KR102362023B1 - Antibiotic modified anticancer compounds for the treatment of non-genetic anti-cancer and anticancer pharmaceutical composition comprising the same - Google Patents

Abstract

The present invention relates to an antibiotic-modified anticancer compound for gene non-toxic anticancer treatment and an anticancer pharmaceutical composition comprising the same. Unlike conventional chemotherapy, which damages and kills cancer cells, it does not cause gene denaturation, so cancer recurrence can be prevented. In addition, the mitochondrial targeted therapy using the compound according to the present invention acquires drug resistance by general anticancer treatment, making it difficult to treat. It can effectively treat difficult malignant tumors.

Description

Antibiotic modified anticancer compounds for the treatment of non-genetic anti-cancer and anticancer pharmaceutical composition comprising the same

The present invention relates to an antibiotic-modified anticancer compound for gene non-toxic anticancer treatment and an anticancer pharmaceutical composition comprising the same.

Tumor recurrence remains the biggest challenge in cancer therapy, accounting for up to 90% of cancer mortality, and paradoxically, recurrence is induced by the accumulation of nuclear gene mutations due to treatment with chemotherapy. Anti-neoplastic agents that rely on direct nuclear DNA damage, such as alkylating agents, are common chemical mutations and are associated with, for example, acute myeloid leukemia (t-AML) tumor recurrence. In addition, drug-induced transgenic mice are carried over to the next generation with detection up to two generations. Given pediatric malignancy survival rates, preventing these long-term effects could essentially warrant a paradigm shift towards non-genetic toxic chemotherapeutic agents.

Programmed cell death through mitochondrial damage-induction represents an attractive pathway for cancer chemotherapy, bypassing direct nuclear DNA damage and preventing the accumulation of nuclear DNA mutations. Mitochondria are widely known to have a bacterial evolutionary origin and share many similarities with the bacterial genome and biosynthetic machinery. In particular, the toxicity and effects of some common antibiotics on mammalian cells are well established. Ciprofloxacin (a type of fluoroquinolones) has been reported to inhibit mitochondrial topoisomerase II. It was recently demonstrated that common antibiotics such as fluoroquinolones, aminopenicillins, aminoglycosides and tetracyclines induce inhibition of the mitochondrial electron transport chain (ETC), although they act through different mechanisms in bacteria and eukaryotes. This slow electron transfer in mitochondria leads to the generation of ROS and causes mitochondrial damage, which may explain why this process accounts for a significant proportion of the common side effects of bactericidal antibiotics.

Efforts to apply antibiotics to chemotherapy have a long history. Bacterial-derived fungicides, such as doxorubicin and mitomycin C, have identified broad clinical applications, but their mode of action involves direct nuclear DNA damage. Attempts to repurpose commonly prescribed fungicides for infectious diseases have largely been unsuccessful, as these drugs are designed with non-toxicity to eukaryotic cells in mind. It has also been demonstrated that high doses of synthetic antibiotics reduce the rate of cancer growth, but that normal cells are more susceptible to microbial fungicides than cancer cells.

As such, tumor recurrence is one of the serious problems caused by nuclear DNA damage as a result of chemotherapy. So far, there are only a handful of potential gene non-toxic therapeutics reported.

In order to design such a drug prototype, the present inventors studied the relocalization of ciprofloxacin, one of the most commonly prescribed antibiotics, into mitochondria. As a result, the concentration of the drug complex of ciprofloxacin in the mitochondria of cancer cells may have increased In this case, it could be observed that oxidative damage to proteins, mitochondrial DNA and lipids was induced.

Contrary to the results of conventional chemotherapy used in clinical trials, it was confirmed that the compound according to the present invention showed a large bias in mitochondrial DNA damage compared to nuclear DNA damage. In particular, it was confirmed that cancer growth was clearly reduced in the xenograft mouse model.

The inventors of the present invention confirmed that drug repurposing by mitochondrial relocalization selectively induces mitochondrial-related oxidative damage and apoptosis, thereby minimizing nuclear DNA damage and reducing drug-induced cancer recurrence. , the present invention was completed.

Therefore, the present invention relates to an antibiotic-modified anticancer drug compound for non-toxic anticancer treatment that minimizes nuclear DNA damage by selectively inducing mitochondrial-related oxidative damage and cell death by repurposing the drug by mitochondrial relocalization, and anticancer pharmaceuticals containing the same It is intended to provide a composition.

In order to solve the above problems, the present invention provides a modified antibiotic compound for cancer treatment that minimizes nuclear gene damage represented by the following [Formula 1].

[Formula 1]

In [Formula 1], R is represented by the following [Formula 1].

[Structural Formula 1]

The structures and substituents of [Formula 1] and [Structural Formula 1] will be described later.

The modified antibiotic anticancer compound according to the present invention is characterized in that it minimizes nuclear gene damage in cancer cells and selectively targets the mitochondria of cancer cells, thereby inhibiting the mitochondrial electron transport system (ETC) function of cancer cells, It is characterized by inhibiting mitochondrial DNA synthesis.

In addition, the present invention provides a pharmaceutical composition for preventing and treating cancer diseases containing a modified antibiotic compound or a salt thereof as an active ingredient for the treatment of cancer that minimizes the nuclear gene damage represented by the above [Formula 1].

Since the modified antibiotic anticancer drug according to the present invention has a therapeutic effect by targeting only the mitochondria of cancer cells, unlike conventional chemotherapy that destroys cancer cells by damaging nuclear DNA, it does not cause gene denaturation, so cancer recurrence can be prevented. In addition, the mitochondrial targeted therapy using the compound according to the present invention can effectively treat malignant tumors that are difficult to treat because drug resistance is acquired by general anticancer treatment.

1 is a result showing the cell viability of TPP, CFX and MT-CFX in MDA-MB-231 cells, all data are expressed as mean ± SEM (n = 3).
2 is a result showing the altered BrdU pattern in Mt-CFX-treated MDA-MB-231 cells.
3 is a result showing the cell viability of MT-CFX in various cancer (A549, SW620, PC3 and DU145) and normal (BJ and MCF10A) cell lines (all experiments were performed in triplicate, all histograms are mean ± SEM (n = 3)).
Figure 4 shows the results of mitochondrial membrane potential (MMP) of various cancer (MDA-MB-231, A549, SW620, PC3 and DU145) and normal (BJ) cell lines (cells were stained with JC-1 according to the protocol and BD Analyzed in FACS caliber ^™ , JC-1 fluorescence was observed in both aggregates (red) and monomers (green).
Figure 5 is a result showing Mt-CFX- induced mitochondrial disruption resulting in apoptosis (after MT-CFX (30 μM) treatment of cells, mitochondria are time-dependently found as depolarizing MMP, cells incubation with MT-CFX for 0 h to 24 h, annexin V-positive apoptotic cells assayed).
6 is a result showing the mitochondrial ROS production induced by Mt-CFX in MDA-MB-231 cells (hydrogen peroxide (H ₂ O ₂ ) level using Amplex red in Mt-CFX (30 μM) treated cells Determination from, mitochondrial-selective peroxide (O2 ^*- ) production and intracellular ROS production were detected with MitoSOX using confocal microscopy, all histogram displays represent mean ± SEM (n = 3).
7 is a result showing the oxidative damage caused by Mt-CFX in MDA-MB-231 cells (MDA-MB-231 after 48 hours of treatment with Mt-CFX (30 μM) and CFX (30 μM). Measuring Oxidative Damage in Cells, Assessing Oxidative DNA Damage by Measuring the Abundance of 8-OHdG, Oxidative Protein Damage, Protein Carbonylation Detected Using Enzyme-Linked Immunosorbent Assay (ELISA), Lipid Peroxidation Assessed by measuring MDA, all histogram representations represent mean ± SEM (n = 3).
Figure 8 shows genomic DNA q-PCR of nuclear GAPDH and mitochondrial ND1 (Mt-CFX (30 μM), CFX (30 μM) and doxorubicin (30 μM) were treated with MDA-MB-231 cells, all histograms are mean ± SEM (n = 3)).
9 shows the expression levels of DNA repair genes (DDB2, ERCC1 are involved in nucleotide excision repair (NER), POLg is involved in mitochondrial-specific base excision repair, Mt-CFX (30 μM) using real-time PCR, CFX (30 μM) and doxorubicin (30 μM) treated MDA-MB-231 cells).
10 shows Mt-CFX (30 μM) induced mitochondrial DNA mutations (all histogram representations represent mean±SEM (n=3)).
11 shows long range genomic DNA q-PCR (nuclear: 3129 bp, mitochondrial: 3723 bp) (MDA-MB-231 cells were treated with Mt-CFX (30 μM), doxorubicin (DOXO) (30 μM), temozolomide). (TMZ) (1 μM), camptothecin (CPT) (250 nM), cis-platin (CDDP) (3 μM), clorambucil (CLB) (50 μM) and fluorouracil (5-FU) (30 μM), Concentrations selected based on IC ₅₀ , all histogram displays represent mean ± SEM (n = 3).
12 shows the gene expression analysis result of Mt-CFX, (A) shows a heat map showing the relative expression level of DEG (differentially expressed gene), (B) is the KEGG pathway enhancement analysis result of 197 DEGs indicates
13 shows the results of real-time PCR evaluation of a subset of metabolic-related pathway genes showing differential expression in the control group, Mt-CFX, and CFX.
14 shows the results of real-time PCR evaluation of a subset of aldehyde dehydrogenase genes showing differential expression in the control group, Mt-CFX and CFX.
15 shows the results of real-time PCR evaluation of a subset of ROS danage genes showing differential expression in the control group, Mt-CFX and CFX.
16 shows the results of real-time PCR evaluation of a subset of cellular component damage genes showing differential expression in the control group, Mt-CFX, and CFX.
17 shows the fluorescence response of Bo-Mt-CFX by reaction to H ₂ O ₂ with drug release (H ₂ O ₂ The fluorescence of Bo-Mt-CFX (5 μM) increased in a time-dependent manner upon treatment with (250 μM), H ₂ O ₂ Upon treatment, the fluorescence of Bo-Mt-CFX (5 μM) increased in a dose-dependent manner (0 to 1500 μM).
18 shows the results of HPLC analysis of resorufin release.
Figure 19 shows the cell viability of Bo-MT-CFX in various cancer (MDA-MB-231, A549, SW620, PC3 and DU145) and normal (BJ) cell lines (experiment was performed in triplicate, all histograms are shown mean ± SEM (n = 3)).
20 shows mitochondrial-dependent apoptosis induced by Bo-Mt-CFX in MDA-MB-231 cells ((a) Annexin V-positive apoptosis cells in Bo-Mt-CFX-treated cells through flow cytometry analysis. analysis, (b) cytoplasmic and membrane fractions were isolated and analyzed by western blotting).
Figure 21 shows the activation of Bo-Mt-CFX in ROS ((a) various concentrations of compound 10 in the MDA-MB-231 cell line, (b) shows a clear difference in viability when treated with ROS inducers and ROS quenchers ).
Figure 22 relates to the self-amplification effect of Bo-Mt-CFX (10 μM), and shows the fluorescence of Bo-Mt-CFX with or without pretreatment with Mt-CFX (10 μM).
23 shows mitochondrial GSH levels measured by MitoRT upon activation of Bo-Mt-CFX.
Figure 24 shows intracellular co-localization of Bo-Mt-CFX in MDA-MB-231 cells (cells were washed with PBS before recording fluorescence images and Mito-, Lyso- and ER trackers green FM were added. ).
Figure 25 shows the intracellular uptake of Bo-MT-CFX (MDA-MB-231 cells were incubated with 10 μM of Bo-Mt-CFX for 8 hours, the cells were washed with PBS before recording fluorescence images and Mito-tracker green FM added).
Figure 26 shows the in vivo and in vitro imaging results and tumor sedimentation effect of Mt-CFX and Bo-Mt-CFX in the MDA-MB-231 xenograft mouse model. In vivo images of MDA-MB-231 xenograft mice are shown 1 to 48 hours after injection, (b) is various organs (1:liver, 2:tumor) taken 48 hours after intravenous injection of Bo-Mt-CFX , 3:brain, 4:heart, 5:testis, 6:lung, 7:kidney, 8:spleen). (c) and (d) show the tumor volume (c) and body weight (d) of the control group, CFX, Mt-CFX and Bo-Mt-CFX-treated mice, respectively. (e) shows a representative image of the MDA-MB-231 xenograft tumor.
27 shows the weight of xenografted mouse tumors in vivo and the AST and ALT activity levels of mice in control, Mt-CFX, CFX and Bo-Mt-CFX sera (White; control, Purple; CFX, Cyan; Mt). -CFX, Red; Bo-Mt-CFX).
28 shows the results of H&E staining and immunohistochemistry experiments.
29 is a mechanism of Bo-Mt-CFX.

Hereinafter, the present invention will be described in more detail.

Tumor recurrence is one of the serious problems caused by nuclear DNA damage as a result of chemotherapy. So far, there are only a handful of potential gene non-toxic therapeutics reported.

In order to design such a drug prototype, the inventors of the present invention studied the relocalization of ciprofloxacin, one of the most commonly prescribed antibiotics, into mitochondria. It could be observed that oxidative damage to mitochondrial DNA and lipids was induced.

Contrary to the results of conventional chemotherapy used in clinical trials, it was confirmed that the compound according to the present invention showed a large bias in mitochondrial DNA damage compared to nuclear DNA damage. In particular, it was confirmed that cancer growth was clearly reduced in the xenograft mouse model.

The inventors of the present invention confirmed that drug repurposing by mitochondrial relocalization selectively induces mitochondrial-related oxidative damage and apoptosis, thereby minimizing nuclear DNA damage and reducing drug-induced cancer recurrence. , the present invention was completed.

The present invention relates to a modified antibiotic drug for anticancer treatment of a new concept that can suppress recurrence and metastasis contributed from strong genotoxicity, which is a major problem of current anticancer treatment.

The modified antibiotic anticancer drug compound according to the present invention is represented by the following [Formula 1], has a high stability antibiotic as a basic skeleton, and is designed to selectively target mitochondria therein, thereby exhibiting a high anticancer therapeutic effect and mitochondrial target It is characterized by minimizing side effects by becoming a safe antibiotic after Qi is hydrolyzed in the body.

[Formula 1]

In [Formula 1], R is represented by the following [Formula 1].

[Structural Formula 1]

In the [Structural Formula 1],

D is a highly stable fluoroquinolone-based antibiotic backbone, flumequine, oxolinic acid, rosoxacin, cinoxacin, nalidixic acid, piromidic acid acid), pipemdic acid, ciprofloxacin, fleroxacin, lomefloxacin, nadifloxacin, norfloxacin, ofloxacin (ofloxacin) , pefloxacin, rufloxacin, enoxacin, balofloxacin, grepafloxacin, levofloxacin, sparfloxacin, pazufloxacin sparfloxacin, temafloxacin, tosufloxacin, clinafloxacin, gatifloxacin, moxifloxacin, sitafloxacin, sitafloxacin Roxacin (prulifloxacin), besifloxacin (besifloxacin), gemifloxacin (gemifloxacin), trovafloxacin (trovafloxacin), delafloxacin (delafloxacin), danofloxacin (danofloxacin), difloxacin (difloxacin) Rofloxacin (enrofloxacin), ibafloxacin (ibafloxacin), marbofloxacin (marbofloxacin), obifloxacin (orbifloxacin) and sarafloxacin (sarafloxacin) is selected from, the hydroxyl group at the end of the skeleton of the fluoroquinolone antibiotic connected to the X.

Wherein X is any one selected from O, S and NR (wherein R is any one selected from hydrogen, an alkyl group having 1 to 30 carbon atoms, an aryl group having 6 to 30 carbon atoms, and a heteroaryl group having 2 to 30 carbon atoms) and preferably O or NR.

In this case, when X is an amide group (NR), the stability in the body of [Formula 1] according to the present invention is more excellent.

L is a linking group with the target group, and may be any one selected from an alkyl group having 1 to 30 carbon atoms, an alkenyl group having 2 to 30 carbon atoms, and a polyalkylene glycol group.

Q may be any one selected from Group 15 elements such as N. P, As and Sb, R ₁ To R ₃ Are the same or different from each other, and each independently an alkyl group having 1 to 30 carbon atoms, 2 to 30 carbon atoms It may be any one selected from an alkenyl group, an aryl group having 6 to 30 carbon atoms, and a heteroaryl group having 2 to 30 carbon atoms.

A ^- is any one anion selected from halogen, hydroxyl, carboxylate, sulfate, sulfurmate, sulfonate, phosphate, phosphonate, boronate and (poly)ethyleneoxy.

As for [Formula 1] according to the present invention, specific compounds may be exemplified by an embodiment as follows, and the scope of [Formula 1] according to the present invention is not limited thereby.

A specific example compound below is based on ciprofloxacin among fluoroquinolone antibiotics.

[Ester-Mt-CFX]

[Amide-Mt-CFX]

In the above compound, n is an integer from 1 to 30, A ^- is the same as the definition above, and in Examples to be described later, n is 6 and A ^- is a chloride anion, and the [Amide-Mt-CFX] further enhances stability in the body. In order to improve it, the binding site is modified with an amide group rather than an ester group.

In addition, the present invention relates to a pharmaceutical composition for the prevention and treatment of cancer diseases containing a modified antibiotic anticancer compound represented by the above [Formula 1] or a salt thereof as an active ingredient.

The pharmaceutical composition according to the present invention can be used for preventing and treating various cancer diseases such as cancer and metastatic cancer thereof, but is not limited thereto, but the cancer diseases include breast cancer, lung cancer, colorectal cancer, prostate cancer and their It may be metastatic cancer.

In addition, the pharmaceutical composition according to the present invention may be administered in the form of a complex formulation together with other drugs known for the prevention or treatment of cancer diseases, or may contain other components such as carriers, diluents, adjuvants and stabilizers.

In addition, the form of the composition according to the present invention may be variously selected depending on the mode to be administered, but is not limited thereto, but for example, a solid state such as a tablet, pill, powder, capsule, gel, ointment, fluid or suspension. , semi-solid or liquid dosage form, may be administered in a unit dosage form suitable for single administration of an accurate dosage, may be administered orally or parenterally, and in the case of parenteral administration, intravenous injection, subcutaneous injection, It can be administered by intramuscular injection.

The composition may also contain, depending on the desired formulation, pharmaceutically acceptable carriers, diluents, adjuvants, stabilizers, defined as aqueous-based vehicles commonly used in formulating pharmaceutical compositions for human administration.

The term "carrier" refers to a substance that facilitates the addition of a compound into a cell or tissue, for example, a carbohydrate compound (eg, lactose, amylose, dextrose, water) that is commonly used in formulations. Cross, sorbitol, mannitol, starch, cellulose, etc.), gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, salt solution, alcohol, arabic Contains rubber, vegetable oils (e.g. corn oil, cottonseed oil, soy milk, olive oil, coconut oil), polyethylene glycol, methyl cellulose, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate and mineral oil. However, the present invention is not limited thereto. A diluent is defined as a substance that not only stabilizes the biologically active form of a compound of interest, but also dissolves the compound in water. Examples of the diluent include distilled water, physiological saline, Ringer's solution, glucose solution, and It may be a Hank's solution or the like. The stabilizing agent may be selected from the group consisting of proteins, carbohydrates, buffers and mixtures thereof. Further, in addition to the above components, lubricants, wetting agents, sweetening agents, flavoring agents, emulsifying agents, suspending agents, preservatives, and the like are further included, but are not limited thereto.

In addition, the effective amount of other ingredients such as carriers, diluents, adjuvants and stabilizers is an amount effective to obtain a pharmaceutically acceptable formulation in terms of solubility and biological activity of the ingredients.

Hereinafter, the present invention will be described in more detail with reference to preferred embodiments. However, these Examples and the like are intended to explain the present invention in more detail, it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited thereby.

Mt - CFX's synthesis

<Scheme: Synthesis of Mt-CFX>

Reagents and conditions: (a) PPh _3, ACN, reflux (b) Boc ₂ O, cosolvent (water / dioxane=1/1), 1.0 N NaOH (c) K ₂ CO ₃ , DMF, 50 °C (d) 1N HCl in dioxane

Synthesis of compounds 1 and 2

With reference to methods reported in the prior literature, compound 1 (J. Marchant, Nature, 2018, 555, 431), compound 2 (C. Lee, HK Park, H. Jeong, J. Lim, AJ Lee, KY Cheon, CS Kim, AP Thomas, B. Bae, ND Kim, SH Kim, PG Suh, JH Ryu, BH Kang, J. Am . Chem . Soc . , 2015, 137, 4358) were synthesized.

Synthesis of compound 3

Compound 1 (1 g, 1.975 mmol) and compound 2 (852 mg, 1.975 mmol) were dissolved in DMF and dissolved in K ₂ CO ₃ (819 mg, 5.925 mmol) was added to the solution and then the reaction mixture was heated to 50 °C overnight. After removal of the solvent under reduced pressure, the residue was purified by column chromatography (eluent: DCM/MeOH = 97/3). The product was dissolved in 10 mL of MeOH and 90 mL of DW was added, then 1 g of NaBF ₄ was added with vigorous stirring and ion exchange was performed for 1 hour. The mixture was extracted with DW/MC, dried over Na ₂ SO ₄ and evaporated under reduced pressure. The resulting compound was dissolved in MeOH, and purified 20 mL of Dowex ^® 1×8 chloride foam (purified by adding 20 mL of Dowex ^® 1X8 chloride foam to 100 mL of MeOH and stirring gently for 20 minutes, then decanting the solvent) was added and stirred gently. The same procedure was repeated 3 times to obtain compound 3 (1.31 g, yield 82%).

¹ H NMR (CDCl ₃ , 500 MHz) δ 8.50 (s, 1H), 7.82-7.77 (m, 3H), 7.74-7.66 (m, 13H), 7.33 (d, J = 7.2 Hz, 1H), 4.25 (t) , J = 6.0 Hz, 2H), 3.65 (t, J = 4.8 Hz, 4H), 3.56-3.50 (m, 1H), 3.39-3.29 (m, 2H), 3.22 (t, J = 4.9 Hz, 4H) , 1.74-1.63 (m, 6H), 1.58-1.51 (m, 2H), 1.50 (s, 9H), 1.37 (dd, J = 14.2 and 6.9 Hz, 2H) and 1.11-1.06 (m, 2H) ppm;

¹³ C NMR (CDCl ₃ , 125 MHz) 173.0, 165.5, 154.6, 153.2 (d, J = 247.7 Hz), 148.2, 144.4 (d, J = 10.4 Hz), 138.1, 135.1 (d, J = 2.75 Hz), 133.6 (d, J = 10.0 Hz), 130.5 (d, J = 12.7 Hz), 122.9 (d, J = 6.6 Hz), 118.1 (d, J = 85.4 Hz), 112.7 (d, J = 22.9 Hz), 110.0, 105.5 (d, J = 2.8 Hz), 80.1, 64.3, 53.5, 49.9 (d, J = 4.2 Hz), 34.9, 29.5 (d, J = 16.0 Hz), 28.4, 28.0, 25.0, 22.3 (d, J = 50.3 Hz), 22.1 (d, J = 4.3 Hz), 8.2 ppm;

ESI-MS ( m/z ): [M] ⁺ calcd for C ₄₆ H ₅₂ FN ₃ O ₅ P: 776.36; found : 776.35.

Mt - CFX's synthesis

Compound 3 (1 g, 1.231 mmol) was dissolved in 30 mL of a solvent mixture (1,4-dioxane/DCM = 4/1), and 10 mL of 4 N HCl in dioxane was added dropwise under ice bath conditions. After preparing a 1 N HCl final solution and stirring overnight, the solvent was evaporated to give the compound Mt-CFX as a pale yellow powder (790 mg, 1.11 mmol, yield 90%). For biological analysis, further purification by flash column.

¹ H NMR (CDCl ₃ , 500 MHz) δ 8.51 (s, 1H), 7.85-7.66 (m, 16H), 7.33 (d, J = 7.1 Hz, 1H), 4.27 (t, J = 5.8 Hz, 2H) , 3.73-3.61 (m, 2H), 3.55-3.50 (m, 1H), 3.43-3.37 (m, 4H), 3.23 - 3.19 (m, 4H), 1.75-1.67 (m, 6H), 1.61-1.52 ( m, 2H), 1.41-1.34 (m, 2H), 1.15-1.08 (m, 2H) ppm.;

¹³ C NMR (DMSO-d ₆ , 125 MHz) 171.8, 164.8, 152.6 (d, J = 246.8 Hz), 148.2, 144.1 (d, J = 10.1), 138.1, 134.9 (d, J = 2.7), 133.6 ( d, J = 10.1 Hz), 130.3 (d, J = 12.6 Hz), 121.7 (d, J = 6.8 Hz), 118.6 (d, J = 86.2 Hz), 111.5 (d, J = 22.8 Hz), 109.1, 106.1 (d, J = 2.8 Hz), 63.7, 49.7 (d, J = 4.1 Hz), 44.7, 34.9, 29.2 (d, J = 16.9 Hz), 27.8, 24.5, 21.6 (d, J = 4.3 Hz), 20.1 (d, J = 49.9 Hz), 7.6 ppm;

ESI-MS ( m/z ): [M] ⁺ calcd for C ₄₁ H ₄₄ FN ₃ O ₃ P: 676.31; found : 676.35.

Bo- Mt - CFX's synthesis

<Scheme: Synthesis of Bo-Mt-CFX

Reagents and conditions: (a) TBDMSCl, imidazole; (b) 4, 4-nitrophenyl chloroformate, TEA, DCM; (c) 11, 5, DMF, RT; (d) Amberlyst 15, MeOH, RT; (e) DIAD, 7, PPh ₃ , anhydrous 1,4-dioxane, 10° C.; (f) 8, 4-nitrophenyl chloroformate, pyridine, anhydrous DCM; (g) Mt-CFX, 9, dry TEA, anhydrous DMF; (h) 1) HCl in EA, 0 °C; 2) 12, dry TEA, DMF, 0 °C; (i) Boc ₂ O, N,N'-dimethylethylenediamine, anhydrous DCM, 0 °C, overnight; (j) 4-nitrophenyl chloroformate, TEA, DMAP

Synthesis of compounds 4, 5, 6, 7, 11, 12

With reference to methods reported in the prior literature, compounds 4 to 7 (L. Tan, Z. Zhang, DL Gao, SP Chan, JF Luo, ZC Tu, ZM Zhang, K. Ding, XM Ren, XY Lu, Eur . J. Med . Chem . , 2019, 166, 318-327), compound 11 (M. Shamis, HN Lode, D. Shabat, J. Am. Chem . Soc ., 2004, 126, 1726), compound 12 (DM Kneeland, K. Ariga, VM Lynch, CY Huang, EV Anslyn, J. Am . Chem . Soc . , 1993, 115, 10042) were synthesized.

Synthesis of compound 8

Compound 7 (300 mg, 0.778 mmol), resorufin (167 mg, 0.78 mmol) and DIAD (206 mg, 1.02 mmol) were dissolved in 20 mL of dried dioxane, followed by PPh ₃ in 10 mL dry dioxane oxane (267 mg, 1.02 mmol) solution was added dropwise and stirred vigorously at 10 °C. The mixture was stirred overnight to complete the reaction, and then extracted with MC/brine. The organic phase was Na ₂ SO ₄ dried over, filtered and evaporated. The resulting residue was purified by column chromatography (eluent: DCM/acetone = 95/5) to give a red viscous compound 8.

¹ H NMR (CDCl ₃ , 500 MHz) δ 7.70 (d, J = 8.9 Hz, 1H), 7.41 (dd, J = 9.8 and 1.1 Hz, 1H), 7.32-7.28 (m, 1H), 7.23-7.18 ( m, 1H), 7.04-6.96 (m, 1H), 6.95-6.87 (m, 1H), 6.84-6.80 (m, 1H), 6.32-6.27 (m, 1H), 5.21-5.07 (m, 2H), 4.57-4.49 (m, 2H), 3.56-3.38 (m, 4H), 3.12-3.02 (m, 3H), 2.94-2.87 (m, 3H), 2.36-2.30 (m, 3H), 1.49-1.42 (m) , 9H) ppm.;

¹³ C NMR (CDCl ₃ , 125 MHz) 186.3, 162.6, 156.3-155.8 (m), 155.7-155.3 (m), 154.8, 154.6, 149.8, 145.6, 145.3-144.8 (m), 136.2 (br), 134.7, 134.1, 131.6, 129.2 (br), 128.9 (br), 128.6, 128.5, 114.2, 106.7, 101.1, 80.0 (m), 66.9-66.2 (m), 60.6-59.8 (m), 47.3, 46.1, 34.6, 30.9 , 28.4, 21.0-20.8 (m) ppm;

ESI-MS ( m/z ) : [M+H] ⁺ calcd for C ₃₁ H ₃₆ N ₃ O ₈ : 578.25; found : 578.35.

Synthesis of compound 9

After cooling a solution of compound 8 (250 mg, 0.43 mmol) and pyridine (0.12 mL, 1.08 mmol) in 50 mL dry DCM, 4-nitrophenyl chloroformate (175 mg, 0.87 mmol) in 10 mL dry DCM was added After the dropwise addition, the mixture was stirred vigorously. The reaction was monitored by TLC and after 6 hours the reaction mixture was washed with brine and 1N HCl water. The organic layer was dried over Na ₂ SO ₄ and filtered, the solution was evaporated under reduced pressure, and the resultant was further purified by column chromatography (eluent: DCM/acetone=92/8) to obtain compound 9.

¹ H NMR (CDCl ₃ , 500 MHz) δ 8.27 (d, J = 8.9 Hz, 2H), 7.72 (d, J = 9.0 Hz, 1H), 7.42 (dd, J = 9.8 and 1.8 Hz, 1H), 7.40 -7.35 (m, 2H), 7.35-7.29 (m, 2H), 7.08-6.99 (m, 1H), 6.98-6.90 (m, 1H), 6.84 (dt, J = 9.8 and 1.9 Hz, 1H), 6.32 -6.30 (m, 1H), 5.30-5.07 (m, 4H), 3.66-3.32 (m, 4H), 3.17-3.01 (m, 3H), 2.96-2.84 (m, 3H), 2.40-2.34 (m, 3H), 1.48-1.38 (m, 9H) ppm.

Synthesis of compound 10

To a solution of compound 9 (200 mg, 0.27 mmol) and TEA (137 mg, 1.35 mmol) in 10 mL dry DMF, Mt-CFX (192 mg, 0.27 mmol) in 2 mL dry DMF was added dropwise and stirred overnight. After completion of the reaction, it was evaporated, extracted with DCM/brine, and further purified by flash column chromatography (eluent: DCM/MeOH=92/8) to obtain compound 10.

¹ H NMR (CDCl ₃ , 500 MHz) δ 8.52 (s, 1H), 7.85-7.79 (m, 3H), 7.75-7.66 (m, 14H), 7.43 (dd, J = 9.9 and 2.0 Hz, 1H), 7.36-7.23 (m, 3H), 7.09-7.02 (m, 1H), 7.00-6.92(m, 1H), 6.83 (d, J = 10.1 Hz, 1H), 6.31 (s, 1H), 5.24-5.08 ( m, 4H), 4.28 (t, J = 5.8 Hz, 2H), 3.78-3.63 (m, 4H), 3.56-3.47 (m, 3H) 3.46-3.34 (m, 4H), 3.28-3.18 (m, 4H) ), 3.18-3.03 (m, 3H), 2.95-2.88 (m, 3H), 2.39-2.34 (m, 3H), 1.73-1.61 (m, 6H), 1.59-1.52 (m, 2H), 1.47-1.39 (m, 9H), 1.37-1.32 (m, 2H), 1.13-1.07 (m, 2H) ppm.;

¹³ C NMR (CDCl ₃ , 125 MHz) 185.6, 172.5, 164.9, 162.1, 155.5-155.1 (m), 155.1-154.7 (m), 154.4, 153.3, 152.6 (d, J = 248.0 Hz), 149.2, 147.8, 145.0, 144.9-144.4, 143.7 (d, J = 10.4 Hz), 137.6, 135.5 (br), 134.6 (d, J = 2.8 Hz), 134.2, 133.4, 133.0 (d, J = 10.0 Hz), 131.1, 130.0 (d, J = 12.5 Hz), 129.0, 128.9, 128.6, 128.0, 122.4 (d, J = 6.6 Hz), 117.7 (d, J = 85.3 Hz), 113.8, 112.1 (d, J = 21.5 Hz), 109.4 , 105.9, 105.3 (br), 100.8, 79.4-78.9 (m), 66.1-65.6 (m), 63.8, 62.2-61.8 (br), 49.3, 46.8, 45.6 (br), 43.2 (br), 34.4, 34.2 , 30.4, 29.0 (d, J = 16.2 Hz), 27.9, 27.5, 24.5, 21.6 (d, J = 4.0 Hz), 21.4 (d, J = 50.9 Hz), 20.5 and 7.7 ppm.;

ESI-MS ( m/z ): [M] ⁺ calcd for C ₇₃ H ₇₇ FN ₆ O ₁₂ P: 1279.53; found : 1279.50.

Bo- Mt - CFX's synthesis

Compound 10 (200 mg, 0.156 mmol) was dissolved in 5 mL of a solvent mixture (anhydrous EA/DCM = 5/1) and stabilized at 0 °C. 5 mL of 1 N HCl in EA was added dropwise and stirred for 3 h. The reaction mixture was evaporated under reduced pressure at a temperature below 35° C., redissolved in dry DMF, and then added dropwise to compound 11 (93 mg, 0.234 mmol) dissolved in TEA (0.1 mL) in 10 mL of anhydrous DMF. The reaction was monitored by TLC and after completion the reaction mixture was evaporated under reduced pressure. The resultant was dissolved in 30 mL of DCM and washed 3 times with 30 mL of brine. The organic layer was Na ₂ SO ₄ After drying and filtration, the solution was evaporated and further purified by flash column chromatography (eluent: DCM/MeOH=92/8~88/12) to synthesize Bo-Mt-CFX.

¹ H NMR (CDCl ₃ , 500 MHz) δ 8.53 (s, 1H), 7.86-7.69 (m, 19H), 7.45-7.23 (m, 6H), 7.08-6.81 (m, 3H), 6.35-6.29 (m , 1H), 5.21-5.00 (m, 6H), 4.28 (t, J = 6.19 Hz, 1H), 3.82-3.75 (m, 2H), 3.75-3.47 (m, 8H), 3.28-3.20 (m, 4H) ), 3.20-3.02 (m, 3H), 3.02-2.89 (m, 3H), 2.41-2.35 (m, 3H), 1.76-1.65 (m, 6H), 1.58-1.50 (m, 2H), 1.48-1.40 (m, 2H), 1.34 (s, 12H) and 1.13 (br, 2H) ppm.;

¹³ C NMR (CDCl ₃ , 125 MHz) 186.1, 172.9, 165.6, 162.4, 156.4, 154.8, 154.7, 154.0, 153.7, 153.1 (d, J = 249), 149.7, 148.2, 145.5, 145.2, 144.1 (d, J = 10.8 Hz), 138.0, 136.0, 135.0 (d, J = 2.9 Hz), 134.8, 134.6, 134.0, 133.5 (d, J = 9.9 Hz), 131.5, 130.4 (d, J = 12.8 Hz), 127.0, 126.9 , 126.8, 126.6, 123.1 (d, J = 6.6 Hz), 118.2 (d, J = 86.2 Hz), 114.2, 112.7 (d, J = 23.5 Hz), 110.1, 106.5, 105.5, 101.2, 83.7, 79.7, 66.2 , 64.3, 62.5, 49.8, 47.0, 46.4, 43.6, 34.7, 29.6, 29.4 (d, J = 15.9 Hz), 27.9, 25.0, 24.8, 22.0, 22.0 (d, J = 50.9 Hz), 21.0, 8.2 ppm. ;

ESI-MS ( m/z ): [M] ⁺ calcd for C ₈₂ H ₈₆ BFN ₆ O ₁₄ P: 1440.61; found : 1440.40.

Experimental example

Material method and apparatus

All synthesis steps requiring anhydrous conditions were performed in flame-dried flasks flushed with argon gas, and a commercial anhydrous solvent (Alfa aesar, Sigma aldrich) was used. All reagents and solvents were purchased from Alfa Aesar, Sigma Aldrich, TCI Chemicals and used. Analytical thin-layer chromatography (TLC) was performed on a silica gel plate Merck 60 F254. Column chromatography purification was performed using silica gel 60 (particle size 0.040-0.063 mm) as a stationary phase. Column chromatography purification was performed using silica gel 60 (particle size 0.040-0.063 μm) as a stationary phase. ¹ H and ¹³ C NMR spectra were recorded on a Bruker NMR instrument. The chemical shift (δ) is reported in ppm and the coupling constant is expressed in Hz. HPLC analysis was performed using a YL9101S (YL-Clarity) instrument equipped with a reversed-phase column (C18, 5 mm, Waters). Acetonitrile for HPLC was purchased from JT Baker, deionized H ₂ O, and 0.1% THF was added. The eluent used in the analysis was a water-acetonitrile gradient (0-30 min; 0-100% acetonitrile) at a flow rate of 1.0 mL/min. A UV-vis detector (254, 550 nm) was used. Fluorescence and UV-Vis absorption spectra were recorded with Shimadzu RF-5301PC and Jasco V-750 spectrometers, respectively. ESI mass spectral analysis was performed using LC/MS-2020 series (Shimadzu). DMSO used for spectral and biological studies was purchased from Sigma-Aldrich (St. Louis, Mo, USA).

UV / Vis and Fluorescence spectroscopy

A 1 mM stock solution of Bo-Mt-CFX was prepared in DMSO and a 100 mM hydrogen peroxide stock solution was prepared in tertiary distilled water. A quartz cuvette with a volume of 4 mL was used for the experiment. All fluorescence emission spectra were obtained by excitation of the sample at 550 nm with a slit width of 5/5. For time course spectra, Bo-Mt-CFX (5 μM) was incubated with hydrogen peroxide (250 μM), λ _max (583 nm). For concentration-dependent spectral analysis, Bo-Mt-CFX (5 μM) was mixed with various concentrations of hydrogen peroxide (0, 1, 2.5, 10, 25, 50, 75, 100, 150, 250, 400, 500, 750, 1000 μM). treated with

Cell lines and reagents

Human cancer MDA-MB-231, A549, SW620, DU145 and PC3 cell lines and normal human fibroblast BJ cell lines were purchased from the Korea Cell Line Bank (Seoul, Korea). MDA-MB-231, SW620, DU145 and PC3 cells were cultured in RPMI 1640 medium, A549 cells were cultured in Modified Eagle's medium, and BJ cells were cultured in Dulbecco's modified Eagle's medium. All media were supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin (Welgene, Daegu, Korea).

Cell viability assay

Cells were seeded in 96 well plates at 4×10 ³ cells per well and allowed to attach for at least 24 hours. Cells were then treated with CFX, MT-CFX or 1% DMSO as controls and incubated for 72 hours. Cytotoxicity was measured in the presence of probes using the CytoTox96 ^® Non-Radioactive Cytotoxicity Assay Kit (Promega, USA) according to the manufacturer's instructions. Absorbance at 490 nm was measured with a SpectraMax Gemini EM microplate reader (Molecular Devices, USA). All experiments were performed in triplicate.

Assessing mitochondrial membrane potential

To evaluate mitochondrial membrane potential, MDA-MB-231 cells (1.5 × 10 ⁶ cells) were seeded in 60 mm dishes and treated with 10 μM MT-CFX for 0, 6, 12 and 24 h. After incubation, cells were stained with 2 mL of PBS solution containing 2 μM JC-1 (Thermo Fisher Scientific Inc., MA, USA) for 15 min at 37° C. under 5% CO ₂ , and then washed with PBS. The mitochondrial membrane potential of cells was excited at 530 nm and 585 nm band pass emission filters and 488 nm and FACS Calibur ^™ Quantitation was performed on a flow cytometer and analyzed using CELLQUEST ^™ software (BD Biosciences).

annexin V analysis

For the detection of apoptotic cells, Annexin V-FITC Early Apoptosis Detection Kit (BD Bioscience, USA) was used, and apoptotic cells were analyzed by FACSCalibur ^™ Quantitation on a flow cytometer and CELLQUEST ^™ The software was used to analyze.

BrDU analyze

Cells were seeded on Lab-Tek chamber slides (Merck Inc., NJ, USA) in DMEM containing 10% FBS. After 48 hours, the medium was changed to DMEM containing 50 mM CFX and MT-CFX. After 24 hours, 20 μM of BrdU was added to the medium and the cells were incubated for 4 hours. Cells were then washed with PBS, fixed in 4% PFA, incubated with BrdU antibody (1:100; sc-32323, santacruz, CA, USA), followed by Alexa Fluor-conjugated donkey anti-mouse antibody ( Thermo Fisher Scientific Inc., MA, USA) and diluted 1:200. Confocal microscopy images were obtained using an LSM 700 (Carl Zeiss).

ROS and mitochondrial peroxide analysis

To detect mitochondrial peroxide, cells were seeded in glass bottom dishes and then treated with Mt-CFX for 24 hours. After washing the cells twice with PBS, 5 μM MitoSOX ^TM at 37 °C for 15 min in the dark. Incubated with Red Mitochondrial Superoxide Indicator (Molecular Probes™, USA). To detect ROS, cells were seeded in glass bottom dishes and then treated with Mt-CFX for 24 hours. Cells were washed twice with PBS and then incubated with 10 μM CM-H2DCFDA (Invitrogen) at 37 °C for 30 min. After incubation, cells were washed twice with PBS. Fluorescence images were obtained using a confocal laser scanning microscope LSM 700 (Carl Zeiss MicroImaging, Inc.).

Analysis of oxidative damage to proteins, lipids and DNA

Protein carbonylation was measured by Protein Carbonyl ELISA Kit (Enzo Life Science), lipid peroxidation by Lipid Peroxixation MDA Assay Kit (Abcam), and 8-OHdG level by Oxiselect ^™ It was quantified with Oxidative DNA damage ELISA Kit (CellBioLabs, USA). All analyzes were performed according to the manufacturer's instructions.

intracellular localization (Subcellular localization) analysis

Cells were seeded on a glass bottom dish (SPL, Korea) and then treated with Mt-CFX. After 48 h, the cells were washed 3 times with PBS, and then mitochondria, lysosomes and ER (Endoplasmic reticulum) were treated with MitoTracker ^™ GreenFM, LysoTracker ^® GreenDND-26 and ER-Tracker ^® Green (BODIPYTMFLGlibenclamide) (Invitrogen, USA) were used for staining for 30 min. After incubation, cells were washed 3 times with PBS. Fluorescence images were obtained using a confocal laser scanning microscope LSM 700 (Carl Zeiss MicroImaging, Inc.).

Mitochondrial damage analysis

To detect mitochondrial genomic damage, cells were treated with Mt-CFX for 48 h, and genomic mitochondria were harvested using a mitochondrial isolation kit (Thermo Fisher Scientific, USA).

immune blotting analyze

Phosphorylated caspase 9 (9508), caspase 3 (9662), BCL-2 (sc-65392), BAX (sc-7480) and GAPDH (sc-47724), β-actin (sc-47724), cytochrome c ( sc-13156) and antibodies specific for COX IV (A21347) were used for immunoblot analysis. These were purchased from Signaling Technology (Massachusetts, USA), Santa Cruz Biotechnology (Texas, USA) or Invitrogen (Cambridge, UK). Briefly, adherent cells were washed 3 times with ice-cold PBS and scraped to collect the cell pellet. After removal of PBS, 50 mM Tris/HCl (pH 7.5), 150 mM NaCl, 0.1% sodium dodecyl sulfate (SDS), 1% Triton X-100, 1% sodium provided by the manufacturer (Up-State, USA) A radioimmunoprecipitation assay (RIPA) lysis buffer containing deoxycholate, a protease inhibitor mixture was added to the cell pellet to obtain a protein lysate. BCA analysis was performed to measure the protein concentration of each cell line, and then, the protein (30 μg/lane) of each cell line was loaded onto a sodium dodecyl sulfate polyacrylamide gel electrophoresis gel (SDS-PAGE) to separate the protein into bands. did The separated protein band was transferred to a polyvinylidene difluoride (PVDF) membrane (Merck Millipore, USA). Membranes were incubated with the antibody overnight at 4 °C. The resulting membrane was washed with Tween-20 (TBS-T), Tris-buffered saline, followed by anti-mouse mustard radish peroxidase (HRP)-conjugated secondary antibody (Santa Cruz Biotechnology; sc-2357) and anti-rabbit mustard. Peroxidase (HRP)-conjugated secondary antibody (GeneTex, Irvine, USA, GTX213110-01) was incubated for 2 hours at room temperature. To detect immunoreactive protein bands, enriched chemiluminescent reagents (Luminate, Merk Millipore) were used according to the manufacturer's instructions.

Separation of cytoplasmic and mitochondrial fractions

Separation of cytoplasmic and mitochondrial fractions was performed using the Mitochondria Isolation Kit (Thermo Scientific, USA). Briefly, cells were washed with cold PBS and lysed by 5-cycle freeze-thaw in Mitochondrial Dissociation Reagent A buffer containing 10 mM phenylmethylsulfonyl fluoride (PMSF). After incubation on ice for 10 min, mitochondrial dissociation reagent B buffer was added, and the lysate was treated with mitochondrial dissociation reagent C buffer, inverted, and centrifuged at 700 × g for 10 min. The supernatant was transferred to a new tube, centrifuged at 12000×g for 15 min at 4° C. and collected as the cytosolic fraction. After addition of 500 mL of mitochondrial isolation reagent C, the pellet was centrifuged at 12,000×g for 5 min and collected as the mitochondrial fraction.

mitochondria GSH measurement analysis

Mito-RealThhiol (MitoRT) for the detection of mitochondrial glutathione was purchased from the laboratory of Dr. Jin Wang of Baylor College of Medicine.

RNA extraction and real-time PCR analysis

Gene expression was quantified by the delta-delta-CT method, and real-time PCR was performed in a CFX-96 thermal cycler and detection system. Primers of each gene are shown in the table below.

RNA extraction and real-time PCR analyze

Total RNA from the cell line was purified using PureLink ^™ according to the manufacturer's instructions. It was isolated by Total RNA Isolation Kit (Invitrogen) and TRIzol Reagent (Invitrogen). iScript ^™ Reverse transcription into cDNA was performed using a cDNA synthesis kit (Bio-Rad Laboratories). All cDNAs used for real-time PCR were normalized to GAPDH. Quantitative real-time PCR was performed using iQTMSYBR Green Supermix (Bio-Rad Laboratories). Gene expression was quantified by the delta-delta-CT method, and real-time PCR was performed in a CFX-96 thermal cycler and detection system. Primers for each gene are shown in the table below.

Genes 5' sequences 3' sequences Nu-16sRNA GGG ATA ACA GCG CAA TCC TA CCT GGA TTA CTC CGG TCT GA Mt-ND1 ATA CCC CCG ATT CCG CTA CGA C GTT TGA GGG GGA ATG CTG GAG A ERCC1 CTA CGC CGA ATA TGC CAT CTC GTA CGG GAT TGC CCC TCT G DDB2 ACC TCC GAG ATT GTA TTA CGC C TCA CAT CTT CTG CTA GGA CCG POLg GCTGCACGAGCAAATCTTCG GTCCAGGTTGTCCCCGTAGA Taq1 control ACA GTT TAT GTA GCT TAC CTC C TTG CTG CGT GCT TGA TGC TTG Taq1 1216 AAC TGC TCG CCA GAA CAC TAC GGG CTA CAC CTT GAC CTA AC nuclear long PCR GAG GCA GGA CTC AGG ACA AG CTC CTC ACA TGC AGC TAC CA nuclear short PCR GAG GCA GGA CTC AGG ACA AG GGA TGC CTC AGG GAC CAG mito long PCR CGC CTC ACA CTC ATT CTC AA AAT GTA TGG GAT GGC GGA TA mito short PCR CGC CTC ACA CTC ATT CTC AA CAA GGA AGG GGT AGG CTA TG

Genes 5' sequences 3' sequences GTP2 GTG ATG GCA CTA TGC ACC TAC TTC ACG GAT GCA GTT GAC ACC ME1 CTG CTG ACA CGG AAC CCT C GAT CTC CTG ACT GTT GAA GGA AG ALDH2 ATG GCA AGC CCT ATG TCA TCT CCG TGG TAC TTA TCA GCC CA PCK2 GCC ATC ATG CCG TAG CAT C AGC CTC AGT TCC ATC ACA GAT ALDH1B1 CCC ATT CTG AAC CCA GAC ATC AAT GAC CTC CCC GGT GGT A SLC25A10 AGG ATG CAG AAC GAC GTG AAG GGT TGC ACC CGA GAA CAG TC DDIT4 TGA GGA TGA ACA CTT GTG TGC CCA ACT GGC TAG GCA TCA GC SESN2 TCT TAC CTG GTA GGC TCC CAC AGC AAC TTG TTG ATC TCG CTG MAP1LC3B AAG GCG CTT ACA GCT CAA TG CTG GGA GGC ATA GAC CAT GT MTHFD2 AGG ACG AAT GTG TTT GGA TCA G GGA ATG CCA GTT CGC TTG ATT A NLRP1 GCA GTG CTA ATG CCC TGG AT GAG CTT GGT AGA GGA GTG AGG CCL2 CAG CCA GAT GCA ATC AAT GCC TGG AAT CCT GAA CCC ACT TCT CCL8 TGG AGA GCT ACA CAA GAA TCA CC TGG TCC AGA TGC TTC ATG GAA TNFSF21 ATT GGC ACA TAC CGC CAT GTT GGC TTG TGT TGG TAC AAT GCT C GADD45A GAG AGC AGA AGA CCG AAA GGA CAC AAC ACC ACG TTA TCG GG

Semi-quantitative DNA- PCR analyze

DNA was separated with G-spin Total DNA Extraction Kit (INTRON Inc., Seongnam. Korea) and used as a template for PCR. Human GAPDH-specific primers (sense; 5'-AACCATGAGAAGTATGACAACAGC-3' and antisense; 5'-GAGTCCTTCCACGATACCAAA-3') and ND1-specific primers (sense; 5'-AATTCTCCGATCCGTCCCTA-3' and antisense; 5'-GCTTACTGGTTGTCCTCCGAT -3') and PCR was performed for 20-25 cycles. PCR products were analyzed using agarose gel electrophoresis and visualized in GelDoc (BioRad). Band intensities were measured on a densitometer and quantified with Quantity One Software (BioRad). Results were expressed as the ratio of ND1 band density to GAPDH band.

RNA for Microarray Analysis quality Check

RNA purity and integrity was assessed by ND-1000 spectrophotometer (NanoDrop, Wilmington, USA), Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, USA).

Affymetrix Whole Transcript Expression Array Method

The Affymetrix Whole Transcript Expression array process was performed according to the manufacturer's protocol (GeneChip Whole Transcript PLUS reagent Kit). cDNA was synthesized using the GeneChip WT (Whole Transcript) amplification kit. Then, the sense cDNA was fragmented and biotin-labeled with TdT (terminal deoxynucleotidyl transferase) using the GeneChip WT Terminal labeling kit. Approximately 5.5 μg of the labeled DNA target was hybridized to an Affymetrix GeneChip Human 2.0 array at 45° C. for 16 hours. Hybridized arrays were washed and stained on a GeneChip Fluidics Station 450 and scanned on a GCS3000 scanner (Affymetrix). Signal values were calculated using Affymetrix ^® GeneChip ^™ Command Console software.

for microarray low Data preparation and statistical analysis

Data were summarized and normalized by a robust multi-average (RMA) method implemented in Affymetrix ^® Power Tools (APT). Results were exported to gene level RMA analysis and differentially expressed gene (DEG) analysis was performed. Statistical significance of expression data determined fold change. For the DEG set, hierarchical cluster analysis was performed using complete linkage and Euclidean distance as measures of similarity. Gene enrichment and functional annotation analysis for important probe lists were performed using Gene Ontology (www.geneontology.org/) and KEGG (www.genome.jp/kegg/). All data analysis and visualization of differentially expressed genes were performed using R 3.3.3 (www.r-project.org).

animal research

Immunodeficient nude mice (nu/nu) mice (Orient Bio, Inc.) at 5 weeks of age were subjected to repeated controlled lighting conditions (12 h dark) with ad libitum access to sterile water and food (Cat no:1314Fort, ALTROMIN company, Germany). 12 h light) in a pressurized ventilated cage. All animal studies were approved by the Korea University Animal and Animal Care Committee and were conducted in accordance with the Korean Animal Protection Act. MDA-MB-231 cells (1 × 10 ⁶ ) in 50 μL PBS with 50 μL Matrigel ^® Basement Membrane Matrix (Corning, NY, USA) were injected subcutaneously into the flank of each nude mouse. When the tumor volume reached 100 mm ³ , mice were randomized into 3 treatment groups; vehicle control (DMSO), CFX, and MT-CFX (n = 4 per group). Mice were IV administered with CFX (0.5 μmol/kg/d), MT-CFX (0.5 μmol/kg/d), Bo-MT-CFX (0.5 μmol/kg/d) or vehicle (DMSO) once weekly for 3 weeks. (intravain). Tumor growth was monitored periodically, and tumor volume (V) was calculated using a modified ellipsoidal formula (V = 1/2 × length × (width) ² ), 12 weeks after treatment, animals were removed by CO ₂ asphyxiation. was euthanized. The xenograft tumor was excised and photographed. Each animal was thoroughly examined post-mortem to minimize the number and suffering of animals used.

in vivo (In in vivo ) and ex-vibo (ex in vivo ) Neon imaging

To evaluate the tumor target specificity and organ distribution of Bo-Mt-CFX in vivo and ex vivo, mice were subcutaneously injected with MDA-MB-231 cells. When tumor growth reached a detectable size, mice were treated with Bo-MT-CFX (0.5 μmol/kg/d) by one IV injection for 48 hours. Animals were euthanized via CO ₂ asphyxiation after one injection for 48 hours, 2 days of Bo-Mt-CFX treatment. The xenograft tumor was excised and photographed. In vitro fluorescence images of tumors and organs of control and injected mice were recorded and quantified using a Maestro2 instrument (excitation and emission wavelengths: 550 and 650 nm, respectively). Then, the fluorescence images and autofluorescence were deconvolved using the software provided with the instrument (Maestro software ver.2.4, CRi, MA, USA) using the multiple excitation spectral analysis function.

hepatotoxicity analyze

Blood samples from each mouse were centrifuged at 3,000 rpm for 10 minutes at 4°C to generate serum. ALT and AST activity in serum were then analyzed using AST and ALT activity assay kits (MAK055, MAK052, Sigma Aldrich) according to the manufacturer's instructions.

H&E dyeing

Tissues were extracted and embedded in frozen section compound (Lieca). Tumor sections (5 μm) were prepared using a Leica cryotome CM3050S, fixed on slides, and stored at -70°C. For H&E staining, slides were rehydrated and counterstained with Hematoxylin Gill's and 0.5% Eosin Y. Immunohistochemistry was performed according to standard protocols.

Experimental example result

(1) Figure 1 is a result showing the cell viability of TPP, CFX and MT-CFX in MDA-MB-231 cells (all data are expressed as mean ± SEM (n = 3)), Figure 2 is Mt-CFX treated Results showing the altered BrdU pattern in MDA-MB-231 cells.

Mt-CFX induces apoptosis in a mitochondrial membrane potential (MMP)-dependent manner. To increase the mitochondrial accumulation of CFX, the drug was derivatized with a triphenylphosphonium group bearing linker and this compound was named Mt-CFX. This compound strongly reduced cell viability in a dose-dependent manner in MDA-MB-231 cells with an IC ₅₀ or 31 μM, whereas the CFX or targeting group exhibited tens of fold greater IC ₅₀ values (Fig. 1). Additionally, BrdU incorporation assay also showed strongly reduced cell proliferation in the presence of Mt-CFX compared to CFX or controls (Fig. 2).

(2) Figure 3 shows the cell viability of MT-CFX in various cancer (A549, SW620, PC3 and DU145) and normal (BJ and MCF10A) cell lines (all experiments were performed in triplicate, all histograms are the mean ± SEM (n = 3)), and Figure 4 shows the mitochondrial membrane potential (MMP) of various cancer (MDA-MB-231, A549, SW620, PC3 and DU145) and normal (BJ) cell lines (according to the protocol). Cells were stained with JC-1 and analyzed on a BD FACS caliber ^™ ), JC-1 fluorescence is observed in both aggregates (red) and monomers (green). 5 shows Mt-CFX-induced mitochondrial disruption leading to apoptosis. After MT-CFX (30 μM) treatment of cells, mitochondria were found to be depolarizing MMPs in a time-dependent manner. The cells were then incubated with MT-CFX for 0 to 24 hours. Annexin V-positive apoptotic cells were analyzed. Cell viability was generally found to be of the same magnitude in cancer cell lines (MDA-MB-231, A549, SW620, DU145 and PC3), whereas toxicity was reduced by at least several fold in normal human fibroblast cell lines (BJ), and human mammary glands. It can be confirmed that the toxicity to breast cancer cells (MCF10A) is substantially low, and in conclusion, these results demonstrate that the activity of Mt-CFX is highly dependent on the mitochondrial accumulation of the drug in proportion to the MMP.

(3) Mt-CFX induces mitochondrial ROS generation with minimal nuclear DNA damage, and several antibacterial agents have previously been demonstrated to cause mitochondrial damage as a result of ROS, thus, ROS generation in MDA-MB-231 cells. The effect of Mt-CFX on

Figure 6 shows the mitochondrial ROS production induced by Mt-CFX in MDA-MB-231 cells, the hydrogen peroxide (H ₂ O ₂ ) level from cells treated with Mt-CFX (30 μM) using Amplex red. was determined, and mitochondrial-selective peroxide (O2 ^*- ) production and intracellular ROS production were detected with MitoSOX using confocal microscopy (all bar graph representations represent mean±SEM (n=3)).

As can be seen in FIG. 6 , intracellular Amplex red fluorescence strongly increased in Mt-CFX-treated cells, indicating an increase in H ₂ O ₂ production, and Mito-SOX fluorescence, a mitochondrial-selective peroxide fluorescent dye, in mitochondria. It clearly showed a large increase in ROS production, and the non-selective oxidative stress indicator further corroborated this result.

(4) Next, Figure 7 is a result showing the oxidative damage (oxidative damage) by Mt-CFX in MDA-MB-231 cells. Oxidative damage was measured in MDA-MB-231 cells after 48 hours of treatment with Mt-CFX (30 μM) and CFX (30 μM). Oxidative DNA damage was evaluated by measuring the abundance (abundance) of 8-OHdG. Oxidative protein damage, protein carbonylation, was detected using enzyme-linked immunosorbent assay (ELISA). Lipid peroxidation was assessed by measuring MDA. All bar graph displays represent mean ± SEM (n = 3).

Significant increases in malondialdehyde (MDA) levels as a measure of protein oxidation, 8-hydroxy-2'-deoxyguanosine (8-OHdG) concentrations as end products of lipid peroxidation, and marker-free protein carbonylation found This clearly suggests that Mt-CFX significantly enhances oxidative stress levels by interfering with the mitochondrial ETC process.

(8) Cytoplasmic protein metabolism was investigated by monitoring the expression levels of nuclear (GAPDH) and mitochondrial (ND1) proteins along with doxorubicin (DOXO), the major mechanism by which ROS production is based on the activity of clinically approved drugs. . Figure 8 shows genomic DNA q-PCR of nuclear GAPDH and mitochondrial ND1 (Mt-CFX (30 μM), CFX (30 μM) and doxorubicin (30 μM) were treated in MDA-MB-231 cells, all histograms are mean ± SEM (n = 3)). DOXO clearly showed a decrease in GAPDH expression levels, but less pronounced for Mt-CFX. Conversely, DOXO-treated cells showed only a weak decrease in ND1-expression, whereas Mt-CFX clearly disrupted mitochondrial function ( FIG. 8 ). In addition, Mt-CFX significantly reduced ND1/GAPDH expression levels in a dose- and time-dependent manner, with a small decrease in the mitochondrial/nuclear expression level ratio observed.

(9) Figure 9 shows the expression levels of DNA repair genes (DDB2, ERCC1 are involved in nucleotide excision repair (NER), and POLg is involved in mitochondrial-specific base excision repair, Mt-CFX (30) using real-time PCR μM), CFX (30 μM) and doxorubicin (30 μM) to MDA-MB-231 cells).

Oxidative lesions on DNA induce repair enzyme expression in both the nucleus and mitochondria, primarily base-excision repair (BER), whereas nucleotide excision repair (NER) is also involved in nuclear DNA repair. Therefore, the expression level of POLG encoding a mitochondrial-selective base excision repair protein was investigated using rt-PCR and found to be significantly increased after incubation with Mt-CFX ( FIG. 9 ). On the other hand, DOXO induced a clear upregulation of NER for both ERCC1 and DDB2, whereas Mt-CFX induced only weak or significantly increased expression levels. Under these conditions, CFX alone could not induce sufficient oxidative damage to cause upregulation of any repair enzymes.

(10) Figure 10 shows Mt-CFX (30 μM) induced mitochondrial DNA mutations, all histogram representations represent mean ± SEM (n = 3). TaqI restriction site mutation assay was used to measure the extent of drug-induced mitochondrial DNA mutations, where restriction enzymes cut double-stranded 5'-TCGA-3' DNA sequences to induce DNA degradation, whereas restriction enzyme-resistant sites were PCR amplified. go through Mt-CFX-treated cells showed an approximately 4.5-fold increase in resistance to TaqI restriction, whereas significantly lower amounts of TaqI resistance were observed for DOX-treated cells ( FIG. 10 ).

(11) Figure 11 shows long range genomic DNA q-PCR (nucleus: 3129 bp, mitochondrial: 3723 bp) (MDA-MB-231 cells were treated with Mt-CFX (30 μM), doxorubicin (DOXO) (30 μM) ), temozolomide (TMZ) (1 μM), camptothecin (CPT) (250 nM), cis-platin (CDDP) (3 μM), clorambucil (CLB) (50 μM) and fluorouracil (5-FU) (30 μM) treated with , concentration was selected based on IC ₅₀ , all histogram displays represent mean ± SEM (n = 3).

Several common chemistries including doxorubicin (DOXO), temozolomide (TMZ), camptothecin (CPT), cis-platin (CDDP), clarambucil (CLB) and fluorouracil (5-FU) The location of the predominant DNA mutagenicity for Mt-CFX with therapeutic drugs was investigated. qPCR (3129 bp and 3723 bp for nuclear and mitochondrial targets, respectively) showed that both conventional drugs induce significant amounts of nuclear DNA mutations while being harmless to the mitochondrial genome. On the other hand, the opposite results were found for Mt-CFX, showing a large tendency to induce mitochondrial DNA damage, but not for nuclear DNA.

This clearly means that Mt-CFX induces significantly increased levels of ROS production in the mitochondrial compartment, leading mainly to mitochondria but not nuclear DNA damage.

(12) Figure 12 shows the results of gene expression analysis of Mt-CFX, (A) is a heat map showing the relative expression level of DEG (differentially expressed gene), (B) is the KEGG pathway of 197 DEGs Reinforcement analysis results are shown.

Identification of cellular processes affected by Mt-CFX was performed by micro DNA array analysis. A DNA sequence comprising 197 genes clearly shows a significant effect of Mt-CFX supplementation on protein expression (Fig. 12).

Most notably, several pathways involved in programmed cell death, such as apoptosis, ferroptosis, and necroptosis, as well as the biosynthesis and metabolism of amino acids, fatty acids and pyruvate are significantly altered.

(13) Figure 13 shows the results of real-time PCR evaluation of a subset of metabolic-related pathway genes showing differential expression in the control group, Mt-CFX and CFX, and Figure 14 shows the differential expression in the control group, Mt-CFX and CFX. It shows the real-time PCR evaluation result of a subset of the aldehyde dehydrogenase gene shown, and FIG. 15 shows the real-time PCR evaluation result of a subset of the ROS danage gene showing differential expression in the control group, Mt-CFX and CFX. , Figure 16 shows the results of real-time PCR evaluation of a subset of cellular component damage genes showing differential expression in the control group, Mt-CFX and CFX.

Selected examples of gene expression levels were analyzed as shown in FIGS. 13 to 16 below using RT-qPCR, and cell metabolism was strongly influenced by Mt-CFX, transaminase, pyruvate synthesis, and folate metabolic pathway (GPT2 , ME1 and MTHFD2) demonstrated increased expression. We also found that several ROS-induced cellular responses were upregulated in the presence of Mt-CFX. As a result of increased protein carbonylation, two mitochondrial aldehyde dehydrogenases (ALDH2 and ALDH1B1) were significantly overexpressed to ameliorate this form of ROS damage. GADD45A, encoding a protein involved in stimulating DNA excision repair and inducing cell cycle arrest, was approximately 12-fold overexpressed. In addition, approximately 20-fold overexpression of NLRP1 suggests the presence of damaged cellular structures and induction of NLRP1 inflammation. DDIT4 involved in mTORC1 inhibition and autophagy activation and SESN2 are about 40-fold and about 23-fold overexpressed, respectively, clearly indicating the need for degradation of damaged cellular components, MAP1LC3B Overexpression has shown degradation of damaged mitochondria and can lead to mitophagy and feroptosis.

(14) The following FIG. 29 shows the mechanism of Bo-Mt-CFX, which synthesizes a small molecule therapeutic drug delivery system (DDS) incorporating Mt-CFX, which is named Bo-Mt-CFX. This type of small molecule DDS system enables accurate spatiotemporal analysis of drug action in vivo, where phenylboronate is selected as a DDS trigger in view of increased ROS production in cancer tissues. As can be seen in the synthesis mechanism scheme of Figure 29, the peroxide-triggered drug release induces the release of drug and fluorophore (resorufin) as well as 3 equivalents of quinonemethide susceptible to nucleophilic attack.

(15) FIG. 17 shows the fluorescence response of Bo-Mt-CFX by reaction to H ₂ O ₂ with drug release (H ₂ O ₂ The fluorescence of Bo-Mt-CFX (5 μM) increased in a time-dependent manner upon treatment with (250 μM), H ₂ O ₂ Upon treatment, the fluorescence of Bo-Mt-CFX (5 μM) increased in a dose-dependent manner (0 to 1500 μM). FIG. 18 shows the HPLC analysis of resorufin release. The peroxide-triggered drug release of the resorufin fluorophore in Bo-Mt-CFX was validated in solution by observing a characteristic fluorescence band centered at 580 nm, and a clear time-dependent reaction with a half-life of about 6000 s was observed in H ₂ O ₂ observed in the presence of 50 equivalents (Fig. 17).

In addition, similarly a concentration-dependent effect was also observed ( FIG. 17 ) and confirmed that the fluorescence source was resorufin ( FIG. 18 ), as evidenced by time-dependent HPLC analysis.

(16) Figure 19 shows the cell viability of Bo-MT-CFX in various cancer (MDA-MB-231, A549, SW620, PC3 and DU145) and normal (BJ) cell lines (experiment performed in triplicate, all bars) Graph display shows mean±SEM (n=3)), FIG. 20 shows mitochondrial-dependent apoptosis induced by Bo-Mt-CFX in MDA-MB-231 cells ((a) Bo-Mt-CFX treatment Annexin V-positive apoptotic cells from the old cells were analyzed by flow cytometry, (b) cytoplasmic and membrane fractions were isolated and analyzed by Western blotting).

As a result of confirming the effect of the DDS system on cancer selectivity, it was confirmed that Bo-Mt-CFX maintained a high level of selectivity for cancer cells compared to BJ cells. Noteworthy here is that Bo-Mt-CFX has higher cytotoxicity than Mt-CFX. Cell viability assay was performed on different cancer cells (A549, SW620, DU145, PC3), and although there was a slight difference in viability, it was generally effective against various cancer cells (Fig. 19).

In addition, as a result of confirming the induction of apoptosis and apoptosis in cells treated with Bo-Mt-CFX using AnnexinV/PI cell flow cytometry, the addition of Bo-Mt-CFX to MDA-MB-231 cells activates the caspase pathway. was clearly shown, and a dose-dependent cytoplasmic rearrangement of cytochrome c was observed (FIG. 20).

(17) Figure 21 shows the activation of Bo-Mt-CFX in ROS, (a) treated with various concentrations of compound 10 in the MDA-MB-231 cell line, (b) viability upon treatment with ROS inducers and ROS quenchers shows a clear difference in

As a result of confirming the dependence of the activity of Bo-Mt-CFX on the intracellular ROS content, the addition of lipopolysaccharide (LPS) or N-acetylcysteine (NAC), which are activators and quenchers of intracellular ROS, respectively, decreased the cell viability. decreased and increased ( FIG. 21 ), and the importance of ROS-triggered drug release was further confirmed using probes without self-inserted trigger (Compound 10), indicating a greatly reduced effect on cell viability.

(18) FIG. 22 relates to the self-amplification effect of Bo-Mt-CFX (10 μM), and shows Bo-Mt-CFX fluorescence with or without pretreatment with Mt-CFX (10 μM). The cellular response to ROS is moderated by shifting the GSH/GSSG redox balance, whereas quinonemethhydrides have previously been shown to be detoxified by covalent GSH conjugation. Therefore, as a result of examining how intra-mitochondrial GSH levels respond to incubation with Bo-Mt-CFX, using a mitochondrial-selective fluorescent GSH sensor, total mitochondrial GSH levels were higher than that of cells supplemented with Mt-CFX. It was confirmed that the mounted cells were more depleted ( FIG. 22 ). This could be the result of quinonemethide production upon activation of Bo-Mt-CFX, and this large depletion of GSH levels also supports a stronger reduction in cell viability of DDS compared to Mt-CFX.

(19) Figure 23 shows the mitochondrial GSH level measured by MitoRT upon activation of Bo-Mt-CFX. Since drug activation of Bo-Mt-CFX is consequently dependent on intracellular ROS generation, the probe exhibits a self-amplifying effect. After a delay time of about 8 hours, a sigmoid time-dependent fluorescence enhancement is observed for MDA-MB-231 cells incubated with Bo-Mt-CFX (10 μM). Addition of Mt-CFX (10 μM) to Bo-Mt-CFX (10 μM) shortened the delay time and a dramatic increase in fluorescence was observed after only 2 hours ( FIG. 23 ).

(20) Figure 24 shows intracellular co-localization of Bo-Mt-CFX in MDA-MB-231 cells (cells were washed with PBS before recording fluorescence images and Mito-, Lyso- and ER trackers green FM was added), Figure 25 shows the intracellular uptake of Bo-MT-CFX (MDA-MB-231 cells were incubated with 10 μM of Bo-Mt-CFX for 8 hours, cells before recording fluorescence images). was washed with PBS and Mito-tracker green FM was added). The release of fluorophores from Bo-Mt-CFX was confirmed to occur in mitochondria (Fig. 24), indicating that the intracellular fate of Mt-CFX was maintained in the DDS system and mitochondrial localization was maintained for at least 8 h (Fig. 25). . These results clearly suggest that the incorporation of Mt-CFX into Bo-Mt-CFX for drug activation does not change the mode of action of the drug after its release while allowing visualization.

(21) Figure 26 shows the in vivo and in vitro imaging results and tumor sedimentation effect of Mt-CFX and Bo-Mt-CFX in the MDA-MB-231 xenograft mouse model, (a) is Bo-Mt-CFX shows in vivo images of MDA-MB-231 xenograft mice 1 to 48 hours after tail vein injection, and (b) shows ex vivo images of various organs taken 48 hours after intravenous injection of Bo-Mt-CFX. indicates. (c) and (d) show the tumor volume (c) and body weight (d) of the control group, CFX, Mt-CFX and Bo-Mt-CFX-treated mice, respectively. (e) shows a representative image of the MDA-MB-231 xenograft tumor.

As a result of examining the in vivo activity of Mt-CFX and Bo-Mt-CFX in MDA-MB-231 tumor xenograft-bearing mice, Bo-Mt-CFX was administered to the tail vein of the mouse, and the in vivo fluorescence was derived from the tumor site. was confirmed, and the localization lasted more than about 48 hours (Fig. 26 (a)). This selectivity was further confirmed ex vivo in organs obtained from euthanized mice 48 h after Bo-Mt-CFX treatment. While almost all fluorescence was localized to the tumor site, other organs, particularly the heart and the reticuloendothelial system, remained unaffected (Fig. 26(b)).

(22) Figure 27 shows the weight of xenografted mouse tumors in vivo and AST and ALT activity levels of mice in control, Mt-CFX, CFX and Bo-Mt-CFX sera (White; control, Purple; CFX, Cyan; Mt-CFX, Red; Bo-Mt-CFX).

After 5 weeks, the results of significantly reduced tumor growth in the mice treated with Bo-Mt-CFX and Mt-CFX were confirmed, and the experiment was terminated at 12 weeks when the tumors of the control group reached 1000 mm 3 . The in vivo experimental results are clearly confirmed in the resected tumor weights (Fig. 26 c, d, e). The liver function test at the end of the experiment showed that the ALT level was slightly increased in the non-control sample, but it was confirmed that the total AST and ALT ratios of all mice were within the normal range ( FIG. 27 ).

(23) Figure 28 shows the results of H&E staining and immunohistochemistry experiments. The tumor removal effect was further confirmed by H&E staining, and in the case of Mt-CFX and Bo-Mt-CFX treatment, there was a clear decrease in blue nuclei and an increase in the level of cleaved caspase 3. It can be seen that the cell proliferation is clearly reduced upon treatment with Mt-CFX and Bo-Mt-CFX ( FIG. 28 ).

As discussed above, in the present invention, Mt-CFX is presented as a mitochondrial targeted chemotherapeutic drug, and Mt-CFX and the corresponding small molecule DDS Bo-Mt-CFX are used for other large cation-containing fluorophores, drugs and DDS. As demonstrated previously, it exhibits excellent intrinsic selectivity for cancer cells.

Mt-CFX and Bo-Mt-CFX interfered with mitochondrial ETC, significantly enhancing the level of ROS, leading to protein carbonylation, lipid peroxidation and oxidative DNA damage, and enhanced effects on Bo-Mt-CFX in vitro. .

Importantly, Mt-CFX caused a sharp reduction in nuclear DNA damage compared with DOX, TMZ, CPT, CDDP, CLB and 5-FU. In particular, it was confirmed that Mt-CFX and Bo-Mt-CFX treatment significantly reduced cancer growth rate, and decreased mitochondrial GSH levels in Bo-Mt-CFX significantly increased drug efficacy in vitro.

Several classes of antibiotics have been shown to cause mitochondrial damage, which is consistent with the mitochondrial endogenous vascular hypothesis, and ciprofloxacin has shown one of the most prominent mitochondrial effects, suggesting that the toxic side effects of these classes of antibiotics are likely to be high. considered to be one of the main causes. Despite recent attention to fluoroquinolone drug safety issues, this class of drugs remains one of the most commonly prescribed drugs in the clinic. It has been found that Mt-CFX not only lowers the rate of drug-induced cancer recurrence, but overall it can cause fewer serious side effects than current chemotherapeutic agents.

Therefore, it was confirmed through the present invention that targeting mitochondrial DNA in order to overcome cancer recurrence by preventing drug-induced nDNA lesions is an important direction in the research and development of small molecule cancer drugs.

Claims (9)

A modified antibiotic anticancer compound represented by the following [Formula 1]:
[Formula 1]

In the [Formula 1], R is represented by the following [Structural Formula 1],
[Structural Formula 1]

In the [Structural Formula 1],
D is a fluoroquinolone antibiotic and is linked to X,
X is any one selected from O, S and NR ₄ , wherein R ₄ is any one selected from hydrogen, an alkyl group having 1 to 30 carbon atoms, an aryl group having 6 to 30 carbon atoms, and a heteroaryl group having 2 to 30 carbon atoms, and ,
L is any one selected from an alkyl group having 1 to 30 carbon atoms, an alkenyl group having 2 to 30 carbon atoms, and a polyalkylene glycol group,
Q is any one selected from N. P, As and Sb,
R ₁ to R ₃ are the same or different from each other, and each independently selected from an alkyl group having 1 to 30 carbon atoms, an alkenyl group having 2 to 30 carbon atoms, an aryl group having 6 to 30 carbon atoms, and a heteroaryl group having 2 to 30 carbon atoms is one,
A ^- is any one anion selected from halogen, hydroxyl, carboxylate, sulfate, sulfurmate, sulfonate, phosphate, phosphonate, boronate and (poly)ethyleneoxy. According to claim 1,
D is a fluoroquinolone-based antibiotic, flumequine, oxolinic acid, rosoxacin, cinoxacin, nalidixic acid, piromidic acid) , pipemdic acid, ciprofloxacin, fleroxacin, lomefloxacin, nadifloxacin, norfloxacin, ofloxacin, pefloxacin pefloxacin, rufloxacin, enoxacin, balofloxacin, grepafloxacin, levofloxacin, pazufloxacin, sparfloxacin sparfloxacin, temafloxacin, tosufloxacin, clinafloxacin, gatifloxacin, moxifloxacin, sitafloxacin, sitafloxacin (prulifloxacin), besifloxacin, gemifloxacin, trovafloxacin, delafloxacin, danofloxacin, difloxacin (difloxacin) A modified antibiotic anticancer compound, characterized in that it is any one selected from enrofloxacin, ibafloxacin, marbofloxacin, orbifloxacin and sarafloxacin. According to claim 1,
The [Structural Formula 1] is a modified antibiotic anticancer compound, characterized in that any one selected from the following compounds:

In the above compound, the definition of A ⁻ is the same as the definition in claim 1, and n is an integer of 1 to 30. The method of claim 1,
The [Formula 1] is a modified antibiotic anticancer compound characterized in that it selectively targets the mitochondria of cancer cells. The method of claim 1,
The [Formula 1] is a modified antibiotic anticancer compound, characterized in that it inhibits the mitochondrial electron transport system (ETC) function of cancer cells, and inhibits mitochondrial DNA synthesis. A pharmaceutical composition for the prevention and treatment of cancer diseases containing the modified antibiotic anticancer compound or a salt thereof as an active ingredient according to [Formula 1] according to claim 1. 7. The method of claim 6,
The pharmaceutical composition is a pharmaceutical composition for the prevention and treatment of cancer diseases, characterized in that selectively targeting the mitochondria of cancer cells. 7. The method of claim 6,
The pharmaceutical composition inhibits the mitochondrial electron transport system (ETC) function of cancer cells, and a pharmaceutical composition for the prevention and treatment of cancer diseases, characterized in that it inhibits mitochondrial DNA synthesis. 7. The method of claim 6,
The cancer disease is a pharmaceutical composition for the prevention and treatment of cancer diseases, characterized in that any one selected from breast cancer, lung cancer, colorectal cancer, prostate cancer and metastatic cancer thereof.

Images