KR102353473B1 - dsRNA targeting NIb for inhibiting of PepMoV replication and uses thereof - Google Patents

Abstract

The present invention relates to double-stranded RNA (dsRNA) for inhibiting propagation of Pepper mottle virus (PepMoV) which is indicated as one basic sequence among basic sequences of sequence numbers 1 to 3 and inhibits expression of a Nuclear Inclusion b (NIb) gene of PepMoV; and a use thereof.

Description

NIb targeting dsRNA for inhibiting proliferation of PepMoV and uses thereof {dsRNA targeting NIb for inhibiting of PepMoV replication and uses thereof}

The present invention relates to a Nuclear Inclusion b ( NIb ) target dsRNA that inhibits the proliferation of PepMoV (Pepper Mottle Virus) and uses thereof.

Based on RNAi (RNA interference) technology, plants expressing RNA homologous to the target RNA have an effective and permanent advantage in terms of virus control. However, this transformation method has disadvantages such as long time, high cost, different effective transformation methods for each crop, and national regulation due to genetically modified organisms (GMOs). In order to overcome this problem, a method of directly processing viral dsRNA into plants by applying RNAi mechanism has emerged. dsRNA is injected into a plant and undergoes maturation to form various siRNAs (small interfering RNA), and siRNA is loaded onto Argonaute protein and complementarily binds to and cuts target mRNA to regulate expression of target genes.

When dsRNA targeting the gene of PepMoV (Pepper Mottle Virus) is treated in plants after exogenous synthesis, it has not been reported that the proliferation of the virus is significantly reduced.

On the other hand, Korean Patent Application Laid-Open No. 2011-0051539 discloses 'a transformant of red pepper with enhanced resistance to PepMoV and a method for manufacturing the same', and Korean Patent Application Publication No. 2019-0051410 discloses ' E75 gene for nuclear receptor of aphids. A composition and method for controlling apoptosis-mediated virus using a specific dsRNA is disclosed, but the NIb target dsRNA for inhibiting the proliferation of PepMoV of the present invention and its use are not described.

The present invention was derived from the above needs, and the present inventors prepared a dsRNA targeting the NIb gene of PepMoV, pre-treated it in a model plant, and confirmed whether the virus was propagated. As a result, the proliferation of PepMoV by dsRNA treatment was By confirming that remarkably suppressed, the present invention was completed.

In order to solve the above problems, the present invention is represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 3, and inhibits the expression of the NIb (Nuclear Inclusion b) gene of PepMoV (Pepper mottle virus), PepMoV proliferation dsRNA (double-stranded RNA) for inhibition is provided.

In addition, the present invention provides a composition for controlling PepMoV comprising the dsRNA as an active ingredient.

In addition, the present invention provides a method for controlling PepMoV comprising the step of treating the composition in plants, seeds of plants or cultivated land.

In addition, the present invention provides a recombinant vector comprising the dsRNA.

The present invention suggests the possibility that exogenous synthetic dsRNA can be applied as an agent for virus control as a virus inhibitor using dsRNA targeting the NIb gene as an active ingredient. In addition, the dsRNA of the present invention may be applied to agro-biotechnology for basic research for using dsRNA as a substitute for chemical crop protection agents and development of innovative Mode Of Action (MOA) crop protection agents.

1 shows the target position and sequence of a dsRNA targeting the NIb gene of PepMoV. The yellow part indicates a region overlapping with other dsRNA.
Figure 2 is the result of confirming the proliferation inhibitory effect of PepMoV according to the NIb gene target dsRNA treatment in tobacco plants by qPCR (A), a photograph observed under UV conditions (B) and a photograph of the phenotype observation of the plant (C).
Figure 3 is the result of analyzing the cleavage site in the NIb gene according to dsRNA treatment through 5' RLM-RACE, (A) is the distribution pattern of the NIb mRNA fragment according to the random degradation of mRNA in tobacco leaves treated only with PepMoV, (B) shows the distribution of NIb mRNA fragments according to the action of dsRNA when PepMoV is applied to tobacco leaves after dsRNA pretreatment, and (C) shows the small RNA pool in the middle part of the NIb predicted based on the cleavage sites in the mRNA.

In order to achieve the object of the present invention, the present invention is represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 3, and inhibits the expression of the NIb (Nuclear Inclusion b) gene of PepMoV (Pepper mottle virus), Provides a dsRNA (double-stranded RNA) for PepMoV proliferation inhibition.

The dsRNA according to the present invention acts by RNA interference (RNAi) in the cell. RNA interference is a post-transcriptional gene expression regulation mechanism that exists widely in eukaryotes including plants. The dsRNA introduced into the cell is processed by Dicer, an RNAse III enzyme, to form a ribonucleo complex called miRNP in the form of siRNA (small interference RNA) to cleave the target gene through complementary binding to the target site, or protein inhibit synthesis. For this reason, RNA interference induced by dsRNA targeting a viral gene introduced into plant cells acts in a way that directly reduces the proliferation of the virus through suppression of the target gene expression of the virus infected in the plant.

The dsRNA for inhibiting PepMoV proliferation according to the present invention is a dsRNA targeting the NIb gene of PepMoV consisting of the nucleotide sequence of SEQ ID NO: 4, and may consist of any one of the nucleotide sequences of SEQ ID NOs: 1 to 3, but preferably For example, it may consist of the nucleotide sequence of SEQ ID NO: 2.

The dsRNA consisting of the nucleotide sequence of SEQ ID NO: 1 targets the 5' region of the NIb gene, and the dsRNA consisting of the nucleotide sequence of SEQ ID NO: 2 targets the middle region of the NIb gene, and consists of the nucleotide sequence of SEQ ID NO: 3 The dsRNA targets the 3' region of the NIb gene.

As used herein, dsRNA or "double-stranded RNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two substantially complementary nucleic acid strands in which sense and antisense are combined. When introduced into a cell, the double-stranded RNA is separated into a single strand, binds to the target transcriptional RNA in the form of siRNA, and prevents protein synthesis therefrom. Accordingly, the sense and antisense strands do not need to be completely complementary as long as they have sufficient complementarity to form a double-strand, and in this sense, only the sequence of one strand may appropriately determine the sequence of the other strand. The term "complementary" refers to the ability of two strands of an oligonucleotide or polynucleotide to hybridize under certain conditions to form a duplex structure. In the present invention, various complementarities can be used as long as the dsRNA is introduced into a cell to achieve the object according to the present invention. For example, the two strands may be fully complementary, or may be substantially complementary. In one embodiment, it may contain up to 4, 3 or 2 or 1 mismatched base pairs.

The nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 3 of the present invention means the nucleotide sequence of the sense strand in dsRNA.

In addition, the dsRNA according to the present invention may comprise substantial modifications at multiple nucleotides and all various types of chemical modifications known in the art. In addition, the dsRNA may be a dsRNA in a naked form, or may be in a form modified with various substances capable of enhancing the stability or absorption of the dsRNA into a target cell.

The present invention also provides a composition for controlling PepMoV comprising the dsRNA of the present invention as an active ingredient.

In the composition for controlling PepMoV according to the present invention, the dsRNA is represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 3, and is a dsRNA that inhibits the expression of the NIb gene of PepMoV.

The composition for controlling PepMoV according to the present invention is prepared, for example, in the form of a direct sprayable solution, powder and suspension or in highly concentrated aqueous, oily or other suspensions, dispersions, emulsions, oily dispersions, pastes, dusts, scattering materials or granules can, but is not limited thereto.

The composition for controlling PepMoV of the present invention can be formulated in various forms. The formulations can be prepared, for example, by adding solvents and/or carriers. Often, inert additives and surface-active substances such as emulsifiers or dispersants are mixed into the formulation. Suitable surface-active substances are aromatic sulfonic acids (eg lignosulfonic acid, phenol-sulfonic acid, naphthalene- and dibutylnaphthalenesulfonic acid), fatty acids, alkyl- and alkylarylsulfonates, alkyl lauryl ethers, alkalis of fatty alcohol sulfates Metals, alkaline earth metals, ammonium salts, sulfated hexa-, hepta- and octadecanols, salts of fatty alcohol glycol ethers, sulfonates naphthalene and derivatives thereof, condensates of formaldehyde, naphthalene or naphthalenesulfonic acids, phenols and formaldehyde Condensate, polyoxyethyleneoctyl phenol ether, ethoxylated isooctyl-, octyl- or nonylphenol, alkylphenyl or tributylphenyl polyglycol ether, alkylarylpolyether alcohol, isotridecyl alcohol, fatty alcohol/ethylene oxide condensate , ethoxylated castor oil, polyoxyethylene alkylether or polyoxypropylene, lauryl alcohol polyglycol ether acetate, sorbitol ester, lignin-sulfite waste liquor or methylcellulose.

Suitable solid carrier materials are, in principle, all porous and agriculturally acceptable carriers such as mineral earths (such as silica, silica gel, silicates, talc, kaolin, limestone, lime, chalk, bowls, ocher, clays, Dolomite, diatomaceous earth, calcium sulphate, magnesium sulphate, magnesium oxide, ground synthetics), fertilizers (e.g. ammonium sulphate, ammonium phosphate, ammonium nitrate, urea), vegetable products (e.g. grain meal, bark meal, wood meal) and nutshell powder) or cellulose powder, but is not limited thereto. In addition, the said solid carrier can also be used 1 type or in mixture of 2 or more types.

The present invention also provides a method for controlling PepMoV comprising the step of treating the composition to a plant, plant seed or cultivated land.

In the PepMoV control method of the present invention, the composition is represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 3, and contains a dsRNA that inhibits the expression of the NIb gene of PepMoV as an active ingredient.

In addition, the treatment is to control PepMoV, after uniformly diluting a composition containing an effective amount of dsRNA with water, directly spraying it on a plant using an appropriate spraying device such as a power spreader, or a composition containing an effective amount of dsRNA to a plant or This can be done by dipping in the seeds of the plant or by irrigation, ie by spraying. In the case of the immersion method, the composition can be poured into the soil around the plant or the seeds can be soaked in the composition. Plants that can be applied to the method of the present invention are not particularly limited.

An 'effective amount' in the present invention means an amount of the composition that is sufficient to control the virus on cultivated plants or does not cause substantial damage to the treated plants. Such amounts may vary within wide limits and depend on various factors, the specific type and condition of the treated cultivated plant, the habitat, or climatic conditions, and the like.

The present invention also provides a recombinant vector comprising the dsRNA.

The dsRNA according to the present invention is a vector for binary transformation that simultaneously expresses sense and antisense directions (Daisuke Miki and Ko Shimamoto, Plant Cell Physiol. 45(4): 490-495, 2004), etc. Gateway system (Gateway system; Invitrogen, USA) can be cloned and used. Such vectors include various promoters, for example, a promoter for overexpression, a promoter for constant expression, an inducible promoter expressed under stress conditions, a promoter for expressing a target foreign sequence at a certain time during the plant growth period, a specific plant tissue It may include a promoter for expressing only a portion or a hybrid promoter to which an enhancer is attached to increase the expression of a target foreign sequence.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Synthesis of dsRNA

dsRNA was synthesized using Thermofisher's RNAi Megascript RNAi kit. It was designed so that the length of each dsRNA does not exceed 600 bp and overlaps a certain length between each dsRNA so that all sequences in the gene are included (FIG. 1).

2. dsRNA injection into model plants

In a previous study, when dsRNA was pretreated, it was found that the inhibitory effect on virus proliferation was the highest. Therefore, in the present invention, dsRNA at a concentration of 25 ng/μl was injected 2 days before virus treatment by an infiltration technique into 3 leaves of 3 weeks old tobacco ( Nicotiana Benthamiana ) plants, each 100 μg each. After 2 days, the virus (PepMoV isolation 134) was expressed in plants by the Agrobacterium transformation method. Briefly, the GFP-expressing PepMoV isolate 134 (NCBI accession no. EU586123) assembled into the pSNU1 vector was used in the experiment (Phu et al., J Virol Methods. 2019 Mar;265:26-34). The vector was introduced into the Agrobacterium tumefaciens GV3101 strain by electroporation, and the Agrobacterium strain was _{cultured so that the OD 600} value was 0.5, and 4 ml of the culture solution was treated with dsRNA. was processed in

At the time of virus treatment 0 dpi (day post inoculation), 5 dpi, 8 dpi, and 12 dpi, pictures were taken under UV to view the GFP expression level.

3. qPCR (quantitative polymerase chain reaction)

To confirm the inhibitory effect of PepMoV proliferation by dsRNA, total RNA was extracted from the samples obtained during the experiment, treated with DNase, synthesized into cDNA through reverse transcription, and then qPCR was performed to measure the relative expression level of GFP.

Primer information used for qPCR gene Base sequence (5'→3') eGFP forward GGACGACGGCAACTACAAGA (SEQ ID NO: 5) reverse TTGTACTCCAGCTTGTGCCC (SEQ ID NO: 6) L23
(reference) forward AAGGATGCCGTGAAGAAGATGT (SEQ ID NO: 7) reverse GCATCGTAGTCAGGAGTCAACC (SEQ ID NO: 8)

Conditions for performing qPCR step Temperature hour repeat (cycle) Pre-incubation 95℃ 5 minutes One Amplification 95℃ 10 seconds 45 60℃ 10 seconds 72℃ 10 seconds melting curve 95℃ 5 seconds One 65℃ 1 min cooling 40℃ 30 seconds One

4. 5' RLM-RACE (RNA Ligase Mediated-Rapid Amplification of cDNA Ends) Analysis

5' RLM-RACE was performed using Thermofisher's GeneRacer™ kit to determine whether target gene mRNA was cut and its location according to dsRNA treatment. After extracting total RNA from the sample obtained during the experiment, after ligation reaction with RNA oligo, it was synthesized into cDNA using the forward primer included in the kit and the gene-specific primer (GSP) in Table 3 below, followed by touch down PCR And by cloning the nested PCR product, the sequence of the target gene mRNA fragment (fragment) was analyzed.

Information on primers used for cDNA synthesis and PCR for 5' RLM-RACE analysis Base sequence (5'→3') GSP1 reverse CTCCGCTCGGTCCCATTGGAGAA (SEQ ID NO: 9) GSP2 reverse TTCACGTTCTGGGTTCACGGCTAT (SEQ ID NO: 10)

touch down PCR conditions step Temperature hour repeat (cycle) Pre-incubation 95℃ 2 minutes One Amplification 95℃ 30 seconds 5 70℃ 1 min 95℃ 30 seconds 5 68℃ 1 min 95℃ 30 seconds 20 65℃ 30 seconds 72℃ 1 min final extension 72℃ 10 minutes One

nested PCR conditions step Temperature hour repeat (cycle) Pre-incubation 95℃ 2 minutes One Amplification 95℃ 30 seconds 18 68℃ 30 seconds 72℃ 2 minutes final extension 72℃ 10 minutes One

Example 1. PepMoV NIb Analysis of virus proliferation inhibition ability of gene-targeted dsRNA

The present inventors divided the NIb gene of PepMoV into three regions of 5', middle, and 3' to prepare a 530bp dsRNA targeting each of them (FIG. 1). In order to analyze the PepMoV proliferation inhibitory ability of each of the dsRNAs, the plants were treated with PepMoV after pretreatment with dsRNA, and the expression level of cloned GFP in the viral genome was analyzed.

As a result, the relative expression level of GFP transcript was significantly reduced in all experimental groups treated with dsRNA and virus compared to the control group treated with virus alone on the 8th day after virus treatment (FIG. 2A), and GFP fluorescence expression level was also confirmed to be reduced (FIG. 2B). It was found that to be the proliferation of PepMoV inhibited by dsRNA pretreatment in particular, the 5 'or 3' pre-treatment the NIb middle portion target dsRNA in comparison to the target dsRNA plant of NIb through the on day 12 after virus treatment, GFP fluorescence expression level was the weakest, and the growth state of the plant was also observed to be the most excellent (FIG. 2C), indicating that the proliferation inhibitory effect of PepMoV was very good.

Example 2. PepMoV NIb When dsRNA targeting the middle part of the gene was treated NIb Identification of cleavage sites in mRNA

To confirm the mRNA cleavage and cleavage site of the target gene that occurs when dsRNA targeting the NIb gene in PepMoV and PepMoV is treated in tobacco ( N. Benthamiana), a model crop, RLM (RNA-Ligase Mediated)-5' RACE PCR proceeded. This experiment was conducted in the three virus inhibitory ability analysis of the dsRNA that target the NIb a sample of the most effective when it is processing a good dsRNA_ NIb _middle.

As a result, in the control group treated with only PepMoV on tobacco leaves, it was confirmed that the mRNA fragment was overall formed in the middle part of the NIb. In contrast, in tobacco leaves treated with PepMoV and dsRNA, relatively large amounts of mRNA fragments were found in the 3' part of the NIb middle. According to these results, when RNA interference occurs in cells according to exogenous synthetic dsRNA, the 3' part of dsRNA is mainly loaded in RISC (RNA-induced silencing complex), and most of the cleavage in the 3' mRNA of dsRNA is It was possible to predict the RNAi mechanism occurring ( FIG. 3 ).

<110> Seoul National University R&DB Foundation <120> dsRNA targeting NIb for inhibiting of PepMoV replication and uses it <130> PN20226 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 555 <212> RNA <213> Artificial Sequence <220> <223> dsRNA <400> 1 gcacacacau caccuuggau gcuugaaguc cugaaagaga auuugaaggc cguugcauau 60 augaagaguc aacucgucac caagcauguu gugaagggug aguguaugau guuuaaacag 120 uaucugcagg aaaaccccag ggcaaaugag uuuuuccagc cuaagaugug ggcguaugga 180 aagaguaugu ugaauaagga agccuauauc aaggauauaa ugaaauauuc aaaagucauu 240 gauguaggag uagucgauug cgacgcauuu gaggaagcua ucauuagagu uauuguauac 300 augcagaucc auggcuuucg caaauguucu uacaucacag augaagagga gauauucaag 360 gcauuaaaua ugaauacagc uguuggagcu auguaugggg gaaagaaaaa ggaguacuuu 420 gaaaagucca caacagagga uaaggcugag auucuccggc aaagcuguuu gagguuguac 480 acggguaaac ugggugugug gaauggaucu cuaaaagcug aacugagaag uaaggaaaag 540 auagaggcua auaag 555 <210> 2 <211> 555 <212> RNA <213> Artificial Sequence <220> <223> dsRNA <400> 2 aauggaucuc uaaaagcuga acugagaagu aaggaaaaga uagaggcuaa uaagacacgg 60 acuuucacag cagccccaau ugauacuuua uuagguggua aggugugugu agaugauuuc 120 aacaaccagu uuuauucgaa aaauauugaa uguuguugga cgguugggau gaccaaauuu 180 uaugguggau ggaauaagcu uuugacagcu uugccugaug gauggauaua uugugaugca 240 gauggcucgc aauucgauag uucauugaca ccuuaccuca uaaaugcugu auugacuaua 300 cgguaugcuu ucauggaaga uugggacauu ggguauaaga uguugcaaaa cuuguacaca 360 gaaauaaucu acacaccaau auccacgccu gauggaacaa ucgugaagaa guucagaggc 420 aauaacagug ggcaaccuuc caccguugua gacaacucac uuaugguugu acuugcuaug 480 cauuaugcau uuguacggga agguguggug uuugaagaaa uugacuccau augcaaguuc 540 uucguuaaug gagau 555 <210> 3 <211> 555 <212> RNA <213> Artificial Sequence <220> <223> dsRNA <400> 3 gguggugu uugaagaaau ugacuccaua ugcaaguucu ucguuaaugg agaugauuug 60 cuaauagccg ugaacccaga acgugaaaac uuauuggaca cacugucaag ucauuuuucu 120 gauuuagggc ucaauuauga uuucucaucu cggacgaggg auaaaucaga auugugguuc 180 augucacauu gugggauuuc uguugaaggu auguauauac cuaagcuuga agaggagcga 240 auuguaucaa uucuccaaug ggaccgagcg gagcuaccag aguacagauu ggaggcuauu 300 ugugcagcaa ugauugaauc auggggauac ccacaauuaa cucaugagau ucgaagauuc 360 uauagcuggu uaauugagaa gaacccauac gcugacuugg caucugaagg aaaagcucca 420 uauauuucug aacuagcucu aaagaagcua uaucugaauc aggauguaca aaaugaugag 480 cuucaggucu accucagaua uuucgcugaa gcagacgaag aguuugaaug ugguacauau 540 gaaguucauc aucag 555 <210> 4 <211> 1557 <212> DNA <213> Pepper mottle virus <400> 4 gcacacacat caccttggat gcttgaagtc ctgaaagaga atttgaaggc cgttgcatat 60 atgaagagtc aactcgtcac caagcatgtt gtgaagggtg agtgtatgat gtttaaacag 120 tatctgcagg aaaaccccag ggcaaatgag tttttccagc ctaagatgtg ggcgtatgga 180 aagagtatgt tgaataagga agcctatatc aaggatataa tgaaatattc aaaagtcatt 240 gatgtaggag tagtcgattg cgacgcattt gaggaagcta tcattagagt tattgtatac 300 atgcagatcc atggctttcg caaatgttct tacatcacag atgaagagga gatattcaag 360 gcattaaata tgaatacagc tgttggagct atgtatgggg gaaagaaaaa ggagtacttt 420 gaaaagtcca caacagagga taaggctgag attctccggc aaagctgttt gaggttgtac 480 acgggtaaac tgggtgtgtg gaatggatct ctaaaagctg aactgagaag taaggaaaag 540 atagaggcta ataagacacg gactttcaca gcagccccaa ttgatacttt attaggtggt 600 aaggtgtgtg tagatgattt caacaaccag ttttattcga aaaatattga atgttgttgg 660 acggttggga tgaccaaatt ttatggtgga tggaataagc ttttgacagc tttgcctgat 720 ggatggatat attgtgatgc agatggctcg caattcgata gttcattgac accttacctc 780 ataaatgctg tattgactat acggtatgct ttcatggaag attgggacat tgggtataag 840 atgttgcaaa acttgtacac agaaataatc tacacaccaa tatccacgcc tgatggaaca 900 atcgtgaaga agttcagagg caataacagt gggcaacctt ccaccgttgt agacaactca 960 cttatggttg tacttgctat gcattatgca tttgtacggg aaggtgtggt gtttgaagaa 1020 attgactcca tatgcaagtt cttcgttaat ggagatgatt tgctaatagc cgtgaaccca 1080 gaacgtgaaa acttattgga cacactgtca agtcattttt ctgatttagg gctcaattat 1140 gatttctcat ctcggacgag ggataaatca gaattgtggt tcatgtcaca ttgtgggatt 1200 tctgttgaag gtatgtatat acctaagctt gaagaggagc gaattgtatc aattctccaa 1260 tgggaccgag cggagctacc agagtacaga ttggaggcta tttgtgcagc aatgattgaa 1320 tcatggggat acccacaatt aactcatgag attcgaagat tctatagctg gttaattgag 1380 aagaacccat acgctgactt ggcatctgaa ggaaaagctc catatatttc tgaactagct 1440 ctaaagaagc tatatctgaa tcaggatgta caaaatgatg agcttcaggt ctacctcaga 1500 tatttcgctg aagcagacga agagtttgaa tgtggtacat atgaagttca tcatcag 1557 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ggacgacggc aactacaaga 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ttgtactcca gcttgtgccc 20 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 aaggatgccg tgaagaagat gt 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gcatcgtagt caggagtcaa cc 22 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ctccgctcgg tcccattgga gaa 23 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ttcacgttct gggttcacgg ctat 24

Claims (5)

dsRNA (double-stranded RNA) for inhibiting proliferation of PepMoV, which is represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 3, and inhibits the expression of the NIb (Nuclear Inclusion b) gene of PepMoV (Pepper mottle virus). A composition for controlling PepMoV comprising the dsRNA of claim 1 as an active ingredient. A method for controlling PepMoV comprising the step of treating the composition of claim 2 to a plant, plant seed or cultivated land. The method according to claim 3, wherein the treatment of the dsRNA is a method of immersion or spraying. A recombinant vector comprising the dsRNA of claim 1.

Images