KR102382610B1 - Pharmaceutical composition for the prevention or treatment of liver disease comprising enhanced mesenchymal stem cell - Google Patents

Abstract

A mixture composition, a method for preparing the composition, and a method for treating liver disease by administering the composition include a peptide containing the amino acid sequence of SEQ ID NO: 1 and a mixed composition of mesenchymal stem cells, thereby treating and preventing liver disease have

Description

A pharmaceutical composition for the prevention or treatment of liver disease comprising enhanced functional mesenchymal stem cells {Pharmaceutical composition for the prevention or treatment of liver disease comprising enhanced mesenchymal stem cells}

It relates to a pharmaceutical composition for preventing or treating liver disease, including functionally enhanced mesenchymal stem cells.

The liver is a major organ in control of metabolism and is responsible for the production, storage and processing of substances in the body. The liver is supplied with blood from both the hepatic artery and the portal vein, which is known as a kind of vein that contains various substances absorbed from the stomach or intestines. When lipids accumulate and fibrosis deepens, cirrhosis, a chronic liver disease, occurs. Currently, liver transplantation is the only treatment for cirrhosis.

On the other hand, the placenta is an organ involved in the synthesis and secretion of various cytokines, etc. as well as serving as a delivery medium of substances such as nutrients and oxygen essential for the development of the fetus. The placental-derived stem cells derived from this method have no ethical problems as stem cells isolated and extracted from the placenta extracted after childbirth, and have the characteristics of being able to recover more easily and a large amount of cells than other adult stem cells. However, there are basic limitations in using such natural placental-derived mesenchymal stem cells as cell therapeutics.

Recently, the WKYMVm peptide has emerged as a method for preventing and treating various diseases, but research and development cases using the WKYMVm peptide for the purpose of treating liver diseases are not known until now.

Under this technical background, studies on the therapeutic effect of the placenta-derived mesenchymal stem cells and WKYMVm peptide are being actively conducted (Korean Patent Publication No. 10-2014-24686), but the treatment and prevention of liver disease is still insufficient. am.

One aspect is to provide a pharmaceutical composition for the treatment of liver disease comprising a mixture of a peptide and mesenchymal stem cells comprising the amino acid sequence of SEQ ID NO: 1.

Another aspect is to provide a method for preparing a pharmaceutical composition for the treatment of liver disease, comprising mixing a peptide comprising the amino acid sequence of SEQ ID NO: 1 and mesenchymal stem cells.

Another aspect is to provide a method for treating liver disease comprising administering the pharmaceutical composition for the treatment of liver disease to an individual.

Each description and embodiment disclosed in this application may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present application fall within the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. For the purposes of the present invention, the following terms are defined below.

The terms “a (a)” and “an (an)” refer to one or more, unless specifically indicated otherwise.

“About” means 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, means any quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length varying by 3, 2 or 1%. In any embodiment discussed in the context of a numerical value used with the term “about,” it is specifically contemplated that the term about may be omitted.

Unless the context requires otherwise, throughout this specification and claims, the term "comprises" and variations thereof, such as "comprises" and "comprising," are open-ended, such as "including, but not limited to," should be construed in an inclusive sense.

By “consisting of” is meant inclusive of, and limited to, everything that is accompanied by the phrase “consisting of”. Accordingly, the phrase "consisting of" indicates that the listed elements are required or mandatory and that other elements may not be present. "Consisting essentially of" is meant to include any element listed after this phrase, and is limited to other elements that do not interfere with or contribute to the activity or action specified in the specification for the listed element. Thus, the phrase "consisting essentially of" indicates that the listed elements are required and mandatory, but other elements are optional and may or may not be present depending on whether they affect the activity or action of the listed elements.

A “reduced” or “reduced” or “lesser” amount is typically a “statistically significant” amount and is about 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 of an amount or level described herein. , 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, or 50 fold or less (eg, 100, 500, 1000 fold) reduction may include. In particular embodiments, it is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% (in between all integers and decimals, including 15%, 26%, etc.).

An “increased” or “enhanced” amount is typically an amount that is “statistically significant” and is 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.5, 3 over an amount or level described herein. , 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, or 50 times or more (eg, 100, 500, 1000 times) (in between and 1 Including all integers and decimals exceeding, eg, 2.1, 2.2, 2.3, 2.4, etc.) may be included in increments. In a particular embodiment, it is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, an increase of at least 150%, at least 200%, at least 500%, or at least 1000% inclusive of all integers and decimal points therebetween, such as 15%, 26%, etc.

Reference throughout this specification to “an embodiment” or “an embodiment” means that a particular nature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the invention. Thus, the appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular characteristics, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

One aspect provides a pharmaceutical composition for the treatment of liver disease comprising a mixture of a peptide and mesenchymal stem cells comprising the amino acid sequence of SEQ ID NO: 1.

The term, “prevention” refers to any action that suppresses or delays the onset of a disease by administration of the composition.

The term "treatment" refers to, to a subject suffering from or at risk of developing a disease, ameliorating the condition (eg, one or more symptoms) of the subject, delaying the progression of the disease, delaying the onset of symptoms or treating the symptoms of the disease. means any form of treatment that provides an effect including blunting and the like. Accordingly, the terms “treatment” and “prevention” are not intended to mean cure or complete elimination of symptoms.

The term "individual" refers to all animals, including humans, that have or can develop liver disease, and the liver disease can be effectively prevented or treated by administering the pharmaceutical composition to the individual. The pharmaceutical composition may be administered in parallel with the existing therapeutic agent for liver disease. More specifically, it refers to mammals such as human or non-human primates, mice, dogs, cats, horses, and cattle.

The peptide comprising the amino acid sequence of SEQ ID NO: 1 is WKYMVm peptide, WKYMVm, Trp-Lys-Tyr-Met-Val-D-Met, 187986-11-4, W-peptide, W-peptide, tryptophan-lysine-tyrosine -Methionine-valine-di-methionine, C ₄₁ H ₆₁ N ₉ O ₇ S ₂ . The peptide comprising the amino acid sequence of WKYMVm represented by SEQ ID NO: 1 is a synthetic peptide identified by screening a series of peptide libraries, and is known as an immunoregulatory peptide. Tryptophan-lysine-tyrosine-methionine-valine-di-methionine (Trp-Lys-Tyr-Met-Val-D-Met) residues peptides linked in sequence. The peptide can bind to a formyl peptide receptor (FPR) expressed in phagocytic cells, such as neutrophils and monocytes, and neutrophils, monocytes, and dendritic cells. and chemotactic migration of leukocytes such as natural killer cells. In addition, it can promote the production of superoxide anions from macrophages including neutrophils and monocytes.

The term “liver disease” may include impairment of liver function, liver fibrosis, liver failure, hepatitis, hepatotoxicity, cholestasis, fatty liver, cirrhosis, liver ischemia, alcoholic liver disease, liver abscess, hepatic coma, liver atrophy, liver cancer, etc. .

In one embodiment, the mixture may contain the peptide comprising the amino acid sequence of SEQ ID NO: 1 at a concentration of 1 μM to 1 mM, 10 μM to 1 mM, 100 μM to 1 mM, 1 μM to 100 μM, 1 μM to 10 μM, 10 μM to 100 μM. there is.

In one embodiment, the mixture is mesenchymal stem cells 0.1X10 ⁶ /kg to 5X10 ⁶ /kg, 1X10 ⁶ /kg to 5X10 ⁶ /kg, 2X10 ⁶ /kg to 5X10 ⁶ /kg, 3X10 ⁶ /kg to 5X10 ⁶ /kg, 4X10 ⁶ /kg to 5X10 ⁶ /kg, 0.1X10 ⁶ /kg to 4X10 ⁶ /kg, 0.1X10 ⁶ /kg to 3X10 ⁶ /kg, 0.1X10 ⁶ /kg to 2X10 ⁶ /kg, 0.1X10 ⁶ /kg to 1X10 ⁶ /kg, 1X10 ⁶ /kg to 4.5X10 ⁶ /kg, 1X10 ⁶ /kg to 4X10 ⁶ /kg, 1X10 ⁶ /kg to 3.5X10 ⁶ /kg, 1X10 ⁶ /kg to 3X10 ⁶ /kg It may be included in a concentration of.

In one embodiment, the mesenchymal stem cells may be derived from placenta, umbilical cord blood, adipose tissue, muscle, cornea, pulp or bone marrow. For example, placental-derived mesenchymal stem cells may be referred to as placental-derived mesenchymal stem cells.

The term “placenta-derived mesenchymal stem cells” may refer to mesenchymal stem cells derived from various tissues constituting the placenta, for example, amniotic epithelial cells, amniotic membrane, trophoblast, and chorion. Preferably, the placenta-derived mesenchymal stem cells may be mesenchymal stem cells derived from the chorionic plate of the placenta, or mesenchymal stem cells derived from the chorionic plate membrane. The separation method of placenta-derived stem cells may use a known separation method, for example, placental-derived mesenchymal stems obtained by the separation method developed by the present inventors (separation method according to Korean Patent Registration No. 10-0900309). cells can be used. Therefore, in the pharmaceutical composition, the placental-derived stem cells are obtained by (a) obtaining a chorionic plate membrane from the placenta separated from the mother after childbirth; (b) step: collecting the mesenchymal stem cells by scraping the cells inside the chorionic valve obtained in (a); Step (c): A solution containing trypsin and ethylenediaminetetraacetate is added to the cells obtained in (b) to perform an enzymatic reaction at 20 to 30°C, and fetal bovine serum is added to stop the enzymatic reaction. step; and (d) culturing the cells recovered by centrifuging the reaction solution obtained in step (c) in a medium supplemented with fetal bovine serum and antibiotics (e) to the placental-derived mesenchymal stem cells obtained in step (d). One obtained by adding a solution containing the WKYMVm peptide and mixing with the WKYMVm peptide may be preferably used. This document is incorporated herein in its entirety.

The term “placenta-derived mesenchymal stem cells enhanced with WKYMVm” may refer to placental-derived mesenchymal stem cells that are co-administered with WKYMVm peptide or pretreated with WKYMVm peptide. The pretreatment may refer to the process of contacting the stem cells with the cell culture medium to which the WKYMVm peptide is added during the culturing or induction of stem cells, and may refer to the process of immersing the cultured stem cells in the WKYMVm peptide solution. .

In one embodiment, the liver disease may be liver function impairment, liver failure, hepatitis, hepatotoxicity, cholestasis, fatty liver, cirrhosis, liver ischemia, alcoholic liver disease, liver abscess, hepatic coma, liver atrophy or liver cancer. A state in which the liver disease continues chronically and fails to perform a normal liver function may be referred to as “hepatic dysfunction”. Patients with hepatic insufficiency have significantly increased expression of fibrosis-related genes compared to normal subjects; and/or blood alanine transaminase (ALT) aspartate aminotransferase (AST) levels are significantly increased compared to normal subjects; And/or the concentration of albumin (ALB) in the blood may be significantly reduced compared to normal people.

In one embodiment, the mesenchymal stem cells provide a pharmaceutical composition for treating liver disease that increases the expression of ColI, VEGF, α-SMA, HNF1α, albumin, endoglin or cyclin D1 gene.

According to one embodiment, the pharmaceutical composition for the treatment of liver disease includes collagen accumulation in liver tissue, expression of liver regeneration-related genes and protein production, anti-fibrosis-related gene expression and protein production in hepatic stellate cells, venous endothelial cells may promote angiogenesis and expression of liver regeneration factors in Therefore, the pharmaceutical composition for treating liver disease can be used to prevent and treat liver disease and liver fibrosis.

Another aspect provides a method for preparing a pharmaceutical composition for the treatment of liver disease, comprising mixing the peptide comprising the amino acid sequence of SEQ ID NO: 1 and mesenchymal stem cells.

The pharmaceutical composition is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person skilled in the art to which the present invention pertains, or It can be prepared by introducing into a multi-dose container.

The cell therapeutic agent or pharmaceutical composition according to one embodiment may include the mesenchymal stem cells as an active ingredient and a pharmaceutically acceptable carrier and/or additive. For example, sterile water, physiological saline, conventional buffers (phosphoric acid, citric acid, other organic acids, etc.), stabilizers, salts, antioxidants (ascorbic acid, etc.), surfactants, suspending agents, isotonic acid, or preservatives, etc. can do. For topical administration, it is also preferable to combine with organic substances such as biopolymers, inorganic substances such as hydroxyapatite, specifically collagen matrix, polylactic acid polymers or copolymers, polyethylene glycol polymers or copolymers and chemical derivatives thereof, etc. .

When the cell therapeutic agent or pharmaceutical composition according to one embodiment is prepared in a formulation suitable for injection, the cell aggregate may be dissolved in a pharmaceutically acceptable carrier or frozen in a dissolved solution.

The cell therapeutic agent or pharmaceutical composition may include an implant.

The term "implant" is a material that can be implanted into a human body or a mammal as a support for isolating a damaged area from the outside or for allowing transplanted cells or secreted therapeutic substances to stay. Such an implant may include, without limitation, materials variously used in the art, such as biodegradable synthetic polymers and natural materials as a support for tissue engineering. The implant may be configured in a form in which the three-dimensional cell aggregate of the present invention or liver tissue formed therefrom is seeded on a support made by molding a biodegradable polymer.

The biodegradable polymer is to be spontaneously decomposed slowly after a certain period in vivo, and includes a polymer having at least one of biocompatibility, blood compatibility, anti-calcification properties, nutrient components of cells, and intercellular matrix formation ability. Types of these biodegradable polymers are not limited thereto, but fibrin, collagen, gelatin, chitosan, alginate, hyaluronic acid, dextran, polylactic acid, polyglycolic acid (poly(glycolic acid), PGA), poly(lactic acid-co- glycolic acid) (poly(lactic-co-glycolic acid), PLGA), poly-ε-(caprolactone), polyanhydride, polyorthoester, polyvinyl alcohol, polyethylene glycol, polyurethane, polyacrylic acid, poly- N-isopropylacrylamide, poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) copolymer, copolymers thereof, mixtures thereof, and the like may be included.

Mesenchymal stem cells according to one embodiment, various types of treatment protocols in which tissues or organs of the body are enriched, treated, or replaced by a desired cell population, for example, engraftment, transplantation, or injection of a stem cell or derived cell population. can be used for The pluripotent stem cell-derived mesenchymal stem cells can replace or enhance existing tissues, become new or changed tissues, or combine with biological tissues or structures.

Another aspect provides a method for treating liver disease, comprising administering the pharmaceutical composition for the treatment of liver disease to an individual in need thereof.

The term "administration" means introducing a predetermined substance into a patient by an appropriate method, and the administration route of the composition may be administered through any general route as long as it can reach a target tissue. Intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, may be administered intrarectally, but is not limited thereto.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in addition to the composition, for example, starch, calcium carbonate, sucrose, or lactose; It is prepared by mixing gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances, preservatives, etc. may be included. However, when administered orally, since the peptide is easily digestible, it is preferred that the oral composition be formulated to coat the active agent or to protect it from degradation in the stomach. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. The suppositories are Witepsol, Macrogol, and Twin61. Cacao butter, laurin fat, glycerogelatin, etc. may be used. Carbohydrates such as glucose, sucrose, and dextran, antioxidants such as ascorbic acid and glutathione, chelating substances, low molecular weight proteins, or other stabilizers can be used to increase the stability or absorption of peptides

In addition, the pharmaceutical composition may be administered by any device capable of transporting an active substance to a target cell. Preferred administration modes and formulations are intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections, and the like. For injection, aqueous solvents such as physiological saline solution and Ringer's solution, vegetable oil, higher fatty acid esters (eg, ethyl oleate), and non-aqueous solvents such as alcohols (eg, ethanol, benzyl alcohol, propylene glycol, glycerin, etc.) Stabilizers for preventing deterioration (e.g., ascorbic acid, sodium hydrogen sulfite, sodium pyrosulfite, BHA, tocopherol, EDTA, etc.), emulsifiers, buffers for pH control, to inhibit the growth of microorganisms Pharmaceutical carriers such as preservatives (eg, phenylmercuric nitrate, thimerosal, benzalkonium chloride, phenol, cresol, benzyl alcohol, etc.) may be included.

Meanwhile, the pharmaceutical composition is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not to cause side effects, and the effective dose level is determined by the patient's gender, age, and weight. , health condition, disease type, severity, drug activity, sensitivity to drug, administration method, administration time, administration route, and excretion rate, treatment period, factors including drugs used in combination or concomitantly, and other medical fields. It can be readily determined by one of ordinary skill in the art according to known factors. Among the terms or elements mentioned in the description of the pharmaceutical composition, the same as those already mentioned are the same as described above.

A pharmaceutical composition for the treatment of liver disease comprising a mixture of WKYMVm peptide and mesenchymal stem cells according to an aspect may be applied to the treatment and prevention of liver disease by promoting anti-fibrosis and vascular regeneration of the liver.

)로 인해 손상 받은 간 성상 세포 (hepatic stellate cell, HSC)에 WKYMVm으로 기능강화 된 태반유래 중간엽 줄기세포 공배양을 함에 따라 섬유화에 관여하는 유전자의 발현을 분석한 결과이다.
도 5는 qRT-PCR 및 혈관 생성 분석법 (tube formation assay)를 이용한 5-플루오로우라실 (5-fluorouracil, 5-FU)로 인해 손상 받은 인간 탯줄 정맥 내피 세포 (human umbilical vein cell, HUVEC)에 WKYMVm으로 기능강화 된 태반유래 중간엽 줄기세포 공배양을 함에 따라 혈관 재생에 관여하는 유전자의 발현 및 혈관 생성을 분석한 결과이다.
도 6은 qRT-PCR 및 western blot을 이용한 WKYMVm으로 기능강화 된 태반유래 중간엽 줄기세포 이식에 따른 간 기능부전 모델에서의 간 재생에 관여하는 인자에 관해 분석한 결과이다.1 is a result of analyzing the degree of collagen accumulation in a liver failure model following transplantation of placental-derived mesenchymal stem cells fortified with WKYMVm.
2 is a result of analyzing the expression of collagen type 1 (collagen type 1, ColI) in a liver failure model following the transplantation of placental-derived mesenchymal stem cells fortified with WKYMVm using qRT-PCR and western blot.
3 is a result of analyzing the expression of genes involved in vascular regeneration in a liver failure model following transplantation of placental-derived mesenchymal stem cells fortified with WKYMVm using qRT-PCR.
Figure 4 is a transforming growth factor-beta (transforming growth factor-beta, TGF-) using qRT-PCR, western blot and immunofluorescence (Immunofluorescence, IF)

), the results of analysis of the expression of genes involved in fibrosis following co-culture of WKYMVm-enhanced placental-derived mesenchymal stem cells into hepatic stellate cells (HSCs) damaged by fibrosis.
Figure 5 is WKYMVm in human umbilical vein cells (HUVEC) damaged by 5-fluorouracil (5-FU) using qRT-PCR and an angiogenesis assay (tube formation assay) This is the result of analyzing the expression of genes involved in vascular regeneration and angiogenesis by co-culture of placental-derived mesenchymal stem cells with enhanced function.
6 is a result of analysis of factors involved in liver regeneration in a liver failure model following transplantation of placental-derived mesenchymal stem cells fortified with WKYMVm using qRT-PCR and western blot.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

For statistical processing of the data of all examples, the significance of each experimental group was tested using Student's t-test between the two groups. Experimental results are expressed as mean ± S.E.

Preparation Example 1: Preparation of experimental animals

50 Sprague-Dawley rats (7 weeks old, weight: about 200 g, male) (Orient Bio, Korea) were acclimatized for 1 week and then used in the experiment. The experimental animals were non-biliary control group (control group, Con), cholangiostomy group (control group, NTx), natural placental-derived mesenchymal stem cell transplant group after bile duct resection (Tx), and WKYMVm function-enhanced placental-derived mesenchymal stem cell transplantation. Groups (Tx+WKYMVm) were divided into 3 rats each over 1, 2, 3, and 5 weeks. The breeding conditions were the same before the surgery and after the cholangioectomy surgery, and specifically, a constant light-dark cycle condition in which light is applied from 7 am to 7 pm, a temperature condition of 22 to 26 ° C, and 55 to 60% of It was carried out by breeding for 6 weeks under relative humidity conditions. Feed and water were allowed to be freely ingested at all times.

After acclimatization for 1 week, cholangioectomy was performed for the control group and the transplant group. Biliary duct resection surgery was performed after anesthesia by intraperitoneally administering Evertin at a dose of 75 mg/ml. The abdomen of the anesthetized experimental animal was incised by 1 cm to excise the inner, outer skin, and muscles, and the bile ducts connected to the liver were found and the upper and lower portions of the bile ducts were tied with sutures to excise them. The incision was sutured using a surgical thread and needle for the incisional epithelium and endothelium. After the operation, 2x10 ⁶ cells/200ul of placental-derived mesenchymal stem cells diluted by adding to phosphate buffered saline (PBS) after 1 week for the experimental group, as well as 2.5mg/kg/200ul of WKYMVm peptide WKYMVm-enhanced placental-derived mesenchymal stem cells with 2x10 ⁶ cells/200ul of natural placental-derived mesenchymal stem cells added to the added phosphate-buffered saline were transplanted through the tail vein using a 24 g 1ml syringe. Thereafter, the WKYMVm-enhanced placenta-derived mesenchymal stem cell transplant group was additionally administered with 2.5 mg/kg/200ul of WKYMVm peptide by intraperitoneal administration twice a week and at 3-day intervals for 2 weeks.

Example 1: Confirmation of the degree of collagen accumulation in liver tissue

In order to measure the effect of the WKYMVm peptide on anti-fibrosis, the following experiment was performed to determine the degree of collagen accumulation in the liver tissue of the rat of Preparation Example 1.

After obtaining liver tissue from the rats of each group of Preparation Example 1, paraffin block preparation and Sirius Red staining were performed at Korean Laboratory Pathology. Then, the degree of accumulation of collagen was quantified through the Image J program.

As shown in FIG. 1 , it was confirmed that the amount of collagen accumulation was typically lower in the transplanted group compared to the placental-derived mesenchymal stem cell non-transplanted group. In particular, it was confirmed that collagen accumulation decreased in the WKYMVm-enhanced placental-derived mesenchymal stem cell transplant group compared to the natural placental-derived mesenchymal stem cell transplant group except for the 5th week group, with a statistically significant ( p<0.05 ) decrease.

Example 2: Confirmation of expression of liver regeneration-related genes at the RNA level

Quantitative RT-PCR (quantitative RT-PCR) to confirm the expression of genes related to angiogenesis, fibrosis, and liver regeneration functions after transplantation of WKYMVm-enhanced placental-derived mesenchymal stem cells into rats subjected to cholangioectomy of Preparation Example 1 , qRT-PCR) analysis and western blot were performed.

RT-PCR was performed as follows. After cholangiostomy was performed, liver tissues from each group were collected and grinded using a mortar and pestle. After mixing the tissues corresponding to each group well, the tissues were lysed using Trizol, the cDNA synthesis step using reverse transcriptase, the gene-specific nucleotide sequence and FasStart universal SYBR Green master mix were used. qRT-PCR analysis was performed based on the PCR amplification step and the numerical results (CT values) of the amplified PCR products. The primer sequences used for amplification of each gene, the composition of the PCR reaction, and the reaction conditions are shown in Tables 1 to 3, respectively.

gene SEQ ID NO: Primer sequence (5'-3') Junction temperature (℃) rat VEGF One F: CTTCTGGGCTCTTCTCTCTC 55 2 R: ACGGACAGACAGACAGACAC ratEndoglin 3 F: AAGGTGTGACTGGACACAAG 55 4 R: CCAGATCTGCATATTGTGGT rat VEGFR1 5 F: CCACACCTGAAATCTACCAA 55 6 R: TGGGGACTGAGTATGTGAAG rat VEGFR2 7 F: AAGCAAATGCTCAGCAGGAT 55 8 R: TAGGCAGGGAGAGTCCAGAA rat ColΙ 9 F: CATGTTCAGCTTTGTGGACCT 55 10 R: GCAGCTGACTTCAGGGATGT rat HNF1α 13 F: AAGATGACACGGATGACGATGG 55 14 R: GGTTGAGACCCGTAGTGTCC rat ALB 15 F: GCCCCAGAACTCCTTTACTA 55 16 R: AATCTCTGCATACTGGAGCA rat GAPDH 17 F: TCCCTCAAGATTGTCAGCAA 55 18 R: AGATCCACAACGGATACATT humanVEGFR1 19 F: GCAGGGACATGGAATTAAGGC 55 20 R: GCAGGGACATGGAATTAAGGC Human Endoglin 21 F: AAGGTGTGACTGGACACAAG 55 22 R: CCAGATCTGCATATTGTGGT Humanα-SMA 23 F: CGATAGAACACGGCATCATCAC 55 24 R: GCATAGCCCTCATAGATAGGCA human GAPDH 25 F: GCACCGTCAAGGCTGAGAAC 55 26 R: GTGGTGAAGACGCCAGTGGA

PCR reaction solution volume cDNA 1-2 μl Forward primer 0.25 μl Reverse primer 0.25 μl Enzyme (FasStart universal SYBR Green mastermix) 12.5 μl DEPC-treated water* X μl total amount 25 μl

* Diethylpyrocarbonate (DEPC)-treated water

95 ℃ Tm ℃ 20 ℃ cycle denaturalization 10 minutes One amplification 10 seconds 30 seconds (50-55℃) 40 Dissolution 1 second (60-94℃)
(melt curve 65-95℃, increasing 1℃) One final 1 min One

Western blot was performed as follows.

After cholangiostomy was performed, liver tissues from each group were collected and grinded using a mortar and pestle. After mixing the tissues corresponding to each group well with each other, protease inhibitor cocktail (Roche) and phosphatase inhibitor (Sigma-Aldrich) are added with RIPA buffer (RIPA buffer, Sigma- Aldrich) for tissue lysis and protein extraction using centrifugation, protein separation using acrylamide gel, protein delivery through polyvinylidene difluoride membrane (PVDF membrane) Western blot was performed based on the step, the reaction step using the primary antibody and the secondary antibody, and the detection of the protein reacted with the antibody. The information of the antibody used for the antibody reaction of each factor is shown in Table 4. In addition, the intensity of the Western blot band in each group was measured using the Image J program through repeated experiments twice.

factor company catalog number dilution factor Col Ι Novus Biologicals NB600-408 1:1,000 ALB Novus Biologicals NBP1-32458 1:1,000 CyclinD1 AB Frontier LF-MA0325 1:1,000 GAPDH AB Frontier LF-PA00212 1:5,000

As shown in Fig. 2, transplantation of WKYMVm-enhanced placental-derived mesenchymal stem cells not only showed the RNA expression of Col I, but also the protein expression, compared to the non-transplanted group of stem cells and the transplanted group of natural placental-derived mesenchymal stem cells. was significantly ( p<0.05 ) reduced.

In contrast, as shown in FIG. 3 , the mRNA expression of vascular endothelial growth factor (VEGF), a gene related to vascular regeneration, receptors 1 and 2 (VEGFR1, 2), and endoglin for WKYMVm-enhanced placenta A statistically significant ( p<0.05 ) significant increase was observed in the group transplanted with the derived mesenchymal stem cells.

Example 3: Confirmation of expression of fibrosis-related genes and proteins in hepatic stellate cells

In order to confirm the degree of fibrosis in the rat liver stellate cells of Preparation Example 1, RT-PCR and Western blot in the same manner as in Example 2, and immunofluorescence staining was performed as follows.

Hepatic stellate cells treated with transforming growth factor were co-cultured with placental-derived mesenchymal stem cells fortified with 1 mM WKYMVm, and then immunofluorescent staining was performed for the expression of α-SMA. After fixing the cells in 4% paraformaldehyde (PFA), alpha-smooth muscle actin (α-SMA) primary antibody (M0851, Dako) and a fluorescent secondary antibody reaction It was performed based on the steps. In addition, the fluorescence intensity of alpha-smooth muscle actin in each group was measured using the Image J program through repeated experiments three times.

As shown in FIG. 4 , it was confirmed that mRNA expression of α-SMA and protein expression of Col I were highest in hepatic stellate cells treated with transforming growth factor. On the other hand, when natural placenta-derived mesenchymal stem cells were co-cultured, the corresponding expression level was decreased, and when WKYMVm function-enhanced placental-derived mesenchymal stem cells were co-cultured, the expression of these factors was statistically significant ( p <0.05 ) was confirmed to be significantly reduced. In addition, as a result of confirming the expression of α-SMA through immunofluorescence staining in hepatic stellate cells, the results were the same as above.

Example 4: Confirmation of angiogenesis in human umbilical vein endothelial cells

To analyze the degree of angiogenesis in the rat of Preparation Example 1, human umbilical vein endothelial cells were subjected to qRT-PCR and Western blot in the same manner as in Example 2, and angiogenesis assays as follows.

Human umbilical vein endothelial cells were stained with acetylated LDL Alexa 488 (Invitrogen) that specifically stains endothelial cells in a culture dish coated with Matrigel (Sigma-aldrich). Thereafter, endothelial cells were damaged with 5-fluorouracil, and placental-derived mesenchymal stem cells fortified with 1 mM WKYMVm were co-cultured, and then blood vessels formed by endothelial cells were observed through a fluorescence microscope. In addition, the measurement of the length of blood vessels formed in each group was performed using the Image J program through two repeated experiments.

As shown in FIG. 5 , it was confirmed that the mRNA expression of VEGFR1 and endoglin in the endothelial cells treated with 5-fluorouracil was the lowest. Accordingly, as the natural placental-derived mesenchymal stem cells were co-cultured, the expression level increased accordingly, and as the WKYMVm function-enhanced placental-derived mesenchymal stem cells were co-cultured, the expression was statistically significantly ( p<0.05 ) increased. was confirmed. In addition, the results of analyzing the degree of blood vessel formation by specifically staining endothelial cells were also the same as the above results.

Example 5: Confirmation of expression of liver regeneration factor

In order to analyze the expression of regeneration-related factors in the liver tissue of the rat of Preparation Example 1, qRT-PCR and Western blot were performed in the same manner as in Example 2.

As a result, as shown in FIG. 6 , after transplantation of WKYMVm-enhanced placenta-derived mesenchymal stem cells, the expression of regeneration-related factors in the liver tissue of a liver failure model was analyzed. As a result, hepatic nuclear factor 1 alpha (hepatic nuclear factor 1) alpha, HNF1α) and albumin mRNA expression was observed to increase in the placental-derived mesenchymal stem cell transplant group. In particular, the mRNA expression level of albumin increased significantly ( p<0.05 ) in the WKYMVm-enhanced placental-derived mesenchymal stem cell transplant group at 3 and 5 weeks. In addition, it was confirmed that the expression of albumin at the protein level increased in the WKYMVm-enhanced placental-derived mesenchymal stem cell transplant group of the previous week, and the increase in the protein expression of cyclin D1 was confirmed by the increase in the expression of natural placental-derived mesenchymal cells. Compared to the stem cell transplant group, the WKYMVm-enhanced placenta-derived mesenchymal stem cell transplant group was more pronounced at weeks 1 and 5.

The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> CHA University Industry-Academic Cooperation Foundation Pusan National University Industry-University Cooperation Foundation <120> Pharmaceutical composition for the prevention or treatment of liver disease comprising enhanced mesenchymal stem cells <130> PN130383KR <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 6 <212> PRT <213> homo sapiens <220> <221> MISC_FEATURE <222> (6) <223> D-Met <400> 1 Trp Lys Tyr Met Val Met 1 5

Claims (7)

As a pharmaceutical composition for the prevention or treatment of liver disease comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 and placental-derived mesenchymal stem cells,
Wherein the liver disease is liver fibrosis, or cirrhosis, the composition. The composition of claim 1, wherein the peptide increases the pharmacological therapeutic activity of mesenchymal stem cells. The composition of claim 1, wherein the peptide is included in a concentration of 1 μM to 1 mM. The method according to claim 1, The mesenchymal stem cells are 0.1X10 ⁶ /kg to 5X10 ⁶ /kg of the composition will be mixed at a concentration of. The method according to claim 1, wherein the placenta-derived mesenchymal stem cells will be derived from amniotic epithelial cells, amniotic membrane, trophoblast or chorion, the composition. delete The composition of claim 1, wherein the mesenchymal stem cells reduce the expression of ColI or α-SMA gene, or increase the expression of VEGF, HNF1α, albumin, endoglin or cyclin D1 gene.

Images