KR102383044B1 - A novel Bacillus sp. strain and use thereof - Google Patents

Abstract

The present invention provides a novel Bacillus sp. strain derived from the Korean rockfish ground which not only enhances the growth, feed efficiency, and immune activity of Korean rockfish, which is a cultured fish, but also increases the diversity of intestinal microflora. The present invention is a novel Bacillus sonorensis KRF-7 strain deposited under accession number KCTC14643BP.

Description

Novel Bacillus genus strains and uses thereof {A novel Bacillus sp. strain and use thereof}

The present invention relates to a novel Bacillus sp. strain and uses thereof, and more particularly, to a novel Bacillus sp. strain for improving productivity and immunity of Zopi rockfish and uses thereof.

Antibiotics used for disease control in aquaculture can contaminate the aquaculture environment and increase antibiotic-resistant pathogenic strains, reducing the effectiveness of treatment for disease. Some countries have banned the use of synthetic antibiotics in fish farmed for human consumption. Research on feed additives to replace antibiotics for the purpose of increasing productivity and controlling diseases in aquaculture is being actively conducted, and interest in these functional additives continues to increase. Among them, probiotics (probiotics), which are environmentally friendly, maintain the host's intestinal microflora balance, increase immunity, and are useful for nutrient digestion and absorption, are attracting attention as feed additives. Currently, a technology for producing functional additives that enhances the immunity of farmed fish by utilizing related technologies such as probiotics, nutrient extracts and organic acids is being commercialized. According to the definition of FAO/WHO, a probiotic means a living microorganism that provides a beneficial effect to the host when supplied in an appropriate amount. Enzymes, antibacterial peptides, and short-chain fatty acids produced by probiotics help the host digest and absorb nutrients, eliminate pathogenic strains, and stimulate immune cells to increase disease resistance. In addition, recent studies have shown that probiotics play a very important role in maintaining the intestinal microbial balance. Meanwhile, Korean rockfish is one of the most important fish species in aquaculture in Asian countries, so research on it is very important. However, the technology development of probiotics carried out on the rockfish is very insufficient. In this regard, Korean Patent Application Laid-Open No. 2012-0130916 discloses an IL-1β polypeptide derived from rockfish and an immune-enhancing composition for fish comprising the same as an active ingredient.

However, the prior art uses a recombinant protein prepared by using a nucleic acid sequence, and the study of probiotics on Zopi rockfish is still limited.

The present invention is to solve various problems including the above problems, and a novel Bacillus genus derived from the Zopi rockfish intestine that not only increases the growth, feed efficiency, and immune activity of the aquaculture fish, but also increases the diversity of the intestinal microbial flora. It aims to provide a strain. However, these problems are exemplary, and the scope of the present invention is not limited thereto.

According to one aspect of the present invention, the new Bacillus sp deposited with accession number KCTC14643BP. The KRF-7 strain is provided.

According to another aspect of the present invention, a probiotic preparation comprising the strain as an active ingredient is provided.

According to another aspect of the present invention, there is provided a feed additive for fish farming, comprising the strain as an active ingredient.

According to another aspect of the present invention, there is provided a feed for fish farming, comprising the feed additive.

The novel Bacillus sp. strain of the present invention made as described above was identified in the Zopi rockfish intestine and applied to the Zopi rockfish. As a result, growth, bioavailability, feed efficiency, etc. were improved, and the immune activity increased, so that it can be actively used for development of a probiotic suitable for the Zopi rockfish. In addition, since damage to aquaculture due to disease is increasing in the aquaculture field, the productivity, immunity and anti-military effects of various fish can be expected when using the probiotic derived from Zopi rockfish as a feed additive. Of course, the scope of the present invention is not limited by these effects.

1 is a Bacillus sp of the present invention. It is a figure analyzing the phylogenetic tree based on the 16S rRNA sequence of the KRF-7 strain. The location of Bacillus sp.KRF-7 and other Bacillus species are indicated. After constructing a phylogenetic tree by the neighbor joining method using MEGA 6 with 1,000 bootstrap repeats, 16S rRNA sequences were aligned by the Clustal W program.
Figure 2a is Bacillus sp of the present invention. This is a photograph of observing the hemolytic properties to evaluate the safety of the KRF-7 strain. In comparison with Bacillus cereus KCTC 1012 and KCTC 3624, the hemolytic activity of KRF-7 using a blood agar medium was measured.
Figure 2b is Bacillus sp of the present invention. It is a graph showing the results of cytotoxicity analysis to evaluate the safety of the KRF-7 strain. The cytotoxicity of KRF-7 to Caco-2 cells was analyzed.
Figure 2c is Bacillus sp of the present invention. This is a gel photograph showing the results of analysis for toxic gene detection as an evaluation of the safety of the KRF-7 strain. The PCR patterns of KRF-7 and B. cereus screened for virulence genes are shown. Lane M. DNA ladder; lane 1. hemolysin; lane 2. nonhemolytic enterotoxin; lane 3. Enterotoxin T; lane 4. Enterotoxin FM; lane 5. cytotoxin K; lane 6. sphingomyelinase; lane 7. phospholipase; Lane 8. Positive control.
3 is a Bacillus sp of the present invention. It is a graph showing the comparison result of prebiotic availability of KRF-7 strain.
Figure 4 is Bacillus sp of the present invention. It is a graph showing the result of analyzing the expression level of the immune-related gene of rockfish fed with a feed additive containing the KRF-7 strain.
Figure 5 is Bacillus sp of the present invention. It is a Venn diagram graph showing the results of analysis of intestinal microorganisms of rockfish bred with experimental feed containing the KRF-7 strain.
6 is a Bacillus sp of the present invention. It is a graph showing the results of analysis of intestinal microorganisms at the phylum and genus level of rockfish raised with experimental feed containing the KRF-7 strain.

Definition of Terms:

As used herein, the term "Korean rockfish (Sebastes schlegelii)" is a fish belonging to the genus Sashimidae, the rockfish family, and is distributed in South Korea of Southeast Asia, southern Japan's northern coast of Japan, the northern coast of China, the Balhae, and the Yellow Sea, In particular, in Korea, it is a coastal-settling fish that inhabits shallow sea reefs in the eastern, western, and southern seas. Among rockfish, it is the best growing species of rockfish, and is particularly strong at low temperatures and can be overwintered all over Korea.

As used herein, the term "probiotics" is a preparation made with microorganisms themselves, which settles in the intestines of farmed fish or livestock, inhibits the growth of other harmful microorganisms, helps digestion and absorption of ingested feed, and provides other nutrients It refers to a substance that promotes growth and improves feed efficiency by helping the synthesis of

DETAILED DESCRIPTION OF THE INVENTION:

According to one aspect of the present invention, the new Bacillus sp deposited with accession number KCTC14643BP. The KRF-7 strain is provided.

In the strain, the strain may have probiotic activity.

According to another aspect of the present invention, a probiotic preparation comprising the strain as an active ingredient is provided.

According to another aspect of the present invention, there is provided a feed additive for fish farming, comprising the strain as an active ingredient.

In the feed additive, MOS (mannan-oligosaccharides) may be further included.

According to another aspect of the present invention, there is provided a feed for fish farming, comprising the feed additive.

The fish to which the novel strain of the present invention can be applied may be halibut (flounder), rockfish, rockfish, black sea bream, red sea bream, sea bream, mullet, sea bass, mackerel, mackerel, horse mackerel, mackerel, and the like, but preferably may be rockfish.

Currently, research on various additives is being conducted for the purpose of enhancing the feed availability and immunity of farmed fish, but research on probiotics on rockfish is still limited. Accordingly, the present inventors investigated the microbial characteristics (hemolysis, cell adhesion rate, cytotoxicity, virulence genes, acid resistance, bile resistance, antibiotic resistance) of the strains identified in Zopi rockfish intestine, and development and breeding test of feed additives using the identified strains. Growth rate, feed efficiency, immune activity, and intestinal microflora were investigated. Specifically, the present invention relates to a method for developing a feed additive that enhances immunity by using a probiotic ( Bacillus sp.) derived from rockfish, and a feed to increase the immunity of rockfish by examining the characteristics of bacteria isolated from the intestine of rockfish and the supplementation effect of the cockroach feed. It is about the development of additives.

The present invention may have negative effects such as growth, digestive physiology and lowering immunity as low fish meal feed is applied to rockfish in order to improve the technology for developing feed additives according to the prior art. This is to provide feed additive development technology that can improve productivity. In the present invention, for the development of a probiotic suitable for rockfish, a strain was isolated from the intestine, and as a result of analyzing 16S rRNA, it was confirmed that the most similar to that of Bacillus species, Bacillus sp . It was named KRF-7.

The present inventors said Bacillus sp . As a result of using KRF-7 as a probiotic of the aquaculture organism, it was a safe strain without hemolytic, cytotoxic, and toxic genes, and the synergistic effect of bioavailability was confirmed due to the increase in productivity and immunity. In addition, KRF-7 showed a high survival rate against artificial gastric juice and bile fluid, and high adhesion to intestinal mucosal cells. In the rockfish breeding experiment, the addition of 10 ⁸ CFU of KRF-7 per 1 g of feed induced positive changes in the growth rate, daily growth rate, feed conversion efficiency, and protein conversion rate of cockle rockfish. In addition, non-specific immune factors such as superoxide dismutase (SOD), lysozyme activity and myeloperoxidase activity were positively regulated. In addition, the addition of KRF-7 changed the composition of microorganisms at the phylum level in the investigation of the intestinal microbial community. The expression levels of κB and B cell activating factors were significantly increased.

In conclusion, the novel strain Bacillus sp isolated in the present invention. KRF-7 is safe against aquacultured fish including rockfish, and has favorable conditions as a probiotic by exhibiting high resistance to artificial gastric juice and bile fluid and high adhesion to intestinal mucosa. In addition, addition to feed in cockroach culture may improve growth performance and beneficially modulate immune responses and gut microbiome. In addition, as a result of investigating the various microbial characteristics of the new strain, it met the safety verification guidelines for probiotics presented by FAO/WHO. Also, it is considered to have high use value as a feed additive for cockroaches. Currently, various probiotics have been commercialized and used in the aquaculture field, and when the technology including the strain of the present invention is applied to the target aquaculture fish species, it is considered that industrial use will be possible without special restrictions.

Hereinafter, the present invention will be described in more detail through examples. However, the present invention is not limited to the embodiments disclosed below, but can be implemented in various different forms. It is provided to fully inform the

Example 1: Isolation and identification of microorganisms

The present inventors separated the intestines from healthy rockfish, suspended in 0.85% NaCl, and then serially diluted. Each of the suspensions was smeared on LB plate medium (100 μl), incubated at 37° C. for 24 hours, and purified according to the morphological characteristics of colonies formed on the medium. After that, the isolated strain was stored in a -80°C ultra-low temperature freezer using 20% glycerol and 5% skim milk, and used for further research. In addition, for identification of microorganisms, genomic DNA of the isolated strain was extracted, PCR was performed using universal primers 27F and 1492R, and the amplified 16S rRNA nucleotide sequence was analyzed. The 16S rRNA sequencing results were compared for homology using NCBI BLAST, and a phylogenetic tree was prepared using the neighbor-joining method of the MEGA 6 program.

Example 2: Investigation of Microbial Characteristics

2-1: hemolytic, cell adhesion rate, cytotoxicity, toxic gene detection

The hemolytic test performed in the present invention was determined by analyzing the color of the colony and the shape of the ring formed around it by inoculating a blood agar plate with streaks and then culturing at 37° C. for 24 hours. The green ring around the colony was judged to be α-hemolysis, and the yellow transparent ring to be β-hemolysis. In addition, the cell adhesion rate was determined by inoculating the strain on a Caco-2 cell line formed as a monolayer, culturing for 2 hours, removing the bacteria that did not adhere to the Caco-2 cells, and treating the attached bacteria with trypsin-EDTA to BHI agar After culturing in , the number of bacteria was measured and shown. In addition, cytotoxicity was analyzed using a cell proliferation assay kit (Cell Proliferation Assay Kit) according to the protocol provided by the manufacturer. In addition, Bacillus cereus -based virulence gene test was analyzed using PCR. PCR was performed on the seven toxic genes shown in Table 1 below to determine the presence of toxic genes depending on whether or not amplification was performed. The nucleotide sequences of the primers used for the PCR amplification are summarized in Table 1 below.

Primer sequences for toxic gene detection gene designation base sequence (5'-->3') size SEQ ID NO: Hbl Hemolysin F GGAGCGGTCGTTATTGTTGT 620 One Hemolysin R GCCGTATCTCCATTGTTCGT 2 NheB Non-hemolytic enterotoxin F CTATCAGCACTTATGGCAG 770 3 Non-hemolytic enterotoxin R ACTCCTAGCGGTGTTCC 4 BceT Enterotoxin T F TTACATTACCAGGACGTGCTT 430 5 Enterotoxin T R TGTTTGTGATTGTAATTCAGG 6 EntFM Enterotoxin FM F ATGAAAAAAGTAATTTGCAGG 1270 7 Enterotoxin FM R TTAGTATGCTTTTGTGTAACC 8 CytK Cytotoxin K F ACAGATATCGGKCAAAATGC 810 9 Cytotoxin K R TCCAACCCAGTTWSCAGTTC 10 Sph Sphingomyelinase F CGTGCCGATTTAATTGGGGC 560 11 Sphingomyelinase R CAATGTTTTAAACATGGATGCG 12 piplc Phospholipase F CGCTATCAATGGACCATGG 570 13 Phospholipase R GGACTATTCCATGCTGTACC 14

2-2: acid resistance, bile resistance, antibiotic resistance

Acid resistance and bile resistance analysis performed in the present invention showed the viability of gastric juice (2 g/L NaCl, 3.2 g/L pepsin powder) and 0.3% bile salt after plate culture on BHI agar. The number of bacteria was measured and calculated by comparison with the number of bacteria in the control group. In addition, antibiotic resistance was measured by measuring the minimum inhibitory concentration (MIC) of five antibiotics, erythromycin, kanamycin, penicillin, streptomycin, and tetracycline. After that, the serially diluted antibiotics and the isolated bacteria were cultured at 37° C. for 24 hours, and the minimum concentration at which the bacteria did not grow was determined as the MIC.

2-3: Prebiotic availability

In the investigation of the availability of prebiotics, the growth of isolated strains was investigated using five well-known prebiotics (mannan-, gluco-, fructo-oligosaccharides, β-glucan, and chitosan) as the sole carbon source. The positive control group showed the availability of probiotics by measuring the absorbance after adding 1% of glucose, followed by incubation at 37° C. for 30 hours.

Example 3: Experimental feed production

The present inventors prepared four feeds (control, pre-, pro-, synbiotics) as experimental feeds based on the feed formulation table (refer to Table 2) provided by the Feed Research Center of the National Academy of Fisheries Science. Sardine fish meal, anchovy fish meal, soybean meal, wheat gluten, soy protein concentrate, resin meal, poultry by-products, etc. were mainly used as the protein source of the experimental feed, and wheat flour was used as the carbohydrate source and fish oil as the lipid source. After mixing all the feed sources evenly, extruded, molded and dried with a pellet maker, and then the particle size was evenly matched to the size of the experimental fish, sealed, and stored frozen at -20°C for use. The feed formulation table is summarized in Table 2 below.

feed formula Ingredients percent(%) fishmeal ¹ 35.00 Soybean Meal ¹ 12.00 starch ¹ 3.25 flour ¹ 7.00 Wheat Gluten ¹ 4.50 Concentrated Soy Protein ¹ 8.00 Tankage min ¹ 11.50 Poultry by-products min ¹ 5.50 tuna spray min ¹ 2.00 fish oil ² 4.60 Lecithin ¹ 0.70 Betaine ¹ 1.00 Taurine ¹ 0.80 Methionine ³ 0.15 Mono Calcium Phosphate ³ 1.10 Vitamin Premix ⁴ 1.00 Mineral Premix ⁵ 1.00 vitamin C 0.10 vitamin E 0.10 choline ³ 0.70 Bacillus sp. KRF-7 10 ⁸ CFU/g

* ¹ The Feed Co., Ltd. Goyang. ² Jeil Feed Co., Ltd. Hamman, Korea. ³ Sigma-Aldrich Korea, Yongin. ⁴ Vitamin Premix (mg kg ^-1 indiets): Ascorbic Acid, 300; dl-Calcium Pantothenate, 150; Choline Bitate, 3000; inositol, 150; Menadion, 6; niacin, 150; pyridoxine.HCl, 15; Riboflavin, 30; Thiamine mononitrate, 15; dl-α-tocopherol acetate, 201; retinyl acetate, 6; biotin, 1.5; folic acid, 5.4; cobalamin, 0.06. ⁵ Mineral premix (mg kg ^-1 indiets): NaCl, 437.4; MgSO ₄ ·7H ₂ O, 1379.8; ZnSO ₄ ·7H ₂ O, 226.4; Fe-citrate, 299; MnSO ₄ , 0.016; FeSO ₄ , 0.0378; CuSO ₄ , 0.00033; Ca(IO) ₃ , 0.0006; MgO, 0.00135; NaSeO ₃ , 0.00025.

Example 4: Cockpit rock breeding experiment

The present inventors performed a breeding experiment of rockfish using 12 120L tanks. Specifically, the breeding water temperature was 18.0±0.5° C., pH 8.0±0.2, dissolved oxygen 7.0 mg/L, and salinity 31±1 ppt. The larvae were purchased from Hanil Sea World in Tongyeong, Gyeongsangnam-do. Before entering the experiment, preliminary rearing was carried out while supplying basic feed for 2 weeks in a 300L tank. After that, 30 larvae of larvae with an average body weight of about 5 g were randomly placed in 3 repetitions in each experimental group. Then, oxygen was supplied by installing an air stone for sufficient oxygen supply in each tank, and the water temperature was maintained at 18±0.5° C. using a cooler during the experiment period. The oxygen supply and flow rate were kept the same, and the experimental feed for the breeding experiment was supplied twice daily (10:00, 16:00 h) for 8 weeks.

Example 5: Growth and health

The present inventors measured growth and health through fish body measurements after completing breeding experiments of rockfish for 8 weeks. Specifically, to investigate the growth rate, the total weight of the experimental fish in each tank was measured after fasting for 24 hours. Weight gain, %, specific growth rate, %/day, and protein efficiency ratio , Feed conversion ratio was analyzed by applying Equations 1 to 4.

(Formula 1)

Growth rate (WG, %) = (final weight - initial weight) × 100/initial weight

(Equation 2)

Daily growth rate (SGR, %) = (final weight - initial weight) × 100/days

(Equation 3)

Protein conversion efficiency (PER) = (wet weight increase/protein intake)

(Equation 4)

Feed efficiency = dry feed intake/wet weight increase

Meanwhile, the hepatosomatic index, the visceralsomatic index, and the condition factor of the rockfish randomly selected for each group were measured by applying Equations 5 to 7 below.

(Equation 5)

Liver weight index (HSI) = (liver weight/weight) × 100

(Equation 6)

Visceral weight index (VSI) = (visceral weight/weight) × 100

(Equation 7)

Obesity = [body weight (g) / body length (cm)3] × 100

Example 6: Blood biochemical analysis and non-specific immune factors

The present inventors performed biochemical analysis by collecting the blood of Zopi rockfish, an experimental fish species. Specifically, the blood of Zopi rockfish was collected using a blood syringe (1 mL), and the collected blood was centrifuged to separate the serum, and AST (aspartate aminotransferase), ALT (alanine aminotransferase), Glucose (total glucose), total cholesterol (total cholesterol), and total protein (total protein) were analyzed. After that, SOD (superoxide dismutase) was obtained by using the SOD Assay Kit (Sigma-Aldrich, 191600) with the serum isolated from the fish for each experimental group, and according to the manufacturer's instructions, WST-1 (Water Soluble Tetrazolium dye) and xanthine oxidase (xanthine oxidase) ) to calculate the inhibition rate of the enzyme as a percentile. The inhibition was expressed in units of SOD activity per mg protein. In addition, lysozyme activity was measured by mixing 50 μL of rock rock blood serum and 1 mL of lyophilized 0.2 mg/mL Micrococcus lysodeikticus , followed by incubation at 22°C for 1 minute and 21 minutes, and then the absorbance value at 530 nm. was measured and confirmed. Subsequently, 1 unit of lysozyme activity was defined as the amount of serum that reduced an OD value of 0.001 per minute. Then, for the peroxidase test, 10 μL of serum was added to 190 μL of Hanks' Balanced Salt Solution (HBSS), 50 μL of 3, 3', 5, 5'-tetramethylbenzidine chloride solution (TMB) was added, and After reaction for 2 minutes, 1N sulfuric acid was added to stop the reaction, and the absorbance at 450 nm was measured. In addition, to measure antiprotease activity, 10 μL of serum and trypsin solution (5 mg/ml) were mixed and reacted at 22° C. for 10 minutes, followed by 200 μL of 0.1M PBS and 125 μL of 2% (w/v) azocasein. was added and incubated at 22 °C for 1 hour. Then, the reaction was terminated by adding TCA, and after precipitation at 6,000 rpm for 5 minutes, 400 μL of the supernatant and 400 μL of 1N sodium hydroxide were mixed and absorbance at 450 nm was measured.

Example 7: RNA Isolation and cDNA Synthesis

The present inventors isolated total RNA from the kidney and spleen of Zopi rockfish using Hybrid-RTM (GeneAll) to investigate immune-related gene expression through qRT-PCR. Specifically, 100 mg or less of tissue was put into 1 ml of RiboExTM, and immediately homogenized, and the homogenized sample was reacted at room temperature for 5 minutes. Thereafter, centrifugation was performed at 12,000 x g at 4°C for 10 minutes, and the supernatant was transferred to a new 1.5 ml microcentrifuge tube. Then, 200 μl of chloroform was added to the homogenized sample, thoroughly mixed through a vortex mixer for 15 seconds, and reacted at room temperature for 2 minutes. Then, centrifuged at 12,000 x g at 4°C for 15 minutes to transfer the supernatant containing RNA to a new 1.5 ml tube, mixed using Buffer RB1 included in the kit, and transferred to a mini column for washing ( washing), and then RNA was isolated from the column using nuclease free water. Then, PrimeScript 1st strand cDNA Synthesis Kit (Takara) was used for cDNA synthesis, and 2 μl of Random 6mers, 1 μl of dNTP Mixture, 1 μg of sample and RNase free water were mixed and reacted at 65° C. for 5 minutes. Thereafter, it was immediately placed on ice and maintained for 5 minutes. In addition, 4 μl of 5X PrimeScript Buffer, 0.5 μl of RNase Inhibitor, and 1 μl of RTase were added, followed by reaction at 30° C. for 10 minutes. Finally, after reacting at 70 °C for 15 minutes, it was used for qRT-PCR. The sequence information of the primers used in the qRT-PCR is summarized in Table 3 below.

Primer sequences for expression of immune-related genes primer base sequence (5'--> 3') base sequence β-actin F AGGCTCAGAGCAAGAGAG 15 β-actin R CGGTGAGCGGACGGGTGC 16 IL-1β F GATTTCCCATCATCCACTGAC 17 IL-1β R AACACAATTTCCTCTTCCACC 18 IL-10 F TTTGCCTGCCACACCATGAACA 19 IL-10R TGGACTCCATGTGAGGCTTTAGGT 20 NF-κB F AGAGCAGGACGAAGATGAGCCAAT 21 NF-κB R TCTTCACTGCTGCTCGACCTCAT 22 HSP70 F GATGCAGCCAAGAACCAGGTGG 23 HSP70 R GCTTCCCTCCATCTCCGATCACC 24 BAFF F CCTGCAGCTGTTGGCAAACAATA 25 BAFF R CGCAAAGGTGCTGTCCATGTAG 26

Example 8: Immune-related gene expression level investigation

qRT-PCR performed in the present invention was analyzed by mixing cDNA synthesized according to an embodiment of the present invention, primers, and TB Green Taq. The amplification was performed in 2 steps, and the condition was that initial denaturation was performed at 95° C. for 30 seconds, followed by 50 repetitions of 95° C. 5 seconds and 60° C. 30 seconds. After the amplification, dissociation was performed to analyze the specificity of the PCR product. Expression of each gene was analyzed through relative quantification of target DNA and housekeeping gene (β-actin).

Example 9: Intestinal Microbiome Analysis

In the intestinal microbiome analysis performed in the present invention, raw data was obtained through 16S metagenomic sequencing of the 16S rRNA V3-V4 region of the microorganisms present in the intestine of Zopi rockfish, and it was analyzed through the EzBioCloud server.

Example 10: Statistical Processing

All result values were statistically analyzed using one-way analysis of variance (ANOVA) in IBM SPSS software, and significant differences were verified at P < .05 level.

Experimental Example 1: Isolation and identification of microorganisms

16S rRNA sequence analysis of the microorganism isolated according to an embodiment of the present invention was performed to confirm that it was most similar to Bacillus species. The isolated microorganism was subjected to Bacillus sp. It was named KRF-7, and a phylogenetic tree analysis was performed based on the 16S rRNA sequence (FIG. 1). In addition, the strain was deposited with the accession number KCTC14643BP to KCTC (Korean Collection for Type Culture, Korea Research Institute of Bioscience and Biotechnology Biological Resources Center) on July 27, 2021.

Experimental Example 2: Hemolytic, cell adhesion rate, cytotoxicity, toxic gene detection analysis

As a result of performing the hemolytic test, two types of Bacillus cereus used as positive controls produced transparent rings, but Bacillus sp. It was confirmed that KRF-7 did not have any hemolytic properties in the vicinity because no ring was generated (FIG. 2a). In addition, as a result of examining the cell adhesion rate using the Caco-2 cell line, vegetative cells were 0.55±0.06% and spores were 14.77±1.94%. In addition, as a result of the cytotoxicity test, 2 types of Bacillus cereus used as a positive control showed a significant decrease in cell viability compared to the control group, but Bacillus sp. It was confirmed that KRF-7 had no significant difference with the control group and had no cytotoxicity (FIG. 2b). In addition, as no band was observed except for the positive control as a result of the toxic gene test, it is considered that there is no Bacillus cereus -based virulence gene (Fig. 2c).

Experimental Example 3: Acid resistance, bile resistance, antibiotic resistance analysis

Bacillus sp of the present invention. KRF-7 strain vegetative cells showed a survival rate of 4.74±0.68% and 3.64±0.42% in gastric juice and intestinal juice, respectively, and spores showed higher survival rates than feeder cells (66.85±4.07%, 5.96±0.24). %) was shown. In addition, there was no difference between feeder cells and spores in resistance to erythromycin, kanamycin and penicillin, but resistance to streptomycin and tetracycline was higher in spores (Table 4). The analysis results are summarized in Table 4 below.

Bacillus sp. Characteristics of KRF-7 physiological
state Survival rate (%)
hemolysis Antibiotic resistance (MIC, μg/ml) gastric juice serum E K P S T vegetative cells 4.74±0.68 3.64±0.42 nasal blood 512 4 16 2 One spore 66.85±4.07 5.96±0.24 512 4 16 8 2

*E, erythromycin; K, kanamycin; P, penicillin; S, streptomycin; T, tetracycline.

Experimental Example 4: Availability of prebiotics

As a result of analysis of the availability of prebiotics for the novel strain of the present invention, the most used prebiotics except for the positive control group were MOS (mannan-oligosaccharides) (FIG. 3).

Experimental Example 5: Growth and health analysis

The present inventors MOS (mannan-oligosaccharides), Bacillus sp. KRF-7 (BK), and the MOSBK feed mixed with the two additives were supplied to rockfish for 8 weeks, and growth changes after breeding were analyzed. As a result, compared to the control group (204±3.76%), the growth rate (WG) was higher when the feed supplemented with MOS (225±4.39%), BK (240±3.58%), and MOSBK (246±6.48%) was supplied. it was In addition, daily growth rate (SGR, %), protein conversion efficiency (PER) and feed efficiency (FCR) showed high results in BK and MOSBK groups. However, in the case of liver weight index, visceral weight index, and obesity, there were no significant differences in all experimental sections. Table 5 below summarizes the growth rate of rockfish supplied with the additive for 8 weeks.

Growth chart of rockfish experimental group Growth performance, feed utilization and organism parameters WG (%) SGR (% day ^-1 ) FCR PER Control 204±3.76 ^a 2.21±0.03 ^a 1.05±0.03 ^c 1.56±0.04 ^a MOS 225±4.39 ^b 2.35±0.02 ^b 0.98±0.01 ^b 1.68±0.01 ^b BK 240±3.58 ^c 2.45±0.02 ^c 0.93±0.03 ^ab 1.75±0.06 ^bc MOSBK 246±6.48 ^c 2.49±0.04 ^c 0.91±0.04 ^a 1.80±0.08 ^c

*Values are mean ± SD of 3 replicates. Values with different superscript characters within the same column of the table indicate significant differences (P < .05).

Experimental Example 6: Blood biochemical analysis and non-specific immune factors

As a result of the blood biochemical analysis performed in the present invention, there was no significant difference between the experimental groups in all survey items. Also, as a result of analyzing the non-specific immune response, the SOD item showed a significantly increased result in the BK (61.16±0.44) group compared to the control group (57.79±2.40). Lysozyme activity was significantly increased in the group fed with BK (0.58±0.22) and MOSBK (0.57±0.04) compared to the control group (0.45±0.04), and MPO also showed a significant increase in BK (0.99±0.12) and MOSBK (1.15). ±0.03) group showed a significant increase compared to the control group (0.84±0.07). On the other hand, there was no significant difference in antiprotease activity in all groups. The results of the non-specific immune response assay are summarized in Table 6 below.

Non-specific immune response assay experimental group Non-specific immune parameters SOD ¹ Lysozyme ² MPO ³ Antiprotease ⁴ control 57.79±2.40 ^a 0.45±0.04 ^a 0.84±0.07 ^a 48.19±7.14 MOS 59.94±0.50 ^ab 0.50±0.07 ^ab 0.83±0.07 ^a 45.27±2.27 BK 61.16±0.44 ^b 0.58±0.02 ^b 0.99±0.12 ^b 43.65±1.28 MOSBK 59.94±0.36 ^ab 0.57±0.04 ^b 1.15±0.03 ^c 43.52±4.03

*Values are mean ± SD of 3 replicates. Values with different superscript characters within the same column of the table indicate significant differences (P < .05). ¹ SOD: superoxide dismutase (% superoxide inhibition).

² Lysozyme: Serum lysozyme activity in ml ⁻¹ .

³ MPO: Myeloperoxidase activity (absorbance at 450 nm).

⁴ Antiprotease: trypsin inhibition rate.

Experimental Example 7: Immune-related gene expression level analysis

The present inventors confirmed the immune activity-related genes IL-1β, IL-10, NF-κB, HSP70, and BAFF and the housekeeping gene β-actin through qRT-PCR. As a result, significant differences in gene expression levels in the kidney and spleen of Zopi rockfish were found in IL-10, NF-κB, and BAFF, and increased in the group fed with BK and MOSBK (FIG. 4).

Experimental Example 8: Intestinal microbiome analysis

The present inventors analyzed the intestinal microorganisms of rockfish raised with the feed prepared according to the present invention. As a result, the largest change in the Richness category was observed in the BK group, but the MOSBK group showed the smallest value in the Shannon category, confirming that the diversity index was high (see Table 7). In addition, as a result of performing Venn diagram analysis, it was confirmed that four species ( Bacillus, Lactobacillus, Prevotella, and Romboutsia ) exist in common in all groups, and the number of species unique to each group is the control, MOS, BK and MOSBK were 7, 87, 108, and 62, respectively (FIG. 5). In addition, as for the composition of the intestinal microflora at the Phylum level, Proteobacteria accounted for the largest proportion in the control and MOS groups, but Firmicutes occupied the largest proportion in the BK and MOSBK groups. At the genus level, the genus corresponding to the Phylum increased in the BK and MOSBK groups was identified as Bacillus (FIG. 6). The results of the intestinal microbial diversity analysis are summarized in Table 7 below.

gut microbiome Classification Abundance estimation
Shannon Diversity Index good coverage Chao1 ACE contrast 32.50 34.50 0.55 99.98 MOS 246.46 247.82 3.30 99.98 BK 287.23 290.74 1.21 99.97 MOSBK 234.78 238.31 0.11 99.95

Although the present invention has been described with reference to the above-described examples and experimental examples, it will be understood that these are merely exemplary, and that various modifications and equivalent other embodiments are possible therefrom by those skilled in the art. Therefore, the true technical protection scope of the present invention should be determined by the technical spirit of the appended claims.

(accession number)

Name of deposit institution: Korea Research Institute of Bioscience and Biotechnology Biological Resources Center

Accession number: KCTC14643BP

<110> Republic of Korea represented by National Fisheries Research & Development Institute <120> A novel Bacillus sp. strain and use thereof <130> PD21-6112 <160> 26 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hemolysin F <400> 1 ggagcggtcg ttattgttgt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hemolysin R <400> 2 gccgtatctc cattgttcgt 20 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Non-hemolytic enterotoxin F <400> 3 ctatcagcac ttatggcag 19 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Non-hemolytic enterotoxin R <400> 4 actcctagcg gtgttcc 17 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Enterotoxin T F <400> 5 ttacattacc aggacgtgct t 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Enterotoxin T R <400> 6 tgtttgtgat tgtaattcag g 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Enterotoxin FM F <400> 7 atgaaaaaag taatttgcag g 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Enterotoxin FM R <400> 8 ttagtatgct tttgtgtaac c 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cytotoxin K F <400> 9 acagatatcg gkcaaaatgc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cytotoxin K R <400> 10 tccaacccag ttwscagttc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sphingomyelinase F <400> 11 cgtgccgatt taattggggc 20 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Sphingomyelinase R <400> 12 caatgtttta aacatggatg cg 22 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Phospholipase F <400> 13 cgctatcaat ggaccatgg 19 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Phospholipase R <400> 14 ggactattcc atgctgtacc 20 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> beta-actin F <400> 15 aggctcagag caagagag 18 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> beta-actin R <400> 16 cggtgagcgg acgggtgc 18 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta F <400> 17 gatttcccat catccactga c 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta R <400> 18 aacacaattt cctcttccac c 21 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-10 F <400> 19 tttgcctgcc acaccatgaa ca 22 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IL-10 R <400> 20 tggactccat gtgaggcttt aggt 24 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NF-kB F <400> 21 agagcaggac gaagatgagc caat 24 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NF-kB R <400> 22 tcttcactgc tgctcgacct cat 23 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HSP70 F <400> 23 gatgcagcca agaaccaggt gg 22 <210> 24 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HSP70 R <400> 24 gcttccctcc atctccgatc acc 23 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BAFF F <400> 25 cctgcagctg ttggcaaaca ata 23 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BAFF R <400> 26 cgcaaaggtg ctgtccatgt ag 22

Claims (6)

A novel Bacillus sonorensis KRF-7 strain deposited with accession number KCTC14643BP. According to claim 1,
A strain having probiotic activity. A probiotic composition comprising the strain of claim 1 as an active ingredient. A feed additive for fish farming, comprising the strain of claim 1 as an active ingredient. 5. The method of claim 4,
A feed additive for fish farming, further comprising mannan-oligosaccharides (MOS). A feed for fish farming, comprising the feed additive of claim 4 or 5.

Images