KR102393079B1 - Composition for preventing or treating respiratory disease of domestic animals - Google Patents

Abstract

The present invention relates to a composition for the prevention or treatment of respiratory diseases in livestock, and more specifically, inhibits the production of inflammatory cytokines induced by LPA in organ cells and pulmonary artery vascular cells, and reduces ZO-1 protein loss and angiogenesis As a laxative LPA antagonist, (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3,4 -Provides a composition for preventing or treating inflammatory diseases of the respiratory tract of livestock containing diol.

Description

Composition for preventing or treating respiratory disease of domestic animals

The present invention relates to a composition for preventing or treating animal respiratory diseases.

Respiratory disease is a common disease in animals. In particular, it occurs frequently in domestic animals such as dairy cows, beef cattle, pigs, and chickens, and pets such as dogs and cats, and costs a lot for its treatment (Snowder, G.D. et al.; 2006).

Livestock respiratory diseases are caused not only by microbial infection, but also by various environmental factors such as stress due to high stocking density. In particular, livestock respiratory diseases are easily induced by ammonia gas, carbon dioxide, and dust in a closed breeding space, and this environmental stress also increases the chance of microbial infection.

Porcine respiratory disease complex (PRDC) occurs in meat and finisher pigs and is characterized by stunted growth, reduced feed efficiency, lethargy, anorexia, fever, cough, and respiratory disorders. Swine respiratory complex infection is caused by a mixed infection of viruses and bacteria, such as porcine respiratory and reproductive syndrome virus (PRRSV) and Actinobacillus pleurpneumoniae, and is often It causes a lot of economic loss to the pig industry by delaying growth including death and lowering feed efficiency.

Bovine respiratory disease (BRD) is caused by bovine herpes virus type 1 (BHV-1) and infectious bovine rhinotracheitis virus (IBR). is having a huge impact.

The respiratory symptoms of BRD respiratory disease are characterized by inflammation, swelling, bleeding, and necrosis of the mucous membrane of the respiratory tract, and may be accompanied by high fever, loss of appetite, depression, runny nose, dyspnea, and inflammation of the nose and mouth. Depending on the type, it can cause miscarriage (Ellis et al., 1996).

In these livestock respiratory diseases, endogenous factors related to the immune system, such as lysophosphatidic acid (LPA), play an important role. LPA is a potent endogenous factor causing inflammation in many diseases, and is a phospholipid derivative that acts as a potent mitogen through a widely distributed G protein-coupled receptor. LPA is produced by the synthesis of lysophosphatase D, autotaxin, or phosphatidic acid, which removes choline groups from lysophospatidylcholene (Zhao, Y. et al., 2013; Knowlden, S. et al. , 2014; Noguchi, K. et al., 2009; Chen, J. et al., 2008). Importantly, LPA plays an important role in many respiratory diseases in livestock, such as respiratory diseases caused by intrinsic factors such as LPA, as well as being a target for the treatment of idiopathic pulmonary fibrosis caused by dust, air pollution and microorganisms (Zhao, Y. et al., 2013).

LPA is an intermediate product of membrane phospholipid metabolism and is associated with the production of various inflammatory cytokines (Kempf K. et al., 2006), induces mRNA expression of TNF-α, and promotes the synthesis and release of TNF-α (Meilleur MA). et al., 2007; Duoduo Zhang et al., 2016). It has also been reported that LPA increases the production of interleukin-6 in the skin of mice (Flavia V. Castelino et al., 2016).

On the other hand, pathogenic angiogenesis is important for inflammatory diseases including respiratory diseases (Rivera Lopez et al., 2008; Gustin, C. et al., 2008), and LPA acts as a strong stimulator of pathogenic angiogenesis in various diseases (Kano). , K. et al., 2008; Lin, C. I. et al., 2008).

The inventors of the present invention relieve LPA-induced inflammatory cytokine production in bovine organ cells in the process of identifying LPA signaling antagonists using cell-based high-throughput screening (HTS). An LPA signaling antagonist having an effect was identified and the present invention was completed. In addition, it was confirmed that the LPA signaling antagonist identified in the present invention alleviated the loss of cell junction materials in bovine organ cells.

Korea Patent No. 1875246 discloses that 1-{4'-[3-methyl-4-((R)-1-phenyl-ethoxycarbonylamino)-isoxazol-5-yl]-biphenyl- as an LPA1 antagonist Although 4-yl}-cyclopropanecarboxylic acid (Compound 1) or a pharmaceutically acceptable salt thereof is disclosed, it is different from the antagonist of LPA signaling identified in the present invention.

Korean Patent Publication No. 20190020049 discloses carbamoyloxymethyl triazole cyclohexyl acid as a selective LPA receptor inhibitor, and Korean Patent No. 1628706 discloses a polycyclic antagonist of lysophosphatidic acid receptor, but this also It is different from the antagonist of LPA signaling identified in the present invention, and it is different from the present invention as an LPA antagonist in animal respiratory diseases.

Korean Patent Registration No. 1875246, polycyclic LPA₁ antagonist and uses thereof, 2018.06.29. registration. Korean Patent Publication No. 20190020049, carbamoyloxymethyl triazole cyclohexyl acid as an LPA antagonist, 2019.02.27. open. Korean Patent No. 1628706, polycyclic antagonist of lysophosphatidic acid receptor, 2016.06.02. registration.

Snowder, G. D.; Van Vleck, L.D.; Cundiff, L. V.; Bennett, G. L. Bovine respiratory disease in feedlot cattle: Environmental, genetic, and economic factors. J. Anim. Sci. 2006, 84: 1999-2008 Ellis et al. (1996) JAVMA 208:393-400; Ellsworth et al. (1994) In: Proceedings, 74th Conference of Research Workers in Animal Disease:34 Zhao, Y.; Natarajan, V. Lysophosphatidic acid (LPA) and its receptors: Role in airway inflammation and remodeling. Biochim. Biophys. Acta 2013, 1831: 86-92. Knowlden, S.; Georas, S. N. The autotaxin-LPA axis emerges as a novel regulator of lymphocyte homing and inflammation. J. Immunol. 2014, 192, 851-857. Noguchi, K.; Herr, D.; Mutoh, T.; Chun, J. Lysophosphatidic acid (LPA) and its receptors. Curr. Opin. Pharmacol. 2009, 9: 15-23. Chen, J.; Chen Y.; Zhu W.; Han Y.; Han B.; Xu R.; Deng L.; Cai Y.; Cong X.; Yang Y.; Hu S.; Chen X. Specific LPA receptor subtype mediation of LPA-induced hypertrophy of cardiac myocytes and involvement of Akt and NFkappaB signal pathways. J. Cell. Biochem. 2008, 103: 1718-1731. Rivera, Lopez, C. M.; Tucker, A. L.; Lynch, K. R. Lysophosphatidic acid (LPA) and angiogenesis. Angiogenesis, 2008, 11: 301-310. Gustin, C.; Van Steenbrugge, M.; Raes, M. LPA modulates monocyte migration directly and via LPA-stimulated endothelial cells. Am. J. Physiol. Cell Physiol. 2008, 295, C905-914. Kano, K.; Arima, N.; Ohgami, M.; Aoki, J. LPA and its analogs-attractive tools for elucidation of LPA, biology and drug development. Curr. Med. Chem. 2008, 15: 2122-2131. Lin, C. I.; Chen, C. N.; Huang, M. T.; Lee, S. J.; Lin, C. H.; Chang, C. C.; Lee, H. Lysophosphatidic acid upregulates vascular endothelial growth factor-C and tube formation in human endothelial cells through LPA(1/3), COX-2, and NF-kappaB activation- and EGFR transactivation-dependent mechanisms. Cell, Signal. 2008, 20: 1804-1814. Kempf K, Haltern G, Futh R, Herder C, Muller-Scholze S, Gulker H and Martin S: Increased TNF-alpha and decreased TGF-beta expression in peripheral blood leukocytes after acute myocardial infarction. Horm Metab Res. 2006, 38: 346-351. Meilleur MA, Akpovi CD, Pelletier RM and Vitale ML: Tumor necrosis factor-alpha-induced anterior pituitary folliculostellate TtT/GF cell uncoupling is mediated by connexin 43 dephosphorylation. Endocrinology. 2007, 148: 5913-5924. Duoduo Zhang, Yan Zhang, Chunyan Zhao, Wenjie Zhang, Guoguang Shao, Hong Zhang: Effect of lysophosphatidic acid on the immune inflammatory response and the connexin 43 protein in myocardial infarction, Experimental and Therapeutic Medicine, 2006, 11(5): 1617- 1624. Flavia V. Castelino, Gretchen Bain, Veronica A. Pace, B.S., Katharine E. Black, Leaya George, Clemens K. Probst, Lance Goulet, Robert Lafyatis, Andrew M. Tager, An Autotaxin-LPA-IL-6 Amplification Loop Drives Scleroderma Fibrosis, Arthritis Rheumatol., 2016, 68(12): 2964-2974. Ingvild J Brusevold1, Ingun H Tveteraas, Monica Aasrum, John Ødegard, Dagny L Sandnes, Thoralf Christoffersen, Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells, r 2014, 14:432

It is an object of the present invention to provide a composition for preventing or treating livestock respiratory diseases.

Another object of the present invention is to provide a composition for preventing or treating livestock respiratory diseases that alleviates the increase in inflammatory cytokines in the livestock respiratory system.

Another object of the present invention is to provide an animal feed for improving livestock respiratory inflammatory diseases.

The present invention provides (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3,4-diol ( Hereinafter, described as KA-1002) provides a composition for preventing or treating inflammatory diseases of the livestock respiratory tract.

The KA-1002 may act as an antagonist of LPA (Lysophosphatidic Acid), and the LPA antagonism of KA-1002 may be mediated by LPAR1 (LPA Receptor1).

The KA-1002 may be to inhibit the production of inflammatory cytokines induced by LPA, and the inflammatory cytokines induced by LPA are TNFα (tumor necrosis factor-α), IL-1β (Interleukin-1β) and It may be one or more selected from the group consisting of IL-6 (Interleukin 1).

The KA-1002 LPA antagonism can prevent or treat inflammatory diseases of the livestock respiratory tract by inhibiting angiogenesis induced by LPA.

In addition, the LPA antagonism of KA-1002 may be to alleviate the inhibition of ZO-1 protein expression induced by LPA.

The inhibition of ZO-1 protein expression induced by the LPA may be to reduce the cell-to-cell tight junction.

The livestock provides a composition for preventing or treating inflammatory diseases of the livestock respiratory tract, comprising at least one selected from the group consisting of cattle, pigs, chickens, dogs, and cats.

The composition provides a composition for preventing or treating inflammatory diseases of the livestock respiratory tract comprising the KA-1002 and a pharmaceutically acceptable excipient.

The KA-1002 may be added in an amount of preferably 0.001 to 50% by weight, more preferably 0.001 to 40% by weight, and most preferably 0.001 to 30% by weight based on the total weight of the total pharmaceutical composition.

The composition may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, liquids, aerosols, etc., external preparations, suppositories, and sterile injection solutions according to conventional methods, respectively. . Carriers, excipients and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, sweeteners, and acidulants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient, for example, starch, calcium carbonate, and water in the solubilized deckercinol of the present invention. It is prepared by mixing cross or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweetening agents, fragrances, preservatives, and acidulants are used. may be included. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween-61, cacao butter, laurin fat, glycerogelatin, and the like can be used.

The dosage of the composition of the present invention will vary depending on the age, sex, and weight of the livestock to be treated, the specific disease or pathology to be treated, the severity of the disease or pathology, the route of administration, and the judgment of the prescriber. Dosage determination based on these factors is within the level of one of ordinary skill in the art, and dosages generally range from 0.01 mg/kg/day to approximately 500 mg/kg/day. A preferred dosage is 0.1 mg/kg/day to 200 mg/kg/day, and a more preferred dosage is 1 mg/kg/day to 200 mg/kg/day. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.

The pharmaceutical composition of the present invention may be administered to livestock such as cattle, pigs, chickens, dogs, and cats by various routes. Any mode of administration can be envisaged, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine or intracerebrovascular injection and dermal application. KA-1002 of the present invention satisfies all ADME parameters ((absorption, distribution, metabolism, excretion) based on Lipinski's rule of five By confirming, pharmacokinetic safety has been established, and there are almost no toxicity and side effects, so it is a drug that can be safely used even when taken for a long period of time for the purpose of prevention.

The present invention provides KA-1002 ((2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3, It provides an animal feed for improving livestock respiratory inflammatory diseases, including 4-diol).

The animal feed for improving the livestock respiratory inflammatory disease is not particularly limited, and a feed commonly used in the art may be used. Non-limiting examples of the feed include plant feeds such as grains, root fruits, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, gourds or grain by-products; and animal feeds such as proteins, inorganic materials, oils and fats, minerals, single-cell proteins, zooplankton, or food. These may be used alone or in mixture of two or more.

The present invention relates to a composition for preventing or treating livestock respiratory diseases, specifically, (2R,3R,4S, ^5R )-2-( 6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3,4-diol (hereinafter KA-1002) has been shown to relieve LPA-induced cell destruction and inflammation. It was confirmed that it acts as an LPA signaling antagonist, and through this, it can be expected to develop a new drug for the prevention or treatment of respiratory diseases in livestock using LPA signaling antagonists.

1 is an LPA antagonist according to the present invention, (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran This is the molecular structure of -3,4-diol (KA-1002).
2 is a graph showing the effect of KA-1002, an LPA antagonist according to the present invention, on the expression of inflammatory cytokines. (A) is a graph showing the effect of KA-1002 on the expression level of LPA-induced TNFα, (B) IL-1β, and (C) IL-6 in bovine pulmonary vascular endothelial cells. (D) is a graph showing the relative transcriptional levels of LPAR1 and LPAR2 in bovine pulmonary vascular endothelial cells.
3 shows the physiological and chemical characteristics of KA-1002, an LPA antagonist according to the present invention, by Swiss ADME analysis.
4 shows the effect of KA-1002, an LPA antagonist according to the present invention, on LPA-induced angiogenesis in a calf pulmonary artery endothelium (CPAE cell) cell line. (A) is a photograph showing that untreated cells, LPA-induced angiogenesis and LPA-induced angiogenesis were inhibited by KA-1002 in CPAE cells, (B) Imaris software (Oxford Instruments) The calculated value of the tube network using the graph is shown.
5 shows the effect of KA-1002, an LPA antagonist according to the present invention, on LPA-induced ZO-1 expression in bovine organ cells (EBTr cells). (A) is a photograph showing untreated EBTr cells, those treated with LPA, and EBTr cells treated with LPA + KA-1002 (ZO-1 (red), F-actin (green) and nuclei (blue)) . (B) is a graph showing the relative expression level of ZO-1 per EBTr cell, (C) is a graph showing the relative expression level of F-actin per EBTr cell.
6 is a graph showing whether or not cells adhere to EBTr cells of KA-1002, an LPA antagonist according to the present invention, after LPA treatment. (A) is a micrograph of EBTr cells untreated, LPA-treated, and LPA treated with KA-1002 at 5 μM and 20 μM, respectively. (B) is a graph showing the relative amount of adhered EBTr cells in each experimental group.
7 is a graph showing the relative transcriptional amounts of (A) TNFα and (B) IL-1β induced by LPA in EBTr cells of KA-1002, an LPA antagonist according to the present invention.

Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided so that this disclosure will be thorough and complete, and will fully convey the spirit of the invention to those skilled in the art.

<Example 1. Selection of LPA signal antagonists through cell-based high-efficiency screening method>

In order to select potent LPA signal antagonists, 2000 compounds from the library of the Korea Research Institute of Chemical Technology were selected by a cell-based high-efficiency screening method (HTS). Potential LPA signal antagonist candidates by confirming whether 2000 compounds selected based on structural similarity to Ki-16427, a well-known LPA antagonist, inhibit the LPA-induced inflammatory cytokine TNFα production in CPAE cells, a bovine vascular cell line. was selected.

CPAE (ATCC® CCL-209™) cells, a bovine vascular cell line, were purchased from ATCC (Manassas, VA, USA) and used. CPAE cells were bovine pulmonary endothelial cells, and were cultured in RPMI (Roswell Park Memorial Institute) medium supplemented with 10% fetal bovine serum, 1% penicillin, and streptomycin at 37° C. in 95% air and 5% carbon dioxide conditions. For TNFα expression analysis, CPAE cells were treated with LPA (Sigma-Aldrich, St. Louis, MO, USA) at 100 μM in the presence of each concentration (5-20 μM) of the compound. Then, total RNA of each treated CPAE cell was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and 20 ng of each was used for real-time reverse transcriptase PCR (RT-PCR). RT-PCR was performed using Thermoscript™ RT-PCR cDNA SuperMix (Invitrogen, Carlsbad, CA, USA). Then, PCR (Agilent Technologies Inc., Santa Clara, CA, USA) was performed using Brilliant II CYBR® Green qPCR Master Mix.

As a result of the experiment, 14 types of substances in which LPA-induced TNFα expression was inhibited by 70% or more at a concentration of 5 μM were selected. Among them, the inhibitory effect of KA-1002 was the most remarkable, and its molecular structure was (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purine-9-yl) -5-(hydroxymethyl)-tetrahydrofuran-3,4-diol) was confirmed. 1 is an LPA antagonist according to the present invention, (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran This is the molecular structure of -3,4-diol (KA-1002).

< Example 2. In pulmonary artery endothelial cells of KA-1002 LPA Confirmation of effect on induced inflammatory cytokine production>

The effect of KA-1002 on other inflammatory cytokines and chemokines produced in CPAE cells induced by LPA was confirmed.

CPAE cells were cultured in the same manner as in Example 1, and after total RNA was isolated in the same manner as in Example 1, cDNA was prepared.

As shown in Table 1 below, primers and probe sets were purchased from Bioneer (Daejeon, Korea), and the results were normalized using the beta-actin amount. Real-time qPCR was performed on two replicate samples using the Agilent Technologies AriaMx real-time system (Agilent Technologies Inc.), and the relative expression based on the 2 ^-ΔΔCT value for the cells of each sample was the highest expression value. It is shown in FIG. 2 expressed as a percentage.

Gene Name 5'-Primer Sequence 3'-Primer Sequence Bovine TNFα TCTCTCTCACATACCCTGCCA CCACATCCCGGATCATGCTT Bovine IL-6 CCAGCCACAAACACTGACCT CCCCAGCTACTTCATCCGAA Bovine IL-1β AACGTCCTCCGACGAGTTTC CCAGCACCAGGGATTTTTGC Bovine LPAR1 AACACAGGGCCCAATACTCG CAATTGCAATGGCCAGGAGG Bovine LPAR2 CCACGAGTCTGTTCGCTACA GTGGCATTTGCTGTACCCTG Bovine β-actin TCGGTTGGATCGAGCATTCC GTGGCTTTTGGGAAGGCAAA

2 is a graph showing the effect of KA-1002, an LPA antagonist according to the present invention, on the expression of inflammatory cytokines. 2(A) to 2(C), KA-1002 significantly inhibited LPA-induced expression of TNFα, IL-1β and IL-6 in bovine pulmonary vascular endothelial cells in CPAE cells. . In the case of IL-1β and IL-6, KA-1002 according to the present invention had a better TNFα expression inhibitory effect than Ki-16425, which is known as a conventional LPA antagonist, and in the case of IL-1β and IL-6, KA-1002 of the present invention is Ki-16425 It was confirmed that the expression inhibition effect was more excellent at 5 and 20 μM, respectively.

< Example 3. KA-1002 LPA Receptor Identification>

In order to investigate the antagonistic mechanism of KA-1002, an LPA antagonist according to the present invention, the expression level of LPA receptor (LPAR) was investigated during KA-1002 treatment. In the same manner as in Example 2, the transcription levels of LPAR1 and LPAR2 upon KA-1002 treatment in CPAE cells were investigated and shown in FIG. 2(D).

As shown in FIG. 2(D), the transcription level of LPAR1 was higher than that of LPAR2 upon KA-1002 treatment. These results are similar to the LPA antagonist effect of Ki-16425, which is interpreted that the KA-1002 of the present invention acts as an LPA antagonist with the same mechanism as Ki-16425, which is known to act as an LPA antagonist through LPAR1. can be

< Example 4. Swiss of KA-1002 ADME Analyze>

Swiss ADME analysis was performed to examine the pharmacokinetic properties of KA-1002 as an LPA antagonist of the present invention. As a result of analyzing the pharmacokinetic properties and drug similarity of KA-1002 with the Swiss ADME program provided by the Swiss Institute of Bioinformatics, as shown in FIG. 3, KA-1002 conforms to Lipinski's rule of five. It was confirmed that all of the basic ADME parameters ((absorption, distribution, metabolism, excretion) were satisfied.

< Example 5. KA-1002 LPA Confirmation of alleviating effect of induced inflammatory angiogenesis>

It is well known that LPA induces angiogenesis to amplify inflammation at the site of inflammation. Since KA-1002 as the LPA antagonist of the present invention inhibits inflammation in bovine vascular cells, we speculate that KA-1002 will inhibit the LPA-mediated increase in angiogenesis, and the LPA-induced inflammatory angiogenesis of KA-1002. The alleviation effect of neonatal was confirmed.

In the same manner as in Experimental Example 2, CPAE cells were treated with untreated, LPA (100 μM) and LPA (100 μM) + KA-1002 (20 μM), and then the angiogenesis of blood vessels was checked with an optical microscope and shown in FIG. it was

As shown in FIG. 4 , it was confirmed that CPAE cells increased angiogenesis by LPA (100 μM), and it was confirmed that LPA-induced angiogenesis was inhibited in the experimental group to which KA-1002 (20 μM) was added. did

< Example 6. Cattle of KA-1002 in organ cells LPA induced by ZO Check the effect on -1>

LPA is known to strongly reduce the expression of Zonula occludens-1 (hereinafter ZO-1) protein in bovine organ cells (EBTr cells). ZO-1 protein is involved in signal transduction in cell-cell junctions, It is a scaffolding protein that provides a structural basis for the assembly of polyprotein complexes on the cytoplasmic surface.It is known that the expression of ZO-1 protein is high in healthy cells, and this cell junction material is lost by LPA in organ cells. Accordingly, it was confirmed whether KA-1002 as an LPA antagonist of the present invention inhibited the decrease of ZO-1 protein induced by LPA.

For ZO-1 expression analysis, EBTr cells were treated with 100 μM LPA (Sigma-Aldrich) in the presence or absence of 20 μM KA-1002 for 18 hours, and tested with 3 replicate samples. First, EBTr cells were inoculated into 8-well μ-slides (Ibidi, Planegg, Germany), treated with 100 μM LPA in the presence or absence of 20 μM KA-1002, and cultured at 37° C. and 5% CO ₂ conditions for 24 hours. . After fixing with paraformaldehyde for 20 minutes, the slides were washed with PBS containing 0.01% Triton X-100, permeabilized, and blocked with 1% bovine serum albumin at room temperature for 1 hour. Thereafter, the phlorophore-conjugated primary antibody was treated at 4° C., washed three times with 1% bovine serum albumin for 10 minutes the next day, and then stained with DAPI diluted 1000 times in PBS. A primary antibody against ZO-1 or F-actin (Thermo 0 Fisher Scientific) was diluted 1:200 and used for visualization of ZO-1 or actin filaments based on intercellular structures and tight junctions. . The fluorescence signal was imaged with an LSM 880 confocal laser scanning microscope equipped with VIS and NIR lasers, and all captured images were taken using the Airyscan mode for image optimization of the LSM 880 confocal laser scanning microscope (Carl Zeiss, Oberkochen, Germany). was photographed, and this is shown in FIG. 5 .

5 shows the effect of KA-1002, an LPA antagonist according to the present invention, on ZO-1 expression induced by LPA in bovine organ cells (EBTr cells). (A) is a photograph showing untreated EBTr cells, those treated with LPA, and EBTr cells treated with LPA + KA-1002 (ZO-1 (red), F-actin (green) and nuclei (blue)) . (B) is a graph showing the relative expression level of ZO-1 per EBTr cell, (C) is a graph showing the relative expression level of F-actin per EBTr cell.

As shown in FIG. 5(A), ZO-1 protein was lost by LPA in EBTr cells, and it was confirmed that the loss of ZO-1 protein was alleviated by KA-1002. F-actin expression was not significantly changed by LPA or KA-1002. As a result of measuring the relative expression levels of ZO-1 and F-actin in the same part of each cell image, in untreated EBTr cells, ZO-1 protein is located in the entire cytoplasm and at the cell edge, especially in the cell boundary region. It was confirmed that ZO-1 expression was high. However, in the case of LPA-treated EBTr cells, the ZO-1 protein was lost in most of the cell marginal region. In addition, when KA-1002 was further treated in LPA-treated EBTr cells, it was found that the arrangement of the ZO-1 protein at the cell edge was restored.

Since the ZO-1 protein located in the cell edge region plays an important role in the cell-to-cell tight junction and cell adhesion, it was found that LPA treatment induced the loss of the cell-to-cell tight junction.

< Example 7. Cattle of KA-1002 in organ cells LPA Confirmation of effect on loss of adhesion induced by

From the results of Example 6, it was confirmed whether KA-1002 had an effect on the loss of adhesion between the cells and the mattress induced by LPA. After EBTr cells were treated in the same manner as in Example 6, the degree of adhesion of EBTr cells to the culture plate was observed and shown in FIG. 6 .

6 is a graph showing whether or not cells adhere to EBTr cells of KA-1002, an LPA antagonist according to the present invention, after LPA treatment. (A) is a micrograph of EBTr cells untreated, LPA-treated, and LPA treated with KA-1002 at 5 μM and 20 μM, respectively. (B) is a graph showing the relative amount of adhered EBTr cells in each experimental group. (C) shows the results of FACS analysis of untreated, LPA-treated and EBTr cells treated with KA-1002 at 20 μM in LPA.

As shown in FIGS. 6(A) and 6(B), LPA-treated EBTr cells had significantly lower adhesion to the culture plate than LPA-treated cells, and LPA-treated cells were non-adherent to adherent cells. of the ratio was large. However, when KA-1002 was treated, it was confirmed that the adhesion of LPA-treated EBTr cells to the culture plate was restored in a KA-1002 concentration-dependent manner.

These results can be interpreted as reducing the cell-to-cell tight junction and cell-matrix adhesion, which can cause structural destruction of cells or tissue damage by LPA, suggesting that the KA-1002 of the present invention can alleviate this. do.

< Example 8. Cattle of KA-1002 in organ cells LPA Confirmation of effect on inflammatory cytokine production induced by

In order to characterize LPA-mediated inflammatory cytokine production in bovine organ cells, TNFα and IL-1β of EBTr cells treated with untreated, LPA-treated and LPA and KA-1002, respectively, were measured in the same manner as in Example 2. 7 is shown.

7 is a graph showing the relative transcriptional amounts of (A) TNFα and (B) IL-1β induced by LPA in EBTr cells of KA-1002, an LPA antagonist according to the present invention. As shown in FIG. 7 , TNFα and IL-1β were significantly increased by LPA treatment, but increases in TNFα and IL-1β induced by LPA treatment were inhibited by KA-1002. Considering the similar results in the CPAE cell experiment of Example 2, it was confirmed that LPA induces inflammation in bovine bronchial and endothelial cells, and that KA-1002 can be used as an antagonist of LPA.

Claims (10)

Livestock containing (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3,4-diol In the composition for the prevention or treatment of respiratory inflammatory diseases,
The (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3,4-diol is LPA ( Lysophosphatidic acid) receptor antagonist
The livestock respiratory inflammatory disease is a preventive or therapeutic composition for an inflammatory disease of the livestock respiratory tract, characterized in that cattle pneumonia or bronchitis. delete According to claim 1,
LPA antagonism of the (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3,4-diol A composition for preventing or treating inflammatory diseases of the livestock respiratory tract, characterized in that the action is mediated by LPAR1 (LPA Receptor1). According to claim 1,
The (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3,4-diol is A composition for preventing or treating inflammatory diseases of the livestock respiratory tract, characterized in that it inhibits the production of inflammatory cytokines induced by 5. The method of claim 4,
The inflammatory cytokine induced by the LPA is TNFα (tumor necrosis factor-α), IL-1β (Interleukin-1β) and IL-6 (Interleukin 1) Livestock respiratory inflammation, characterized in that at least one selected from the group consisting of A composition for preventing or treating a disease. According to claim 1,
The (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3,4-diol is A composition for preventing or treating inflammatory diseases of livestock respiratory tract, characterized in that it inhibits angiogenesis induced by According to claim 1,
The (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3,4-diol is A preventive or therapeutic composition for inflammatory diseases of the livestock respiratory tract, characterized in that alleviating the inhibition of ZO-1 protein expression induced by 8. The method of claim 7,
Inhibition of ZO-1 protein expression induced by the LPA is a composition for preventing or treating inflammatory diseases of livestock respiratory tract, characterized in that it reduces tight junctions between cells. delete Livestock containing (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3,4-diol In the animal feed for improving respiratory inflammatory diseases,
The (2R,3R,4S,5R)-2-(6-((2-hydroxyethyl)amino)-9H-purin-9-yl)-5-(hydroxymethyl)-tetrahydrofuran-3,4-diol is LPA ( Lysophosphatidic acid) receptor antagonist
The inflammatory disease of the livestock respiratory tract is an animal feed for improving inflammatory diseases of the livestock respiratory tract, characterized in that it is pneumonia or bronchitis in cattle.

Images