KR102360077B1 - Composition for Improving Skin Comprising Exosomes Isolated from Umbilical Cord Derived Mesenchymal Stem Cell - Google Patents

Abstract

The present invention relates to a cosmetic composition or a pharmaceutical composition including an exosome isolated from umbilical cord-derived mesenchymal stem cells as an active ingredient, which exhibits injury alleviation, wrinkle improvement, regeneration, increased elasticity, moisturizing, barrier strengthening, anti-inflammatory or whitening effect, thereby being usefully used for a cosmetic composition for skin improvement, prevention of inflammatory skin disease, or a pharmaceutical composition.

Description

Cosmetic composition for improving skin comprising exosomes isolated from umbilical cord-derived mesenchymal stem cells {Composition for Improving Skin Comprising Exosomes Isolated from Umbilical Cord Derived Mesenchymal Stem Cell}

It relates to a cosmetic composition for skin improvement comprising exosomes isolated from umbilical cord-derived mesenchymal stem cells as an active ingredient.

Stem cells are known to be involved in biological actions through regulation of the micro-environment of damaged tissues, such as promotion of neovascularization, inhibition of inflammation, and immune regulation in the human body. These biological actions are caused by the secretion of various growth factors, cytokines, proteins constituting the extracellular matrix, and antioxidant proteins from mesenchymal stem cells that promote the protection and regeneration of damaged tissues. do. This is called the paracrine effect.

Exosomes are lipid-bilayered vesicles and contain various types of substances such as proteins, lipids, and nucleic acids present inside the parent cell, and are known to play a very important role in information transfer between cells. In particular, exosomes isolated from stem cells are attracting attention as an alternative that can overcome various disadvantages of cell therapeutics because they are cell-free while retaining the therapeutic efficacy of stem cells. Unlike cells, exosomes are not capable of self-replication, so the risk of tumor formation is very low, and they have the advantage of being safe because they do not induce an immune response. In addition, since the exosomes are much smaller compared to the cell size of 10,000 nm to 20,000 nm, administration is possible without the risk of embolism, a potential risk factor for cell therapeutics.

On the other hand, Korean Patent Publication No. 10-2019-0003336 discloses the use of adipose stem cell-derived exosomes for treating dermatitis, and Korean Patent No. 10-1663912 discloses exosomes derived from human adipose-derived stem cells. Although disclosed for the use of skin whitening, wrinkle improvement or regeneration, exosomes isolated from umbilical cord (umbilical cord)-derived mesenchymal stem cells are used for wound relief, wrinkle improvement, regeneration, elasticity increase, moisturizing, barrier strengthening, and anti-inflammatory It is not known about the skin improvement effect.

An object of the present invention is to provide a cosmetic composition for skin improvement that exhibits a skin improvement effect through wound relief, wrinkle improvement, regeneration, elasticity increase, moisturizing, barrier strengthening, anti-inflammatory or whitening.

Another object is to provide a pharmaceutical composition for preventing or treating inflammatory skin disease.

In order to achieve the above object, one aspect provides a cosmetic composition for improving skin comprising an exosome isolated from umbilical cord (umbilical cord)-derived mesenchymal stem cells as an active ingredient.

The term "umbilical cord" may refer to the cord that connects the mother and the abdomen so that the fetus of a mammal can grow in the placenta, and is usually surrounded by three blood vessels, ie, two umbilical cords, surrounded by Wharton's jelly. It may refer to a tissue composed of an artery and one umbilical vein, and is also called an umbilical cord.

The term "mesenchymal stem cells" exists in cartilage, bone tissue, adipose tissue, bone marrow stroma, etc. differentiated from mesoderm generated by division of a fertilized egg, and may refer to stem cells having multipotent ability. .

The term "Umbilical Cord Derived Mesenchymal Stem cells" is derived from the umbilical cord or Wharton's jelly tissue of the umbilical cord, and has the ability to differentiate into various cells such as osteoblasts, chondrocytes, muscle cells, and adipocytes. Eggplant may mean a cell.

The term "exosome" may refer to nano-sized particles that are naturally secreted by being packaged in a lipid bilayer in living cells, and serve as information transfer between cells and an endoplasmic reticulum having a composition similar to that of an exosome ( It may be a concept including all of the extracellular vesicles, microvesicles, multivesicular vesicles, exosome-like endoplasmic reticulum, etc.).

The size of the exosome is known to be approximately 30 nm to 250 nm in diameter, and although there is a slight difference depending on the type of cell of origin, the exosome membrane contains surface proteins (surface markers) such as CD9, CD63, and CD81, It is known that exosomes contain proteins such as TSG101 and ALIX that can prove the origin of endosomes inside the exosomes. In addition, it contains proteins including growth factors and cytokines having various functions, and nucleic acids such as mRNA and miRNA, and has components and efficacy that reflect the characteristics of the cell of origin. In particular, stem cell exosomes are known to have effects such as regulating stem cell differentiation, regeneration, growth promotion, and induction of a specific immune response, so the development of therapeutic agents using the same is being actively performed.

In one embodiment, it is possible to isolate the exosomes from the umbilical cord-derived mesenchymal stem cell culture medium. Accordingly, the exosomes isolated from the umbilical cord-derived mesenchymal stem cells may include the exosomes isolated from the umbilical cord-derived mesenchymal stem cell culture medium, and is also called umbilical cord-derived mesenchymal stem cell exosomes.

The exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells are activin A, adiponectin/Acrp30, angiopoietin-2, Angiopoietin-like 1, angiostatin, A Proliferation-Inducing Ligand (APRIL), Bcl2 associated X protein (BAX), Bone Morphogenetic Protein (BMP)-3, bone morphogenetic protein receptor (BMPR)-IB/ALK (Anaplastic lymphoma kinase)-6, CC chemokine receptor (CCR) ; CC chemokine receptor)7, CCR8, CCR9, CTACK/CCL27 (CC motif chemokine ligand 27), CXCR1 (CXC chemokine receptor type 1)/IL-8 RA (Interleukin 8 receptor, alpha), CXCR2/IL-8 RB ( Interleukin 8 receptor, beta), EDA (Ectodysplasin A)-A2, EMAP (Endothelial monocyte-activating polypeptide)-II, Endothelin, FGF R (fibroblast growth factor receptor)4, FGF- 9, GDF (Growth Differentiation Factor)3, HB-EGF (Heparin-binding EGF-like growth factor), HGF (hepatocyte growth factor; hepatocyte growth factor), IGFBP-rp (Insulin-like growth factor-binding protein related protein; 1/IGFBP-7, IGF-I SR (Anti-Insulin-like Growth Fac) tor-I Receptor), IL-1 ra, IL-4 R, IL-29, Kremen-1, Lck, Latent TGF-beta bp (tumor growth factor beta binding protein) 1, M-CSF (Macrophage colony) -stimulating factor; macrophage colony stimulating factor), macrophage-derived chemokine (MDC), neutrophil activating protein (NAP)-2, TGF-beta 5, Thrombospondin-1, Thrombospondin- 2, thioinosine monophosphate (TIMP)-1, TIMP-2, TRADD (Tumor necrosis factor receptor type 1-associated DEATH domain protein; tumor necrosis factor receptor type 1-associated death domain protein), or a combination thereof. . For example, the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells are 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, or all proteins.

As a result of analyzing cetochrome in one embodiment, the exosomes isolated from the umbilical cord-derived mesenchymal stem cells may include the above 40 kinds of proteins.

The exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells are Adiponectin/Acrp30, Angiopoietin-2, Angiopoietin-like 1, Angiostatin, APRIL, BAX, BMPR-IB/ALK-6, CCR7, CCR9, CTACK/CCL27 , CXCR1/IL-8 RA, CXCR2/IL-8 RB, Endothelin, FGF-9, HB-EGF, IGFBP-rp1/IGFBP-7, IL-1 ra, IL-4 R, IL-29, M-CSF , may include one or more proteins selected from the group consisting of TGF-beta 5, Thrombospondin-1 and Thrombospondin-2.

The exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells are Activin A, BMPR, which are not components of the umbilical cord (umbilical cord)-derived mesenchymal stem cell culture medium prepared by the method disclosed in Korean Application No. 10-2020-0180918 -Consisting of -IB/ALK-6, EMAP-II, HGF, IL-1 ra, IL-4 R, IL-29, Kremen-1, Lck, Latent TGF-beta bp 1, TGF-beta 5 and Thrombospondin-2 It may include one or more proteins selected from the group.

The exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells are hsa-let-7e-5p, hsa-let-7d-5p, hsa-miR-1273g-3p, hsa-miR-6089, hsa-miR- 3665, hsa-miR-151a-5p, hsa-miR-1275, hsa-miR-3656, hsa-miR-6125, hsa-miR-127-3p, hsa-miR-455-3p, hsa-miR-2115- 5p, hsa-let-7f-5p, hsa-miR-8069, hsa-miR-1915-3p, hsa-miR-21-5p, hsa-miR-6849-5p, hsa-miR-297, hsa-miR- 7844-5p, hsa-miR-4701-3p, hsa-miR-670-5p, hsa-miR-595, hsa-miR-483-5p, hsa-miR-6870-5p, hsa-miR-6800-5p, hsa-miR-409-3p, hsa-miR-6724-5p, hsa-miR-3064-5p, hsa-miR-4281, hsa-miR-3148, hsa-mir-1908, hsa-miR-6816-5p, hsa-miR-4463, hsa-miR-7108-5p, hsa-miR-4481, hsa-miR-6883-5p, hsa-miR-126-3p, hsa-miR-7114-5p, hsa-miR-7977, hsa-miR-146a-5p, hsa-miR-125a-5p, hsa-miR-214-5p, hsa-miR-122-5p, hsa-miR-210-3p, hsa-miR-34a-3p, hsa- miR-223-3p, hsa-miR-4665-5p, hsa-miR-21-3p, hsa-miR-198, hsa-miR-137, hsa-miR-211-3p, hsa-miR-192-5p, one or more miRNAs selected from the group consisting of hsa-miR-18a-3p, hsa-miR-140-5p, hsa-miR-138-1-3p, hsa-miR-221-5p and hsa-miR-204-3p may contain. For example, the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells are 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, among the 57 types of miRNAs. 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, or all miRNAs.

In one embodiment, the components of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes were automatically extracted from the Affymetrix data extraction protocol using software provided by Affymetrix GeneChip® Command Console® Software (AGCC). may contain miRNA.

The exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells are hsa-let-7e-5p, hsa-let-7d-5p, hsa-miR-1273g-3p, hsa-miR-6089, hsa-miR- 3665, hsa-miR-151a-5p, hsa-miR-1275, hsa-miR-3656, hsa-miR-6125, hsa-miR-127-3p, hsa-miR-455-3p, hsa-miR-2115- 5p, hsa-let-7f-5p, hsa-miR-8069 and hsa-miR-1915-3p may contain one or more miRNAs selected from the group consisting of.

The exosomes isolated from the umbilical cord-derived mesenchymal stem cells are from the group consisting of has-let-7e-5p, has-let-7d-5p, has-miR-3665, has-miR-3656 and has-miR-6089. It may contain one or more miRNAs of choice.

The skin improvement may be wound relief, wrinkle improvement, regeneration, elasticity increase, moisturizing, barrier strengthening, anti-inflammatory or whitening.

The cosmetic composition can relieve the wound by restoring the wound of the skin cells.

The cosmetic composition may exhibit the effect of improving skin wrinkles, regenerating or increasing elasticity by promoting the proliferation of skin cells.

The cosmetic composition may exhibit the effect of improving skin wrinkles, regenerating or increasing elasticity by promoting the synthesis of proteins constituting the extracellular matrix of skin cells.

The protein constituting the extracellular matrix may be collagen, elastin or fibronectin.

The cosmetic composition may exhibit the effect of moisturizing the skin by promoting the synthesis of hyaluronic acid.

In particular, the cosmetic composition can increase the expression level of HAS2 or HAS3 gene among hyaluronic acid synthase (HAS).

The cosmetic composition may exhibit the effect of the skin barrier by promoting the synthesis of Loricrin or Filaggrin. Lorricrin is one of the proteins constituting the keratin of the skin, is rich in glycine, serine, and methionine, and is known to be involved in the strengthening of the skin barrier. Filaggrin is a moisturizing component contained in keratinocytes constituting the skin barrier, and is known to be involved in the normalization of pH of the stratum corneum or anti-inflammatory action.

The term “hyaluronic acid (HA)” is a high molecular compound composed of N-acetylglucosamine and glucuronic acid, and may refer to a factor that helps to moisturize the skin.

The cosmetic composition may exhibit an anti-inflammatory effect by inhibiting the generation of nitric oxide (NO) generated during an inflammatory reaction.

The cosmetic composition may exhibit a skin whitening effect by inhibiting melanin production.

The exosomes isolated from the umbilical cord-derived mesenchymal stem cells may have a size of about 30 to 250 nm.

The exosomes isolated from the umbilical cord-derived mesenchymal stem cells are i) positive for one or more surface antigens selected from the group consisting of CD9, CD63 and CD81, and ii) negative for cytochrome C surface antigens. can indicate

The term "positive" with respect to an exosome surface marker may mean that the surface marker is present in a greater amount or at a higher concentration compared to other non-exosomes as a reference. That is, since a certain surface marker exists on the surface of the exosome, if the exosome can be distinguished from one or more other non-exosomes using the marker, it becomes positive for the marker. For example, exosomes may be detectable with an antibody specific for CD81, which is an exosome-specific surface antigen, and if the signal intensity from this antibody is detectably greater than a control (eg, background value), the exosomes is "CD81 ⁺ ".

The term “negative” may mean that even using an antibody specific for a specific exosome surface marker, the marker cannot be detected compared to a background value. For example, if the exosome cannot be detectably labeled with an antibody specific for cytochrome C, the exosome is "Cytochrome ^C- ".

The immunological properties can be determined by conventional methods known in the art. For example, various methods such as flow cytometry, immunocytochemical staining, western blot or RT-PCR may be used.

The umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes may include: a) separating mesenchymal stem cells from the umbilical cord from which blood vessels are removed; b) subculturing the isolated mesenchymal stem cells 1 to 10 times in a serum-free cell culture medium; c) filtering after obtaining a culture solution in the process of subculturing; d) may be prepared by a method comprising the step of separating the exosomes by ultracentrifugation of the filtered culture solution.

The umbilical cord may use a placenta isolated after childbirth from a healthy mother (eg, a mother who is HIV, HCV, or HBV negative). That is, the "separated umbilical cord" may mean an umbilical cord that is separated from the mother's mother after childbirth. The separated umbilical cord may be stored in a sterilized container and ice immediately after separation.

The method for obtaining the separation of the umbilical cord from the placenta may include, for example, separating the umbilical cord from the separated placenta; removing blood outside the separated umbilical cord; removing the arteries and veins of the umbilical cord from which the blood has been removed; and/or cutting the umbilical cord from which the arteries and veins have been removed to a predetermined size (eg, 1 to 20 mm). For the removal of the blood, for example, Ca/Mg free DPBS or Ca/Mg free DPBS containing gentamicin may be used.

Next, a step of isolating the mesenchymal stem cells from the cut umbilical cord (eg, the isolated umbilical cord) by treating the separation enzyme may be performed. The separation enzyme may include collagenase, trypsin, and/or dispase.

Next, the isolated umbilical cord-derived mesenchymal stem cells may include the step of subculturing 1 to 10 times as P0. Specifically, it can be subcultured 3 times, 4 times or 5 times.

The umbilical cord (umbilical cord)-derived mesenchymal stem cell culture solution according to an embodiment can be obtained through the step of filtration after obtaining the culture solution in the subculture process.

After filtering the umbilical cord (umbilical cord)-derived mesenchymal stem cell culture medium, the exosomes can be separated using an ultracentrifuge.

The cosmetic composition may be formulated as a cosmetic formulation conventionally prepared in the art, if necessary.

The cosmetic composition is formulated as, for example, a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, and spray. may be, but is not limited thereto. Specifically, it may be formulated in the form of a flexible lotion, a nourishing lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder. In addition, when the formulation of the cosmetic composition is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, and mixtures thereof It may include a carrier component selected from the group consisting of.

In addition, when the formulation of the cosmetic composition is a solution or emulsion, it may include a carrier component selected from the group consisting of a solvent, a solvating agent, an emulsifying agent, and a mixture thereof. Examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic esters, polyethylene glycol, sorbitan fatty acid esters and mixtures thereof. can be heard

In addition, when the formulation of the cosmetic composition is a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystals and a carrier component selected from the group consisting of adult cellulose, aluminum metahydroxide, bentonite, agar, tragacanth, and mixtures thereof.

The carrier component may be included in an amount of about 1 to about 99.99% by weight, preferably about 80% to about 90% by weight, based on the total weight of the cosmetic composition.

Another aspect provides a pharmaceutical composition for preventing or treating inflammatory skin disease comprising an exosome isolated from umbilical cord-derived mesenchymal stem cells as an active ingredient.

The exosomes isolated from the umbilical cord-derived mesenchymal stem cells are as described above.

The inflammatory skin disease may be one or more diseases selected from the group consisting of atopic dermatitis, allergic dermatitis, contact dermatitis, acne, seborrheic dermatitis, sweat glands, urticaria, psoriasis, sclerosis, eczema, vitiligo, lupus and alopecia areata. , but is not limited thereto.

The pharmaceutical composition contains, as an active ingredient, from about 0.1% to about 90% by weight, specifically from about 0.5% to about 75% by weight of the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells, based on the total weight of the composition. %, more specifically, from about 1% to about 50% by weight.

The pharmaceutical composition may include conventional and non-toxic pharmaceutically acceptable additives formulated into a formulation according to a conventional method. For example, the pharmaceutical composition may further include a pharmaceutically acceptable carrier, diluent or excipient.

The pharmaceutical composition may be applied to the skin. The formulation of the pharmaceutical composition may be a formulation for external application to the skin. The external preparation for skin is not particularly limited thereto, but may be prepared and used in the form of, for example, ointment, lotion, spray, patch, cream, powder, suspension, patch or gel.

Cosmetic composition comprising exosomes isolated from umbilical cord (umbilical cord)-derived mesenchymal stem cells according to an aspect improves the skin because it exhibits wound relief, wrinkle improvement, regeneration, elasticity increase, moisturizing, barrier strengthening, anti-inflammatory or whitening effect It can be widely used as a cosmetic composition for use.

The pharmaceutical composition comprising the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells according to another aspect effectively inhibits the inflammatory response of the skin, so it can be usefully used as a pharmaceutical composition for preventing or treating inflammatory skin diseases.

1 is a result of measuring the size of the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells according to one embodiment.
2 is a result of observing the morphology of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment using a transmission electron microscope.
3 is a result of confirming the expression of exosome-specific markers and cell-specific markers in the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment using Western blot.
Figure 4 is a mesenchymal stem cell exosomes derived from the umbilical cord (umbilical cord) according to an embodiment and a graph measuring the protein expression intensity (FIG. 4B) by analyzing the protein components secreted from the culture medium except for the exosomes (FIG. 4A) to be.
5 is a result of analyzing the miRNA component contained in the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment.
6 is a result of displaying the Top 5 Ranking probes with red dots in the order of the highest miRNA expression intensity contained in the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to one embodiment.
7 is a result of measuring the cell growth rate of human dermal fibroblasts (HS68) according to the treatment concentration of the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to one embodiment.
8 is a result of measuring the cell growth rate of human keratinocytes (epidermal) cells (HaCaT) according to the treatment concentration of the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment.
9 is a micrograph (FIG. 9a) and a cell growth curve taken to analyze the cell proliferation rate of human dermal fibroblasts (HS68) according to the treatment concentration of the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment. It is a result showing a graph (FIG. 9B).
10 is a micrograph (FIG. 9a) and wound recovery rate ( Figure 9b) is a measurement result.
11 is after treatment of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment to human dermal fibroblasts (HS68), collagen type I, collagen type III, elastin, and fibronectin synthesis genes were confirmed. It is the result of comparing the expression level with the electrophoresis picture (FIG. 11a) (FIG. 11b).
12 is a result of comparing the expression level of PICP in human dermal fibroblasts (HS68) according to the treatment concentration of the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to one embodiment.
13 is an electrophoretic photograph confirming the expression of HAS2 and HAS3 synthesis genes in human epidermal cells (HaCaT) according to the treatment concentration of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment (FIG. 13a) and It is the result of comparing the expression level of each (FIG. 13b).
14 is an electrophoretic photograph (FIG. 14a) confirming the expression of loricrin and filaggrin in human epidermal cells (HaCaT) according to the concentration of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosome treatment according to an embodiment; is a result of comparing the expression level (FIG. 14b).
15 shows mouse macrophages (Raw 264.7) treated with lipopolysaccharide (LPS) to induce an inflammatory response, and after treatment with umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to one embodiment by concentration, NO It is the result of comparing the expression level.
16 is a result of comparing the amount of melanin secretion in the medium according to the treatment concentration of the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment after treatment with melanin-stimulating hormone in rodent-derived melanoma cells (B16F10) to be.
17 is a result of comparing the melanin content in the cells according to the treatment concentration of the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment after treatment with melanin-stimulating hormone in rodent-derived melanoma cells (B16F10) to be.

Hereinafter, the present invention will be described in more detail by way of Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited by these examples.

Preparation Example 1. Preparation of umbilical cord (umbilical cord)-derived mesenchymal stem cells and umbilical cord (umbilical cord)-derived mesenchymal stem cell culture solution

The umbilical cord donated during delivery of healthy mothers was washed with Phosphate Buffered Saline (PBS) by placing a cell culture dish on ice in a Clean Bench or Biological Safety Cabinet (BSC). The blood vessels in the umbilical cord were first removed with sterile scissors, and cut into pieces with a size of 3 mm to 5 mm. After transferring the chopped umbilical cord tissue to a cell culture flask, it was treated with trypsin enzyme and reacted at 37° C. for 30 minutes to obtain 5% HPL (Human Platelet Lysate; Helios UltraGRO), 1% P/S (Penicillin/Streptomycin; GIBCO). ) containing MEM-alpha (GIBCO) medium was added and cultured in an incubator at 37° C. to obtain umbilical cord (umbilical cord)-derived mesenchymal stem cells.

After subculturing the obtained mesenchymal stem cells 3 or 4 times, when the cell confluency reaches 70-80%, the culture medium is replaced with phenol-red free MEM-alpha containing 1% P/S. Thus, the culture medium was separated in the process of culturing for 48 to 72 hours. The separated culture medium was filtered through a 0.22 μm filter to obtain a culture medium of umbilical cord (umbilical cord)-derived mesenchymal stem cells.

Preparation Example 2. Separation of exosomes from umbilical cord (umbilical cord)-derived mesenchymal stem cells

The umbilical cord (umbilical cord)-derived mesenchymal stem cell culture solution obtained in Preparation Example 1 was transferred to an ultracentrifuge tube, followed by centrifugation using an ultracentrifuge at a rotation speed of 120,000 g for 2 hours and 30 minutes. The resulting pellet was separated through centrifugation and resuspended in 100 to 1000 μl of PBS, followed by further centrifugation at a rotation speed of 120,000 g using an ultracentrifuge for 2 hours and 30 minutes. Concentrated exosomes were obtained by separating the resulting pellets through centrifugation, resuspending them in 100 to 1000 μl of PBS, and storing them in a cryogenic freezer.

Experimental Example 1. Characterization of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes

Experimental Example 1.1. Measurement of the size of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes

The size of the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells in Preparation Example 2 was observed using Zetaview (Nanoparticle Tracking Analyzers PMX120) (FIG. 1). As a result, it was confirmed that the median value was 144 nm and the average value was 157.7 nm.

Experimental Example 1.2. Observation of morphology of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes

The shape of the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells in Preparation Example 2 was observed with a transmission electron microscope (Transmission Electron Microscope (120kv), Talos L120C) (FIG. 2).

Experimental Example 1.3. Identification of expression markers of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes

Western blot was performed as follows to determine whether the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells in Preparation Example 2 express the exosome-specific surface markers.

First, protein quantification (BCA assay; Thermo Scientific, Cat. 23227) of umbilical cord (umbilical cord)-derived mesenchymal stem cells and umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes was performed to reduce the amount of protein to 40 µg, and a sample for western use. was produced. Then, according to the composition of the SDS-PAGE gel, a resolving gel was first made using each solution and then placed between the cast plates (resolving gel was added up to about 70% of the total). After that, a small amount of distilled water or isopropanol was added on the gel to prevent dryness of the surface and to make a flat layer. After hardening at room temperature for about 30 to 40 minutes, all distilled water or isopropanol on the hardened running gel was removed. After filling the stacking gel made according to the composition to the top of the resolving gel, insert the comb and harden it again at room temperature for 30 to 40 minutes. After removing the comb, casting the completed SDS-PAGE gel to the electrophoresis kit and filling running buffer (1x Tris/Glycine/SDS buffer), electrophoresis was performed. After the gel running was completed, the transfer was carried out, and after the transfer was completed, a blocking solution (5% skim milk with 1x TBST) was added, and the reaction was carried out slowly for 1 to 2 hours. Primary antibodies CD9 (Santacruze, SC-59140), CD63 (Santacruze, SC-5275), CD81 (Santacruze, SC-166029), Cytochrome C (santacruze, SC-13156) in a blocking solution (5% skim milk with 1x) TBST), and then reacted at 4°C for 24 hours. After the reaction was completed, after washing 3 times for 10 minutes with 1x TBST, a secondary antibody, Anti-mouse IgG1 (Cell signaling, cat.no. 7076S) was added and reacted at room temperature for 1 hour. After the reaction was completed, the protein expression level was confirmed using iBright (CL1000 Imaging system, Thermo Scientific) after adding ECL substrates (FIG. 3). As a result, it was confirmed that the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes had the characteristics of exosomes by expressing CD9, CD63, and CD81 proteins belonging to the Tetraspanin family, which are membrane proteins of exosomes. In addition, Cytochrome C (Cytochrome C), which is known as a marker to be present in the inner membrane of mitochondria (Crista) and expressed in cells, is not expressed in the exosomes isolated in Preparation Example 2, so that it has the characteristics of non-cellular exosomes. Confirmed.

Experimental Example 2. Secretome analysis of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes

In order to analyze the secretome of the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells in Preparation Example 2, RayBio Human Cytokine/Growth Factor Antibody (RayBiotech, Noncross, GA, USA) was used as follows Similarly, the components of the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes (UC-MES-Exosome) and the exosomes were separated and the components of the remaining culture medium (without Exosome) were confirmed.

After incubating the array membrane in blocking buffer for 30 minutes at room temperature, 2 ml of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes (UC-MES-Exosome) was treated for 1 hour. After washing the membrane 5 times, biotin-conjugated antibody was treated at room temperature for 1-2 hours, and 2 ml of HRP-conjugated streptavidin as a substrate was added. After 2 hours, the detection buffer was treated for 2 minutes, and the components of the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosome (UC-MES-Exosome) were checked with iBright (CL1000 Imaging system, Thermo Scientific). , after measuring the signal intensity using iBright Analysis Software, it is shown in Table 1 below.

No. Secretome signal strength No. Secretome signal strength One Activin A 766982 21 GDF3 756334 2 Adiponectin/Acrp30 1407090 22 HB-EGF 1324716 3 Angiopoietin-2 2063878 23 HGF 443420 4 Angiopoietin-like 1 2298531 24 IGFBP-rp1/IGFBP-7 2712454 5 Angiostatin 1965586 25 IGF-I SR 562716 6 APRIL 2320269 26 IL-1ra 2869700 7 BAX 2991383 27 IL-4R 2321928 8 BMP-3 403138 28 IL-29 2476542 9 BMPR-IB/ALK-6 1252806 29 Kremen-1 537549 10 CCR7 1900365 30 Lck 95253 11 CCR8 26437 31 Latent TGF-beta bp1 239493 12 CCR9 1205334 32 M-CSF 1990669 13 CTACK / CCL27 2015242 33 MDC 937072 14 CXCR1/IL-8 RA 1169036 34 NAP-2 572279 15 CXCR2 / IL-8 RB 1459287 35 TGF-beta 5 2930398 16 EDA-A2 687885 36 Thrombospondin-1 2908401 17 EMAP-± 188324 37 Thrombospondin-2 2294302 18 Endothelin 1231208 38 TIMP-1 511202 19 FGF R4 864703 39 TIMP-2 961901 20 FGF-9 2062455 40 TRADD 878435

As a result, it was confirmed that the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes contained a large number of various growth factors, cytokines, and the like. Specifically, activin A, adiponectin/Acrp30, angiopoietin-2, angiopoietin-like 1, angiostatin, BMP ( Bone Morphogenetic Protein)-3, CTACK/CCL27 (CC motif chemokine ligand 27), CXCR2/IL-8 RB (Interleukin 8 receptor, beta), EDA (Ectodysplasin A)-A2, FGF (fibroblast growth factor; fibroblast growth factor) ) R4, FGF-9, GDF (Growth Differentiation Factor)3, HB-EGF (Heparin-binding EGF-like growth factor), HGF (hepatocyte growth factor; hepatocyte growth factor), IGFBP-rp (Insulin-like growth factor- binding protein related protein; 1/IGFBP-7, IGF-I SR (Anti-Insulin-like Growth Factor-I Receptor), IL-4 R, Latent TGF-beta bp ( It was confirmed that tumor growth factor beta binding protein) 1, TGF-beta 5, Thrombospondin-1, and TIMP (thioinosine monophosphate)-1 were included.

In addition, Activin A, APRIL (A Proliferation-Inducing Ligand), BAX (Bcl2 associated X protein), BMPR (bone morphogenetic protein receptor)-IB/ALK (anaplastic lymphoma kinase)-6, CCR (CC chemokine receptor; CC chemokine receptor)7, CCR8, CCR9, CXCR (CXC chemokine receptor)1/IL-8 RA, EMAP (Endothelial monocyte-activating polypeptide)-II, IL-1 ra, IL-29, Macrophage colony-stimulating factor (M-CSF), macrophage-derived chemokine (MDC), neutrophil activating protein (NAP)-2, TGF- Beta 5, Thrombospondin-1, TIMP-1, TIMP-2, TRADD (Tumor necrosis factor receptor type 1-associated DEATH domain protein; tumor necrosis factor receptor type 1-associated death domain protein) was confirmed to be included.

In addition, in the same way, the components of the umbilical cord (umbilical cord)-derived mesenchymal stem cell culture medium (without Exosome) except for the exosomes were identified, and the components and their strengths were measured for the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes (UC-MES- exosome) (FIG. 4). As a result, it was confirmed that most of the proteins such as growth factors and cytokines were contained in the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosome (UC-MES-Exosome).

Experimental Example 3. MiRNA analysis of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes

In order to analyze the miRNA contained in the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells in Preparation Example 2, from the CEL file using the RMA + DABG (All Organisms) algorithm of Affymetrix ^® Power Tools (APT). After performing background subtraction, normalization, and summarizing probe sets and measuring normalized intensity, it is shown in Table 2 and FIG. 5 below.

No. miRNA Name expression No. miRNA Name expression One hsa-let-7e-5p 13.177500 30 hsa-miR-3148 8.652750 2 hsa-let-7d-5p 12.422040 31 hsa-mir-1908 8.380390 3 hsa-miR-1273g-3p 12.392600 32 hsa-miR-6816-5p 8.314740 4 hsa-miR-6089 11.690030 33 hsa-miR-4463 8.298890 5 hsa-miR-3665 11.294940 34 hsa-miR-7108-5p 8.249980 6 hsa-miR-151a-5p 11.226940 35 hsa-miR-4481 8.075400 7 hsa-miR-1275 10.859830 36 hsa-miR-6883-5p 8.030810 8 hsa-miR-3656 10.773080 37 hsa-miR-126-3p 7.959910 9 hsa-miR-6125 10.750350 38 hsa-miR-7114-5p 7.952790 10 hsa-miR-127-3p 10.576360 39 hsa-miR-7977 7.717210 11 hsa-miR-455-3p 10.406250 40 hsa-miR-146a-5p 7.229260 12 hsa-miR-2115-5p 10.400270 41 hsa-miR-125a-5p 6.333070 13 hsa-let-7f-5p 10.384530 42 hsa-miR-214-5p 5.313420 14 hsa-miR-8069 10.282430 43 hsa-miR-122-5p 5.021290 15 hsa-miR-1915-3p 10.121610 44 hsa-miR-210-3p 4.854580 16 hsa-miR-21-5p 9.888040 45 hsa-miR-34a-3p 4.321370 17 hsa-miR-6849-5p 9.780590 46 hsa-miR-223-3p 4.242860 18 hsa-miR-297 9.514660 47 hsa-miR-4665-5p 4.148700 19 hsa-miR-7844-5p 9.456640 48 hsa-miR-21-3p 3.280490 20 hsa-miR-4701-3p 9.433150 49 hsa-miR-198 3.161050 21 hsa-miR-670-5p 9.303630 50 hsa-miR-137 2.690570 22 hsa-miR-595 9.301710 51 hsa-miR-211-3p 2.579940 23 hsa-miR-483-5p 9.285540 52 hsa-miR-192-5p 2.473390 24 hsa-miR-6870-5p 9.217340 53 hsa-miR-18a-3p 2.432650 25 hsa-miR-6800-5p 9.104420 54 hsa-miR-140-5p 2.286280 26 hsa-miR-409-3p 9.052220 55 hsa-miR-138-1-3p 2.254900 27 hsa-miR-6724-5p 8.987500 56 hsa-miR-221-5p 1.938560 28 hsa-miR-3064-5p 8.959680 57 hsa-miR-204-3p 1.793860 29 hsa-miR-4281 8.834080

Specifically, hsa-let-7e-5p, hsa-let-7d-5p, hsa-miR-1275, hsa-miR-127-3p, hsa-miR, which are miRNAs known to be involved in skin regeneration, anti-aging, and wound healing. -455-3p, hsa-miR-2115-5p, hsa-let-7f-5p, hsa-miR-8069, hsa-miR-1915-3p, hsa-miR-6849-5p, hsa-miR-297, hsa -miR-7844-5p, hsa-miR-670-5p, hsa-miR-483-5p, hsa-miR-6870-5p, hsa-miR-6800-5p, hsa-miR-409-3p, hsa-miR -6724-5p, hsa-miR-3064-5p, hsa-miR-4281, hsa-miR-3148, hsa-mir-1908, hsa-miR-6816-5p, hsa-miR-4463, hsa-miR-7108 -5p, hsa-miR-4481, hsa-miR-6883-5p, hsa-miR-126-3, hsa-miR-7114-5p, hsa-miR-7977, hsa-miR-146a-5p, hsa-miR -125a-5p, hsa-miR-214-5p, hsa-miR-122-5p, hsa-miR-210-3p, hsa-miR-34a-3p, hsa-miR-223-3p, hsa-miR-4665 -5p, hsa-miR-21-3p, hsa-miR-198, hsa-miR-137, hsa-miR-211-3p, hsa-miR-192-5p, hsa-miR-140-5p, hsa-miR -221-5p, hsa-miR-204-3p, etc. were confirmed to contain. In addition, hsa-let-7d-5p, hsa-miR-1273g-3p, which are known miRNAs related to skin barrier strengthening and skin moisturizing, hsa-miR-6089, hsa-miR-3665, hsa-miR-151a-5p, hsa-miR-6125, hsa-miR-21-5p, hsa-miR-4701-3p, hsa-miR-595, hsa- miR-18a-3p, hsa-miR-138-1-3p, etc. It was confirmed that it contains

In addition, the volume (intensity) of miRNA expression values in exosomes isolated from umbilical cord (umbilical cord)-derived mesenchymal stem cells was high, but it was shown as a volume plot to identify probes that were different in the experimental group compared to the control group (X-axis). : Volume, Y-axis: log2 Fold change). The volume of the expression value was defined as the geometric mean of the expression values of the two groups (volume = square-root(Control Normalized value * Test Normalized value)). Even if the fold change differs by 2 times or more, the reliability of probes with a difference in a high place can be high compared to a difference of more than 2 times in a low volume place. Ranking probes were marked with red dots (Fig. 6). As a result, it was confirmed that has-let-7e-5p, has-let-7d-5p, has-miR-3665, has-miR-3656, and has-miR-6089.

Experimental Example 4. Umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes Assessment of cytotoxicity and cytostatic effects

In order to evaluate the cytotoxicity and cell proliferation effect of exosomes isolated from umbilical cord (umbilical cord)-derived mesenchymal stem cells in Preparation Example 2, human dermal fibroblasts (HS68) and human epidermal cells (HaCaT) were used as follows. Experiments were performed.

First, 1Х10 ³ cells/100 μl of HS68 was dispensed per well in a 96-well plate and cultured for 24 hours, and then as a control (control; untreated group) and experimental group, concentrations of 5 μg/ml, 10 μg/ml, 20 μg/ml, 50 μg/ml, and 100 μg/ml of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes were treated, respectively. After treatment with each concentration of exosomes, changes in cell activity were observed by measuring absorbance at 450 nm using CCK-8 (Dojindo, CK04-13) reagent at the same time every day for 3 days. As a result, it was confirmed that the survival rate of skin dermal fibroblasts was significantly increased in the group treated with umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes at 10 μg/ml, 20 μg/ml, 50 μg/ml, and 100 μg/ml. (Fig. 7).

In addition, in a 96-well plate, HaCaT was dispensed at 2Х10 ³ cells/100 μl per well and cultured for 24 hours, and then as a control group (control; untreated group) and an experimental group, concentrations of 5 μg/ml, 10 μg/ml, 20 μg/ml, 50 μg/ml, and 100 μg/ml umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes were treated with the exosomes, respectively. After treatment with each concentration of exosomes, changes in cell activity were observed by measuring absorbance at 450 nm using CCK-8 (Dojindo, CK04-13) reagent at the same time every day for 3 days. As a result, it was confirmed that the survival rate of skin keratin (epidermal) cells was significantly increased in the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosome-treated group at all concentrations ( FIG. 8 ).

In addition, HS68 was dispensed at a rate of 8 x 10 ⁵ cells/ml per well in a 6-well plate and cultured for 24 hours, and then 10 μg/ml, 20 μg/ml as control (control; DMEM treatment group) and experimental groups. , 50 μg/ml of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes were treated, respectively. After 24 hours, the cells were stained using a crystal violet reagent. As a result of analyzing the cell proliferation rate through the Image J program, it was confirmed that the cell proliferation rate increased in the exosome-treated group (FIG. 9).

Through this, it was found that the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment did not exhibit cytotoxicity in skin cells and had a cell proliferation effect.

Experimental Example 5. Confirmation of skin wound healing effect of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes

In order to evaluate the skin wound healing effect of the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells in Preparation Example 2, the following experiment was performed using human epidermal cells (HaCaT).

In a 24-well plate, HaCaT was seeded at 3Х10 ⁵ cells per well and cultured to a density of 100%. After making a wound on the cells by scraping the center of the well using a 1000P white tip, as a control (NC; untreated group) and experimental group, the umbilical cord ( umbilical cord)-derived mesenchymal stem cell exosomes were treated, respectively. The recovery rate was confirmed by measuring the area of the wound immediately after treatment with the exosomes in HaCaT and after 24 hours. At this time, the exosomes were treated and 24 hours later, the cells were stained with a crystal violet reagent and observed under a microscope. As a result, it was confirmed that when the wounded HaCaT was treated with umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes, the wound recovery rate was statistically and significantly increased in a concentration-dependent manner ( FIG. 10 ).

Through this, it was found that the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment has an effect of skin cell wound healing.

Experimental Example 6. Confirmation of extracellular matrix (ECM) synthesis effect of mesenchymal stem cell exosomes derived from umbilical cord (umbilical cord)

In order to evaluate the synthetic effect of components constituting the extracellular matrix (ECM) of the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells in Preparation Example 2, human dermal fibroblasts (HS68) were used to evaluate the The following experiments were performed.

Experimental Example 6.1. Expression level analysis of extracellular matrix component synthesis genes using RT-PCR

HS68 was dispensed at 1.0Х10 ⁵ cells per well in a 6-well plate and cultured for 24 hours. As a control (NC; untreated group) and experimental group, umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes at concentrations of 10 μg/ml, 20 μg/ml, and 50 μg/ml were treated, respectively, and cultured for 24 hours. Real-time polymerase chain reaction (qPCR) was used as follows in order to analyze the expression level of the synthetic gene of the exogenous matrix.

Specifically, RNA was extracted using phenol/chloroform. The extracted RNA was reverse transcribed to synthesize cDNA. The expression level of cDNA was analyzed using qPCR on Applide Biosystems 700 sequence detection system (foster City, CA, USA). In this case, the primers used are as described in Table 3 below.

gene name forward primer reverse primer Collagen type I GGCGGCCAGGGCTCCGAC (SEQ ID NO: 1) GGTGCCCCAGACCAGGAATT (SEQ ID NO: 2) Collagen type Ⅲ TGAAAGGACACAGAGGCTTCG (SEQ ID NO: 3) GAGCCTGGTAAGAATGGTGC (SEQ ID NO: 4) Fibronectin AAGATTGGAGAGAAGTGGGACC (SEQ ID NO:5) GAGCAAATGGCACCGAGATA (SEQ ID NO:6) Elastin ATCAACGTTGGTGCTACTGCTT (SEQ ID NO:7) ATCTTTAGAGGAGCCCCAGGTA (SEQ ID NO:8) β-actin TCCTCCCTGGAGAAGAGCTA (SEQ ID NO: 9) AGGAGGAGCAATGATCTTGATC (SEQ ID NO: 10)

qPCR was repeated 25 times with a cycle of 10 min at 95 °C, 15 sec at 95 °C and 1 min at 58 °C. mRNA levels were compared by normalizing them to β-actin levels. As a result, it was confirmed that when the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes were treated, the expression levels of Collagen type I, Collagen type III, Elastin, and Fibronectin genes constituting the extracellular matrix significantly increased compared to the control group ( Fig. 11).

Experimental Example 6.2. using ELISA Collagen synthesis promoting ability evaluation

HS68 was dispensed at 1.0Х10 ⁵ cells per well in a 6-well plate and cultured for 24 hours. Negative control (Cont; untreated group), TGF-β at 1 ng/ml as a positive control and umbilical cord (umbilical cord)-derived mesenchymal stem cell exo at concentrations of 10 μg/ml, 20 μg/ml, and 50 μg/ml as an experimental group After treating each moth and culturing for 24 hours, the cultured medium was centrifuged to obtain a supernatant. Collagen synthesis promoting ability was confirmed by analyzing the degree of procollagen synthesis using Procollagen Type I C-peptide (PICP) ELISA Kit (Takara, Cat.# MK101). As a result, when the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes were treated, the PICP expression level was significantly increased in a concentration-dependent manner. was confirmed (FIG. 12).

Through this, it was found that the umbilical cord (umbilical cord)-derived mesenchymal stem cell culture medium according to an embodiment is effective in improving skin wrinkles and increasing skin elasticity.

Experimental Example 7. Confirmation of skin moisturizing and skin barrier strengthening effect of mesenchymal stem cell exosomes derived from umbilical cord (umbilical cord)

In order to evaluate the skin moisturizing and barrier strengthening effects of the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells in Preparation Example 2, the following experiments were performed using human epidermal cells (HaCaT).

In a 6-well plate, each well of HaCaT was aliquoted at 1.0Х10 ⁶ cells and cultured, followed by exchange with a serum-free medium. After 24 hours, umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes at concentrations of 10 μg/ml, 20 μg/ml, and 50 μg/ml were treated as control (NC; untreated group) and experimental groups, respectively. After 24 hours, RNA was isolated from the cells to synthesize cDNA, and qRT-PCR was performed in the same manner as in Experimental Example 6.1 to perform hyaluronic acid synthase (HAS)-2, HAS-3, which is a moisturizing factor. of the expression level was analyzed. In addition, the expression levels of Loricrin and Filaggin, which are factors related to skin barrier strengthening, were analyzed. In this case, the primers used are as described in Table 4 below.

gene name forward primer reverse primer HAS-2 AGAGCACTGGGACGAAGTGT (SEQ ID NO: 11) ATGCACTGAACACACCCAAA (SEQ ID NO: 12) HAS-3 CTTAAGGGTTGCTTGCTTGC (SEQ ID NO: 13) GTTCGTGGGAGATGAAGGAA (SEQ ID NO: 14) Loricrin GTGGGAGCGTCAAGTACTCC (SEQ ID NO: 15) TAGAGACGCCTCCGTAGCTC (SEQ ID NO: 16) Filaggrin TCGGCAAATCCTGAAGAATC (SEQ ID NO: 17) TGCTTTCTGTGCTTGTGTCC (SEQ ID NO: 18)

As a result, it was confirmed that the expression levels of HAS-2 and HAS-3 increased when the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes were treated (FIG. 13). In addition, it was confirmed that the expression levels of Loricrin and Filaggrin increased when the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes were treated (FIG. 14). The skin performs a barrier function by various moisturizing factors such as hyaluronic acid. , hyaluronic acid is mainly synthesized by HAS of keratinocytes and fibroblasts and accumulated in the extracellular matrix. In addition, filaggrin is a protein related to the adhesion of keratin fibers present in epidermal cells, and promotes the final differentiation of epidermal cells.

Through this, it was found that the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment has a skin moisturizing effect and a skin barrier strengthening effect through this.

Experimental Example 8. Confirmation of anti-inflammatory effect of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes

In order to confirm the anti-inflammatory effect of the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells in Preparation Example 2, the following experiment was performed using mouse macrophages (Raw 264.7; ATCC ^® , TIB-71™). carried out.

In a 6-well plate, Raw 264.7 per well was dispensed with 2.5Х10 ⁵ cells, cultured to a density of 80%, and then exchanged with a serum-free medium. After 24 hours, in order to induce an inflammatory response, 2 μg/ml of lipopolysaccharide (LPS) was treated and the concentration was 10 μg/ml, 20 as a negative control (untreated group), positive control (LPS-treated group) and experimental group. ㎍ / ㎖, 50㎍ / ㎖ umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes were treated, respectively.

After 24 hours, the cell culture medium was obtained, and the anti-inflammatory effect was confirmed by checking the amount of NO (Nictric Oxide; Promega, #G2930) produced using the obtained culture medium. A negative control, a positive control, and an experimental group were each loaded in a 96-well plate at 50 μl/well. Sulfanilamide solution was loaded at 50 μl/well, and incubated for 5 to 10 minutes at room temperature in a light-shielding condition. Then, the NED solution was additionally loaded at 50 μl/well, and incubated for 5 to 10 minutes at room temperature in a light-shielding condition. Optical Density was measured at a wavelength of 550 nm using an ELISA Reader.

As a result, it was confirmed that when the inflammatory response-induced cells were treated with the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes, they significantly inhibited NO production compared to the LPS-treated group (positive control group). (Fig. 15).

Through this, it was found that the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment has an effect of inhibiting the skin inflammation reaction.

Experimental Example 9. Confirmation of whitening effect of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes

Experimental Example 9.1. Measurement of melanin secretion

To confirm the skin whitening effect of the exosomes isolated from the umbilical cord (umbilical cord)-derived mesenchymal stem cells in Preparation Example 2, the amount of melanin secretion was measured as follows.

In a 6-well plate, 1.0Х10 ⁵ cells of rodent B16F10 melanoma cells were dispensed per well, and the next day, the non-adherent cells were washed with PBS to remove the negative control (untreated group), and the melanin secretion inhibitory effect was evaluated as a positive control. 10 mM of arbutin, 10 μg/ml, 20 μg/ml, 50 μg/ml of umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes as an experimental group, and 100 nM of α-MSH ( α-melanocyte stimulating hormone; melanocyte stimulating hormone) was treated. To obtain a culture medium after 48 hours and check the amount of melanin secretion in the culture medium, Optical Density was measured at a wavelength of 405 nm using an ELISA Reader.

As a result, it was confirmed that when the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes were treated, melanin synthesis and secretion inhibitory effects were significantly inhibited ( FIG. 16 ).

In addition, the melanoma cells of each group were washed with PBS and the cells were obtained with trypsin (Trypsin-EDTA) to measure the melanin content.

As a result, it was confirmed that when the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes were treated, the melanin synthesis and secretion inhibitory effects were significantly inhibited ( FIG. 17 ).

Through this, it was found that the umbilical cord (umbilical cord)-derived mesenchymal stem cell exosomes according to an embodiment inhibits melanin secretion and synthesis, thereby having a skin whitening effect.

<110> HANS PHARMA CO.,LTD. <120> Composition for Improving Skin Comprising Exosomes Isolated from Umbilical Cord Derived Mesenchymal Stem Cell <130> PN210501KR <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Collagen type I forward primer <400> 1 ggcggccagg gctccgac 18 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type I reverse primer <400> 2 ggtgccccag accaggaatt 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Collagen type III forward primer <400> 3 tgaaaggaca cagaggcttc g 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type III reverse primer <400> 4 gagcctggta agaatggtgc 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Fibronectin forward primer <400> 5 aagatggag agaagtggga cc 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fibronectin reverse primer <400> 6 gagcaaatgg caccgagata 20 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Elastin forward primer <400> 7 atcaacgttg gtgctactgc tt 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Elastin reverse primer <400> 8 atctttagag gagccccagg ta 22 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin forward primer <400> 9 tcctccctgg agaagagcta 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> beta-actin reverse primer <400> 10 aggaggagca atgatcttga tc 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HAS-2 forward primer <400> 11 agagcactgg gacgaagtgt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HAS-2 reverse primer <400> 12 atgcactgaa cacacccaaa 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HAS-3 forward primer <400> 13 cttaagggtt gcttgcttgc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HAS-3 reverse primer <400> 14 gttcgtggga gatgaaggaa 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Loricrin forward primer <400> 15 gtgggagcgt caagtactcc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Loricrin reverse primer <400> 16 tagagacgcc tccgtagctc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Filaggrin forward primer <400> 17 tcggcaaatc ctgaagaatc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Filaggrin reverse primer <400> 18 tcggcaaatc ctgaagaatc 20

Claims (15)

A cosmetic composition for skin improvement comprising exosomes isolated from umbilical cord-derived mesenchymal stem cells as an active ingredient,
The exosomes are hsa-let-7e-5p, hsa-let-7d-5p, hsa-miR-1273g-3p, hsa-miR-6089, hsa-miR-3665, hsa-miR-151a-5p, hsa- miR-1275, hsa-miR-3656, hsa-miR-6125, hsa-miR-127-3p, hsa-miR-455-3p, hsa-miR-2115-5p, hsa-let-7f-5p, hsa- miR-8069, hsa-miR-1915-3p, hsa-miR-21-5p, hsa-miR-6849-5p, hsa-miR-297, hsa-miR-7844-5p, hsa-miR-4701-3p, hsa-miR-670-5p, hsa-miR-595, hsa-miR-483-5p, hsa-miR-6870-5p, hsa-miR-6800-5p, hsa-miR-409-3p, hsa-miR- 6724-5p, hsa-miR-3064-5p, hsa-miR-4281, hsa-miR-3148, hsa-mir-1908, hsa-miR-6816-5p, hsa-miR-4463, hsa-miR-7108- 5p, hsa-miR-4481, hsa-miR-6883-5p, hsa-miR-126-3p, hsa-miR-7114-5p, hsa-miR-7977, hsa-miR-146a-5p, hsa-miR- 125a-5p, hsa-miR-214-5p, hsa-miR-122-5p, hsa-miR-210-3p, hsa-miR-34a-3p, hsa-miR-223-3p, hsa-miR-4665- 5p, hsa-miR-21-3p, hsa-miR-198, hsa-miR-137, hsa-miR-211-3p, hsa-miR-192-5p, hsa-miR-18a-3p, hsa-miR- 140-5p, hsa-miR-138-1-3p, hsa-miR-221-5p and hsa-miR-204-3p to contain one or more miRNAs selected from the group consisting of, a cosmetic composition for improving skin. According to claim 1,
The exosomes isolated from the umbilical cord-derived mesenchymal stem cells are activin A, adiponectin/Acrp30, angiopoietin-2, Angiopoietin-like 1, angiostatin, APRIL, BAX, BMP-3, BMPR-IB/ALK-6 , CCR7, CCR8, CCR9, CTACK/CCL27, CXCR1/IL-8 RA, CXCR2/IL-8 RB, EDA-A2, EMAP-II, Endothelin, FGF R4, FGF-9, GDF3, HB-EGF, HGF , IGFBP-rp1/IGFBP-7, IGF-I SR, IL-1 ra, IL-4 R, IL-29, Kremen-1, Lck, Latent TGF-beta bp 1, M-CSF, MDC, NAP-2 , TGF-beta 5, thrombospondin-1, thrombospondin-2, TIMP-1, TIMP-2 and one or more proteins selected from the group consisting of TRADD, a cosmetic composition for skin improvement. According to claim 1,
The exosomes isolated from the umbilical cord-derived mesenchymal stem cells are adiponectin/Acrp30, angiopoietin-2, Angiopoietin-like 1, angiostatin, APRIL, BAX, BMPR-IB/ALK-6, CCR7, CCR9, CTACK/CCL27 , CXCR1/IL-8 RA, CXCR2/IL-8 RB, endothelin, FGF-9, HB-EGF, IGFBP-rp1/IGFBP-7, IL-1 ra, IL-4 R, IL-29, M- CSF, TGF-beta 5, thrombospondin-1 and thrombospondin-2, the cosmetic composition for skin improvement comprising one or more proteins selected from the group consisting of. According to claim 1,
The exosomes isolated from the umbilical cord-derived mesenchymal stem cells are activin A, BMPR-IB/ALK-6, EMAP-II, HGF, IL-1 ra, IL-4 R, IL-29, Kremen-1, Lck , Latent TGF-beta bp 1, TGF-beta 5, and thrombospondin-2 will contain one or more proteins selected from the group consisting of, a cosmetic composition for skin improvement. delete According to claim 1,
The exosomes isolated from the umbilical cord-derived mesenchymal stem cells are from the group consisting of has-let-7e-5p, has-let-7d-5p, has-miR-3665, has-miR-3656 and has-miR-6089. A cosmetic composition for skin improvement that contains one or more selected miRNAs. According to claim 1,
The skin improvement is wound relief, wrinkle improvement, regeneration, elasticity increase, moisturizing, barrier strengthening, anti-inflammatory or whitening, cosmetic composition for skin improvement. According to claim 1,
A cosmetic composition for improving skin, which promotes the synthesis of proteins constituting the extracellular matrix. 9. The method of claim 8,
The protein constituting the extracellular matrix is collagen, elastin or fibronectin, a cosmetic composition for skin improvement. According to claim 1,
A cosmetic composition for improving skin, which promotes the synthesis of hyaluronic acid. According to claim 1,
A cosmetic composition for improving skin, which promotes the synthesis of loricrin or filaggrin. According to claim 1,
A cosmetic composition for improving skin, which inhibits melanin production. According to claim 1,
The exosomes isolated from the umbilical cord-derived mesenchymal stem cells are
i) is positive for one or more surface antigens selected from the group consisting of CD9, CD63 and CD81,
ii) A cosmetic composition for improving skin, which is negative for cytochrome C surface antigen. According to claim 1,
The exosomes isolated from the umbilical cord-derived mesenchymal stem cells will be prepared by a method comprising the following steps, a cosmetic composition for skin improvement:
a) isolating the mesenchymal stem cells from the umbilical cord from which blood vessels have been removed;
b) subculturing the isolated mesenchymal stem cells 1 to 10 times in a serum-free cell culture medium;
c) filtering after obtaining a culture solution in the process of subculturing; and
d) separating the exosomes by ultracentrifuging the filtered culture solution. As a pharmaceutical composition for preventing or treating inflammatory skin diseases comprising exosomes isolated from umbilical cord-derived mesenchymal stem cells as an active ingredient,
The exosomes are hsa-let-7e-5p, hsa-let-7d-5p, hsa-miR-1273g-3p, hsa-miR-6089, hsa-miR-3665, hsa-miR-151a-5p, hsa- miR-1275, hsa-miR-3656, hsa-miR-6125, hsa-miR-127-3p, hsa-miR-455-3p, hsa-miR-2115-5p, hsa-let-7f-5p, hsa- miR-8069, hsa-miR-1915-3p, hsa-miR-21-5p, hsa-miR-6849-5p, hsa-miR-297, hsa-miR-7844-5p, hsa-miR-4701-3p, hsa-miR-670-5p, hsa-miR-595, hsa-miR-483-5p, hsa-miR-6870-5p, hsa-miR-6800-5p, hsa-miR-409-3p, hsa-miR- 6724-5p, hsa-miR-3064-5p, hsa-miR-4281, hsa-miR-3148, hsa-mir-1908, hsa-miR-6816-5p, hsa-miR-4463, hsa-miR-7108- 5p, hsa-miR-4481, hsa-miR-6883-5p, hsa-miR-126-3p, hsa-miR-7114-5p, hsa-miR-7977, hsa-miR-146a-5p, hsa-miR- 125a-5p, hsa-miR-214-5p, hsa-miR-122-5p, hsa-miR-210-3p, hsa-miR-34a-3p, hsa-miR-223-3p, hsa-miR-4665- 5p, hsa-miR-21-3p, hsa-miR-198, hsa-miR-137, hsa-miR-211-3p, hsa-miR-192-5p, hsa-miR-18a-3p, hsa-miR- 140-5p, hsa-miR-138-1-3p, hsa-miR-221-5p and hsa-miR-204-3p containing one or more miRNAs selected from the group consisting of, preventing or treating inflammatory skin disease pharmaceutical composition for use.

Images