KR102435515B1 - Kit for diagnosing stem cell senescence - Google Patents

Abstract

It relates to a composition for diagnosing senescence of stem cells, comprising a gene encoding a deubiquitin protein or an agent capable of specifically detecting the expression level of the protein, and it is possible to determine whether the senescence of the stem cells is progressing. It can be usefully used to evaluate the quality of stem cells used in therapeutics.

Description

Kit for diagnosing stem cell senescence

It relates to a composition for diagnosing aging of stem cells, comprising an agent capable of specifically detecting a gene encoding a deubiquitin protein or an expression level of the protein.

As part of an effort to overcome the limitations of existing treatment regimens for various intractable diseases, research on regenerative medicine cell therapy using stem cells is being actively conducted around the world with the goal of replacing damaged cells and regenerating them to restore their original functions. . In particular, mesenchymal stem cells among various stem cells have self-renewal ability and differentiation ability into cells of various tissues, suppress immune rejection, and damage when administered in the body. Efforts to be applied to a wide variety of diseases are being actively applied based on research results that move to the site to replace damaged cells or secrete various growth factors and cytokines to inhibit disease and promote regeneration of damaged areas.

Meanwhile, various treatment results using autologous stem cells have recently been reported in various diseases. Stem cells may be affected by the donor's condition, and stem cells of the elderly may have a lower function compared to stem cells of young people due to cellular aging. Therefore, it is necessary to identify the enzymes involved in the aging of stem cells.

One aspect is to provide a composition for diagnosing senescence of stem cells, comprising an agent capable of specifically detecting a gene encoding a deubiquitin protein or an expression level of the protein.

Another aspect is to provide a kit for diagnosing senescence of stem cells comprising the composition.

Another aspect is to provide an information providing method for predicting or diagnosing aging of stem cells, comprising measuring the expression level of a gene or protein encoding a de-ubiquitin protein from stem cells.

Another aspect is to provide a composition for inhibiting the proliferation, differentiation or aging of stem cells comprising an expression promoter of a gene encoding a deubiquitin protein as an active ingredient.

Another aspect is to provide a cell therapy composition for the prevention or treatment of senescence-related diseases comprising an expression promoter of a gene encoding a deubiquitin protein as an active ingredient.

One aspect provides a composition for diagnosing aging of stem cells, comprising an agent capable of specifically detecting a gene encoding a deubiquitin protein or an expression level of the protein. In one embodiment, the de-ubiquitin protein may be USP1, USP12, or TNFαIP3. Specifically, the protein is SEQ ID NO: 1 and 2; SEQ ID NOs: 3 and 4; And it may be one selected from the group consisting of SEQ ID NOs: 5 and 6.

As used herein, the term "agent capable of specifically detecting a gene" refers to a substance that can be used to specifically identify or detect a gene encoding the de-ubiquitin protein, for example, USP1, USP12, or TNFαIP3. it means. The agent capable of specifically detecting the gene may be a primer, a probe, or an antisense nucleic acid. Specifically, the primer, probe or antisense nucleic acid can be prepared by those skilled in the art for EZH2 It can be designed based on the nucleotide sequence of the genetic variant.

As used herein, the term "primer" refers to a nucleic acid sequence having a short free 3' hydroxyl group, capable of forming a complementary template and base pair, and serving as a starting point for template strand copying. It means a nucleic acid sequence of 7 to 50nt. The sequence of the primer does not necessarily have to be exactly the same as the sequence of the template, but only if it is sufficiently complementary to hybridize with the template. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for a polymerization reaction (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature. Can be.PCR conditions, sense and antisense primer length can be modified based on known in the art.Therefore, PCR using sense and antisense primers of nucleotide sequence region of EZH2 gene mutant Amplification can be performed to predict survival prognosis following chemotherapy in lung cancer patients.

The term, "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases in length that can form specific binding to mRNA, and is labeled to determine the presence or absence of a specific mRNA. can The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like. Selection of appropriate probes and hybridization conditions can be modified based on those known in the art. Therefore, by performing hybridization using a probe complementary to the nucleotide sequence of the EZH2 gene variant, the survival prognosis according to chemotherapy in lung cancer patients can be predicted by determining whether hybridization occurs.

The term "antisense nucleic acid" refers to a nucleic acid-based molecule that has a sequence complementary to a target EZH2 gene variant and can form a dimer with the EZH2 gene variant, and can be used to detect EZH2 gene variants.

The antisense nucleic acid may be the polynucleotide or a fragment thereof, or complementary thereto. The fragment may have nucleotides of 5 nt or more, 10 nt or more, 10 to 1000 nt, 10 to 500 nt, 15 to 500 nt, 15 to 300 nt, 15 to 200 nt, or 15 to 150 nt, but an appropriate length to increase detection specificity You can choose.

As used herein, the term "agent capable of specifically detecting a protein" refers to a substance that can be used to specifically identify or detect the de-ubiquitin protein. The agent capable of specifically detecting the protein may be an antibody, an antibody fragment, an antibody mimic, an aptamer, an avidity multimer, or a peptidomimerics. A method for generating an antibody using a de-ubiquitin protein can be easily prepared by a person skilled in the art using techniques known in the art. For example, in the case of polyclonal antibodies, deubiquitin antigens are injected into animals and blood is collected from animals to be produced by methods well known in the art to obtain serum containing antibodies, and such polyclonal antibodies are goat, rabbit, It can be prepared from a host of any animal species, such as sheep, monkeys, horses, pigs, cattle, dogs, and the like. Monoclonal antibodies may be prepared using a hybridoma method well known in the art, or may be prepared using a phage antibody library technology. In addition, the antibody may include a functional fragment of an antibody molecule as well as a complete form having two full-length light chains and two full-length heavy chains. The functional fragment of the antibody molecule means a fragment having at least an antigen-binding function, and includes Fab, F(ab'), F(ab') 2 and Fv.

The stem cells are not limited as long as they have multipotent properties, and may be derived from adult cells such as mammals, including humans, and all known tissues and cells derived from humans. In addition, the stem cells may be cells proliferated by in vivo cell culture for use as a stem cell therapeutic agent, and isolated from the bone marrow, umbilical cord, umbilical cord blood, fat, muscle, skin, amniotic membrane or placenta of a patient for stem cell therapeutics. It may be a cell. . For example, the stem cells may be mesenchymal stem cells derived from human fat, bone marrow, placenta, or umbilical cord blood.

As used herein, the term "senescence of stem cells" refers to various stresses that mesenchymal stem cells receive from the inside or outside (eg, high-concentration oxygen conditions during continuous passage culture and in vitro culture, etc.), growth) means a regular or significantly delayed phenomenon, and may include cell growth arrest or delay independent of telomere shortening of mesenchymal stem cells.

Another aspect provides a kit for diagnosing aging of stem cells comprising the composition.

The kit diagnoses the aging of stem cells by specifically detecting the expression level of the deubiquitin gene or the protein encoded by the gene in the mesenchymal stem cells proliferated by in vivo cell culture or in the mesenchymal stem cells isolated from the patient. can do.

The kit may include a primer, a probe or an antisense nucleic acid capable of specifically detecting a gene encoding a deubiquitin protein, for example, USP1, USP12, or TNFαIP3, and in addition, one or more other suitable for analysis A component composition, solution or device may be included.

Specifically, the kit may be an RT-PCR kit, a microarray chip kit, or a protein chip kit.

The RT-PCR kit may include essential elements required for performing RT-PCR in order to specifically detect the gene encoding the deubiquitin protein. The RT-PCR kit contains, in addition to each pair of primers specific for a specific site of the deubiquitin gene, a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC-water, sterile water, and the like. The kit may also include instructions for use. The instructions for use include, for example, when the target sequence is amplified in the amplification reaction using the specific primer, and the target sequence is not amplified in the amplification reaction using the non-specific primer, among the samples used for amplification, the anticancer drug for lung cancer patients. Determining that there is a sequence associated with low reactivity and poor survival prognosis, and from the result, including a description of predicting survival prognosis according to chemotherapy in lung cancer patients, including explanation of outcome judgment can do.

The microarray chip may include a DNA or RNA polynucleotide probe. The microarray means that the probes are immobilized at a high density on the separated regions of the substrate surface. The microarray may include a conventional microarray configuration except for including a probe specific for a specific region of the deubiquitin gene.

In addition, hybridization of nucleic acids on microarrays and detection of hybridization results are well known in the art. In the detection, the nucleic acid sample is labeled with a fluorescent substance, for example, a label capable of generating a detectable signal including a substance such as Cy3 and Cy5, and then hybridized on a microarray and a signal generated from the labeling substance. By detecting the hybridization result can be detected. The kit may also include instructions for use.

The protein chip kit can measure the expression level of the de-ubiquitin protein. The protein chip kit may include a substrate, a suitable buffer solution, a secondary antibody labeled with a chromogenic enzyme or a fluorescent material, a chromogenic substrate, and the like for immunological detection of the antibody. As the chromogenic enzyme, peroxidase, alkaline phosphatase, and the like may be used. In addition, FITC, RITC, etc. may be used as a fluorescent material, and ABTS (2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)), OPD (o-phenyl) as a color developing substrate. rendiamine), TMB (tetramethyl benzidine), and the like can be used. The kit may also include instructions for use.

Another aspect provides an information providing method for predicting or diagnosing aging of stem cells, comprising measuring the expression level of the gene or the protein encoding the deubiquitin protein from the stem cells. Specific details of the gene encoding the de-ubiquitin protein are as described above.

The method according to one embodiment includes measuring the expression level of a gene or protein encoding a de-ubiquitin protein from stem cells. The method of measuring the expression level of the gene encoding the de-ubiquitin protein or the expression level of the protein may be performed by a known process by isolating mRNA or protein from a sample using a known technique.

Specifically, the measurement of the expression level of the gene encoding the deubiquitin protein is to measure the level of mRNA, and as a method for measuring the level of mRNA, for example, reverse transcription polymerase reaction, competitive reverse transcription polymerase reaction, real time Reverse transcription polymerase reaction, large-capacity polymerase reaction, RNase protection assay (RPa), Northern blotting, or DNA chip.

In addition, the amount of de-ubiquitin protein expression can be measured using an antibody. An antibody specific for ubiquitin protein in the sample forms a binding substance, that is, an antigen-antibody complex, and the amount of antigen-antibody complex formed is determined by a detection label ( It can be quantitatively measured through the magnitude of the signal of the edetedction label). The detection label may be selected from the group consisting of an enzyme, a fluorescent substance, a ligand, a luminescent substance, a microparticle, a redox molecule, and a radioisotope. As an analysis method for measuring the protein level, for example, Western blotting, ELISA, radioimmunoassay, radioimmunodiffusion method, Ouchterlony immunodiffusion method, rocket immunoelectrophoresis, immunohistochemical staining, immunohistochemistry Precipitation analysis, complement fixation analysis, FACS or protein chip, etc. are available.

The method according to one embodiment may further include determining that the aging of the stem cells is progressing when the expression level of the gene encoding the ubiquitin protein or the protein is increased compared to the control. Stem cells determined to be senescent according to the above method may be used as a basis for determining whether stem cells can function properly or properly before using the stem cells as a cell therapeutic agent. Therefore, it can be developed as a stem cell therapeutic agent by inhibiting the aging of stem cells by regulating the expression of genes related to the activity of deubiquitination enzymes.

Another aspect provides a composition for inhibiting the proliferation, differentiation or aging of stem cells comprising an expression promoter of a gene encoding a deubiquitin protein as an active ingredient. Another aspect provides a method for inhibiting proliferation, differentiation or aging of stem cells, comprising the step of promoting the expression or activity of a gene encoding a deubiquitin protein in the stem cells. Specific details of the gene encoding the de-ubiquitin protein are as described above.

In one embodiment, the expression promoter of the gene encoding the de-ubiquitin protein may be PDGF or the like. By promoting the expression of the gene encoding the de-ubiquitin protein, the expression of the de-ubiquitin protein is increased, and thus the proliferation, differentiation or aging of stem cells can be suppressed. In one embodiment, by treating the stem cells with an agent that promotes the expression of USP1, it was confirmed that the osteogenic differentiation ability of the stem cells was improved. Therefore, the composition according to one aspect can inhibit stem cell proliferation, differentiation or aging by increasing the expression of deubiquitin protein, and as a cell therapy agent for promoting bone formation and differentiation of stem cells treated with the composition. can be utilized

Another aspect provides a cell therapy composition for preventing or treating aging-related diseases, comprising an expression promoter of a gene encoding a deubiquitin protein as an active ingredient. Another aspect provides a method for preventing or treating a senescence-related disease comprising administering a therapeutically effective amount of a cell therapy agent to an individual. Specific details of the gene encoding the de-ubiquitin protein are as described above. The aging-related disease may be, for example, arthritis or osteoporosis.

The administration route of the cell therapy composition may be administered through any general route as long as it can reach the target tissue. Parenteral administration, for example, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, may be administered into blood.

The composition may be formulated in a suitable form together with a pharmaceutical carrier commonly used for cell therapy. "Pharmaceutically acceptable" refers to a composition that is physiologically acceptable and does not normally cause allergic reactions such as gastrointestinal disorders, dizziness, or similar reactions when administered to humans. Pharmaceutically acceptable carriers include, for example, carriers for parenteral administration such as water, suitable oils, saline, aqueous glucose and glycol, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. As other pharmaceutically acceptable carriers, reference may be made to those described in the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

The cell therapy composition of the present invention may contain a therapeutically effective amount of the cell therapy agent for the treatment of a disease.

An effective amount (therapeutically effective amount) means an amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human as considered by a researcher, veterinarian, physician or other clinician, which is a disease to be treated or an amount that induces alleviation of the symptoms of the disorder. It is apparent to those skilled in the art that the cell therapy agent included in the composition of the present invention will change depending on the desired effect. Therefore, the optimal content of the cell therapy agent can be easily determined by those skilled in the art, and the type of disease, the severity of the disease, the content of other components contained in the composition, the type of formulation, and the age, weight, general health status, sex and diet of the patient , administration time, administration route and secretion rate of the composition, treatment period, and drugs used at the same time may be adjusted according to various factors. In consideration of all of the above factors, it is important to include an amount that can obtain the maximum effect with a minimum amount without side effects. For example, the composition may contain 1×10 ⁴ cell/kg to 1×10 ⁸ cell/kg of a cell therapy agent.

The cell therapy agent promotes the proliferation of stem cells by promoting the expression of USP1, and thus can be usefully used for the prevention or treatment of senescence-related diseases.

It relates to determining the aging of stem cells by a gene encoding a de-ubiquitin protein or an agent for measuring the expression level of the protein according to an aspect, wherein stem cells proliferated by in vitro cell culture or stem cells isolated from a patient It can be used to determine whether aging has progressed or not, and can be usefully used to evaluate the quality of stem cells used in cell therapy products.

1 is a graph confirming the expression of senescence-related genes according to the number of passages of mesenchymal stem cells.
2 is a graph confirming the length of telomeres according to the number of passages of mesenchymal stem cells.
3 is a result of confirming the beta-galactosidase staining according to the number of passages of mesenchymal stem cells.
4 is a result of confirming the profiling of changes in the deubiquitin enzyme through multiplex PCR during aging of mesenchymal stem cells.
5 is a result of confirming the profiling of changes in the deubiquitin enzyme through microarray during the aging of mesenchymal stem cells.
6 is a graph showing the expression ratio of the deubiquitinated gene for each passage number of mesenchymal stem cells.
Figure 7 (a) shows the expression of USP1, USP12 and TNFα1P3 by passage number of mesenchymal stem cells, Figure 7 (b) is after knocking down USP1 with siRNA, USP1 gene expression in mesenchymal stem cells it has been confirmed
8 is a graph showing the expression level of senescence-related genes in mesenchymal stem cells after knockdown of USP1 with siRNA.
9a is a graph showing the degree of cell proliferation as an absorbance (OD) value after treatment of the mesenchymal stem cells with an expression inhibitor of USP1.
9B is a graph showing the degree of cell proliferation as an absorbance (OD) value after treatment of the mesenchymal stem cells with an expression promoter of USP1.
Figure 9c is a graph showing the degree of cell proliferation as an absorbance (OD) value after treating the mesenchymal stem cells with an expression promoter and/or inhibitor of USP1.
Figure 10a is the result of confirming the osteogenic differentiation in the aging mesenchymal stem cells by Alizarin Red S staining.
FIG. 10b shows the results of confirming whether or not bone differentiation in mesenchymal stem cells was performed by staining with Alizarin Red S after treating the mesenchymal stem cells with an expression promoter of USP1.
FIG. 10c shows the results of confirming whether or not bone differentiation in the mesenchymal stem cells was performed by staining with Alizarin Red S after the treatment of the mesenchymal stem cells with an expression inhibitor of USP1.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Securing of stem cells

Adipose tissue of healthy adults who obtained consent was obtained, chopped with a scalpel, and then added with collagenase Type I, and incubated for 60 minutes in a shaking incubator at 37°C. Thereafter, the lipids and adipocytes were separated by standing vertically for 5 minutes, the supernatant was removed, and the remaining cells were filtered with a cell strainer to obtain adipose-derived mesenchymal stem cells.

The subculture of the adipose-derived mesenchymal stem cell subculture step 1 (P1) cells was repeated until the proliferative ability of the cells stopped, and each was stored separately by the number of passages.

Example 2. Confirmation of cell aging of mesenchymal stem cells

In order to confirm whether the adipose-derived mesenchymal stem cells obtained in Example 1 are cellularly aging, SA-β-Gal (Senescence), an enzyme that promotes hydrolysis to monosaccharides in senescent cells as a direct marker of cellular aging -associated beta-galactosidase) activity was confirmed. Specifically, by purchasing a Senescence-β-Galactosidase Staining Kit from Cell Signaling Technology, the change in staining was observed at each passage number (passage 1, passage 3, passage 5, passage 7, passage 9, and passage 11) of ADMSCs.

1 is a graph confirming the expression of senescence-related genes according to the number of passages of mesenchymal stem cells, and FIG. 2 is a graph confirming the length of telomeres.

As shown in FIG. 1 , it was confirmed that the expression level of aging-related genes increased as the number of passages increased. In particular, the expression of p16, a type of cdk inhibitor, was significantly increased in P7 and P14 than in P1. In addition, as shown in FIG. 2 , it was confirmed that the length of the telomeres became shorter as the number of passages increased. Telomeres become shorter and shorter as cell division progresses, which is presumed to be the cause of determining aging and lifespan.

3 is a result of confirming whether beta-galactosidase staining according to the number of passages of mesenchymal stem cells. As shown in FIG. 3 , as the number of passages increased, it was confirmed that the ratio of staining with beta-galactosidase in mesenchymal stem cells increased. In particular, it was confirmed that the ratio increased more than 5 times in the passage number 11 compared to the passage number 1.

Example 3. Profiling of changes in deubiquitin enzymes

3-1. multiplex polymerase chain reaction (multiplex PCR)

The large-capacity polymerase chain reaction is a method of amplifying a plurality of target genes in the same reaction solution by using a plurality of primer pairs simultaneously, and 78 expressed in the mesenchymal stem cells P1, P7, and P15 obtained in Example 1 above. The deubiquitin enzymes in dogs were compared. The enzymes are as shown in Table 1 below. First, RNA for large-capacity polymerase chain reaction was extracted and cDNA was synthesized. Specifically, when the cells are 80-90% saturated in a 100 mm dish, RNA is extracted by lysing the cells using 1 ml of TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). did. Then, cDNA was synthesized using ReverTra Ace qPCR Master Mix (Toyobo Life Science, Osaka, Japan).

Next, PCR was performed according to the manufacturer's protocol using the cDNA synthesized above and the primers (Catalog Number MDCheck101 - MDCheck111) purchased from UbiProtein Corporation (Seongnam, Korea) (78 DUB genes) [ref: Kim SY, Kwon SK, Lee SY, and Baek KH: Ubiquitin-specific peptidase 5 and ovarian tumor deubiquitinase 6A are differentially expressed in p53+/+ and p53-/- HCT116 cells. Int J Oncol. 2018.]. Specifically, using 2X Multiplex PCR Smart Mix (Catalog Number SMP01-M25h; Solgent Co., Ltd., Daejeon, Korea), after initial denaturation at 95 ° C. for 15 minutes, 95 ° C. for 20 seconds 40 cycle was carried out. Thereafter, an annealing process was performed at 60° C. for 40 seconds, followed by an extension process at 72° C. for 1 minute and 72° C. for 3 minutes. The amplified polymerase chain reaction product was separated on 2% agarose gel and stained with StaySafe Nucleic Acid Gel Stain (Catalog Number RSS01; Real Biotech Corpration; RBC, Taipei, Taiwan). At this time, GAPDH was used as a control gene, and was analyzed using ImageJ v1.4.3.6.

USP5 USP11 USP34 JOSD2 EIF3S3 OTUD3 UCHL5 PAPR11 USP8 USP13 USP18 EIF3S5 ZRANB1 OTUD4 MYSM1 USP36 USP4 USP12 USP21 Ataxin3 OTUB1 YOD1 USP38 USP24 USP9X USP14 USP16 STAMBP OTUD1 OTUD7A USP31 MPND USP51 USP15 USP33 COPS5 TNFAIP3 USP35 USP28 USP32 USP27 USP54 USP53 PRPF8 OTUD5 USP26 BAP1 USP39 USP47 USP48 USP3 PSMD14 VCPIP1 USP17 CYLD USP37 USP42 USP46 USP19 PSMD7 OTUB2 USP50 USP43 USPL1 USP35 USP52 JOSD1 COPS6 OTUD6B USP9Y USP20 USP1 USP10 BRCC3 STAMBPL1 OTUD7B USP7 USP22

4 is a result of confirming the profiling of changes in the deubiquitin enzyme through multiplex PCR during aging of mesenchymal stem cells. As shown in FIG. 4 , as the number of passages of the mesenchymal stem cells increased, the expression levels of USP12, USP14, and USP15 increased, and it was confirmed that the expression levels of USP52 decreased (group 2). In addition, it was confirmed that the expression levels of USP10 and USP53 (group 3), PSMD14, PSMD7 and COPS6 expression levels (group 5) also increased as the number of passages of the mesenchymal stem cells increased. In the case of Group 6, as the number of passages of mesenchymal stem cells increased, the expression level of OTUD1 decreased, the expression level of TNFαIP3 increased, and in the case of Group 8, it was confirmed that the expression level of USP17 decreased. In addition, it was confirmed that the expression levels of UCHL5 (group 9) and USP31 (group 10) increased as the number of passages of the mesenchymal stem cells increased.

3-2. Microarray Analysis

Microarray analysis was performed to confirm the difference in genetic expression between the early and late subcultures of mesenchymal stem cells. The deubiquitin enzyme expression level of the mesenchymal cells of P7 and P15 obtained in Example 1 was screened. First, using an ND-1000 Spectrophotometer (NanoDrop, Wilmington, USA) and Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, USA), the quality of the RNA extracted in Example 3-1 was confirmed. Next, Affymetrix Whole transcript expression array was performed according to the manufacturer's protocol (GeneChip Whole Transcript PLUS reagent Kit). Specifically, cDNA was prepared using the GeneChip WT (Whole Transcript) Amplification kit. Then, the template cDNA was fragmented using the GeneChip WT Terminal labeling kit, and TdT (terminal deoxynucleotidyl transferase)-conjugated biotin was labeled at the end of the cDNA.

5.5 μg of biotin-labeled DNA target was hybridized with Affymetrix GeneChip Human 2.0 ST Array at 45° C. for 16 hours. After washing, staining was performed on a GeneChip Fluidics Station 450 and scanned on a GCS3000 Scanner (Affymetrix). Afterwards, the Signal values were converted to Affymetrix® GeneChip?? It was confirmed using the Command Console software. Raw data were obtained using the Affymetrix GeneChip® Command Console® Software (AGCC) program. Data in CEL files can be converted to Affymetrix® Expression Console?? Normalization was performed using the robust multi-average (RMA) method in Software (EC). Then, differentially expressed gene (DEG) analysis was performed. Specifically, the fold change values of the experimental group and the control group were compared, and gene-enrichment and functional annotation analysis were analyzed using gene ontology (http://geneontology.org/) and KEGG (http://kegg.jp). .

5 is a result of confirming the profiling of changes in the deubiquitin enzyme through microarray during the aging of mesenchymal stem cells.

As shown in FIG. 5 , various deubiquitination enzymes were changed as cells aged, but among them, USP1 decreased -2,45 times, showing the largest difference.

Example 4. Confirmation of survival and differentiation regulation of mesenchymal stem cells

PCR was performed to observe changes in gene expression for each passage number of the deubiquitination enzyme selected in Example 3 at the mRNA and protein levels.

First, 1000 μl of Trizol solution per 1 x 10 ⁵ cell for each mesenchymal stem cell passage (P1, P7, P15) obtained in Example 1 was added and ground, followed by centrifugation at 4 ° C., 12,000 x g for 10 minutes. . The supernatant was transferred to a new tube, chloroform was added, and the mixture was shaken vigorously. Again, the supernatant was transferred to a new tube, and isopropanol was added so that the ratio of the supernatant to isopropanol was 1:1. After shaking vigorously 10 times, leave at room temperature for 15 minutes, centrifuge at 12,000 x g, 4°C for 10 minutes, remove the supernatant, and add 1 ml of 70% ethanol to the remaining precipitate, 7,500 x g, 4°C for 5 minutes during centrifugation. After removing the ethanol, the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and the RNA pellet was dissolved using nuclease free water. Using a UV/VIS spectrophotometer (Beckman coulter, DU730), the concentration of the RNA sample extracted at 260 nm and 280 nm wavelength was measured, and the integrity of the RNA sample was confirmed by performing agarose gel electrophoresis.

cDNA was synthesized by performing reverse transcription on RNA samples extracted from mesenchymal stem cells using oligo dT primer and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA). PCR was performed using the cDNA obtained through reverse transcription as a template and the 5' and 3' flanking sequences of the gene cDNA to be amplified as primers, and the primer sequences used are shown in [Table 2]. 1 μl of the amplified PCR product was electrophoresed on a 1% agarose gel to confirm a DNA band.

gene primer SEQ ID NO: Base sequence (5'→3') Annealing temperature
(℃) USP1 F One TCAAGTTGTTCCTGCTGCAC 70 R 2 TGCAGCTTCCCTTATCCTTC USP12 F 3 TACATGGACCAGCTTCATCG 70 R 4 GATTGGGACCACTTCCACAG TNFαIP3 F 5 TGGTTCCAATTTTGCTCCTT 70 R 6 CGTTGATCAGGTGAGTCGTG

6 is a graph showing the expression ratio of the deubiquitinated gene for each passage number of mesenchymal stem cells. As shown in FIG. 6 , it was confirmed that the expression ratio of USP12 and TNFαIP3 genes increased as the number of passages increased. It can be confirmed that these results are consistent with the large-capacity polymerase chain reaction results of Example 3-1. Figure 7 (a) shows the gene expression of USP1, USP12 and TNFα1P3 by passage number of mesenchymal stem cells, Figure 7 (b) is after knocking down USP1 with siRNA, USP1 gene expression in mesenchymal stem cells will confirm

As shown in Figure 7 (a), as the number of passages of mesenchymal stem cells increased, the expression levels of USP1 and USP12 decreased, and it was confirmed that the expression level of TNFα1P3 increased. In addition, as shown in FIG. 7(b) , when USP1 was knocked down with siRNA, it was confirmed that the expression of USP1 was reduced.

Also previously reported (1. Wenjia Liu, Meng Qi, Anna Konermann, Liqiang Zhang, Fang Jin, Yan Jin. 2015. The p53/miR-17/Smurf1 pathway mediates skeletal deformities in an age-related model via inhibiting the function of mesenchymal stem cells.Aging.3, 205-218.

2. Li Y, Hu J, Guan F, Song L, Fan R, Zhu H, Hu X, Shen E, Yang B. 2013. Copper induces cellular senescence in human glioblastoma multiforme cells through downregulation of Bmi-1. Oncol Rep. 5, 1805-1810) to prepare primers for genes related to aging. When a candidate gene was knocked down or overexpressed, si-RNA was purchased to observe changes in aging-related genes at the mRNA level, and gene cloning was performed to perform transfection. After knocking down USP1 among candidate genes with siRNA, senescence-related genes of mesenchymal stem cells were analyzed.

8 is a graph showing the expression level of senescence-related genes in mesenchymal stem cells after knockdown of USP1 with siRNA.

As shown in FIG. 8 , when USP1 was knocked down with siRNA, it was confirmed that the expression of p16, p21, p53 and TNF-β was increased. On the other hand, it was confirmed that there was no significant difference in the expression level of IGFβP3. That is, by suppressing the expression of USP1 in senescent mesenchymal stem cells, the expression of the cdk inhibitor is increased, and thus it is possible to inhibit cell division, which may cause the arrest of the G1 phase of the DNA cycle.

Example 5. Confirmation of proliferation of mesenchymal stem cells through regulation of expression of USP1

In order to confirm that the proliferation of mesenchymal stem cells is regulated by increasing or decreasing the expression of USP1, a USP1 expression promoter and inhibitor were treated. Specifically, PDGF-bb, a USP1 expression promoter, was treated with mesenchymal stem cells at intervals of 2-3 days for 5 days. In addition, the USP1 expression inhibitor was treated with a pimozide solution diluted in DMSO at a ratio of 1000:1 to mesenchymal stem cells at intervals of 2-3 days for 5 days. Thereafter, 10 μg of CCK-8 solution per 100 μg of the culture medium was diluted, treated with mesenchymal stem cells, and the degree of absorption at a wavelength of 450 nm was measured. FIG. 9a is a graph showing the degree of cell proliferation as an absorbance (OD) value after treating mesenchymal stem cells with an expression inhibitor of USP1.

As shown in FIG. 9a , when pimozide, an inhibitor of USP1 expression, was treated, it was confirmed that the absorbance at a wavelength of 450 nm decreased in a concentration-dependent manner. That is, when the expression of USP1 is decreased, the proliferation of mesenchymal stem cells may be inhibited.

9B is a graph showing the degree of cell proliferation as an absorbance (OD) value after treatment of the mesenchymal stem cells with an expression promoter of USP1.

As shown in FIG. 9b , when PDGF, which is an expression promoter of USP1, was treated, it was confirmed that the absorbance at a wavelength of 450 nm increased in a concentration-dependent manner. That is, when the expression of UPS1 is increased, the proliferation of mesenchymal stem cells can be promoted.

Figure 9c is a graph showing the degree of cell proliferation as an absorbance (OD) value after treating the mesenchymal stem cells with an expression promoter and/or inhibitor of USP1.

As shown in FIG. 9c , when PDGF, which is an expression promoter of USP1, was treated, the absorbance at a wavelength of 450 nm was increased compared to the untreated control, and when treated with Pimozide, an expression inhibitor of USP1, 450 compared to the untreated control The absorbance at the wavelength of nm was decreased, and when the accelerator and the inhibitor were simultaneously treated, it was confirmed that the absorbance at the wavelength of 450 nm was increased compared to the inhibitor-treated group. Therefore, it can be seen that the USP1 expression promoter promotes the proliferation of mesenchymal stem cells, and the USP1 expression inhibitor inhibits the proliferation of mesenchymal stem cells.

Example 6. Confirmation of osteogenic differentiation in aged mesenchymal stem cells

Bone differentiation in aged adipose-derived mesenchymal stem cells was evaluated through Alizarin Red S staining. Specifically, senescent adipose-derived mesenchymal stem cells and early passage mesenchymal stem cells as a control were cultured for 14-21 days in osteogenic differentiation medium, changing the medium once every 2-3 days. Thereafter, Alizarin Red solution diluted in 2% water was treated for 5 minutes, and cell staining was confirmed through a microscope.

Figure 10a is the result of confirming the osteogenic differentiation in the aging mesenchymal stem cells by Alizarin Red S staining.

As shown in FIG. 10A , it was confirmed that the absorbance at the late stage was significantly decreased compared to the initial stage of osteodifferentiation. That is, it can be seen that in the aging mesenchymal stem cells, bone formation is reduced as bone differentiation progresses.

It was confirmed whether bone differentiation was increased or decreased depending on whether the expression of USP1 was increased or decreased in aged adipose-derived mesenchymal stem cells. Specifically, adipose-derived mesenchymal stem cells treated with 20 ng/ml of PDGF, an expression promoter for USP1 and 3 μM of pimozide, an inhibitor, were mixed in each osteogenic differentiation medium and cultured for 14 to 21 days, changing the medium once every 2-3 days. did. Thereafter, Alizarin Red solution diluted in 2% water was treated for 5 minutes, and cell staining was confirmed through a microscope.

FIG. 10b shows the results of confirming whether or not bone differentiation in mesenchymal stem cells was performed by staining with Alizarin Red S after treating the mesenchymal stem cells with an expression promoter of USP1.

As shown in Figure 10b, the absorbance was significantly increased in the PDGF-treated mesenchymal stem cells, it can be seen that the increase in the expression of USP1 increases the bone differentiation in the mesenchymal stem cells.

Figure 10c is the result of confirming whether or not bone differentiation in the mesenchymal stem cells after treatment of the USP1 expression inhibitor in the mesenchymal stem cells by Alizarin Red S staining.

As shown in FIG. 10c , the absorbance was significantly decreased in the mesenchymal stem cells treated with Pimozide, ML323, and it can be seen that the decrease in the expression of USP1 reduces the osteogenic differentiation in the mesenchymal stem cells.

<110> SUNGKWANG MEDICAL FOUNDATION <120> Kit for diagnosing stem cell senescence <130> PN140503 <150> KR 10-2018-0033587 <151> 2018-03-23 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of USP1 <400> 1 tcaagttgtt cctgctgcac 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of USP1 <400> 2 tgcagcttcc cttatcctt 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of USP12 <400> 3 tacatggacc agcttcatcg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of USP12 <400> 4 gattgggacc acttccacag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of TNF alpha IP3 <400> 5 tggttccaat tttgctcctt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of TNF alpha IP3 <400> 6 cgttgatcag gtgagtcgtg 20

Claims (2)

A kit for diagnosing senescence of stem cells comprising a composition for diagnosing senescence of stem cells comprising a gene encoding a deubiquitin protein or an agent capable of specifically detecting the expression level of the protein,
The de-ubiquitin protein is at least one protein selected from the group consisting of USP12, USP14, USP15, USP10, USP53, PSMD14, PSMD7, COPS6, UCHL5, USP31, USP52, OTUD1 and USP17, and TNFαIP3, the kit. delete

Images