KR102433429B1 - Nanomagnetic antibody labelled with carboxylated iron oxide nanoparticle and the preparation method thereof - Google Patents

Abstract

The present invention provides a nanomagnetic antibody-based lateral flow immunodiagnostic kit for rapid and high-sensitivity diagnosis of pathogenic microorganisms, a method for manufacturing the kit, and a high-sensitivity rapid diagnosis method for pathogenic microorganisms using the kit.

Description

Nanomagnetic antibody labeled with carboxylated iron oxide nanoparticles and the preparation method thereof

The present invention relates to a lateral flow immunodiagnostic kit for rapid and highly sensitive diagnosis of pathogenic microorganisms and a diagnostic method for pathogenic microorganisms using the same. It relates to a diagnostic method for pathogenic microorganisms.

The incidence of infectious diseases is continuously increasing due to climate change and the like. For example, in the case of Korea, food-borne infectious diseases include norovirus, enterohemorrhagic E. coli, enterotoxin E. coli, enteropathogenic E. coli, salmonella, enteritis vibrio, staphylococcus aureus, clostridium perfringens, campylobacter jjuni, kudoa. The incidence rate is high in the order of the causative pathogens such as protozoa and Bacillus cereus. In addition, viruses and bacteria that cause food poisoning in the United States are known as Norovirus, Salmonella, Clostrium perfringens, Campylobacter j. juni, Staphylococcus aureus, Clostrium botulinum, Listeria, Shiga toxin-producing E. coli O157, Vibrio .

For rapid prescription and follow-up measures for infectious diseases, a technology for diagnosing with high sensitivity in a short time is required for a pathogen that may exist in an infected person, a suspected infection, or an object suspected of being contaminated by a pathogen. In addition, screening positive samples for pathogen infection through on-site diagnosis using a high-sensitivity test in a short time can reduce the time, cost, and labor required for a diagnostic test for all samples.

Existing immunodiagnostic antibody kits can be tested only when a certain number of pathogens are secured through incubation for several hours or more. Therefore, in order to improve the accuracy and convenience of the immunodiagnostic antibody kit, it is necessary to improve the sensitivity to pathogens and to simplify the diagnostic test process. The process of immunodiagnostic testing can be simplified by mixing the target pathogens and the reaction reagent, processing them for a few minutes, and then taking the supernatant and using it for analysis. Therefore, a technique for detecting a pathogen by improving the sensitivity of the immunodiagnostic test and increasing the accuracy of the test is advantageous in reducing various financial resources required for the diagnostic test.

In contrast to the PCR test that requires professional equipment, a laboratory equipped with biosafety facilities, and skilled professionals, the immunodiagnostic strip has a relatively simple structure and low cost for mass production. It is known that the diagnostic method using colloidal gold strips, which is widely used in the lateral flow immunoassay, has hundreds to thousands of times lower sensitivity than the diagnostic method using RT-PCR.

Magnetic particles such as iron oxide nanoparticles have several advantages over optical markers commonly used in immunodiagnostics. Magnetic nanoparticles can also be applied to light-opaque media. Since biological samples do not have a basal magnetic signal, biological samples labeled with magnetic nanoparticles can exhibit a high signal-to-noise ratio, and are stable because they are not affected by chemical reactions or photo-bleaching of reagents used for testing. provides a signal. It is possible to manipulate magnetically labeled samples using an external magnetic field, and through magnetic mixing and magnetic washing and separation, it is possible to improve diagnostic efficiency and shorten the test time. can

In general, iron oxide nanoparticles are prepared through a method such as thermal decomposition, electrochemical method, ultrasonic synthesis method, co-precipitation method. The co-precipitation method has the advantages of low manufacturing cost, high yield, and no need for high-risk solvents or high-temperature conditions compared to other manufacturing methods.

The sensitivity of the nanomagnetic antibody to the antigen to be analyzed is greatly affected by the uniformity of binding between the magnetic nanoparticle and the antibody. In order to uniformly bind the antibody to magnetic nanoparticles in the process of nanomagnetic antibody, the tendency of paramagnetic nanoparticles to aggregate by hydrophobic attraction in the reaction solution must be suppressed. In general, in order to inhibit the aggregation of magnetic nanoparticles in aqueous solution, methods such as coating the surface of magnetic nanoparticles with a hydrophilic low-molecular material, a hydrophilic high-molecular material, and an amphiphilic material are used. The material used to coat the surface of the magnetic nanoparticles should be able to provide sufficient water dispersibility and electrostatic repulsion to the magnetic nanoparticles without changing the intrinsic properties of the antibody.

Immunoassay using the lateral flow immunodiagnostic method is a method for diagnosing the presence or absence of antigen-antibody reaction using fluorescence detection. The development of diagnostic kits using this in

Korean Patent Publication No. 10-1945846 B1 (2019.01.30)

Accordingly, an object of the present invention is to provide a new diagnostic kit and diagnostic method capable of rapidly and highly sensitively detecting pathogenic microorganisms.

The problem to be solved by the present invention is the color of the color exhibited by the nanomagnetic antibody by the nanomagnetic particles in the nanomagnetic antibody-antigen-capturing antibody using the nanomagnetic antibody labeled with the pathogen's antibody using carboxylated magnetic nanoparticles. An object of the present invention is to provide a method for qualitative analysis of pathogen antigens by determining the strength by methods such as visual observation, or quantitative analysis of pathogen antigens by measuring the magnetic strength exhibited by nanomagnetic antibodies. Another object of the present invention is to provide a method for rapidly diagnosing pathogens with high sensitivity due to the simplicity of the sample pretreatment method and the sensitivity of the nanomagnetic antibody to the antigen of the pathogen.

In order to achieve the above object, the present invention is to provide a nanomagnetic antibody-based lateral flow immunodiagnostic kit for rapid and high-sensitivity diagnosis of pathogenic microorganisms, a method for preparing the kit, and a high-sensitivity rapid diagnosis method for pathogenic microorganisms using the kit.

One embodiment of the present invention provides a nanomagnetic antibody-based immunodiagnostic kit for detecting pathogenic microorganisms, and a method for manufacturing the same, comprising:

An embodiment of the present invention is a method for manufacturing a nanomagnetic antibody-based lateral flow immunodiagnostic kit for rapid and sensitive diagnosis of pathogenic microorganisms,

a) providing carboxylated magnetic nanoparticles;

b) activating the carboxylated magnetic nanoparticles;

c) preparing a nanomagnetic antibody by binding the activated magnetic nanoparticles with an antibody of a pathogenic microorganism; and

There is provided a method for manufacturing a magnetic nano-antibody-based immunodiagnostic kit for detecting pathogenic microorganisms, comprising the step of d) providing the magnetic nano-antibody to react with a pathogenic microorganism antigen to a conjugate pad.

In the present invention, rapid and high-sensitivity diagnosis of pathogenic microorganisms is made through a magnetic nano-antibody in which magnetic nanoparticles are bound to an antibody of a pathogen. is needed The pathogenic microorganism may be, in particular, food poisoning-inducing bacteria, for example, may be one or more selected from the group consisting of enterohemorrhagic E. coli, Salmonella and norovirus.

In step a), it may include washing and completely suspending the magnetic nanoparticles before activation. The magnetic nanoparticles may be superparamagnetic iron oxide (Fe ₃ O ₄ ) nanoparticles having a single particle size of 350 to 400 nm. In order to react with an amine group present on the surface of the antibody to form a covalent bond, the iron oxide nanoparticles may have a functional group such as a carboxyl group, an isocyanate group, an acylazide group, an aldehyde group, an epoxide group, preferably a carboxyl group, isocyanate group group, most preferably a carboxyl group. The size of the surface carboxylated magnetic nanoparticles may be 350 to 400 nanometers. The surface carboxylated magnetic nanoparticles, preferably the surface carboxylated iron oxide nanoparticles, have an advantageous binding to the antibody, and when applied to the strip for rapid and high-sensitivity diagnosis of the present invention, a stable reaction is possible.

Step b) is a step for improving the binding force between the carboxylated magnetic nanoparticles and the antibody of the pathogenic microorganism. The carboxylated magnetic nanoparticles are 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide, 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS) in order to achieve the object of the present invention. ), and any one or more selected from the group consisting of N-hydroxysulfosuccinimide (Sulfo-NHS), preferably 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide, 1-Ethyl-3-(3-dimethylaminopropyl) Carbodiimide hydrochloride (EDC), a mixture of 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide and N-hydroxysuccinimide (NHS), 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide and N-hydroxysulfosuccinimide (Sulfo-NHS) It can be activated by reaction with a mixture, a mixture of EDC and N-hydroxysuccinimide (NHS), and/or a mixture of EDC and N-hydroxysulfosuccinimide (Sulfo-NHS). When activated with the compound, the reactivity with the antibody is excellent. Through the 'activation', reactivity with an antibody to be bound can be improved.

Step c) includes coupling the activated nanomagnetic antibody with the antibody of the pathogenic microorganism. By reacting the activated magnetic nanoparticles prepared in step b) with the antibody of the pathogenic microorganism to be detected, it can be combined with the antibody of the pathogenic microorganism. Preferably, the bond may be a covalent bond, and there is no particular limitation on the coupling, but preferably includes an amide coupling. In the present invention, the sensitivity of the detection of pathogenic microorganisms using the nano-magnetic antibody may depend on the binding form of the antigen to the nano-magnetic antibody.

The antibody binding to the magnetic nanoparticles in step c) may be a polyclonal antibody and/or a monoclonal antibody capable of binding to the magnetic nanoparticles as an antibody of a pathogenic microorganism, preferably a monoclonal antibody. The reaction rate of the antibody of the pathogenic microorganism to the magnetic nanoparticles in the nanomagnetic antibody prepared through the preparation method of the present invention is 81.0 to 99.99%, preferably 92.0 to 99.99%, and most preferably 92.0 to 99.99%. The capture antibody used for the detection of the pathogen antigen bound to the nanomagnetic antibody is a polyclonal antibody and a monoclonal antibody as an antibody of a pathogenic microorganism, preferably a polyclonal antibody. This can improve diagnostic sensitivity.

One embodiment of the present invention provides a nanomagnetic antibody-based lateral flow immunodiagnostic kit for the detection of pathogenic microorganisms.

One embodiment of the present invention is a nanomagnetic antibody-based lateral flow immunodiagnostic kit for rapid and sensitive diagnosis of pathogenic microorganisms,

The kit includes a sample pad, a conjugate pad and a detection unit,

The conjugate pad is where the antigen of the pathogenic microorganism reacts with the nano-magnetic antibody, and the magnetic nano-antibody is formed by binding the magnetic nanoparticles with the antibody of the pathogenic microorganism,

The detection unit may detect the pathogenic microorganism antigen by binding the nanomagnetic antibody bound to the pathogenic microorganism antigen with the capture antibody.

The detection unit comprises a test line for detecting the pathogenic microbial antigen by binding the nanomagnetic antibody bound to the pathogenic microbial antigen with the capture antibody, and a control line for detecting the nanomagnetic antibody not bound to the pathogenic microbial antigen by binding the anti-IgG antibody, Provided is a lateral flow immunodiagnostic kit based on a nanomagnetic antibody that rapidly and sensitively diagnoses pathogenic microorganisms using such a detection unit.

The kit may include a structure in which a sample pad, a conjugate pad in contact with one end of the sample pad, an NC membrane in contact with one end of the conjugate pad, and an absorbent pad in contact with the NC membrane are sequentially connected. The magnetic nanoparticles may be superparamagnetic iron oxide (Fe ₃ O ₄ ) paramagnetic nanoparticles in which a single particle has a size of 350 to 400 nm.

The pathogenic microorganism antigen is not particularly limited, and may preferably be one or more selected from the group consisting of enterohemorrhagic E. coli, Salmonella and norovirus.

The form of the kit is not particularly limited, and may be provided in the form of a diagnostic strip and a diagnostic pad commonly used in the industry. The kit may be provided so that the sample pad, the conjugate pad, the NC membrane including the detection unit, and the absorption pad are overlapped to allow the sample solution containing the sample to be tested to react sequentially flowing from the sample pad in a certain direction. .

The pad and membrane constituting the lateral flow immunodiagnostic kit are at least one material selected from the group consisting of nylon, polyester, cellulose, polysulfone, polyvinylidene difluoride, cellulose acetate, glass fiber, and nitrocellulose. One characteristic, but not limited thereto.

One embodiment of the present invention provides a high-sensitivity rapid diagnosis method of pathogenic microorganisms, preferably food poisoning-causing microorganisms, comprising the following steps.

S1) providing a sample by pre-treating the pathogenic microorganism;

S2) providing a lateral flow immunodiagnostic kit manufactured by the above method;

S3) loading the sample into the sample pad of the lateral flow immunodiagnostic kit; and

S4) In the test line of the detection part of the kit, the magnetic signal generated by binding the antigen-binding nano-antibody of the pathogenic microorganism to the capture antibody is measured, or the intensity of the color displayed by the magnetic nano-antibody is determined with the naked eye or a colorimeter. Quantitative, qualitative or quantitative and qualitative analysis of pathogenic microorganism antigens in the sample

Step S1) is a sample preparation step, and may include a lysis step of pathogenic microbial cells. One embodiment may include a sample pretreatment step, such as treating pathogenic microorganisms through cell heating. In addition, after treating the cell suspension at a high temperature for a certain period of time, centrifugation and a method of preparing the supernatant may be used. In addition to the cell heating method, pathogenic microorganisms can be lysed through cell lysis, and optical, mechanical, acoustic, electrical and/or chemical methods commonly used in the industry (chemical) method and the like may all be used. The cell pretreatment method may selectively use a general method used in the industry according to the type of microorganism to be analyzed.

The time required for diagnosing the pathogenic microorganism by the above assay is 3 to 20 minutes, preferably 5 to 15 minutes, and most preferably 10 minutes. The time required for the pretreatment of the pathogen sample in the diagnostic test may be 20 to 60 minutes, preferably 30 to 50 minutes, and more preferably 40 minutes.

In the case of using the above diagnostic method, the intensity of the color displayed by the magnetic nanoparticles of the nanomagnetic antibody to which the pathogenic microorganism is bound or unbound can be determined using the naked eye or a colorimeter, and visual discrimination is preferable in terms of convenience. In the diagnostic test, the time required to detect the nanomagnetic antibody bound to the pathogenic microorganism using the magnetic detector is 1 minute or less, preferably 30 seconds or less, and most preferably 20 seconds or less.

Accordingly, when the diagnostic method of the present invention is used, rapid diagnosis of pathogenic microorganisms may be possible within one hour.

The magnetic nano antibody of the present invention enhances the detection sensitivity of the antigen to be analyzed. Diagnosis using nano-magnetic antibodies allows detection of antigens with a small number of pathogens, so long-term incubation of pathogens is not required. In addition, rapid analysis is possible through a simple pretreatment process of pathogen samples.

The present invention quantitatively analyzes the amount of antigen of a pathogen bound to a nano-magnetic antibody to which an antigen of a pathogen is bound with a nano-magnetic detector, or analyzes the intensity of a unique color displayed by magnetic nanoparticles of a nano-magnetic antibody through visual observation, etc. Since it is possible to qualitatively determine the amount of antigen-bound nano-magnetic antibody, it can be used for quantitative analysis and standardization analysis of various pathogens.

The diagnostic method of the present invention does not require a separate chromogenic substrate, does not require an artificial enzyme action of iron oxide nanoparticles, and does not cause discoloration of the colored substrate, so it has the advantage of being more convenient to use compared to the existing diagnostic method. .

The following drawings attached to the present specification illustrate preferred embodiments of the present invention, and serve to further understand the technology of the present invention together with the above-described content of the present invention, so the present invention is limited only to the matters described in such drawings should not be interpreted as
1 shows a change in magnetic signal according to the mass of carboxylated superparamagnetic nanoparticles (C-SPIONP) detected by a magnetic detector.
Figure 2 shows the zeta potential values of C-SPIONP, EHEC nano-magnetic antibody (EHEC Ab-SPIONP), Salmonella nano-magnetic antibody (Salmonella Ab-SPIONP), and Norovirus G1 nano-magnetic antibody (Norovirus G1-SPIONP). .
Figure 3a shows the gel electrophoresis results of the EHEC nano-magnetic antibody.
Figure 3b shows the gel electrophoresis result of the nano-magnetic antibody of Salmonella.
Figure 3c shows the gel electrophoresis results of the nano-magnetic antibody of Norovirus G1.
4 shows the structure of a nanomagnetic antibody-based lateral flow immunodiagnostic strip.
5a shows the results of RT-PCR analysis of vt1 and vt2 genes of EHEC.
Figure 5b shows the results of RT-PCR analysis of sdf-1, invA and prt genes of Salomonella.
6 shows the results of qualitative and quantitative analysis using nanomagnetic antibody-based immunodiagnostic strips after EHEC and Salmonella were treated with a cell heating method.

Hereinafter, examples and the like will be described in detail to help the understanding of the present invention. However, the embodiments according to the present invention may be modified in various other forms, and the scope of the present invention should not be construed as being limited to the following examples. The embodiments of the present invention are provided to explain the present invention in more detail to those of ordinary skill in the art to which the present invention pertains.

<Example 1> Preparation of magnetic nano-antibody of enterohemorrhagic Escherichia coli (EHEC, Enterohemorrhagic Escherichia coli)

Nanomagnetic antibody against EHEC was obtained by using carboxylated superparamagnetic iron oxide nanoparticles (C-SPIONP, MP350-CA-1, NANOCS, New York, NY, USA) having a diameter of 350 to 400 nm. Purification, activating the carboxyl group of C-SPIONP and preparing the activated SPIONP and EHEC antibody through amide coupling.Three steps for amide coupling between EHEC antibody and C-SPIONP The process is as follows.

Step 1: Purification of C-SPIONP

1-1) Add 100 uL of C-SPIONP to an EP (Eppendorf) tube.

1-2) Add 1 mL of activation/coupling buffer (50 mM MES (2-(N-morpholino)ethanesulfonic acid, pH 6.0) to the EP tube of step 1-1).

1-3) Centrifuge the C-SPIONP suspension after 1-2) at 17,000 rpm for 10 minutes.

1-4) Discard the supernatant from the centrifuged solution in 1-3).

1-5) After performing 1-2) to 1-4) two more times, 1 mL of activation/coupling buffer is added.

Step 2: Activation of C-SPIONP

2-1) Preparation of EDC (1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) solution

2-1-1) Prepare a 1 M EDC solution by adding 1.0 mL of deionized water to 192 mg of EDC.

2-1-2) Prepare a 200 mM EDC solution by diluting the 1 M EDC solution prepared in the step 2-1-1) with deionized water, and store it at -20 degrees Celsius.

2-2) Preparation of Sulfo-NHS (N-Hydroxyssulfosuccinimide) solution

2-2-1) Prepare a 200 mM Sulfo-NHS solution by adding 1.0 mL of activation/coupling buffer to 43.4 mg of Sulfo-NHS, aliquot and store at -20°C.

3) After adding 24 uL of 200 mM EDC solution and 24 uL of 200 mM NHS solution to the purified C-SPIONP prepared in step 1, incubate with shaking at room temperature for 30 minutes.

4) After the reaction mixture completed in step 3) is centrifuged at 17,000 rpm for 10 minutes, the supernatant is removed.

5) Add 1 mL of activation/coupling buffer to the reaction mixture after step 4), centrifuge for 10 minutes, and remove the supernatant.

6) Repeat step 5) twice.

7) Add 700 uL of activation/coupling buffer to the reaction mixture after step 6).

Step 3 Coupling of activated SPIONP and EHEC detection antibody

8) 300 uL of 2 mg/mL EHEC detection antibody (Anti-Shiga toxin II subunit B Antibody, Mouse Monoclonal Antibody, Cat. 40019-MM13, Sino Biological Inc., Wayne, PA, USA) solution was added, and incubated with shaking at room temperature for 2.5 hours.

9) After adding 30 uL of ethanolamine to the reaction mixture after step 8), incubate with shaking at room temperature for 30 minutes.

10) After the reaction mixture completed in step 9) is centrifuged at 17,000 rpm for 10 minutes, the supernatant is taken and the amount of unreacted antibody is analyzed to determine the reaction rate of the antibody to activated SPIONP.

11) Add 1 mL of blocking buffer (50 mM Tris containing 0.5% (w/v) casein) to the reaction mixture after step 10) and incubate with shaking at room temperature for 2 hours. Overnight reaction is also possible.

12) After the reaction product completed in 11) is centrifuged at 17,000 rpm for 10 minutes, the supernatant is discarded.

13) 1 mL of blocking buffer is added to the reaction product after step 12), and then is suspended by pipetting.

14) Centrifuge the reaction product after the process of 13) at 17,000 rpm for 10 minutes.

15) Repeat steps 13) to 14).

16) After removing the supernatant from the reaction product after step 15), add 1 mL of blocking buffer.

17) Store the nanomagnetic antibody of EHEC, which is the reaction product prepared through the process of 16), at 4°C until used.

<Example 2> Preparation of Nanomagnetic Antibody of Salmonella

The same method as in Example 1 except for using the Salmonella detection antibody (Rabbit purified polyclonal antiboby, Ig fraction, Cat. No. J142, EastCoast Bio, North Berwick, ME, USA) instead of the EHEC detection antibody. was used to prepare nanomagnetic antibodies against Salmonella.

<Example 3> Preparation of Nanomagnetic Antibody of Norovirus G1

The same method as in Example 1 was used except that the Norovirus G1 detection antibody (Mouse monoclonal antibody, Cat. No. HM022, EastCoast Bio, North Berwick, ME, USA) was used instead of the EHEC detection antibody. Nanomagnetic antibody of Norovirus G1 was prepared.

Experimental Example 1) Magnetic signal measurement of C-SPIONP

The magnetic signal of C-SPIONP used in the preparation of the nanomagnetic antibody against the pathogen antigen was measured with a magnetic detector (NMP Bio Strip Analyzer, MagRay 3000B, Magsolution Inc., Daejeon, Republic of Korea), and as shown in FIG. The magnetic signal value of C-SPIONP detected by the magnetic detector was proportional to the C-SPIONP whose mass was changed to 2, 5, 10, 15 and 20 ug while having a correlation coefficient (R ² ) value of 0.9913.

Experimental Example 2) Measurement of zeta potential of C-SPIONP and nanomagnetic antibody

The zeta potential of C-SPIONP and the nanomagnetic antibody is measured by taking 1 mL of a solution in which each particle is dispersed in a phosphate buffer (pH 7.4) and injecting it into the zeta potential measuring cell, followed by a zeta potential measuring device (Zetasizer nano ZS, Malvern Instruments). Ltd., Malvern, Worcestershire, USA). As shown in FIG. 2, C-SPIONP exhibited a zeta potential of -13.5±5.47 mV due to the carboxyl group on the particle surface, whereas C-SPIONP activated with EDC/NHS was bound with the antibody of the pathogen as in the above example. The prepared EHEC nano-magnetic antibody, Salmonella nano-magnetic antibody and Norovirus GI nano-magnetic antibody showed potential values of -5.44±4.37 mV, -5.57±6.31 mV and 13.5±11.8 mV, respectively. Since the zeta potential of the nanomagnetic antibody was higher than that of C-SPIONP, it can be indirectly confirmed that the number of carboxyl groups decreased through the activation of the C-SPIONP surface, and that the activated C-SPIONP reacted with the antibody of the pathogen.

Experimental Example 3) Gel Electrophoresis Experiment of Nano Magnetic Antibodies

Sodium dodecylsulfate (SDS)-polyacrylamide gel electrophoresis for the pathogen antibody and the nanomagnetic antibody, respectively, to confirm the formation of the nanomagnetic antibody against the pathogen through the coupling reaction between SPIONP and the pathogen antibody (polyacrylamide gel electrophoresis) (SDS-PAGE) was performed. As the electrophoresis kit, a 10% acrylamide kit (Cat. No. 161-0183, TGX Stain-Free FastCast Acrylamide Kit, 10%, Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used.

From the gel preparation kit, 3 mL of resolver A solution, 3 mL of resolver B solution, 30 μL of 10% ammonium persulfate (APS, Ammonium persulfate) solution and 3 μL of tetramethylethylenediamine (TEMED, Tetramethylethylenediamine) were sequentially added and After mixing to prepare a resolve gel solution, it was injected into the cast. From the gel kit, 1 mL of stacker A solution, 1 mL of stacker B solution, 10 μL of 10% APS, and 2 μL of TEMED were sequentially added and mixed to prepare a stacking gel solution, and then injected into the top of the resolve gel. After inserting the comb into the gel, the gel was cured for 30 minutes. After removing the comb from the gel, the gel was washed with tris/glycine/SDS (T/G/SDS) running buffer. The gel was set in an electrophoresis apparatus (BIO-RAD Mini-Protein® Tetra System, Bio-Rad Laboratories, Inc., Hercules, CA, USA) and filled with T/G/SDS running buffer. The sample solution and the sample buffer (2X) were mixed at a ratio of 2:1 (v/v) and heated in a microwave for 3 minutes. The sample was loaded into the well on the top of the gel, and a current of 20 mA/gel was applied to electrophoresis the sample. When bromophenol blue (BPB) moves to the bottom of the gel, the current supplied to the device is cut off, and the gel is taken out and washed with sterile water. After putting the gel in a Coomassie blue staining solution and shaking for 1 hour, it was washed with sterile water for 30 minutes to dye the gel. The results are shown in FIGS. 3A to 3C.

3a to 3c show the SDS-PAGE results of the nanomagnetic antibody. As shown in FIGS. 3A to 3C , bands are observed for the antibodies of each pathogen on the gel, whereas the SPIONP to which the antibody is bound, that is, the nanomagnetic antibody 1) has a larger size than the pores of the polyacrylamide gel, so it closes the pores of the gel. Since it did not pass through, the band of the nanomagnetic antibody moved by electrophoresis was not observed on the gel, 2) the band caused by the antibody that did not react with SPIONP was also not observed, and 3) the lane in which the nanomagnetic antibody was electrophoresed. Coupling of the pathogen antibody and SPIONP was confirmed from the results such as when the magnetic strength of the upper, middle, and lower regions of the lane was measured using a magnetic detector, and magnetism was detected only at the upper end of the lane.

Experimental Example 4) Analysis of the reaction rate and antibody immobilization degree of the antibody to SPIONP

The amount of antibody bound to SPIONP is Pierce?? Protein quantification was performed using the Coomassie Plus (Bradford) Assay Kit (Cat#: 23236 ThermoScientific, Rockford, IL, USA). For the amount of antibody before the activation C-SPIONP and coupling reaction, use a standard protocol with a high working range (100-1500 μg/mL), and use a micro protocol with a low working range (1-25 μg/mL) for the amount of unreacted antibody after reaction. and analyzed.

Before the coupling reaction between SPIONP and the antibody, the antibody in the reaction solution and the unreacted antibody in the supernatant after the coupling reaction were subjected to a color reaction according to the test protocol provided in the kit described above, and the absorbance was measured at 595 nm with a microplate plate reader (Hidex sense 425 -301, Hidex Oy. Turku, Finland). The antibody concentration was calculated using a calibration curve prepared using a standard solution of bovine serum albumin (BSA), and the antibody reaction rate and antibody immobilization degree were calculated using the following equations. The results are shown in Table 1.

Antibody reaction rate (%) = [(Amount of antibody in reaction solution before reaction (μg/mL) - Amount of antibody in supernatant after reaction (μg/mL))]/Amount of antibody in reaction solution before reaction (μg/mL) X 100

Antibody immobilization degree (μg/g) = weight of coupling reaction (μg/mL)/weight of C-SPIONP (g/mL)

The reaction rate and immobilization degree of the antibody bound to SPIONP are shown in Table 1 below.

pathogenic microorganisms before reaction
of the reaction solution
antibody amount
(μg/mL) after reaction
supernatant
antibody amount
(μg/mL) reaction rate
(%) Antibody immobilization
(μg/g C-SPIONP) EHEC 74.3±23.5 0.014±0.007 99.98 185.22 Salmonella 201.2±23.6 15.52±0.91 92.29 464.20 Norovirus G1 234.2±43.1 0.006±0.005 99.99 585.49

As shown in Table 1, the response rate of the antibody of the pathogen antigen to the activated SPIONP was 92.29 to 99.99%, and the degree of immobilization was 185.22 to 585.49 ug/g.

<Example 4> Preparation of EHEC nanomagnetic antibody-based lateral flow immunodiagnostic strip

The immunodiagnostic strip to which the EHEC nanomagnetic antibody was applied consisted of a sample pad, a conjugate pad, a nitrocellulose membrane, a moisture absorption pad, and a support card. All materials were made to have a thickness of 4 mm, and the length of the support card was made to be 70 mm. The lengths of the sample pad, conjugate pad, nitrocellulose (NC) membrane and moisture absorption pad were set to 21 mm, 9 mm, 25 mm and 21 mm, respectively. The sample pad and the conjugate pad were wetted with 0.01 M phosphate buffered saline (PBS) solution containing 1% BSA 0.5% NaCl and 1% Tween 20, dried at 37 °C for at least 1 hour, and then dried at room temperature. Capture antibody (Anti-Shiga toxin II subunit B Antibody, Mouse Monoclonal Antibody, Cat. No. 40019-MM08, Sino Biological, Inc., Wayne, PA) prepared by diluting 100 times with deionized water to a final concentration of 20 μg/mL , USA) were spotted 3 to 4 times on the test line of the NC membrane by 0.1 μL. Goat anti-rabbit-IgG antibody, which was diluted 50-fold with 50 mM MES buffer to a final concentration of 20 μg/mL, was spotted 3 to 4 times with 0.1 μL each on the control line of the NC membrane. The antibody-spotted membranes on the test and control lines were dried at 37 °C for 2 h. 20 μL of the EHEC nanomagnetic antibody prepared in Example 1 was spotted on the conjugate pad and dried at 37 °C for at least 1 hour. An immunodiagnostic strip was prepared so that the sample pad and the conjugate pad, the conjugate pad and the NC membrane, and the NC membrane and the moisture absorption pad overlap each other by 2 mm or more. The prepared nanomagnetic antibody strip is shown in FIG. 4 .

<Example 5> Preparation of lateral flow immunodiagnostic strip based on nanomagnetic antibody of Salmonella

A lateral flow immunodiagnostic strip based on the Salmonella nano-magnetic antibody was prepared in the same manner as in Example 4, except that the Salmonella nano-magnetic antibody was used instead of the EHEC antibody-coupled nano-magnetic antibody.

Experimental Example 5) Securing, culturing and verifying pathogenic microorganisms

EHEC (NCCP No. 15955) and Salmonella Typhimurium (NCCP No. 16207), the pathogen microorganism standard strains distributed from the National Culture Center for Pathogens (NCCP), were inoculated into tryptic soy broth (TSB) medium. After incubation at 37 ^o C for 4 hours, plated on tryptic soy agar (TSA) medium, and incubated at 37 ^o C for more than 12 hours to proceed with colony selection.

Some of the selected colonies of each bacteria were cultured for 4 hours at 37 ^o C using TSB medium, and the bacteria enriched were used for pathogen verification. 1.0 mL of the enrichment solution containing the proliferated bacteria was transferred to a microcentrifuge tube, and centrifuged at 14,000 rpm for 3 minutes. After centrifugation, the supernatant was discarded from the microcentrifuge tube and the cells were suspended in 0.5 mL of secondary distilled water. The suspension was bathed in boiling water for 15 minutes to disrupt the cells, followed by centrifugation at 14,000 rpm for 2 minutes. 5 μl of the supernatant was taken from the cell lysate after centrifugation and used as a DNA template for polymerase chain reaction (PCR). By adding 10 pmol of a DNA primer set (QuantiNova, Qiagen, Venlo, The Netherland) having the nucleotide sequence shown in Table 2, 95 ^o C (2 min) → 50 cycle (95 ^o C (5 sec) → 60 ^o C ( 10 sec)) → Real-time PCR was performed according to the same protocol as melting curve analysis (70 ~ 95 ^o C).

The RT-PCR primer sets used for verification of EHEC and Salmonella distributed by the National Pathogen Resources Bank (NCPP) are shown in Table 2 below.

pathogen microorganism primer base sequence product size
(bp) EHEC vt1_f CGTACGGGGATGCAGATAAATCGC 210 vt1_r CAGTCATTACATAAGAACGCCCAC vt2_f GTTCTGCGTTTTTGTCACTGTCAC 326 vt2_r GTCGCCAGTTATCTGACATTCTGG Salmonella sdf-1_f CTTTCTCAGATTCAGGGAGTATATCA 123 sdf-1_r TGAACTACGTTCGTTCTTCTGGT invA_f AGCGTACTGGAAAGGGAAAG 115 invA_r ATACCGCCAATAAAGTTCACAAAG prt_f AGCTCCATAGAAATGCTCCAAT 130 prt_r GAACATCACTGCCACCAAATAC

As shown in Figure 5a, EHEC confirmed the amplification curve and the melting peak through RT-PCR analysis of the toxin genes vt1 and vt2. The Cq values of both toxin genes were observed in the range of 15 to 20, and the amplified melting peaks of vt1 and vt2 were observed at 80.5 and 82.5 ^o C, respectively. As shown in FIG. 5b, Salmonella confirmed the amplification curve and melting peak through RT-PCR analysis for the toxin genes sdf-1, invA and prt. Cq values of sdf-1, invA and prt toxin genes were all observed in the range of 20 to 22, and the amplified melting peaks of sdf-1, invA and prt were observed at 78.5, 79.0 and 76.0 ^o C, respectively.

Experimental Example 6) Pathogenic microorganism detection using nanomagnetic antibody-based lateral flow immunodiagnostic strip

Detection of EHEC or Salmonella was performed using the nanomagnetic antibody-based lateral flow immunodiagnostic strips prepared in Examples 4 and 5. The heating method was used as a pretreatment method for EHEC or Salmonella. 50 µL of the bacterial culture was suspended in 100 µL of secondary distilled water. The cell suspension was heated at 100 ^o C for 3 minutes and 30 seconds, and then placed on ice for 1 minute. After centrifugation at 14,000 rpm for 5 minutes, the supernatant was transferred to another tube, 150 μL of secondary distilled water was added, and the strip reaction was performed. The results of the nanomagnetic antibody-based immunostrip analysis of bacteria treated by the cell heating method are shown in FIG. 6, and the intensity of the color and the magnetic signal ratio of the conjugate pad, test line, and control line of the tested immunostrip is shown in the table below. 3 is shown.

Table 3 shows the color intensity and magnetic signal ratio of the conjugate pad, test line and control line of the nanomagnetic antibody-based immunodiagnostic strip treated with EHEC and Salmonella.

color intensity ⁴⁾ Magnetic signal ratio (%) EHEC Salmonella EHEC Salmonella ¹⁾ CP +++++ ++++ 60 40 ²⁾ TL; ++ ++ 20 30 ³⁾ CL ++ +++ 20 30

¹⁾ CP = conjugate pad, ²⁾ TL = test line, ³⁾ CL = control line

⁴⁾ Magnetic Signal Ratio:

CP magnetic signal ratio = [CP amplitude value / (CP amplitude value + TL amplitude value + CL amplitude value)] x 100,

TL magnetic signal ratio = [TL amplitude value / (CP amplitude value + TL amplitude value + CL amplitude value)] x 100,

CL magnetic signal ratio = [CL amplitude value / (CP amplitude value + TL amplitude value + CL amplitude value)] x 100

In FIG. 6, the intensity of the color displayed when the nanomagnetic particles bound to the antigen of the pathogen bind to the antibody present in the test line and the control line of the immunodiagnostic strip can be visually confirmed within 10 minutes after the start of the detection test. The antigens of pathogenic microorganisms were detected by measuring the magnetic signals indicated by the nanomagnetic antibodies present in the conjugate pad, test line, and control line, respectively, with a frequency mixing method magnetic detector.

Claims (9)

As a nanomagnetic antibody-based lateral flow immunodiagnostic kit for the detection of pathogenic microorganisms,
The kit includes a sample pad, a conjugate pad and a detection unit,
The conjugate pad is where the antigen of the pathogenic microorganism reacts with the nano-magnetic antibody, and the magnetic nano-antibody is formed by binding the magnetic nanoparticles with the antibody of the pathogenic microorganism,
The detection unit detects the pathogenic microorganism antigen by binding the nanomagnetic antibody bound to the pathogenic microorganism antigen with the capture antibody,
The magnetic nanoparticles are carboxylated magnetic nanoparticles, single particles having a size of 350 to 400 nm, and carboxylated superparamagnetic activated with N-hydroxysulfosuccinimide (Sulfo-NHS) Nanomagnetic antibody-based lateral flow immunodiagnostic kit for the detection of pathogenic microorganisms, which are iron oxide (Fe ₃ O ₄ ) nanoparticles,
Nanomagnetic antibody-based lateral flow immunodiagnostic kit, characterized in that the pathogenic microorganism is norovirus. delete delete A method for manufacturing a nanomagnetic antibody-based lateral flow immunodiagnostic kit for the detection of pathogenic microorganisms,
The pathogenic microorganism is norovirus,
a) providing carboxylated superparamagnetic iron oxide (Fe ₃ O ₄ ) nanoparticles, wherein the single particles have a size of 350 to 400 nm;
b) activating the carboxylated superparamagnetic iron oxide (Fe ₃ O ₄ ) nanoparticles with N-hydroxysulfosuccinimide (Sulfo-NHS);
c) preparing a nanomagnetic antibody by binding the activated carboxylated superparamagnetic iron oxide (Fe ₃ O ₄ ) nanoparticles with an antibody of a pathogenic microorganism; and
d) providing the nanomagnetic antibody to react with the pathogenic microbial antigen to a conjugate pad,
Method for manufacturing nanomagnetic antibody-based lateral flow immunodiagnostic kit for the detection of pathogenic microorganisms. delete delete S1) providing a sample pretreated with pathogenic microorganisms;
S2) providing a lateral flow immunodiagnostic kit manufactured according to the method of claim 4;
S3) loading the sample of step S1) into the sample pad of the lateral flow immunodiagnostic kit; and
S4) In the test line of the detection unit of the kit, the magnetic signal generated by binding the antigen-binding nano-magnetic antibody to the capture antibody in the test line of the kit, or by visually determining the color intensity of the nano-magnetic antibody to determine the pathogenicity in the sample A method for detecting pathogenic microorganisms in an isolated sample, comprising the step of quantitatively, qualitatively or quantitatively and qualitatively analyzing the microbial antigen,
The pathogenic microorganism is a method for detecting a pathogenic microorganism, characterized in that the norovirus. delete The detection method according to claim 7, wherein the time required for the detection of the pathogenic microorganism, including the time required for step S1), is less than 1 hour.

Images