KR102371762B1 - Use for regulating cell differentiation and apoptosis by BRCA1 mediated NSD2 ubiquitination - Google Patents

Abstract

The present invention is to provide a method for screening therapeutic agents for leukemia through BRCA1-mediated NSD2 ubiquitination and a method for inducing differentiation of leukemia cells. More specifically, it is confirmed that BRCA1 translocated from the cytoplasm to the nucleus interacts with NSD2 in the nucleus to induce differentiation of NSD2 protein by ubiquitination, and it is confirmed that the differentiation of NSD2 protein by ubiquitination induces differentiation of leukemia cells into red blood cells and increases apoptosis of leukemia cells. Accordingly, a BRCA1-mediated NSD2 ubiquitination regulation method can be provided as a leukemia therapeutic agent screening method that increases apoptosis by inducing differentiation of leukemia cells into red blood cells and can be provided as a method for differentiating leukemia cells for differentiation therapy for cancer treatment.

Description

{Use for regulating cell differentiation and apoptosis by BRCA1 mediated NSD2 ubiquitination}

The present invention relates to a method for screening a therapeutic agent for leukemia through BRCA1-mediated NSD2 ubiquitination and a method for inducing differentiation into leukemia cells.

Leukemia refers to a disease in which white blood cells proliferate as a tumor. The types of leukemia can be divided into myeloid leukemia and lymphocytic leukemia according to the white blood cells from which the leukemia originates. The clinical manifestations of leukemia vary depending on the type of disease and the nature of the cells involved. Lymphocytic leukemia is caused by lymphoid blood cells, myeloid leukemia is caused by myeloid blood cells, and chronic myelogenous leukemia (CML) is caused by malignant clones of mutated hematopoietic stem cells.

Acute myeloid leukemia is the most common leukemia among leukemias, in which immature leukocytes in the bone marrow transform into malignant cells, proliferate excessively, and then spread throughout the body via blood. The exact cause of acute myeloid leukemia is unknown, but it is known to be caused by smoking and exposure to radiation or chemicals.

Unlike acute myeloid leukemia, chronic myelogenous leukemia develops when mature granulocytes proliferate rather than die when white blood cells are produced in the bone marrow. In most chronic myeloid leukemia patients, chromosomes 9 and 22 are attached to each other and a unique type of chromosome is found, and this chromosome is called the Philadelphia chromosome. In the early stages, symptoms do not appear well, but as the disease progresses, fatigue, anorexia, and anemia appear. Chronic myeloid leukemia progresses slowly, but if left untreated, it can progress to acute myeloid leukemia.

Gleevec has been developed as a treatment for such chronic myeloid leukemia, and in addition to Gleevec, it is treated using drugs such as dasatinib and nilotinib, and there are other treatment methods such as hematopoietic stem cell transplantation.

In cancer treatment, differentiation therapy is a cancer treatment method that uses chemicals to differentiate tumor cells to induce death similar to normal cells. Differentiated cells do not function like normal cells, but are normal cells. death similar to that of In addition, when differentiation therapy is performed, cancer cells respond sensitively to radiation or chemotherapy, thereby enhancing the anticancer effect.

Patent Publication No. 10-2016-0115503 (published on October 6, 2016)

The present invention provides a method for screening a leukemia therapeutic agent capable of inducing differentiation and apoptosis of leukemia cells into red blood cells by inducing degradation of NSD2 in leukemia cells by regulating BRCA1-mediated NSD2 ubiquitination, and a method for inducing differentiation of leukemia cells into red blood cells would like to provide

The present invention comprises the steps of (1) treating leukemia cells with a test substance; (2) determining the level of NSD2 ubiquitination by BRCA1 in cancer cells treated with the test substance; (3) It provides a screening method for a therapeutic agent for leukemia, comprising the step of selecting a test substance having an increased level of NSD2 ubiquitination by BRCA1 compared to a control sample.

The present invention provides a reagent composition for inducing NSD2 ubiquitination in leukemia cells in vitro, containing BRCA1 as an active ingredient.

The present invention also provides a method for inducing differentiation of leukemia cells into red blood cells, comprising inducing NSD2 ubiquitination activity by BRCA1 of the leukemia cells in vitro.

According to the present invention, it was confirmed that BRCA1 translocated from the cytoplasm to the nucleus interacts with NSD2 in the nucleus to induce NSD2 protein degradation by ubiquitination. As it was confirmed that it induces differentiation and increases apoptosis of leukemia cells, the BRCA1-mediated NSD2 ubiquitination regulation method can be provided as a screening method for a leukemia therapeutic agent that induces differentiation of leukemia cells into red blood cells and increases apoptosis. And it can be provided as a method of differentiation of white blood cells for cancer treatment and differentiation therapy.

1 is a result confirming that NSD2 inhibits K562 cell differentiation into erythrocytes. FIG. 1a is a schematic diagram showing the genome-wide human knockout screen process in K562 cells during hemin-mediated differentiation, and FIG. 1b is NaOH after 3 days of culture. Or the result of confirming the CRISPR-Cas9 guide ranking score (derived from the average of the four shRNA CRISPR-Cas9 guide scores in the sgRNA targeting the gene) for the erythrocyte differentiation-positive cells selected by hemin, Figure 1c is NSD2, PAX1 , The levels of HBE1 and HBA1/2 mRNA were quantified using real-time PCR in K562 cells in which SIRT3 or SOX4 was deleted and treated with 30 μM hemin, and the results were expressed as mean ± SEM, n = 5; *p < 0.05 and **p < 0.01. The left figure of FIG. 1d shows the results of confirming cell differentiation by staining NSD2, PAX1, SIRT3 or SOX4-deleted K562 cells with o-dianisidine. Cells stained with , indicate hemoglobin accumulation, the black arrow indicates the result of o-dianisidine positive cells, the scale bar is 25 μm, the figure on the right is the quantitative analysis result, which is expressed as mean ± SEM, n = 4; *p < 0.05 and **p < 0.01. FIG. 1E shows the results of quantifying HBE1 and HBA1/2 mRNA levels using real-time PCR after treatment with 30 μM hemin in K562 cells overexpressing the Y1118A mutant of wild-type or NSD2, and the results are the mean ± SEM, n = 5; *p < 0.05 and **p < 0.01, and FIG. 1f is the result of confirming cell differentiation by staining with o-dianisidine in K562 cells overexpressing the Y1118A mutant of wild-type or NSD2. Stained cells indicate hemoglobin accumulation, black arrows indicate o-dianisidine positive cells, and the scale bar is 25 μm. Figure 1g is the result of FACS sorting after staining with anti-CD235A for 1 hour to confirm hemin-mediated cell differentiation induction in K562 cells overexpressing Y1118A mutant of wild-type or NSD2, and the values of hemin-treated K562 cells ( red line) was used as a control. Figure 1h is the result of quantification of FACS data in K562 cells overexpressing wild-type, Y1118A or K292R mutants of NSD2 using anti-CD235A, the results are the mean ± SEM, n = 4; **p < 0.01.
Figure 2 is the result of confirming that K562 differentiation reduces NSD2 stability through ubiquitin induction, the left figure of Figure 2a shows the level of NSD2 protein using the lysate of K562 cells treated with 30 μM hemin for 1 and 2 days. It is the confirmed immunoblot result, and the figure on the right shows the CD36 and NSD2 mRNA levels using real-time PCR, and the results are mean ± SEM, n=4; *P<0.05. Figure 2b is an immunoblotting result confirming the NSD2 expression level using an antibody suitable for the lysate of K562 cells treated with 30 μM hemin for 2 days and treated with MG132 protease inhibitor for 6 hours, Figure 2c is 30 in K562 cells After treatment with μM hemin for 16 hours and treatment with 100 μg/ml cycloheximide, cell lysates were collected after 2, 4, 6 and 8 hours to confirm the effect of hemin-mediated differentiation on NSD2 stability regulation. Immunoblotting results, FIG. 2d is an immunoprecipitation analysis result confirming the polyubiquitination chain of NSD2. The lysate of K562 cells collected after treatment with 30 μM hemin for 2 days and treatment with 10 μM MG132 for 6 hours was anti- These are the results of immunoprecipitation using an NSD2 antibody and immunoblotting analysis of related proteins and polyubiquitin chains using a suitable antibody.
3 is a result confirming that BRCA1 reduces NSD2 protein stability through induction of polyubiquitination of NSD2. As a result of confirming the interaction partner, the related protein was eluted, separated by SDS-PAGE, and immunoblotted. FIG. 3b is a schematic diagram showing the BRCA1 or BRCA1 deletion structure, and FIG. As a result of GST pull-down analysis, the upper figure is the result of incubating the K562 cell extract with GST-BRCA1 or GST-BRCA1 deletion mutant, eluting the associated protein, and then separating it by SDS-PAGE and immunoblotting. Coomassie staining results confirming the amount of BRCA1 or BRCA1 deletion mutants, FIG. 3D is the result of immunoblot analysis of NSD2 and BRCA1 using 293T cells stably knocked down BRCA1 using two independent shRNAs, and FIG. 3E is BRCA1 transfection. It is the result of immunoblotting of the injected 293T cell extract using a suitable antibody, and FIG. 3f is an immunoprecipitation analysis confirming the polyubiquitin chain of NSD2 by transfecting BRCA1 into 293T cells and treating with 10 μM MG132 for 3 hours. Results, Figure 3g is the result of confirming the NSD2 and BRCA1 protein levels by treatment with 30 μM hemin in K562 cells stably knocked down BRCA1 and immunoblotting using an appropriate antibody, Figure 3h is K562 stably knocked down BRCA1 Cells were treated with 30 μM hemin and 10 μM MG13, and immunoprecipitation analysis was performed to confirm the polyubiquitin chain of NSD2. As a result of isolating and confirming the localization of NSD2 and BRCA1 using immunoblot, H3 and tubulin were It was used as a positive control for the fraction. 3j is the result of immunoprecipitation analysis confirming the NSD2 interaction partner using K562 cells and anti-BRCA1 antibody treated with 30 μM hemin for 2 days and MG132 for 6 hours.
Figure 4 shows the results confirming that BRCA1 induces NSD2 polyubiquitination during hemin-mediated differentiation. 4b shows K562 cells stably overexpressing WT or K292R mutants of NSD2 were treated with 30 μM hemin and 100 μg/ml cycloheximide and 2, 4, 6 and 8 hours later It is the result of immunoblotting analysis performed using a suitable antibody by collecting the cell lysate, and FIG. 4c shows K562 cells overexpressing WT or K292R mutant of NSD2 with 30 μM hemin for 2 days and MG132 after treatment for 6 hours. It is the result of immunoprecipitation analysis confirming the polyubiquitin chain of NSD2, and FIG. 4d is 293T cells transfected with BRCA1, NSD2-WT or NSD2 K292R mutant treated with 100 μg/ml cycloheximide and treated with 2, 4, 6 and 8 It is the result of performing an immunoblot using an antibody suitable for the cell lysate collected after a period of time, and FIG. 4e is a 293T cell transfected with BRCA1, NSD2-WT or NSD2 K292R mutant treated with 10 μM MG132 for 3 hours, and NSD2 It is the result of immunoprecipitation analysis confirming the polyubiquitin chain of
Figure 5 is the result of confirming that NSD2 suppresses K562 cell differentiation by regulating the expression of erythrocyte differentiation-related genes. The indicated blood cell-related genes are shown, and gene groups that are up- or down-regulated by a factor of at least 1.5 times are shown in red and green, respectively. Figure 5b is the result of functional classification of the NSD2 target gene using the annotation tool DAVID, Figure 5c is the result of quantifying the mRNA level of the differentiation-related gene in K562 cells stably knocked down NSD2 by real-time PCR, standardized with β-actin , results are mean ± SEM, n = 4; *p < 0.05, **p < 0.01. 5D is an area-proportional Venn diagram showing the overlapping 125 genes among differentially expressed genes between NSD2 knockdown and hemin treatment in microarray data, and FIG. 5E is a differentiation-related relationship after hemin treatment at a concentration of 30 or 50 μM in K562 cells. mRNA levels of genes were quantified by real-time PCR analysis and normalized to β-actin levels, and the results were mean ± SEM, n = 4; *p < 0.05, **p < 0.01, ***p < 0.001. FIG. 5f shows that K562 cells overexpressed with WT or K292R variants of NSD2 were treated with 30 μM hemin for 2 hours, the mRNA levels of differentiation-related genes were quantified by real-time PCR, and then normalized to β-actin levels, and the results were average ± SEM, n = 4; *p < 0.05, **p < 0.01, ***p < 0.001. Figure 5g is the result of confirming cell differentiation by hemin by staining with CD235A for 1 hour and sorting by FACS K562 cells or vector control overexpressing WT or K292R variants of NSD2, hemin-treated K562 cells value (red line) is the control was used as Figure 5h is the result of confirming cell differentiation by staining K562 cells or vector control overexpressing WT or K292R variants of NSD2 with o-dianisidine. Cells stained in brown indicate hemoglobin accumulation, and black arrows indicate o- Scale bar is 25 μm to represent dianisidine-positive cells, all results in (c), (d) and (f) are mean ± SEM, (n = 3), *p < 0.05, **p < 0.01, ***p < 0.001.
6 is a result confirming that the BRCA1 mutation inhibits hemin-mediated K562 cell differentiation. As a result of normalization to actin, the result value was expressed as mean ± SD (n=6), and *p<0.05, **p<0.01, and ***p <0.001. 6b is a result of confirming cell differentiation by hemin by staining BRCA1 knockdown K562 or control cells with CD235A for 1 hour and sorting by FACS, and the value of shNC K562 cells (red line) was used as a control. 6c is a result of confirming cell differentiation by staining K562 BRCA1 knockdown or control cells with o-dianisidine. , the scale bar is 25 μm, and the figure on the right shows quantitative data, and the results are mean ± SEM, n=4; *p < 0.05, ***p < 0.001. Figure 6d shows the results of BRCA1 WT, P871L, E1038G, K1183R or S1613G mutants overexpressed K562 cells treated with 30 μM hemin for 2 days and immunoblots of BRCA1 and NSD2 were performed, and Figure 6e is BRCA1 WT, P871L, K562 cells overexpressed with E1038G, K1183R or S1613G mutants were treated with 30 μM hemin for 2 days and the localization of each mutation of BRCA1 was confirmed using immunoblot. Bullin was used as a positive control for the nucleus and cytoplasm, respectively. Figure 6f is the result of immunoprecipitation analysis confirming the interaction between NSD2 and BRCA1 WT or mutant, BRCA1 WT or 4 mutants overexpressed K562 cells were treated with 30 μM hemin for 2 days and MG132 was treated for 6 hours. , FIG. 6G is a FACS analysis result confirming K562 differentiation in K562 cells overexpressing WT, P871L, E1038G, K1183R, S1613G or four mutants of BRCA1. K562 cells were treated with 30 μM hemin for 2 days and hemin-treated K562 BRCA1 WT values expressed in cells (red line) were used as controls.

Hereinafter, the present invention will be described in more detail.

The inventors of the present invention confirmed that BRCA1 translocated from the cytoplasm to the nucleus [Breast cancer 1] interacts with NSD2 [Multiple Myeloma SET domain (MMSET/NSD2)] in the nucleus to induce NSD2 protein degradation by ubiquitination, As it was confirmed that NSD2 protein degradation induced by ubiquitination induces differentiation of leukemia cells into red blood cells and increases apoptosis of leukemia cells, the BRCA1-mediated NSD2 ubiquitination regulation method is to convert leukemia cells into red blood cells. It can be provided as a screening method for a therapeutic agent for leukemia that induces the differentiation of leukemia and leads to apoptosis, and it is intended to provide a method for differentiation of leukocyte cells for differentiation therapy for cancer treatment.

The present invention comprises the steps of (1) treating leukemia cells with a test substance; (2) determining the level of NSD2 ubiquitination by BRCA1 in cancer cells treated with the test substance; (3) It is possible to provide a screening method for a therapeutic agent for leukemia, comprising the step of selecting a test substance having an increased level of NSD2 ubiquitination by BRCA1 compared to a control sample.

The increase in NSD2 ubiquitination level by BRCA1 may decrease protein stability of NSD2, induce differentiation of leukemia cells into red blood cells, and increase death of leukemia cells.

The NSD2 ubiquitination may be ubiquitination at NSD2 Lys292.

The test substance may translocate BRCA1 to the nucleus and increase NSD2 protein degradation in cancer cells by increasing ubiquitination activity for NSD2.

The leukemia may be selected from the group consisting of acute myeloid leukemia, chronic myelogenous leukemia, acute lymphocytic leukemia and chronic lymphocytic leukemia.

The level of NSD2 ubiquitination by BRCA1 may be measured by any one selected from the group consisting of enzyme immunoassay (ELISA), immunoprecipitation, immunohistochemistry, Western blotting and flow cytometry (FACS). there is.

The "ubiquitination" of the present invention refers to the process of attaching ubiquitin, a small protein found in almost all tissues of eukaryotes, to other proteins is called ubiquitination, and through the ubiquitination, the activity of the corresponding protein is changed or cells It can change the function of the protein, but the main phenomenon of ubiquitination is the degradation of the ubiquitinated target protein into the proteasome.

The term "test substance" used while referring to the screening method of the present invention affects the expression level of a gene, affects the expression or activity of a protein, or affects the binding between proteins. It refers to an unknown candidate substance used for screening. The test substance includes, but is not limited to, chemicals, nucleotides, antisense-RNA, small interference RNA (siRNA), and natural product extracts.

The present invention can provide a reagent composition for inducing NSD2 ubiquitination in leukemia cells in vitro, containing BRCA1 as an active ingredient.

In addition, the present invention may provide a method for inducing differentiation of leukemia cells into red blood cells, comprising the step of inducing NSD2 ubiquitination activity by BRCA1 of leukemia cells in vitro.

The NSD2 may inhibit the differentiation of white blood cells into red blood cells by inhibiting the expression of VEGFa, DNAse2, FOS, BCL6, PIM, and CD36, which are genes inducing differentiation into red blood cells.

"BRCA1" used in the present invention is NCBI accession no. It may be NM_007294.4.

"NSD2" used in the present invention is NCBI accession no. It can be NM_133330.3.

Hereinafter, to help the understanding of the present invention, examples will be described in detail. However, the following examples are merely illustrative of the content of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

<Experimental example>

The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

1. Plasmid Construction

The pCMV3-C-Flag NSD2 plasmid was obtained from Sino Biological Inc. (Beijing, China). GST-NSD2 fusion protein and mammalian expression vector by inserting NSD2 into bacterial expression vector pGEX-4T1, a pcmv-3Xflag vector (Sigma, St. Louis, MO) and modified plenti-puro-3Xflag vector (Addgene; #39481) was built. NSD2 (Y1118A) or NSD2 (K292R) point mutations were constructed and inserted into the pcmv-3Xflag vector and the modified plenti-puro-3Xflag vector. Sequences encoding NSD2 #1 (residues 1-400), NSD2 #2 (residues 400-1365) and NSD2 #3 (residues 1000-1365) were subcloned into the pGEX-4T1 vector.

In addition, the plasmid pBABE puro HA BRCA1 was purchased from Addgene (#14999), and BRCA1 was inserted into the bacterial expression vector pGEX-4T1 and the plenti-puro vector. BRCA1 point mutations (P871L, E1038G, K1183G, S1613G, 4 mutations) were constructed and inserted into the plenti-puro vector. Sequences encoding BRCA del#1 (residues 1-420), BRCA1 del#2 (residues 400-1100) and BRCA1 del#3 (residues 1080-1863) were subcloned into the pGEX-4T1 vector. Plasmids plko-shNSD2 #1, plkoshNSD2 #2 and pcDNA6-HA-Ub were prepared by the previously reported method (Woo Park, J., et al., Sci. Rep. 5, 12485 (2015).) for human BRCA1 shRNA was designed using siRNA sequence designer software (Clontech). For shRNA plasmid construction, double-stranded oligonucleotides were produced using primers in the 5′→3′ direction as shown in Table 1 (Supplementary Table 1), and the oligonucleotides were inserted into the AgeI/EcoRI site of the pLKO.1 TRC vector. .

Name Sequencing (5' to 3') purpose shMMSET #1 sense CCGGGGGCATTGTTCAAGCAGAAGACTCGAGCTTCTGCTTGAACAATGCCCTTTTTG shRNA shMMSET #1 anti-sense AATTCAAAAAGGGCATTGTTCAAGCAGAAGACTCGAGTCTTCTGCTTGAACAATGCCC shRNA shMMSET #2 sense CCGGCGGAAAGCCAAGTTCACCTTTCTCGAGAAAGGTGAACTTGGCTTTCCGTTTTTG shRNA shMMSET #2 anti-sense AATTCAAAAACGGAAAGCCAAGTTCACCTTTCTCGGAAAGGTGAACTTGGCTTTCCG shRNA shBRCA1 CDS F CCGGGAGTATGCAAACAGCTATAATCTCGAG ATTATAGCTGTTTGCATACTCTTTTTG shRNA shBRCA1 CDS R AATTCAAAAAGAGTATGCAAACAGCTATAAT CTCGAGATTATAGCTGTTTGCATACTC shRNA shBRCA1 UTR F CCGGCCCTAAGTTTACTTCTCTAAACTCGAG TTTAGAGAAGTAAACTTAGGGTTTTTG shRNA shBRCA1 UTR R AATTCAAAAACCCTAAGTTTACTTCTCTAAACTCGAG TTTAGAGAAGTAAACTTAGGG shRNA BCL6 proximal promoter F AGGGACCTGAGTTGCATTCTG ChIP BCL6 proximal promoter R GAACCTGTTTCCTGCTTGCC ChIP BCL6 distal Promoter F CTGAAGAGCCACCTGCGAAT ChIP BCL6 distal Promoter R CATTAGCGTAGTGGTTGCCC ChIP BCL6 genebody F CTGGAGATGGTATTGCCGCC ChIP BCL6 genebody R TGTGGGAAGGGCTACGAATC ChIP CD36 proximal promoter F GCCAGTCTTGAGGTCCTACAT ChIP CD36 proximal promoter R GAGTGCATCAACTACAAAAGACAT ChIP CD36 distal Promoter F ACTGAATGGATACCTTGCCC ChIP CD36 distal Promoter R GCTCTGCCAACTCAAGAAGT ChIP CD36 genebody F AGGTGAGTGAGTCCCCACAA ChIP CD36 genebody R TGACATTTGCCAAGTAGAAGACT ChIP HBE1 proximal promoter F AGAGGATTTCTCTGGAAGCACTG ChIP HBE1 proximal promoter R TCCACAGTGGGACTAAAGCC ChIP HBE1 distal Promoter F GATGGGCTAGAGTTCCTCTTTC ChIP HBE1 distal Promoter R GTCACTGGGCAATACAAGACCT ChIP HBE1 genebody F GGGTGAGGGTGTAGGTAGGT ChIP HBE1 genebody R GGTTTGTGCCCACCCAAAAA ChIP RRAS2 proximal promoter F AGTGGGTGTCAGTTGGGAGT ChIP RRAS2 proximal promoter R CCACACAATCCCTTACATAGACAA ChIP RRAS2 distal Promoter F ATATAGGCAATCTCTCAGTCCCT ChIP RRAS2 distal Promoter R CCCTGGAGAGAGTGTGGAAC ChIP RRAS2 genebody F ATAGATGACAGAGCAGCCCG ChIP RRAS2 genebody R ACATGGGCTAATATTCCAGATCA ChIP VEGFA F ACGAAAGCGCAAGAAATCCC RT-PCR VRGFA R GGAGGCTCCAGGGCATTAG RT-PCR DNAse2 F AGCCAAGAACCCTGGAACAG RT-PCR DNAse2 R GCCGGAGTACAGGTCATCTC RT-PCR FOS F CTTTGCAGACCGAGATTGCC RT-PCR FOS R ATCAGGGATCTTGCAGGCAG RT-PCR BCL6 F ATGAGGAGTTTCGGGATGTC RT-PCR BCL6 R TGCCTCTTCTGGGATTGTTT RT-PCR PIM F GCTGTGCTGGGAGAAATACT RT-PCR PIM R GGTCTTGGCTTTGAAACAGT RT-PCR CD36 F TGTCCTGGCTGTGTTTGGAG RT-PCR CD36R AGACTGTGTGTCCTCAGCG RT-PCR P5 0 nt stagger AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG illumina sequencing P5 1nt stagger AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCTTGTGGAAAGGACGAAACACCG illumina sequencing P5 2 nt stagger AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCTTGTGGAAAGGACGAAACACCG illumina sequencing P5 3 nt stagger AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGCTTGTGGAAAGGACGAAACACCG illumina sequencing P5 4 nt stagger AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCAACTTGTGGAAAGGACGAAACACCG illumina sequencing P5 6 nt stagger AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCACCTTGTGGAAAGGACGAAACACCG illumina sequencing P5 7 nt stagger AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACG
CAACTTGTGGAAAGGACGAAACACCG illumina sequencing P5 8 nt stagger AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACGCAACTTGTGGAAAGGACGAAACACCG illumina sequencing P7 primer CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTC
AGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT illumina sequencing C01 GCACGACC Barcode sequence D01 TATGGACC Barcode sequence

2. Antibodies

H3K36me2 (Millipore, Billerica, MA; 07-274, dilution (1:2000)), BRCA1 (07-434 dilution (1:1000)), Flag (Sigma, St. Louis, MO; F3165, dilution into 1 ng/ ml)), NSD2 (EpiCypher, Durham, NC; 13-0002 dilution (1:1000)), MMSET/NDS2 (Abcam, ab75359 dilution (1:1000)), APC-CD235A (eBioscience, Waltham, MA; 17- 9987-42), FK2 (Enzo Life Sciences, Farmingdale, NY; BML-pw-8810-0100, dilution (1:1000)), β-actin (sc-47778 dilution (1:1000)), H3 (sc- 8654, dilution (1:1000)), PARP1 (sc-56197, dilution (1:1000)) and tubulin (sc-9103, dilution (1:1000)) (all from Santa Cruz Biotechnology, Dallas, TX) Antibody was used.

3. Cell Culture

In DMEM (Dulbecco's modified Eagle's medium) medium, K562 cells were cultured in RPMI 1640 medium containing 10% inactivated fetal bovine serum (FBS) and 0.05% penicillin-streptomycin, respectively, at 37°C and 5% CO ₂ conditions. did

DNA 293T cells were transfected with DNA constructs using polyethyleneimine (PEI) or lipofectamine 2000 (Invitrogen, Carlsbad, CA). For differentiation of K562 cells, 30 mM hemin (hemin, Sigma, St. Louis, MO) was treated. After 48 hours of incubation, cells were collected and used.

To confirm protein stability, cells were treated with 100 μg/ml cyclohexamide (cyclohexamide, Sigma, St. Louis, MO) and incubated for 2, 4, 6, and 8 h before cells were collected and subjected to western blot analysis. was used.

4. CRISPR-Cas9 screening

CRISPR-Cas9 screening was performed by the previously reported method (Doench, J. G. et al., Nat. Biotechnol. 34, 184-191 (2016)). Genome-wide CRISPR screening was performed with the same experimental procedure as in FIG. 1A. Human Brunello pooled library plasmids (total sgRNA 76,441 and 4 sgRNA per gene) and CRISPR-V2 plasmids were obtained from Addgene (cat #73178 and #52961, respectively) and amplified by electroporation according to the protocol.

For lentivirus production, 293T cells were infected in tissue culture dishes to become 2 × 10 ⁶ cells per 100 mm surface area. Plasmid DNA was diluted with a medium containing the lentiviral packaging plasmid mixture of pMD2.G and pPAX2 and transfected using polyethyleneimine (PEI) (3 μg PEI: 1 μg DNA). Virus supernatants were collected between 36 and 72 hour points post transfection.

The lentiviral titer was confirmed by transducing target cells dispensed with clonogenic density and serial dilution of the virus in the presence of 1 μg/mL puromycin.

CRISPR-Cas9 screening was performed with two vector systems. First, K562 cells were infected with lenti-CRISPR-V2 virus and selected using 1 μg/mL puromycin to produce Cas9-expressing K562 cells. Brunello pooled library virus (at a multiplicity of infection of 0.3) was infected into Cas9-expressing K562 cells using polybrene at the same density in 2.5 × 10 ⁷ cells per 150 mm plate.

After 3 days, 2.5 × 10 ⁷ K562 cells per 150 mm plate were cultured and treated with NaOH or hemin for 3 days. To sort differentiated cells, hemin-treated cells were washed with PBS and 1 × Cells were resuspended in binding buffer and stained with CD235A-APC Abs for 30 minutes at room temperature in the dark.

CD235A+ cells were isolated by FACS Aria III (BD biosciences) and positive APC staining (total CD235A+ cells). The purity of the isolated fractions confirmed by FACS analysis was more than 50%.

5. Next Generation Sequencing (NGS) Library Preparation and Sequencing

A sequencing library was prepared by PCR amplification method. Genomic DNA (genomic DNA, gDNA) was isolated using the wizard genomic DNA purification kit (Promega) according to the manufacturer's instructions.

For NGS library sequencing, 10 parallel PCRs for a given sample were prepared. Barcode samples isolated from multiple 50 μl reactions (total volume) containing up to 5 μg gDNA, P5 stagger primer mix (1 μM), a uniquely barcoded P7 primer (1 μM) and 5× HiPI PCR master mix (Elpis Biotech) PCR of gDNA was performed by attaching a sequencing adapter and a sequencing adapter. PCR cycle conditions were as follows: After starting at 95°C for 1 minute, 28 cycles of 30 seconds at 94°C, 30 seconds at 52.5°C, and 30 seconds at 72°C were performed, followed by extension at 72°C for the final 10 minutes. .

The P5/P7 primers in Table 1 were synthesized by DNA Technologies (IDT), and the samples were purified with Agencourt AMPure XP SPRI beads (Beckman Coulter, A63880) according to the manufacturer's instructions. The final purified product was quantified with DNA Picogreen according to the DNA Picogreen Quantification Protocol Guide (QuantiFluor dsDNA system kits for Promega), and verified using the TapeStation DNA screentape HSD1000 (Agilent).

In addition, it was arranged using the HiSeqTM 2500 platform (Illumina, San Diego, USA). For all sgRNA inserts, the CACCG sequence was first searched for and counted in the primary read result shown in vector 5'.

The next 20 nt are sgRNA inserts, which were mapped to reference files of all possible sgRNAs in the library. The reads were then confirmed under conditions based on the 8-nt barcode containing the P7 primer (eg, wells of a PCR plate).

6. Data processing and analysis

The sgRNA spacer sequence was mapped to a reference human Brunello library. Normalized reads were obtained by normalizing to total reads per sample.

First, compared to CD235A-positive cells, genes showing an increase or decrease in three or more of the four sgRNAs were selected. CRISPR guide scores were expressed by calculating the mean log fold change in the number of normalized sgRNA reads between NaOH or hemin-treated CD235A positive samples.

7. Immunoprecipitation and Ubiquitin Assay

293T cells were transfected with flag-BRCA1, and after 48 hours, the cell lysate was immunoprecipitated using the NSD2 antibody. After addition of Protein A/G agarose beads (GenDEPOT), the mixture was spun at 4° C. for 2 hours. The bound protein was analyzed by immunoblotting with each antibody.

For ubiquitin assay, transiently transfected 293T or K562 cells were treated with modified RIPA buffer (10 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.025% SDS, 1% sodium deoxycholate, 1% NP-40, 1× protease). inhibitor cocktail, 5 mM EDTA). After immunoprecipitation of cell lysates using anti-NSD2, protein A/G agarose beads were added and the mixture was spun at 4°C for 2 hours. Bound proteins were analyzed by immunoblotting with a suitable antibody.

8. Reverse Transcription and Real-Time PCR Analysis

Total RNA was isolated from virus-infected K562 cells using RNAiso Plus (TaKaRa, Kusatsu, Japan). After cDNA synthesis, cDNA was amplified and mRNA expression analysis was performed. PCR primers as in Supplementary Table 1 were used. Dissociation curves were checked after each PCR run to confirm amplification of a single product of appropriate length.

Mean threshold cycle (C _T ) and standard error values were calculated with each C _T value obtained from triplicate reactants per step.

The normalized mean C _T value was estimated as ΔC _T by subtracting the average C _T value of β-actin, and the ΔΔCT value was calculated by calculating the difference between the control ΔC _T and the value obtained from each sample. An n-fold change in gene expression relative to untreated controls was calculated as 2- ^ΔΔCT .

9. Subcellular fractionation

Cells were lysed on ice for 10 minutes using buffer A (10 mM HEPES [pH 7.9], 10 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 1× protease inhibitor cocktail, and 0.4% NP-40) on ice for 3 minutes. The nuclear and cytoplasmic fractions were prepared by centrifugation at 15,000 × g.

The cytoplasmic fraction was obtained from the supernatant, and the pellet was further lysed with buffer B (20 mM HEPES [pH 7.9], 0.4 M NaCl, 1 mM EDTA, 10% glycerol, 1 mM DTT, 0. PMSF and 1× protease inhibitor cocktail). . The pellet was resuspended with a pipette, stirred at 4°C for 2 hours, the lysate was centrifuged at 15,000 × g, and the supernatant was collected to obtain a nuclear fraction.

10. FACS Analysis

To confirm cell proliferation, flow cytometry analysis was performed with a slight modification of the previously reported method (Shi, J. et al., Nat. Biotechnol. 33, 661-667 (2015).).

The pLKO-GFP-NC or pLKO-GFP-shNSD2 plasmids were used for lentivirus production by transfecting 293T cells with pMD2.G and pPAX2 plasmids using PEI reagent. Virus supernatants were collected between 36 and 72 hours post-transfection.

For proliferation assay, K562 transfected with GFP lentivirus was flow cytometered using a BD Accuri™ C6 Plus flow cytometer (BD Biosciences). Gating was performed on living cells using forward and side scatter before confirming GFP positivity.

To confirm the effect of NSD2 on apoptosis, K562 shNC and shNSD2 cells were washed with PBS, resuspended in 1× binding buffer, and FITC-Annexin V and PI (BD Bioscience) were added thereto for 30 minutes at room temperature in the dark. After incubation for a while, the cells were analyzed by FACS using a FACSCalibur system.

To determine the K562 differentiation rate, K562 cells were induced with NSD2 WT, Y1118A or K292R and treated with 30 mM hemin. Cells were washed with PBS, resuspended in 1× binding buffer, and then cultured for 30 minutes in dark conditions at room temperature with the addition of APC-CD235A, followed by FACS analysis of the cells using a FACSCalibur system.

11. Chromatin Immunoprecipitation Assay

ChIP analysis was performed as previously reported (Kim, J. Y. et al., Mol. Cell. Biol. 28, 2023-2034 (2008).). Briefly, K562 cells were treated with 30 mM hemin for 48 h. Cells were cross-linked by adding 1% formaldehyde to the medium, and incubated at 37° C. for 10 minutes, then 125 mM glycine was added and incubated at room temperature for 5 minutes.

After washing the cells with SDS lysis buffer and sonicating the sample, immunoprecipitation was performed using a suitable antibody. Immunoprecipitates were eluted and back-crosslinked.

After purifying the DNA fragment, PCR amplification for quantification was performed using each PCR primer pair (Supplementary Table 1).

Dissociation curves were checked after each PCR to confirm amplification of a single product of appropriate length. Mean threshold cycle (C _T ) and standard error values were calculated with each C _T value obtained from triplicate reactants per step. The normalized mean C _T value was estimated as ΔC _T by subtracting the mean C _T of each gene.

12. O-dianisidine staining

According to a previous report (Sawafuji, K., Miyakawa, Y., Kizaki, M. & Ikeda, Y., Am. J. Hematol. 72, 67-69 (2003).), O-dianisidine in K562 cells Staining was performed to confirm hemoglobin activity.

Briefly, K562 cells were incubated with 30 nM hemin for 2 days. To confirm hemoglobin synthesis, K562 cells were washed with PBS and under dark conditions, 0.6 mg/ml 3,3′-dimethoxy benzidine (3,3′-dimethoxy benzidine, Sigma, St. Louis, MO, USA), 0.01 M sodium acetate (sodium acetate, pH 4.5), 0.65% H ₂ O ₂ and 40% (v/v) ethanol was stained for 15 minutes.

The cells were then washed once with PBC and suspended in 70% glycerol for microscopic analysis.

To confirm the mean, the percentage of dianisidine positive cells was calculated by counting at three independent locations. In some experiments, K562 cells were treated with alisertib (AURKA inhibitor).

13. Organizational Analysis

Formalin-fixed, paraffin-embedded tissue analysis slides containing lymphoma tissue were purchased from US BIOMAX.

Briefly, endogenous peroxidase activity was blocked by deparaffinization with xylene, rehydration with graded ethanol, and incubation in 3% hydrogen peroxide for 10 min. Next, for antigen retrieval, the tissue sections were heated with 100 mM citrate buffer (pH 6.0) for 10 minutes and then pre-incubated with normal horse serum for 20 minutes at room temperature.

Anti-BRCA1 antibody (diluted 1:100) was used as the primary antibody.

Samples were then incubated with biotinylated anti-rabbit and anti-mouse secondary antibodies (Vectastain Laboratories) and streptavidin-horseradish peroxidase (Zymed Laboratories Inc.). DAB (3,3-diaminobenzidine; Vectastain Laboratories) was used as a chromogen, and eosin was used for counterstaining.

14. Microarray Analysis

For NSD2 target gene profiling, the Illumina HumanHT-12 v4 Expression BeadChip (Illumina) was used, which contained a bead pool of more than 47,231 specific bead types corresponding to 28,688 RefSeq annotated transcripts.

Total RNA (0.55 μg) isolated from the control and shNSD2-stabilized K562 cell line was reverse transcribed and amplified according to the Illumina TotalPrep RNA amplification kit manual (Ambion).

Next, transcription was performed in vitro to generate cRNA (0.75 μg), which was hybridized in each array and labeled with Amersham fluorolink streptavidin-Cy3 (GE Healthcare Bio-Sciences).

Thereafter, the array was scanned using the Illumina Bead Array Reader Confocal Scanner. Array data were extracted and analyzed using Illumina GenomeStudio v2011.1 (Gene Expression Module v1.9.0). This data set was submitted to Gene Expression Omnibus under submission number GSE144939. Array probes were converted to logarithms and normalized to the quantile method. Gene frequency and function analysis for the list of important probes was performed using DAVID software (http://david.abcc.ncifcrf.gov/home.jsp).

<Example 1> Confirmation of the effect of NSD2 on hemin-mediated K562 cell differentiation

Differentiation Cancer cell therapy is to allow cancer cells to undergo terminal differentiation. However, since relatively little is known about the differentiation mechanism of the erythroleukemia cell line K562, as shown in FIG. CRISPR-Cas9 mutagenesis screening (including 76,441 single guide RNAs (sgRNAs)) was performed.

Lentiviruses of the sgRNA library were infected in K562 expressing Cas9. The cells were treated with NaOH or hemin for 3 days, and CD235A-positive K562 cells showing erythroid differentiation were sorted. Screening data obtained from NaOH-treated K562 cells as well as differentiated K562 cells were compared using the CRISPR-Cas9 guide score, which represents the median-corrected log fold change in each sgRNA abundance. Next, using the DAVID ontology tool, ontology analysis was performed based on the list of genes that could affect differentiation to confirm the MAPK cascade, granulocyte differentiation, and hematopoietic progenitor cell differentiation.

For further analysis, genes with an exclusively increased at least three sgRNAs in CD235A-positive K562 cells compared to NaOH-treated K562 cells were identified.

As a result, several genes known to be important for hematopoietic progenitor cell differentiation, including RUNX1, SOX4 and DOCK1, could be identified as shown in FIG. 1b.

Next, four sgRNAs targeting each of the genes PAX1, SIRT3, SOX4 and NSD2 confirmed by CRISPR screening were constructed. Since CD235A was used as a differentiation marker, it was confirmed that each gene could regulate the CD235A mRNA level. As a result, it was confirmed that knockout of the genes did not affect the CD235A expression level.

Reduction of these genes induced the expression of globin genes such as erythroid differentiation markers, HBE1 and HBA1/2, during hemin-mediated differentiation and accelerated the reduction of GATA1 expression by hemin. Also, referring to FIG. 1D , the number of O-dianisidine-positive cells increased during differentiation induced by hemin, and knockout of the gene increased the number of O-dianisidine-positive cells than the control group.

From the above results, it was confirmed that the decrease in NSD2 had a strong effect on K562 cell differentiation.

In order to confirm the role of NSD2 during hemin-induced erythrocyte differentiation, we generated NSD2 WT or Y1118A, HMTase deletion mutants stably overexpressed in K562 human leukemia cells through lentiviral infection.

Referring to FIG. 1E , hemin treatment improved the globin gene expression level, whereas overexpression of NSD2 inhibited the increase in HBE1 and HBA1/2 induced by hemin. Surprisingly, the HMTase deletion mutant NSD2 Y1118A had no effect on K562 cell differentiation.

In addition, although the number of O-dianisidine-positive cells increased during hemin-induced differentiation as shown in FIG. 1f , NSD2 overexpression did not cause serious expression changes in hemin-treated K562 cells. However, NSD2 Y1118A slightly increased the number of O-dianisidine positive cells. Consistent with the previous CRISPR-Cas9 screening, NSD2 knockdown further increased the number of O-dianisidine positive cells in hemin-treated K562 cells compared to control cells.

In addition, as shown in FIG. 1g , in FACS analysis, NSD2 overexpression suppressed the hemin-induced increase in the differentiation marker CD235A, whereas NSD2 Y1118A had a very weak effect.

Since enhanced erythrocyte differentiation is accompanied by a marked decrease in proliferation, it was confirmed how dysregulation of NSD2 affects K562 cell differentiation.

As a result of cell proliferation analysis using NSD2 deletion and GFP K562 cells, it was confirmed that NSD2 deletion decreased cell proliferation, and as a result of FACS analysis, NSD2 knockdown increased apoptotic cells. In addition, as a result of Western blot analysis, cleavage of PARP, an apoptosis marker, was confirmed.

From the above results, it was confirmed that the knockdown of NSD2 suppressed the proliferation of leukemia cells through induction of apoptosis and erythrocyte differentiation.

<Example 2> Confirmation of NSD2 expression reduction through NSD2 polyubiquitination

As it was confirmed that NSD2 inhibited cell differentiation into red blood cells as shown in FIG. 1, the expression level of NSD2 was confirmed in differentiated K562 cells.

As a result, the level of NSD2 protein decreased during hemin-induced differentiation as shown in FIG. 2a (left), while the mRNA level in FIG. 2a (right) did not change.

Since the NSD2 protein level was decreased as shown in the above results, it was hypothesized that the protein level of NSD2 could be regulated by proteasome degradation during hemin-induced differentiation.

To confirm this, as a result of treatment with the proteasome inhibitor MG132, hemin-mediated reduction of NSD2 in K562 cells as shown in FIG. 2b did not appear.

In addition, K562 cell differentiation induced by NaBu (sodium butyrate), a derivative of erythrocyte differentiation through reduction of GATA1, was confirmed.

As a result, the protein stability of NSD2 was decreased during NaBu-induced differentiation, consistent with the previous experimental results.

In addition, for further analysis of time-dependent NSD2 expression in cells, K562 cells were treated with a protein synthesis inhibitor, cycloheximide (CHX; 100 μg/ml).

As a result, as shown in FIG. 2c , the half-life of NSD2 was confirmed to be approximately 8 hours in the control cells, whereas it rapidly decreased to approximately 4 hours in the hemin-treated K562 cells. In addition, as shown in FIG. 2d , it was confirmed that hemin treatment increased polyubiquitination of NSD2 in K562 cells.

From the above results, it was confirmed that K562 cell differentiation induced by hemin induces NSD2 degradation in a protease-dependent manner.

<Example 3> Confirmation of E3 ligase activity on NSD2 of BRCA1

From the data obtained from previous studies, as NSD2 is known to interact with BRCA1, a ubiquitin E3 ligase, in fact, to confirm the interaction between NSD2 and BRCA1, co-immunoprecipitation (co-immunoprecipitation (co-immunoprecipitation) in 293T cells overexpressing NSD2 and BRCA -IP) analysis was performed.

As a result, it was confirmed that NSD2 physically interacts with BRCA1 in vivo as shown in FIG. 3a.

In addition, in order to confirm which domain was involved in the interaction of BRCA1 from the above results, GST pull-down analysis was performed in vitro using the BRCA1 wild-type (WT) or deletion construct as shown in FIG. 3b.

As a result, it was confirmed that the middle region of BRCA1 (BRCA1 del#2) is responsible for the interaction between BRCA1 and NSD2 as shown in FIG. 3c.

Similarly, in in vitro GST pull-down analysis using NSD2 WT or deletion constructs, the intermediate region of NSD2 (NSD2 del#2) containing HMG, PHD, RING, and PWWP domains contributed to the interaction between NSD2 and BRCA1. it was confirmed

Next, since BRCA1 has E3 ubiquitin ligase activity, it was confirmed whether BRCA1 could regulate the NSD2 protein level.

Referring to FIGS. 3D and 3E , BRCA1 knockdown upregulated NSD2 in stably BRCA1 knockdown 293T cells generated through lentiviral infection using two independent shRNAs, whereas NSD2 decreased in BRCA1 overexpressed 293T cells. has been confirmed

To determine whether NSD2 stability can be regulated through polyubiquitination during BRCA1 overexpression, the NSD2 protein level was checked in a time-dependent manner in BRCA1 overexpressed 293T cells with 100 μg/ml CHX treatment.

As expected, overexpression of BRCA1 reduced the stability of NSD2, but not the stability of the control group. In addition, as shown in FIG. 3f , BRCA1 improved the level of NSD2 polyubiquitination in 293T cells.

From the above results, it was confirmed that BRCA1 interacts with NSD2 through polyubiquitination to promote degradation.

Next, it was confirmed whether BRCA1 regulates NSD2 in hemin-treated K562 cells. As a result, as shown in FIG. 3G, hemin-induced erythrocyte differentiation reduced NSD2 protein levels in control cells, but was not confirmed in BRCA1 knockdown K562 cells.

In addition, as shown in FIG. 3h , the polyubiquitination level of NSD2 during hemin-induced differentiation in control K562 cells increased the level of NSD2, whereas it was not confirmed in K562 cells in which BRCA1 was knocked down. Surprisingly, it was confirmed from the above results that BRCA1 knockdown did not affect the expression of internalized NSD2 in undifferentiated K562 cells, not 293T cells.

From the above results, as it was expected that BRCA1 would not colocalize with NSD2 in undifferentiated K562 cells, the localization of NSD2 and BRCA1 during hemin-induced K562 differentiation was confirmed.

As a result, as shown in FIG. 3i , NSD2 was mainly confined to the nucleus, and differentiation by hemin downregulated NSD2. In addition, as shown in Figure 4D, NaBu co-localized with NSD2 by increasing the translocation of BRCA1 from the cytoplasm to the nucleus, as previously confirmed. Therefore, as shown in FIG. 3J, the endogenous interaction between BRCA1 and NSD2 was increased during hemin-induced K562 cell differentiation.

From the above results, it was confirmed that BRCA1 exhibits E3 ubiquitin ligase activity on NSD2, and reduces NSD2 protein level through translocation in hemin-treated K562 cells.

<Example 4> Confirmation of polyubiquitination of NSD2 induced by BRCA1

In the previous experiment, oxidative stress such as H ₂ O ₂ induced erythrocyte differentiation of K562 cells, and as it was confirmed in the proteomic database that DNA damage induces polyubiquitination of NSD2 in Lys292, UV, etoposide , H ₂ O ₂ It was confirmed that the NSD2 expression level is reduced by the treatment of several drugs for DNA damage, including doxorubicin.

Since BRCA1 is associated with a decrease in NSD2 protein stability during K562 differentiation, and oxidative stress induces K562 differentiation, we hypothesized that BRCA1 would induce polyubiquitination of NSD2 at Lys292 during hemin-induced differentiation.

To confirm this, first, K562 cells in which flag-NSD2 or flag-NSD2 K292R were stably overexpressed were generated, and NSD2 downregulation was confirmed as shown in FIG. 4a. However, NSD2 was not downregulated during hemin-induced differentiation in the ubiquitination deletion mutant NSD2 K292R.

To confirm that NSD2 stability can be regulated through polyubiquitination of Lys292 during hemin treatment, hemin-treated NSD2 WT or K562 cells overexpressing NSD2 K292R were treated with 100 μg/ml CHX and time-dependent NSD2 expression was confirmed. .

As a result, referring to FIG. 4b , as expected, K562 differentiation induced by hemin reduced the stability of NSD2 WT, but was not confirmed in NSD2 K292R.

Next, polyubiquitination chains of NSD2 and NSD2 K292R were identified in hemin-treated K562 cells after MG132 treatment. As a result, as shown in FIG. 4c , hemin treatment induced the polyubiquitination level of NSD2, but was not confirmed in NSD2 K292R.

In order to confirm the role of BRCA1 in the regulation of NSD2 polyubiquitination in Lys292, BRCA1 overexpressed 293T cells were treated with 100 μg/ml CHX, and then the stability of NSD2 WT or K292R mutants was confirmed.

Referring to FIG. 4d , the addition of BRCA1 destabilized NSD2 WT when 293T cells were treated with CHX, whereas the NSD2 K292R mutant was stable for more than 6 hours. Also, as shown in FIG. 4E , BRCA1 induced polyubiquitination of NSD2, but polyubiquitination was not observed in NSD2 K292R.

From the above results, it was confirmed that BRCA1 regulates NSD2 stability through NSD2 polyubiquitination at Lys292 during K562 cell differentiation.

<Example 5> Confirmation of Effect of Regulating Erythrocyte Differentiation Gene by NSD2

To confirm the function of NSD2 during K562 cell differentiation, gene expression was profiled in K562 cells in which NSD2 was stably knocked down.

Referring to FIG. 5a , the knockdown of NSD2 regulated 473 genes (fold change [FC] > 1.5, p < 0.01), of which 143 genes were down-regulated and 331 genes were up-regulated.

The signaling process performed by the NSD2 target gene was analyzed using the DAVID ontology tool. As a result, it was confirmed that the enrichment of the target gene is involved in the regulation of metabolism, immunity, apoptosis and differentiation as shown in FIG. 5b.

Since NSD2 acts as an inhibitor of K562 differentiation into erythrocytes, several target genes associated with erythrocyte differentiation were selected, and qRT-PCR of selected genes including VEGFa, DNAse2, FOS, BCL6, PIM and CD36 was performed.

As a result, as shown in FIG. 5c , NSD2 had HMTase activity for methylation of the transcriptional activator H3K36, and strongly upregulated the target gene related to the differentiation in NSD2-deleted K562 cells.

It was hypothesized that NSD2 would indirectly regulate the selected gene, and to confirm this, chromatin immunoprecipitation analysis (ChIP) was performed using anti-NSD2 and anti-H3K36me2 antibodies.

As a result, it was confirmed that the influx of BCL6, CD36 and HBE1 promoters was not affected during hemin-induced differentiation, but the direct target gene RRAS2 promoter increased and H3K36me2 induction was confirmed during hemin-induced differentiation.

From the above results, it was confirmed that NSD2 indirectly regulates the target gene during K562 cell differentiation.

Since NSD2 induces AURKA methylation and enhances kinase activity, and AURKA inhibits leukemia cell differentiation, it was hypothesized that NSD2 would regulate genes through induction of AURKA kinase activity. As a result of confirming this, it was confirmed that the methylation level of AURKA decreased during hemin-induced differentiation, and the AURKA inhibitor alisertib induced erythrocyte differentiation-related genes to accelerate K562 differentiation upon hemin treatment.

Based on the results of induction of erythrocyte differentiation by the knockdown of NSD2 confirmed as shown in FIG. 1 , the microarray data of the knockdown of NSD2 was compared with the data of the published hemin treatment study.

As a result, it was confirmed that about 26% (125/473) of genes showing 1.5-fold or more changes in NSD2 knockdown cells overlapped with the target gene induced by hemin as shown in FIG. 5d, and as expected, the selected target gene was microarrayed confirmed in the data.

To confirm the regulation of selected genes in hemin-treated K562 cells, qRT-PCR analysis was performed.

Referring to FIG. 5e, hemin upregulated BCL6, VEGFa, FOS, PIM1, DNaseII and CD36 genes.

In addition, it was confirmed whether NSD2 overexpression could inhibit the hemin-induced differentiation of K562 cells. As a result, as shown in FIG. 5f , NSD2 overexpression inhibited hemin-mediated induction of differentiation-related genes, and further, overexpression of NSD2 K292R strongly downregulated hemin-induced genes.

In order to understand the difference in these phenotypic levels, the level of CD235A in NSD2 overexpressing cells after hemin treatment was confirmed using FACS.

As a result, as shown in FIG. 5g , it was confirmed that NSD2 overexpression inhibited hemin-mediated CD235A induction and had a stronger effect on NSD2 K292R than the wild type. In addition, similar results were confirmed in o-dianisidine staining as shown in FIG. 5f.

From the above results, it was confirmed that NSD2 suppressed erythrocyte differentiation induced by hemin through downregulation of genes related to erythrocyte differentiation.

<Example 6> Confirmation of roles of BRCA1 and NSD2 in K562 cell differentiation

To confirm the physiological significance of NSD2 stability regulated by BRCA1 during K562 cell differentiation, expression levels of target genes identified as downregulated by NSD2 in BRCA1 knockdown K562 cells were quantified.

Referring to FIG. 6a , hemin treatment upregulated genes related to erythrocyte differentiation, and no effect was found on target gene expression in BRCA1 knockdown K562 cells. In addition, as a result of FACS, hemin-induced differentiation was not observed in the BRCA1 knockdown cells as compared to the control cells as shown in FIG. 6b . Similarly, as shown in Figure 6c, BRCA1 knockdown resulted in a small number of o-dianisidine positive cells.

From the above results, it was confirmed that BRCA1 knockdown inhibited hemin-induced differentiation through downregulation of erythrocyte-related genes.

As various mutations of BRCA1 have been identified in several cancers including breast, ovarian, and lymphoma, it was hypothesized that downregulation or mutation of BRCA1 would lead to leukemia through dysregulation of NSD2 during myeloid cell differentiation.

To confirm this, the level of BRCA1 in lymphoma was checked.

Downregulation of BRCA1 in lymphoma was confirmed in HPA analysis as shown in FIG. 7A. In addition, tissue analysis confirmed downregulation of BRCA1 in granulocyte and large B-cell lymphoma.

In addition, several cancer-related mutations in BRCA1 were identified using the TCGA database (https://portal.gdc.cancer.gov/), and the role of these genes in the degradation of NSD2 during K562 cell differentiation was confirmed.

First, we generated K562 cells stably overexpressed with BRCA1 WT and mutant constructs, and checked NSD2 levels during hemin-induced K562 cell differentiation.

As a result, referring to FIG. 6d , as in the previous results, the BRCA1 WT had a decreased level of the NSD2 protein, but was not confirmed in the K1183R mutant.

In order to determine why the BRCA1 K1138R mutation reduces NSD2 protein levels during differentiation, the interaction between NSD2 and BRCA1 in 293T cells was confirmed.

Surprisingly, as shown in Fig. 6e, BRCA1 K1138R did not translocate from the cytoplasm to the nucleus and did not reduce the protein level of NSD2 during K562 cell differentiation.

Also, as shown in Fig. 6f, BRCA1 WT induced interaction with NSD2 in response to hemin treatment, whereas the other four mutants of BRCA1 did not interact with NSD2.

From the above results, it was confirmed that the mutant form of BRCA1 was not translocated for interaction.

To determine whether BRCA1 mutation affects K562 cell differentiation, CD235A levels were checked after hemin treatment in BRCA1 WT or K562 cells overexpressed with each mutation using FACS.

As a result, as shown in FIG. 6g , BRCA1 WT overexpression strongly enhanced hemin-mediated CD235A induction, and hemin-mediated CD235A induction was weakly increased in BRCA1 P871L, E1038G or S1613G, whereas BRCA1 K1138R did not induce induction.

From the above results, it was confirmed that the level of BRCA1 is important for K562 cell differentiation, and the BRCA1 mutation K1183R found in lymphoma patients inhibits nuclear translocation in hemin-treated K562 cells, thereby inhibiting the differentiation of K562 cells into red blood cells. could

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (9)

(1) treating leukemia cells with a test substance;
(2) determining the level of NSD2 ubiquitination by BRCA1 in cancer cells treated with the test substance;
(3) A screening method for a therapeutic agent for leukemia comprising the step of selecting a test substance having an increased level of NSD2 ubiquitination by BRCA1 compared to a control sample. The method according to claim 1, wherein the increase in NSD2 ubiquitination level by BRCA1 reduces the protein stability of NSD2, induces differentiation of leukemia cells into red blood cells, and increases the death of leukemia cells. . The method according to claim 1, wherein the NSD2 ubiquitination is ubiquitinated at NSD2 Lys292. The method according to claim 1, wherein the test substance translocates BRCA1 to the nucleus and increases NSD2 protein degradation in cancer cells by increasing ubiquitination activity for NSD2. The method according to claim 1, wherein the leukemia is selected from the group consisting of acute myeloid leukemia, chronic myelogenous leukemia, acute lymphocytic leukemia and chronic lymphocytic leukemia. The method according to claim 1, wherein the level of NSD2 ubiquitination by BRCA1 is selected from the group consisting of enzyme immunoassay (ELISA), immunoprecipitation, immunohistochemistry, Western blotting and flow cytometry (FACS). A method for screening a leukemia therapeutic agent, characterized in that one measurement is performed. A reagent composition for inducing NSD2 ubiquitination in leukemia cells in vitro, comprising BRCA1 as an active ingredient. A method for inducing differentiation of leukemia cells into red blood cells, comprising inducing NSD2 ubiquitination activity by BRCA1 of the leukemia cells in vitro. The differentiation according to claim 8, wherein the NSD2 inhibits the expression of VEGFa, DNAse2, FOS, BCL6, PIM and CD36, which are genes inducing differentiation into red blood cells, thereby inhibiting the differentiation of white blood cells into red blood cells. induction method.

Images