KR102362878B1 - Method for integration of transgene in cho cells - Google Patents

Abstract

The present invention relates to a method for integrating a transgene into a CHO cell, and specifically, a transposon vector (TP) comprising a Tol2 right inverted terminal repeat (ITR), a Tol2 left ITR and a transgene into a CHO cell. ) with transposase mRNA.

Description

METHOD FOR INTEGRATION OF TRANSGENE IN CHO CELLS

The present invention relates to a method for integrating a transgene into a CHO cell, and specifically, a transposon vector (TP) comprising a Tol2 right inverted terminal repeat (ITR), a Tol2 left ITR and a transgene into a CHO cell. ) with transposase mRNA.

Eukaryotic genomes contain abundant repetitive DNA and some repetitive sequences are mobile. In the genome, a transposable element (TE) is a DNA sequence that can move from one location to another. The vertebrate genome contains several sequences associated with DNA transposons, such as the hAT family transposons, but none of these appear to be naturally active, all of which are considered non-autonomous factors. However, the Tol2 factor is activated autonomously. This factor was confirmed to produce albino mutant fish by mutating the tyrosinase gene in Medaka fish (Oryzias latipes). To12 is 4.7 kb in length and includes a transposase gene consisting of two ITRs of variable length and four exons between the ITRs. Tol2 is capable of transposing genes larger than 10 kb, and although the integration region is not clear, it was hypothesized that genes in the 5' region may be preferred because they are generally similar to other hAT factors. Tol2 is integrated into a single copy via a cut-and-paste mechanism and does not cause relocation or modification at the target location, except for creating 8 base-pair (bp) copies.

In 2012, total biologics sales in the United States amounted to $63.3 billion, an increase of 18.2% from 2011. In the past 15 years (1999-2013), the FDA has approved 113 of the Type 1 drugs, 30% of which are biologics. When producing recombinant antibodies, CHO cells are the most commonly used host. This is because cultured mammalian cells remain a major host for the production of therapeutic antibodies due to their ability to human-like post-translational modifications. With the prevalence of therapeutic antibodies in the biopharmaceutical industry, a recent problem is to increase the efficiency of production of therapeutic antibodies. To this end, efforts are being made to generate an expression vector with high efficiency. It is also important to reduce the size of the expression vector to increase the dose of the desired gene. To date, the Tol2 transposon system has been used in many experiments, but has hardly been applied when introducing the Tol2 transposon system into mammalian cells to increase protein expression. In previous experiments using the transposon system, the transposase was co-transfected in the form of a plasmid.

However, this may result in the presence of the transposase for a long time after transfection, resulting in transient expression of the transposase and retransposition of the integrating transposon and potentially genotoxicity.

Transposon systems have been found to be reliable tools for generating recombinant cells that exhibit higher protein production. Several transposon systems, including sleeping beauty (SB), Tol2 and piggyback (PB), have been studied for efficient protein production in mammalian cells. Each set of these transposon systems exhibited similar volumetric productivity distributions and average productivity. However, these systems differ in size limitations in the carrying capacity of the transgene. When the size of the gene that the SB transposon can possess is 6 kb, the translocation efficiency of SB appears as a 50% reduction in activity. The To12 transposon is capable of integrating transgenes of up to 10 kb into the host genome without significantly reducing translocation activity. Since the insertion size of a therapeutic antibody is generally 6 kb or more, a transposon system capable of carrying a large transgene is preferred. In the present study, we aimed to confirm the effect of the Tol2 transposon system on protein productivity. To further prevent possible genotoxicity by the Tol2 transposase vector, Tol2 transposase mRNA was used and an optimal ratio between Tol2 transposon vector and Tol2 transposase mRNA was identified. Also,

The present inventors optimized a mini Tol2 transposon system with reduced Tol2 transposon size and discovered the role of DNA methylation in Tol2 transposon-mediated expression. Our study reveals a novel mechanism by which improved protein productivity is mediated by the novel Tol2 transposon platform.

Republic of Korea Patent Publication No. 10-2018-0054718

In the existing Tol2 system, transposase was put into the cell in the form of a vector. The vector can then remain in the cell and cause genotoxicity. To solve this, in the present invention, transposase was added in the form of mRNA. In addition, in the existing Tol2 system, the combined length of both ITRs exceeds 1kb. Since the smaller the size of the expression vector, the greater the capacity to load a desired gene, so the present invention found the core part of ITRs and shortened the ITRs to make the vector size smaller.

According to an embodiment of the present invention, CHO cells are co-transfected with a transposon vector (TP) comprising a Tol2 right inverted terminal repeat (ITR), a Tol2 left ITR and a transgene together with a transposase mRNA. A method for integrating a transgene into a CHO cell is provided, comprising the steps of:

The To12 right ITR may include the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3, and the To12 left ITR may include the nucleotide sequences of SEQ ID NO: 2 and SEQ ID NO: 4.

When the To12 right ITR and the To12 left ITR have the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, respectively, the transposon vector (TP) and the transposase mRNA are co-transformed in a weight ratio of 2:1 to 1:2 Infection is preferred. That is, when the Tol2 right ITR and the Tol2 left ITR have the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, respectively, the transposase mRNA is preferably added in a weight ratio of 0.5 to 2 times that of the transposon vector (TP). .

When the Tol2 right ITR and the Tol2 left ITR have the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4, respectively, the transposon vector (mini-TP) and the transposase mRNA are co-located in a weight ratio of 1:2 to 1:4 - Transfection is preferred. That is, when the Tol2 right ITR and Tol2 left ITR have the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4, respectively, transposase mRNA is added in a weight ratio of 2 to 4 times that of the transposon vector (mini-TP). desirable.

The transgene is present between the Tol2 right inverted terminal repeat (ITR) and the Tol2 left ITR, and the transfection is preferably performed by electroporation.

In another embodiment of the present invention, there is provided a method for producing a protein encoded by the transgene in CHO cells, comprising the step of culturing the CHO cell into which the transgene is integrated by the above method.

The protein production method may further include treating a methylation inhibitor or a histone deacetylase inhibitor.

The methylation inhibitor is any one of 5-azacytidine, decitabine, and zebularine, and the histone deacetylase inhibitor is Trichostatin A, dihydrocoumarin, naph It may be any one of topyranone (naphthopyranone) and 2-hydroxynaphaldehydes, but is not limited thereto.

The system has low integration efficiency and unstable protein expression over time. To improve this, the present inventors introduced a Tol2 vector system, and in particular, used mini-Tol2 with minimal ITR to verify its effect on protein expression. Consequently, we found that mini-Tol2 is effective for protein expression, which can be applied to generate recombinant antibodies in the biopharmaceutical industry.

1 is a schematic diagram of a vector system used in the present invention; (A) Control vector: luciferase expression was driven by the CMV promoter, and cells transfected with this vector were selected as G418 by the neomycin (Neo) gene. (B) Tol2 vector: The expression vector of luciferase, designated as the control vector, was delimited by two ITRs, designated the Tol2 left arm and right arm. (C) Tol2 vectors were co-transfected with Tol2 transposase mRNA.
Figure 2 is a diagram showing the effect of the Tol2 transposon system for protein production, (A) the effect of the transposase mRNA amount on the volumetric productivity of the Tol2 system as a bulk pool; (B) Comparison of luciferase copy number integrated into genomic DNA between non-TP and TP; (C) Comparison of luciferase mRNA expression levels between non-TP and TP; (D) the effect of the To12 transposon system on the expression of luciferase as determined by Western blot analysis; (E) As a result of analysis of clonal cell lines generated with TP and non-TP, dots in each plot represent luciferase productivity of one cell line. Horizontal bars represent the mean of luciferase production for each condition. (F) As a result of volumetric protein production analysis of recombinant cell lines over time, clonal cell lines with high luciferase expression in each group were selected in FIG. 2E . Cell lines were grown for 1 month with passage every 3 days. Volumetric productivity of each cell line was measured by luciferase assay at the end of the 3-day batch culture at the indicated times.
3 is a result of comparing the protein expression efficiency between the existing Tol2 vector and the mini Tol2 vector system. (A) The mini-TP construct contains a portion of the conventional TP in the left and right sequences, and the length is 200 bp for the left arm; The right arm is 150 bp. (B) Tol2 transposase mRNA optimization of mini-TP is shown, and cell pools expressing luciferase were generated by transfecting cells with different amounts of Tol2 transposase mRNA. In addition, the luciferase expression levels of the mini Tol2 system and the Tol2 system were compared. (C) Comparison of luciferase copy number integrated in genomic DNA between TP and mini-TP (D) Comparison of luciferase mRNA expression level between TP and mini-TP (E) Comparison of luciferase mRNA expression levels between TP and mini-TP Comparison of TP and mini-TP for expression (F) Comparison of luciferase expression levels between clonal cell lines of the mini Tol2 system and the Tol2 system. Each dot on the plot represents the luciferase productivity of one cell line. Horizontal bars represent the mean of luciferase production for each condition. (G) Analysis of volumetric protein production of a pool of recombinant cells over time. The present inventors selected a cell line having high luciferase expression from each group in FIG. 3E, and evaluated protein production stability with the cell line for 1 month.
Figure 4 is an experimental result on the effect of methylation inhibition on the Tol2 system on protein expression, (A) methyl transferase inhibitor 5-aza-2'-deoxycytidine (5-AzaC, 5-Aza-2' -deoxycytidine) and the histone deacetylase inhibitor tricostatin A (TSA, Trichostatin A) were treated to determine how inhibition of methylation affects protein expression in the Tol2 system. (B) shows a comparison of protein expression levels when TP and mini-TP are treated with the DNA methylation inhibitors Aza and TSA.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are only for helping the understanding of the present invention, and the scope of the present invention is not limited to these examples in any sense.

Experimental example

1. Cell Culture

CHO-DG44 cells (Thermo Fisher Scientific, Waltham, MA, USA) were used in this study. Cells were cultured in Dulbecco's modified Eagle's medium containing 25 mM glucose supplemented with 10% fetal calf serum with 100 U/ml penicillin and 100 μg/ml streptomycin and 10 mM sodium hypoxanthine and 1.6 mM thymidine. cultured. Cells were maintained in 40-80 ml of medium in 250 ml of Erlenmeyer Flask by orbital shaking with 5% CO ₂ and 150 rpm on a 37% incubator shaker. Cells were passaged every 2 days. Cell density and viability were evaluated by Cedex HiRes Analyzer (Roche, Switzerland, Basel).

2. Plasmids and mRNA

A donor plasmid for the To12 transposon system was constructed with Terminal Inverted Repeats (TIR) sequences.

Gene (Insert) forward primer Reverse primer Tol2 left arm & right arm TTTTTGCGCTGCTTCGCGATCTGCGAAGATACGGCCACG (SEQ ID NO: 5) CTGGCCCGTACATCGCGAGGCCCATCTGGCCTGTGTTTC
(SEQ ID NO: 6) mini Tol2 left arm AAGTGATCTCCAAAA
(SEQ ID NO: 7) CAGAGGTGTAAAAGTA
(SEQ ID NO: 8) mini Tol2 right arm GCGGCGTTACTAGTGGATCC CAGAGGTGTAAAAAG
(SEQ ID NO: 9) GACCATGATTACGCCAAGCTTAATACTCAAGTACAA
(SEQ ID NO: 10) mini Tol2 left arm & right arm TTTTGCGCTGCTTCGCGAAAGTGATCTCCAAAA
(SEQ ID NO: 11) CTGGCCCGTACATCGCGAAATACTCAAGTACAA
(SEQ ID NO: 12)

TIR for the To12 transposon system was amplified from T2U-CAF using specific oligonucleotide primers (SEQ ID NO: 5 and SEQ ID NO: 6) shown in Table 1. In the DNA template, To12 right arm (SEQ ID NO: 1) and left arm (SEQ ID NO: 2) were contiguous and could be amplified simultaneously. The PCR product was then subcloned into a luciferase control vector, a modified version of pcDNA3_SP_Luciferase, to generate a To12-luciferase vector. Similarly,

TIR for the mini Tol2 transposon system was amplified from T2U-CAF using specific oligonucleotide primers shown in Table 1. Contrary to the above, the mini Tol2 right (SEQ ID NO: 3) and left arm (SEQ ID NO: 4) were not contiguous, so a cloning step was added. The mini Tol2 left arm (SEQ ID NO: 3) amplified by SEQ ID NO: 7 and SEQ ID NO: 8 and the mini Tol2 right arm (SEQ ID NO: 4) amplified by SEQ ID NO: 9 and SEQ ID NO: 10 were prepared using T-Blunt ^TM PCR Cloning kit ( Solgent, Daejeon, Korea) were cloned side-by-side in the right orientation in T-vector. In the cloned T-vector, the mini To12 left arm and right arm adjacent to each other were amplified by PCR using specific oligonucleotide primers (SEQ ID NOs: 11 and 12) shown in [Table 1]. When cloning Tol2 and mini Tol2, the PCR product was inserted into the NruI site of the luciferase control vector, and cloning was performed using the EZ-Fusion ^TM HT Cloning Kit (EZ015TS; Enzynomics, Daejeon, Korea). For transposition, Tol2 transposase mRNA was co-transfected with Tol2 or mini Tol2 vectors. Tol2 transposase mRNA was amplified from pcDNA6_Tol2 transposase using the MEGAscript ^™ T7 Transcription Kit (Thermo Fisher Scientific). The template plasmid was transcribed by linearization into the SalI site downstream of the To12 transposase. Otherwise, the circular plasmid template produces very long and heterogeneous RNA transcripts because RNA polymerase is highly engineered.

3. Transfection

CHO-DG44 cells were transfected using the SG cell line 4D-Nucleofector ^™ X Kit L (V4XC-3024; Lonza, Basel, Switzerland). The cells were counted with Cedex HiRes Analyzer, and 2Х10 ⁶ cells were centrifuged at 2,000 rpm for 2 minutes. Cells were washed twice with phosphate buffered saline (PBS). Then, the pellet of these cells was resuspended in 100 μl of 4D-Nucleofector Solution™ (Nucleofector ^™ Solution 82 μl + Supplement 18 μl) by pipetting. 2 μg of donor plasmid was added to these cells. All samples were transferred to a nucleocuvette ^™ vessel. The cuvette was placed in an electroporation unit called a 4D-Nucleofector ^TM Core Unit (AAF-1002B; Lonza) and the unit was actuated. Then, the transfected cells were seeded in 6-well plates.

4. Cell Line Development

Cells were co-transfected as described above using 2 μg of donor plasmid and 1 μg to 8 μg of transposase mRNA. Control transfections were performed with a luciferase control vector without ITR. One day after transfection, the medium was changed. When the cells were confluent in the 6-well, they were transferred to a T75 flask or a T25 flask. In neomycin, the selective antibiotic 500 μg/ml G418 (ant-gn-1; Invivogen, San Diego, USA) was used to change the medium every 2 days for 10 days. After removing the selective pressure, the resulting cell pool was incubated as a clonal cell line by limiting dilution. Briefly, cells were resuspended at a density of 0.8 cells per 150 μl medium. These diluted cells were transferred to each well of a 96-well plate and gave an average of 0.8 cells per well. After 15-20 days of culture, cells were observed under a fluorescence microscope (Axiovert 200, Carl Zeiss, Oberkochen, Germany) and selected to have only one colony in one well. Individual colonies of cells were transferred to 6-well plates. After one cell passage in 6-well plates, cells were seeded into T75 or T25 flasks. The luciferase levels of these clonal cell lines were then measured with a luciferase assay system (E1500; Promega, Madison, Wisconsin, USA).

5. Protein Quantification

Cell number was determined using Cedex HiRes Analyzer and luciferase protein concentration was analyzed by luciferase assay system; 2Х10 ⁶ cells were centrifuged at 2,000 rpm for 2 minutes. These cells were washed twice with PBS. The pellet of these cells was then vortexed in 100 μl of 1x cell culture lysis reagent and 100 μl of PBS. These lysed samples were transferred to each well of 100 μl white 96-well, and 100 μl luciferase assay reagent (LARII) was added to each well (lysed sample: LARII=1:1). The plates were then measured with a VICTOR Multilabel Plate Reader (2030-0050; PerkinElmer, Waltham, MA, USA) with luminescence.

6. Preparation of gDNA and cDNA

Genomic DNA (gDNA) was prepared from a stable recombinant CHO cell line; 2Х10 ⁶ cells were harvested and washed with PBS. gDNA was isolated and purified using the Solg ^TM Genomic DNA Prep Kit (SGD41-C100; SPL) according to the manufacturer's instructions. Total RNA was isolated from ^2Х106 cells using the Rnasy Mini Kit (74104; QIAGEN, Hilden, Germany) according to the manual. Purified RNA was stored in RNAse-free water at -80°C. Total RNA was reverse transcribed using the Phusion RT-PCR Kit (F-546S; Thermo Fisher Scientific) according to the manufacturer's instructions. Purity and concentration of gDNA and cDNA were measured with a DS-11 Spectrophotometer (DeNovix).

7. Real-time PCR

Real-time qPCR was performed with a CFX Connect ^™ Real-Time PCR Detection System (Bio-Rad) using the SYBR method. Primers were designed to amplify a 200 bp fragment in the luciferase region, a 200 bp fragment in the housekeeping gene GAPDH and serve as an internal control and normalize the data. Real-time qPCR was performed with 20 ng of gDNA or cDNA containing non-template control and negative control by denaturation (95 °C for 5 min, followed by 94 °C for 30 s, 57 °C for 30 s and 70 °C for 10 s. , 40 cycles).

8. Methylation inhibitor treatment

CHO cells were treated with a methyltransferase inhibitor, 5-aza-2'-deoxycytidine (5-AzaC) and a histone deacetylase inhibitor, tricostatin A (TSA). To analyze the effect of demethylation, CHO cells were treated with 5 μM of 5-AzaC and 100 ng/ml of TSA. Four days before luciferase measurement, 5-AzaC was applied to the cells daily and TSA was added 24 hours before measurement. Control cells were treated with vehicle dimethyl sulfoxide (DMSO).

9. Statistical Analysis

Statistical analyzes were performed using a standard statistical software package (SigmaPlot 12.5; Systat Software, San Jose, CA, USA). We checked whether the differences were significant using student's t-test or two-way ANOVA test.

Example

1. For high protein productivity Tol2 transposon Effect of Vector Introduced System

To evaluate the Tol2 transposon system-mediated gene expression, the present inventors analyzed the CMV promoter-driven luciferase gene SV40 promoter located between the Tol2 right inverted terminal repeat (SEQ ID NO: 1) and the left ITR (SEQ ID NO: 2)- A transposon vector (TP) containing a driving neomycin resistance gene was designed (Fig. 1A). For comparison, we designed a non-transposon vector (non-TP) containing a CMV promoter-driven luciferase gene and an SV40 promoter-driven neomycin resistance gene ( FIG. 1B ). The Tol2 transposon system requires the Tol2 transposase to insert the TP into the genome. Tol2 transposase can be transfected as a helper plasmid encoding the Tol2 transposase. However, the use of transposon systems in mammalian cells is hampered by the uncontrolled activity of transposase from DNA vectors, which carries the risk of genomic instability. Therefore, To12 transposase mRNA was used as a helper plasmid of the To12 transposon system (Fig. 1C).

To identify the optimal ratio between TP and Tol2 transposase mRNA, TPs (2 µg) were co-transfected with different amounts of Tol2 transposase mRNA (0, 1, 2, 4 and 8 µg) (Figure 2A). A pool of cells transfected with 2 μg non-TP was used as a control (Fig. 2A). After transfection, cell pools were selected in medium containing 500 μg/ml G418 for 10 days. Then, transgene expression was investigated by measuring luciferase activity. There was no difference in luciferase activity between non-TP and TP, indicating that the presence of ITR did not increase transgene expression ( FIG. 2A ). However, co-transfected cell pools with TP and different amounts of To12 transposase mRNA (1, 2 and 4 μg) significantly increased luciferase activity ( FIG. 2A ). Among them, 1 μg of Tol2 transposase mRNA containing TP showed the highest activity ( FIG. 2A ). These results indicated that the Tol2 transposon system promoted transgene expression and that the ratios of 2:1 and 1:2 between TP and Tol2 transposon mRNA were critical factors in Tol2 transposon-mediated expression. Referring to FIG. 2A , even when TP and Tol2 transposon mRNA were transfected at a ratio of 1:1, luciferase activity was increased compared to the case where transposon mRNA was not added. Therefore, TP and Tol2 transposon mRNA were 2:1 to 1 It is judged that it is preferable to be added in a ratio of :2.

The transposon system is a precise process in which defined DNA segments are moved to different parts of the genome, increasing the efficiency of transgene integration into the host genome. Therefore, to confirm that the Tol2 transposon system promotes transgene integration, quantitative PCR was performed using genomic DNA (Fig. 2B). Cells co-transfected with TP and 1 μg To12 transposase mRNA were observed to exhibit significantly increased transgene integration compared to non-TP ( FIG. 2B ). We then investigated whether increased transgene integration promotes transgene expression. Quantitative PCR was performed using cDNA to investigate the expression level of the luciferase gene (Fig. 2C). Cells co-transfected with TP and 1 μg To12 transposase mRNA showed a significant increase in expression of the luciferase gene compared to non-TP ( FIG. 2C ). To confirm once again that the To12 transposon system had higher protein expression than non-TP, the amount of expressed protein was compared using Western blot. As a result, the bands of cells co-transfected with TP and 1 μl of To12 transposase mRNA were approximately 2-fold thicker than that of non-TP ( FIG. 2D ). These results suggest that when the Tol2 transposon system is introduced, the protein expression is about 2-fold higher than when it is not. These results indicated that the Tol2 transposon system increased gene expression through increased transgene integration efficiency. To obtain single cell clones from a heterogeneous pool, limiting dilutions were performed. Fourteen clonal cell lines were generated from each cell pool ( FIG. 2E ). Single cell clones co-transfected with the Tol2 transposon system exhibited a higher mean of luciferase activity than non-TP, confirming the transient data results from the cell pool again ( FIG. 2E ).

The effect of transposons on the long-term stability of transgene expression for 1 month was then evaluated. The specific growth rate (μ) of each cell line was determined periodically from three-day batch cultures. For comparison, single cell lines with high levels of luciferase expression were selected one from non-TP and one from TP, which are indicated by blue circles (Fig. 2E, F). When the Tol2 transposon cell line and the non-TP cell line were compared, it was confirmed that the μ value of the two cell lines had little difference and was constant for 30 days ( FIG. 2F ). These results indicate that the Tol2 transposon is an effective vector system for protein expression because the cell growth rate of the Tol2 transposon is constant like that of the non-TP and the luciferase expression level is higher than that of the non-TP.

2. Comparison of protein expression efficiency between conventional TP and mini-TP

Vector size affects transfection efficiency. The larger the size, the less effective the transfection. Tol2 ITR has a cis-sequence essential for transposition. The right and left ITRs are 536 bps and 517 bps, respectively. The minimum cis-sequence (mini-Tol2) of Tol2 ITR2 consisted of 200 bp in the left ITR and 150 bp in the right ITR. It is known that this mini-Tol2 can translocate without a decrease in efficiency. However, it has not been tested how efficiently mini-Tol2 induces transgene integration and subsequent expression compared to conventional Tol2. Therefore, to test its ability as a transposon, we designed a mini Tol2 transposon vector (mini-TP) comprising a CMV promoter-driven luciferase gene and an SV40 promoter-driven neomycin resistance gene flanked by a minimal ITR. (Fig. 3A). The mini Tol2 transposon vector (mini-TP) designed by the present inventors includes a Tol2 right ITR (SEQ ID NO: 3) and a left ITR (SEQ ID NO: 4).

To identify the optimal ratio between mini-TP and Tol2 transposase mRNA, mini-TP (2 μg) was co-transfected with different amounts of To12 transposase mRNA (1,2, 4 and 8 μg) (Fig. 3B). A pool of cells transfected with 2 μg non-TP was used as a control (Fig. 3B). In addition, a pool of co-transfected cells with TP and 1 μg To12 transposase mRNA was used as another control to compare the activity between TP and mini-TP ( FIG. 3B ). A pool of co-transfected cells with TP and 1 μg Tol2 transposon mRNA significantly increased luciferase activity compared to non-TP, confirming increased transgene expression by Tol2 transposon-mediated expression. The co-transfected cell pool with mini-TP and 4 μg Tol2 transposase showed significant luciferase activity compared to non-TP ( FIG. 3B ).

These results indicate that mini-TP significantly promoted transgene expression, and that the ratios of 1:2 and 1:4 between mini-TP and Tol2 transposon mRNA are critical factors in mini-Tol2 transposon-mediated expression. In addition, the mini-TP system exhibited similar luciferase activity compared to a pool of cells co-transfected with TP and 1 μg To12 transposase mRNA ( FIG. 3B ). These results show that even though the ITR of the mini-TP is smaller than the ITR of the TP, the mini-TP shows the same activity as the original TP.

To compare the integrated copies of the transgene between TP and mini-TP, quantitative PCR was performed using genomic DNA. The co-transfected cell pool with the mini-TP system showed significantly increased transgene integration compared to using the original TP system ( FIG. 3C ). Quantitative PCR was performed using cDNA to investigate the effect of increased transgene integration on expression (Fig. 3D). The pool of co-transfected cells with the mini-TP system showed similar transgene expression compared to those with the original TP system ( FIG. 3D ). These results show that mini-TPs are more effective in transgene integration than native TPs, but mini-TPs show similar expression results to TPs.

In order to confirm that the protein expression level of TP and mini-TP are the same, the amount of expressed protein was compared using Western blot. As a result, it was confirmed that the cells co-transfected with mini-TP and 4 μg of transposase had a band approximately 1.5 times thicker than that of cells co-transfected with TP and 1 μg of transposase (FIG. 3E). These results indicate that mini-TP may be more effective for protein expression than TP.

To obtain single cell clones and assess the distribution of transgene activity, limiting dilutions were performed from a heterologous pool. Twenty clonal cell lines were generated from each cell ( FIG. 3F ). Single cell clones from the mini-TP system showed similar luciferase activity as the TP system, indicating that the mini-TP system has similar capabilities to the TP system. However, cells from the mini-TP system showed a higher mean of luciferase activity than the TP system, suggesting that using a short ITR rather than a long ITR may yield the same protein yield or better (Figure 3F). . The data from the single cell clone results once again confirm the temporal data in terms of similar luciferase activity between TP and mini-TP.

In order to confirm the effect of mini-TP on the long-term stability of each clone, single cell clones indicated by blue circles showing high luciferase activity from each group were maintained for 1 month (FIG. 3G). The cell growth rate (μ) of each cell line was determined periodically from 3 days batch culture. When comparing the TP cell line and the mini-TP cell line, it was confirmed that the μ value of the two cell lines had little difference and was constant for 30 days ( FIG. 3G ). These results show that there is no difference in the effects of native TP and mini-TP on protein expression, indicating that TP and mini-TP are effective protein expression systems.

3. Transposons and DNA Methylation

DNA methylation results in the formation of heterochromatin and consequently transcriptional repression. It is closely related to transposons because they evolved to protect the eukaryotic genome from transposons. When transposons such as sleeping beauty were used in human cells, gene silencing was observed after integration into the genome. However, this gene silencing was partially reversed using DNA methylation inhibitors. Therefore, we investigated the effect of DNA methylation inhibitors on Tol2 transposon-mediated expression. As a DNA methylation inhibitor, the present inventors used 5-azacytidine, which is incorporated into DNA and inhibits DNA methylation. Trichostatin A is also known to increase histone H4 acetylation while decreasing DNA methylation.

To investigate the potentiated effect of DNA methylation inhibition, tricostatin A and 5-azacytidine were treated simultaneously. The luminescence of the 5-azacytidine-treated group was normalized by the luminescence of the DMSO-treated group (Fig. 4A, B). Inhibition of DNA methylation in cells from the TP system significantly improved transgene activation compared to cells from non-TP ( FIG. 4A ). When the methylation inhibitor was treated in the non-TP group, it was observed that the protein expression level was increased about 2-fold compared to DMSO treatment ( FIG. 4A ). However, when the methylation inhibitor was treated in the TP group, the protein expression increased about 3-fold compared with DMSO treatment (Fig. 4A). These results indicate that inhibition of DNA methylation may prevent gene silencing, which may occur in the Tol2 transposon-mediated system, resulting in transgene activation. In addition, the protein expression levels of TP and mini-TP when treated with a methylation inhibitor were also compared. When TP-transduced cells were treated with a methylation inhibitor, protein expression was increased approximately two-fold compared to the DMSO-treated group ( FIG. 4B ). When the mini-TP-introduced cells were treated with the methylation inhibitor, the protein expression was increased about 4-fold compared to the DMSO-treated group ( FIG. 4B ). These results indicate that mini-TP has a better ability to prevent gene silencing due to inhibition of DNA methylation than TP, resulting in higher transgene activation.

Review the results

Currently, therapeutic recombinant proteins are attracting attention in the biopharmaceutical industry. Therefore, increasing therapeutic protein productivity has become a major concern in this field. Conventional vector systems used to generate therapeutic recombinant proteins can be readily generated by random integration, but integration efficiency is low and unstable. Because of these limitations in existing vector systems, experiments have been conducted to improve the efficiency of integrating GOIs into the host genome using transposon systems. The importance of the effect of the vector containing the Tol2 transposon system is supported by the experimental results comparing the protein expression levels of the Tol2, SB (Sleeping Beauty) and PB (PiggyBac) transposon systems.

However, there are no experiments with the mini Tol2, which is performed with a minimum length ITR to transposition. In the present invention, the Tol2 transposon system was introduced into CHO cells commonly used for recombinant antibody production, and the expression level of the protein was evaluated. Therefore, we generated an expression vector using a Tol2 transposable element (TE) essential for translocation and co-transfected it with Tol2 transposase mRNA. Co-transfection of host cells with the To12 vector and transposase mRNA allows for transfer of the recombinant transposon from the donor vector to the cell genome.

To date, there are many experiments using transposon systems to increase protein expression, but there are three novel points in our experiments. First, when co-infecting a transposon vector with a transposase, the transposase was introduced as a plasmid in many previous experiments, but rarely as an mRNA. Plasmids can be genotoxic as long as they stay in the cell for a long time. However, the use of mRNA reduces this risk because mRNA degrades over time. Therefore, mRNA optimization was performed to determine the amount of mRNA transposase with high protein production efficiency. Second, the higher the carrier gene capacity of an expression vector, the more efficient the vector. Therefore, we found the minimum Tol2 sequence required for translocation and evaluated the protein expression level compared to the conventional Tol2 vector. Third, the Tol2 transposon system was treated with the methylation inhibitors Aza and TSA to further increase the protein expression level.

To our knowledge, the present invention provides the first demonstration that mini Tol2 vectors are more effective for expressing proteins than conventional Tol2 vectors. This improvement should be accompanied by co-transfection of transposase mRNA. Expanding the relevance of these results, co-transfection of mini-Tol2 and 4 μg transposase mRNA showed similar luciferase expression to co-transfection of conventional Tol2 vector and 1 μg transposase mRNA. This indicates that the mini-Tol2 vector system is an effective expression vector system because it has the same effect as the existing Tol2 system and increases the protein production capacity. In addition, treatment with a methylation inhibitor in these mini-Tol2 vector systems was found to increase protein expression by about 4-fold compared to untreated ones. Consequently, the present invention suggests that mini-Tol2 vectors will provide many advantages for recombinant protein production. In addition, the present inventors suggest that the use of a methylation inhibitor in the mini-Tol2 system is effective for protein expression, but further studies are needed to confirm this result.

In summary, conventional vector systems have low integration efficiency and unstable protein expression over time. To improve this, the present inventors introduced a Tol2 vector system, and in particular, used mini-Tol2 with minimal ITR to verify its effect on protein expression. Consequently, we found that mini-Tol2 is effective for protein expression, which can be applied to generate recombinant antibodies in the biopharmaceutical industry.

<110> INCHEON NATIONAL UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> METHOD FOR INTEGRATION OF TRANSGENE IN CHO CELLS <130> P20-0000 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 864 <212> DNA <213> Artificial Sequence <220> <223> Tol2 right ITR <400> 1 catatttgtt tcttacatca tttctagcat ctttgagcgc tggctaagaa ctcatcagcc 60 tccccggtcc atctactcac gtaccaatgc accaattggc cacaatgacg gctactacat 120 ggtgccattc cttcctcttt ataggaatgg agactacctc ctgtccaaca atgctcttgg 180 atacgagtac gcctacctgt tggacccagg tcattgcaca acaccagaaa tgccctctga 240 tctgcaaaag acgtgaatat ctgttcagac acccatatcc actctgttcc acacaggtca 300 gaggtttgtc caggagttct tgacagaggt gtaaaaagta ctcaaaaatt ttactcaagt 360 gaaagtacaa gtacttaggg aaaattttac tcaattaaaa gtaaaagtat ctggctagaa 420 tcttacttga gtaaaagtaa aaaagtactc cattaaaatt gtacttgagt attaaggaag 480 taaaagtaaa agcaagaaag aaaactagag attcttgttt aagcttttaa tctcaaaaaa 540 cattaaatga aatgcataca aggttttatc ctgctttaga actgtttgta tttaattatc 600 aaactataag acagacaatc taatgccagt acacgctact caaagttgta aaacctcaga 660 tttaacttca gtagaagctg attctcaaaa ttgttagtgt caagcctagc tcttttgggg 720 ctgaaaagca atcctgcagt gctgaaaagc ctctcacagg cagccgatgc gggaagaggt 780 gtattagtct tgatagagag gctgcaaata gcaggaaacg tgagcagaga ctccctggtg 840 tctgaaacac aggccagatg ggcc 864 <210> 2 <211> 558 <212> DNA <213> Artificial Sequence <220> <223> Tol2 left ITR <400> 2 tctgcgaaga tacggccacg ggtgctcttg atcctgtggc tgattttgga ctgtgctgct 60 cgcagctgct gatgaatcac atacttcctc cattttcttc cactgattga ctgttataat 120 ttccctaatt tccaggtcaa ggtgctgtgc attgtggtaa tagatgtgac atgacgtcac 180 ttccaaagga ccaatgaaca tgtctgacca atttcatata atgtgaaaac gattttcata 240 ggcagaataa ataacattta aattaaactg ggcatcagcg caattcaatt ggtttggtaa 300 tagcaaggga aaatagaatg aagtgatctc caaaaaataa gtactttttg actgtaaata 360 aaattgtaag gagtaaaaaag tacttttttt tctaaaaaaa tgtaattaag taaaagtaaa 420 agtattgatt tttaattgta ctcaagtaaa gtaaaaatcc ccaaaaataa tacttaagta 480 cagtaatcaa gtaaaattac tcaagtactt tacacctctg gttcttgacc ccctaccttc 540 agcaagccca gcagatcc 558 <210> 3 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> Mini-Tol2 right ITR <400> 3 cagaggtgta aaaagtactc aaaaatttta ctcaagtgaa agtacaagta cttagggaaa 60 attttactca attaaaagta aaagtatctg gctagaatct tacttgagta aaagtaaaaa 120 agtactccat taaaattgta cttgagtatt 150 <210> 4 <211> 200 <212> DNA <213> Artificial Sequence <220> <223> Mini-Tol2 left ITR <400> 4 aagtgatctc caaaaaataa gtactttttg actgtaaata aaattgtaag gagtaaaaag 60 tacttttttt tctaaaaaaa tgtaattaag taaaagtaaa agtattgatt tttaattgta 120 ctcaagtaaa gtaaaaatcc ccaaaaataa tacttaagta cagtaatcaa gtaaaattac 180 tcaagtactt tacacctctg 200 <210> 5 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Tol2 left arm & right arm Forward primer <400> 5 ttttgcgctg cttcgcgatc tgcgaagata cggccacg 38 <210> 6 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Tol2 left arm & right arm Reverse primer <400> 6 ctggcccgta catcgcgagg cccatctggc ctgtgtttc 39 <210> 7 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> mini Tol2 left arm Reverse primer <400> 7 aagtgatctc caaaa 15 <210> 8 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> mini Tol2 left arm Reverse primer <400> 8 cagaggtgta aagta 15 <210> 9 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> mini Tol2 right arm Forward primer <400> 9 gcggccgtta ctagtggatc ccagaggtgt aaaaag 36 <210> 10 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> mini Tol2 right arm Reverse primer <400> 10 gaccatgatt acgccaagct taatactcaa gtacaa 36 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> mini Tol2 left arm & right arm Forward primer <400> 11 ttttgcgctg cttcgcgaaa gtgatctcca aaa 33 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> mini Tol2 left arm & right arm Reverse primer <400> 12 ctggcccgta catcgcgaaa tactcaagta caa 33

Claims (9)

Co-transfecting a CHO cell with a transposon vector (TP) comprising a Tol2 right inverted terminal repeat (ITR), a Tol2 left ITR and a transgene together with a transposase mRNA,
The transgene is characterized in that it exists between the Tol2 right ITR (inverted terminal repeat) and the Tol2 left ITR,
When the Tol2 right ITR and the Tol2 left ITR have the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, respectively, the transposon vector (TP) and transposase mRNA are co-transfected in a ratio of 2: 1 to 1: 2 It is characterized by
When the To12 right ITR and the To12 left ITR have the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4, respectively, the transposon vector (TP) and transposase mRNA are co-transfected at a ratio of 1:2 to 1:4 A method for integrating a transgene into CHO cells, characterized in that
delete delete delete The method of claim 1,
The method, characterized in that the transfection is performed by electroporation (electroporation).
A method for producing a protein encoded by the transgene in CHO cells comprising the step of culturing the CHO cell into which the transgene is integrated by the method of any one of claims 1 to 5.
7. The method of claim 6,
A method further comprising treating a methylation inhibitor or a histone deacetylase inhibitor.
8. The method of claim 7,
The methylation inhibitor is any one of 5-azacytidine, decitabine, and zebularine.
8. The method of claim 7,
The histone deacetylase inhibitor is Trichostatin A (Trichostatin A), dihydrocoumarin (dihydrocoumarin), naphthopyranone (naphthopyranone) and 2-hydroxynaphaldehyde (hydroxynaphaldehydes) method, characterized in that any one.

Images