 SM 98 strain을 사용하였다. The efficacy against the porcine epidemic diarrhea virus of the present invention was confirmed through MTT assay and immunostaining. As test viruses, SGP-M1 and SM 98 strains, which are swine epidemic diarrhea virus, were used.

2.5x10⁵ Vero cell을 웰에 접종하여 2일간 배양하였다. 그 후, 항바이러스제(미세 입자, 리포좀) 250 μL (10, 5, 2.5, 1.25, 0.62, 0 μM)및 시험 바이러스인 SGP-M1 및 SM 98을 250 μL(200 TCID/웰)를 세포에 접종한 후 하루간 배양하였다(도 19).2.5x10 ⁵ Vero cells were inoculated into the wells and cultured for 2 days. After that, the cells were inoculated with 250 µL (10, 5, 2.5, 1.25, 0.62, 0 µM) of antiviral agents (fine particles, liposomes) and 250 µL (200 TCID/well) of the test viruses SGP-M1 and SM 98. and then cultured for one day (FIG. 19).

그 후, 상기 배양 결과물을 대상으로 MTT assay, 리얼타임 PCR, 형광면역염색을 수행하였다. Thereafter, MTT assay, real-time PCR, and fluorescence immunostaining were performed on the culture result.

MTT assay를 수행한 결과, SGP-M1을 접종한 군에서는 5 μM, 2.5 μM 또는 1.25 μM의 항바이러스제를 처리한 경우에서 세포의 생존율이 높게 나타났으며, SM-98을 접종한 군에서는 5 μM 또는 2.5 μM의 항바이러스제를 처리한 군에서 세포의 생존율이 높게 나타내었다 (도 20). As a result of performing the MTT assay, in the group inoculated with SGP-M1, the cell viability was high when 5 μM, 2.5 μM or 1.25 μM of the antiviral agent was treated, and 5 μM in the group inoculated with SM-98. Alternatively, the cell viability was high in the group treated with 2.5 μM of the antiviral agent (FIG. 20).

Anti-PEDV monoclonal IgG(메디안디노스틱, 대한민국)을 이용하여 형광면역염색을 수행한 결과, 항바이러스제의 농도가 증가할수록 바이러스 합포체(syncytium)의 형성이 억제되는 양상을 나타내었으며, 특히 2.5 μM 이상의 항바이러스제를 처리하는 경우 항바이러스 효과가 우수하게 나타내었다(도 21).As a result of fluorescent immunostaining using Anti-PEDV monoclonal IgG (Mediandinostic, Korea), as the concentration of the antiviral agent increased, the formation of virus syncytium was inhibited. When the antiviral agent was treated, the antiviral effect was excellent (FIG. 21).

즉, 항바이러스제(미세 입자, 리포좀)는 유행성 설사병 바이러스에 항바이러스 효과를 나타내며, 특히 5 μM 또는 2.5 μM의 농도에서 우수한 효과를 나타낸다. That is, the antiviral agent (fine particles, liposomes) exhibits an antiviral effect on the epidemic diarrhea virus, particularly at a concentration of 5 μM or 2.5 μM.

실시예 9: 항바이러스제(리포좀)의 고양이 코로나 바이러스에 대한 효능 평가Example 9: Efficacy evaluation of antiviral agents (liposomes) against feline coronavirus

본 발명의 조성물 및 렘데시비르의 병용 제제의 고양이 코로나 바이러스에 대한 효과를 RT-PCR을 통해 확인하였다. 구체적인 실험 방법은 다음과 같다. The effect of the composition of the present invention and the combination preparation of remdesivir on feline coronavirus was confirmed through RT-PCR. The specific experimental method is as follows.

Patho Gene-spin?? DNA/RNA Extraction Kit (Intron bio, korea)를 사용하여 혈청에서 바이러스의 RNA를 추출하였으며, Maxime?? RT-PCR PreMix (Intron bio, korea)를 사용하여 RT-PCR 진단을 수행하였다. RT-PCR에 사용된 프라이머는 FCoV-F (5'-ACG GTG TCT TCT GGG TTG CAA G-3', 서열번호 4)와 FCoV-R (5'-GGC TAT GAT TGT ATC CTC AAC AT-3', 서열번호 5)을 사용하였으며 키트 제조사의 방법에 따라 실험을 수행하였다. RT-PCR의 조건은 45도 30분, 95도 5분을 수행한 이후, 95도 30초, 52도 30초, 72도 45초 단계를 35회 반복 수행 후 72도 7분간 반응하였다. 반응 된 PCR 산물은 2% 아가로즈 겔에 전기영동하여 밴드를 확인하였다.Patho Gene-spin?? Virus RNA was extracted from serum using DNA/RNA Extraction Kit (Intron bio, korea), and Maxime?? RT-PCR Diagnosis was performed using PreMix (Intron bio, Korea). The primers used for RT-PCR were FCoV-F (5'-ACG GTG TCT TCT GGG TTG CAA G-3', SEQ ID NO: 4) and FCoV-R (5'-GGC TAT GAT TGT ATC CTC AAC AT-3'). , SEQ ID NO: 5) was used, and the experiment was performed according to the kit manufacturer's method. RT-PCR conditions were 45 degrees 30 minutes, 95 degrees 5 minutes, 95 degrees 30 seconds, 52 degrees 30 seconds, 72 degrees 45 seconds steps were repeated 35 times, followed by a reaction at 72 degrees 7 minutes. The reacted PCR product was electrophoresed on a 2% agarose gel to confirm the band.

위와 같은 방법으로 FIP (Feline infectious peritonitis)의 진단을 수행하여 양성이 확인된 고양이에게 리포좀 제제(로틀레린 1 mg/ml, 렘데시비르 1 mg/ml)를 각각 0.3 ml를 비강을 통하여, 1ml를 복강에 투여하였으며, 각 주사는 3일 간격으로 수행하였고, 혈액은 주사 전 채취하여 바이러스의 유무를 판단하였다.Perform the diagnosis of FIP (Feline infectious peritonitis) in the same way as above and inject 0.3 ml each of the liposome preparation (Rotlerin 1 mg/ml, Remdesivir 1 mg/ml) to the cat confirmed positive through the nasal passages, 1 ml It was administered intraperitoneally, and each injection was performed every 3 days, and blood was collected before injection to determine the presence or absence of virus.

처음 전혈과 혈청에서 FIP에 대하여 양성 밴드가 확인된 고양이는 1차 치료제를 투여 3일후에 전혈과 혈청 모두 바이러스의 RNA가 검출되지 않았다. 또한 2차, 3차 치료제 투여 후 9일 후에도 지속적으로 바이러스의 RNA가 검출되지 않았으며, 2차 투여 후 FIP에 대한 임상증상이 없어지고 자발식이가 회복되었으며 5일차까지 지속되던 설사 증상이 회복되었다(도 22). In cats, for which a positive band for FIP was first confirmed in whole blood and serum, viral RNA was not detected in both whole blood and serum 3 days after administration of the first treatment. In addition, the virus RNA was not continuously detected even after 9 days after administration of the second and third treatments, and after the second administration, clinical symptoms of FIP disappeared, spontaneous diet was restored, and diarrhea symptoms that persisted until the fifth day were recovered. (Fig. 22).

도 25에서 각 기호는 다음을 의미한다: N: 음성 대조군, P: 양성 대조군, Pre_W: 치료제 투여 전 전혈, Pre_S: 치료제 투여 전 혈청, 1W: 치료제 1차 투여 3일 후 전혈, 1S: 치료제 1차 투여 3일 후 혈청, 2W: 치료제 2차 투여 3일 후 전혈, 2S: 치료제 2차 투여 3일 후 혈청, 3W: 치료제 3차 투여 3일 후 전혈, 3S: 치료제 3차 투여 3일 후 혈청.In Fig. 25, each symbol means: N: negative control, P: positive control, Pre_W: whole blood before administration of therapeutic agent, Pre_S: serum before administration of therapeutic agent, 1W: whole blood 3 days after first administration of therapeutic agent, 1S: therapeutic agent 1 Serum 3 days after the first administration, 2W: Whole blood 3 days after the 2nd administration of the treatment, 2S: Serum 3 days after the 2nd administration of the treatment, 3W: Whole blood 3 days after the 3rd administration of the treatment, 3S: Serum 3 days after the 3rd administration of the treatment .

따라서, 본 발명의 로틀레린을 포함하는 조성물은 고양이 복막염 바이러스에 대해서도 우수한 항바이러스 효과를 나타내는 것을 알 수 있었다.Therefore, it was found that the composition containing rotlerin of the present invention exhibits an excellent antiviral effect against feline peritonitis virus.

실시예 10: 항바이러스제(리포좀)의 인플루엔자 바이러스에 대한 효능 평가Example 10: Efficacy evaluation of antiviral agents (liposomes) against influenza virus

또한, 본 발명자들은 본 발명의 항바이러스제(리포좀)의 인플루엔자 바이러스에 대한 효능을 평가하기 위하여 마우스의 골수유래 대식세포(bone marrow derived macrophage, BMDM)에 H1N1형의 인플루엔자 백신주(A/Brisbane/59/2007 Reassortant virus IVR-148(H1N1))를 MOI 2로 접종하였다. 바이러스만을 접종한 양성대조군, 바이러스 및 로틀레린 리포좀 (2.5 μM, 5 μM, 10 μM)를 접종한 군으로 나누고, 접종후 0시간, 12시간, 24시간, 48시간, 및 72시간에 real-time PCR을 통하여 바이러스의 genome copy number를 측정하였다. 결과는 도 23에 나타내었다. 도 23에 나타낸 바와 같이, 로틀레린 리포좀의 농도가 높아질수록 인플루엔자 바이러스 게놈의 복제 수가 감소하였다. 구체적으로는 접종 72시간 후 2.5 μM에서 1.4 log, 5 μM에서 3.7 log, 10 μM에서 3.6 log가 감소하는 것으로 나타났으며, 이 감소 값은 각각 96.6%, 99.98% 99.97%의 값이었다. 따라서, 본 발명의 로틀레린을 포함하는 조성물은 인플루엔자 바이러스에 대해서도 우수한 항바이러스 효과를 나타내는 것을 알 수 있었다. In addition, the present inventors in order to evaluate the efficacy of the antiviral agent (liposome) of the present invention against influenza virus H1N1 influenza vaccine strain (A / Brisbane / 59 / bone marrow derived macrophage, BMDM) of mice 2007 Reassortant virus IVR-148 (H1N1)) was inoculated at MOI 2. A positive control group inoculated with virus only, virus and rotlerin liposome (2.5 μM, 5 μM, 10 μM) were divided into groups inoculated, and real-time at 0 hours, 12 hours, 24 hours, 48 hours, and 72 hours after inoculation. The genome copy number of the virus was measured through PCR. The results are shown in FIG. 23 . As shown in FIG. 23 , as the concentration of the rotlerin liposome increased, the number of copies of the influenza virus genome decreased. Specifically, it was found that 1.4 log at 2.5 μM, 3.7 log at 5 μM, and 3.6 log at 10 μM after inoculation 72 hours after inoculation decreased, and these reduction values were 96.6%, 99.98% and 99.97%, respectively. Therefore, it was found that the composition containing rotlerin of the present invention exhibits excellent antiviral effect against influenza virus.

결론적으로, 로틀레린을 포함하는 조성물은 돼지생식기호흡기증후군 바이러스, 코로나 바이러스, 및 인플루엔자 바이러스 등 여러 가지 바이러스에 대해 우수한 항바이러스 효과를 나타내며, 다양한 제형(미세 입자, PDA 코팅, 리포좀)의 형태에서도 우수한 항바이러스 효과를 나타낸다.In conclusion, the composition containing rotlerin shows an excellent antiviral effect against various viruses such as porcine reproductive and respiratory syndrome virus, corona virus, and influenza virus, and is excellent even in the form of various formulations (fine particles, PDA coating, liposome). It exhibits antiviral effect.

<110> QVet <120> Composition for Preventing or Treating Viral Infections Comprising Rottlerin as an active ingredient <130> PN210144P <150> KR 10-2021-0046145 <151> 2021-04-08 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SARS-CoV2-nsp10-F <400> 1 ttgtgatcaa ctccgcgaac 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SARS-CoV2-nsp10-R <400> 2 taagacgggc tgcacttaca 20 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SARS-CoV2-nsp10-P <400> 3 ccatgcttca gtcagctgat gcaca 25 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FCoV-F <400> 4 acggtgtctt ctgggttgca a 21 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> FCoV-R <400> 5 ggctatgatt gtatcctcaa cat 23 <110> QVet <120> Composition for Preventing or Treating Viral Infections Comprising Rotttlerin as an active ingredient <130> PN210144P <150> KR 10-2021-0046145 <151> 2021-04-08 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SARS-CoV2-nsp10-F <400> 1 ttgtgatcaa ctccgcgaac 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SARS-CoV2-nsp10-R <400> 2 taagacgggc tgcacttaca 20 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SARS-CoV2-nsp10-P <400> 3 ccatgcttca gtcagctgat gcaca 25 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FCoV-F <400> 4 acggtgtctt ctgggttgca a 21 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> FCoV-R <400> 5 ggctatgatt gtatcctcaa cat 23

Claims

In the pharmaceutical composition for the prevention or treatment of viral infection comprising rotlerin as an active ingredient, the virus is porcine reproductive and respiratory syndrome virus, porcine epidemic diarrhea virus (PEDV), and feline coronavirus (feline coronavirus) : FCoV) is at least one virus selected from the group consisting of, a pharmaceutical composition.

The pharmaceutical composition according to claim 1, wherein the rotlerin is a fine particle.

delete

The pharmaceutical composition according to claim 1, wherein the rotlerin is contained in liposomes composed of lipids.

The pharmaceutical composition of claim 4, wherein the lipid comprises phosphatidylcholine and a sterol-based compound.

The pharmaceutical composition according to claim 5, wherein the phosphatidylcholine and the sterol-based compound have a molar ratio of 0.1-15:1.

The pharmaceutical composition according to claim 4, wherein the lipid and rotlerin have a weight ratio of 0.1-150:1.

According to claim 5, wherein the phosphatidylcholine is hydrogenated soy phosphatidylcholine (HSPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (1,2-Dimyristoyl-sn-Glycero) -3-Phosphocholine, DMPC), 1,2-dihexanoyl-sn-glycero-3-phosphocholine (1,2-dihexanoyl-sn-glycero-3-phosphocholine, DHPC), 1,2-dihepta Noyl-sn-glycero-3-phosphocholine (1,2-diheptanoyl-sn-glycero-3-phosphocholine), 1,2-dioctanoyl-sn-glycero-3-phosphocholine (1,2-diheptanoyl-sn-glycero-3-phosphocholine) -dioctanoyl-sn-glycero-3-phosphocholine, 1,2-dinonanoyl-sn-glycero-3-phosphocholine), 1,2-didecanoyl-sn-glycero-3-phosphocholine (1,2-didecanoyl -sn-glycero-3-phosphocholine), 1,2-diundecanoyl-sn-glycero-3-phosphocholine (1,2-diundecanoyl-sn-glycero-3-phosphocholine), 1,2-di Lauroyl-sn-glycero-3-phosphocholine (1,2-dilauroyl-snglycero-3-phosphocholine, DLPC), 1,2-ditridecanoyl-sn-glycero-3-phosphocholine ( 1,2-ditridecanoyl-snglycero-3-phosphocholine), 1,2-dipentadecanoyl-sn-glycero-3-phosphocholine (1,2-dipentadecanoyl-sn-glycero-3-phosphocholine), 1, 2-Dipalmitoyl-sn-glycero-3-phosphocholine (1,2-dipalmitoyl-sn-glycero-3-phosphocholine, DPPC), 1,2-diheptadecanoyl-sn-glycero-3- 1,2-diheptadecanoyl-sn-glycero-3-phosphocholine and 1,2-distearoyl-sn-glycero-3-phosphocholine (1,2-distearoyl-sn) -glycero-3-phosphocholine, DSPC) will be selected from the group consisting of, a pharmaceutical composition.

The method of claim 5, wherein the sterol-based compound is cholesterol, 3b-[N-(N',N'-dimethylaminoethane)-carbamyl}cholesterol (3b-[N-(N',N'-dimethylaminoethane)- cabamyl]cholesterol, DC-Chol, stigmasterol, campesterol, sitosterol, ergosterol, lanosterol, dinosterol, gorgosterol, avenasterol, saringosterol, fucosterol, cholesteryl hemisuccinate, cholesteryl benzoate, cholesteryl oleate oleate), cholesteryl oleyl carbonate, cholesteryl isostearate, cholesteryl linoleate, cholesteryl acetate, cholesteryl palmitate (cholesteryl palmitate), cholesteryl stearate (cholesteryl stearate), cholesteryl chloride (Cholesteryl chloride), cholesteryl nonanoate (Cholesteryl nonanoate) and selected from the group consisting of cholesteryl arachidonate (Cholesteryl arachidonate) which will be, a pharmaceutical composition.

delete

The pharmaceutical composition of claim 1, wherein the pharmaceutical composition is administered intranasally.

In the feed additive for the prevention or improvement of viral infections containing rotlerin, the virus is porcine reproductive and respiratory syndrome virus, porcine epidemic diarrhea virus (PEDV), and feline coronavirus (FCoV). One or more viruses selected from the group consisting of, a feed additive.

In the method of treating a viral infection comprising administering the pharmaceutical composition of claim 1 to mammals or poultry other than humans, the virus is a porcine reproductive and respiratory syndrome virus, porcine epidemic diarrhea virus (PEDV), and one or more viruses selected from the group consisting of feline coronavirus (FCoV), a method of treatment.