KR102337404B1 - A Composition for regeneration of tissue - Google Patents

Abstract

The present invention is a CK2 (casein kinase 2) protein activity inhibitor; Or it relates to a composition for tissue regeneration comprising an expression inhibitor of a gene encoding a CK2 protein as an active ingredient, wherein the composition of the present invention inhibits the activity of the CK2 protein or suppresses the expression level of the gene encoding the CK2 protein, It can induce and promote the differentiation of stem cells into cartilage. Therefore, it can be very effectively used for preventing, improving, or treating diseases related to bone or cartilage by promoting cartilage differentiation.

Description

A composition for regeneration of tissue

The present invention is a CK2 (casein kinase 2) protein activity inhibitor; Or it relates to a composition for tissue regeneration comprising an expression inhibitor of the gene encoding the CK2 protein as an active ingredient.

Cartilage, a tissue with elasticity, connects two bones to each other, and plays a role in providing mobility to joints and absorbing shock. In particular, articular cartilage is a connective tissue, and such cartilage includes chondrocytes embedded in a matrix of proteoglycan and type collagen. When cartilage tissue is damaged by various causes, direct friction between bone and bone, stiffness of the joint, gradual deterioration of articular cartilage movement, and frequent pain in the cartilage area are induced. According to the findings so far, it is known that the initial pathogenesis of osteoarthritis is usually caused by cartilage destruction due to changes or imbalances in anabolic and catabolic metabolic mechanisms in the articular cartilage matrix.

In general, the cartilage tissue constituting the joints of vertebrates lacks blood vessels, nerves, and lymphoid tissue, and once the cartilage tissue is damaged, it cannot be normally regenerated in vivo. When the cartilage tissue of the joint is damaged in this way, daily activities are restricted due to severe pain, and when the cartilage tissue damage becomes chronic, it causes fatal degenerative arthritis, making it difficult to perform normal life or professional activities. Accordingly, various medical methods for regenerating damaged cartilage tissue have been tried, but it is still insufficient to restore the articular cartilage, Hyaline cartilage, to a natural state.

Clinically, ① a method of inducing differentiation of stem cells into chondrocytes, ② a method of transplanting autologous or allogeneic cartilage tissue into a cartilage defect site by osteochondral transplantation, ③ a method of inducing the differentiation of stem cells into chondrocytes, ③ a method that is damaged by microfracture When the cartilage is well scraped and removed and the subchondral bone is exposed, a hole is drilled at regular intervals to promote the regeneration of bone marrow cells that have flowed through it into cartilage tissue A method of inducing cartilage regeneration by transplanting chondrocytes is used as a surgical method for cartilage regeneration.

However, since fibro-cartilage is mainly generated instead of supercartilage required for the actual joint, the micro-fracture technique has a disadvantage in that it does not achieve a satisfactory effect in terms of functionality, and the osteochondral transplantation is There is a disadvantage in that a gap remains between the site and the existing tissue, and in the case of the chondrocyte transplantation, there is a disadvantage in that the patient's pain and economic burden due to multiple surgeries are large. According to these problems, there is still a need to develop a technology capable of regenerating tissues such as cartilage very effectively.

One object of the present invention is to provide a composition for tissue regeneration.

Another object of the present invention is to provide a composition for preventing, improving or treating cartilage disease.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those of ordinary skill in the art from the following description.

One. composition for tissue regeneration

One embodiment of the present invention provides a composition for tissue regeneration.

The composition for tissue regeneration of the present invention is an inhibitor of CK2 (casein kinase 2) protein activity; Or a gene encoding the CK2 protein (eg, CSNK2A1 , CSNK2A2 and CSNK2B ) includes an expression inhibitor as an active ingredient.

By inhibiting the activity of the CK2 protein of the present invention or suppressing the expression level of a gene encoding the CK2 protein, various types of stem cells can be induced and promoted to be differentiated into cartilage.

의 경우에는 CSNK2B에 암호화된다. 상기 CK2 단백질의 α 서브유닛을 암호화하는 유전자를 파괴하였을 때에는 효모가 죽는 현상이 나타나므로, 이와 같은 CK2 단백질은 세포의 생육에 필수적인 것에 해당한다. 본 발명의 목적상 상기 CK2 단백질은 CK2 α 1, CK2 α 2 및 CK2 β일 수 있고, 예를 들면, CK2 β일 수 있으나, 이에 제한되는 것은 아니다.The "CK2 protein" of the present invention exists in various eukaryotic cells, and is composed of two molecules of catalytic subunits (α 1 and α 2) and two molecules of regulatory subunit (β). In the case of the CK2 α 1, it is encoded by CSNK2A1, and in the case of the CK2 α 2, it is encoded by CSNK2A2, and the CK2

In the case of , it is encrypted in CSNK2B. When the gene encoding the α subunit of the CK2 protein is disrupted, the yeast dies, so the CK2 protein is essential for cell growth. For the purpose of the present invention, the CK2 protein may be CK2 α 1 , CK2 α 2 and CK2 β, for example, CK2 β, but is not limited thereto.

The CK2 α 1 protein of the present invention may consist of the amino acid sequence shown in SEQ ID NO: 1, the CK2 α 2 protein may consist of the amino acid sequence shown in SEQ ID NO: 2, and the CK2 β protein is SEQ ID NO: It may consist of the amino acid sequence represented by 3, but is not limited thereto.

The amino acid sequence of the present invention can be easily modified by a person skilled in the art according to one or more amino acid substitutions, deletions, insertions, or combinations thereof. Therefore, the activity or expression level of the gene is also reduced when a protein or polypeptide having high homology with the amino acid sequence shown in SEQ ID NOs: 1 to 3, for example, 80% or more, 90% or more, or 95% or more of homology All of the above proteins of the present invention are included as long as they maintain the technical characteristics of inducing or promoting differentiation of bone or cartilage when inhibited.

The homology of the present invention is intended to indicate a degree of similarity to the amino acid sequence of a wild type protein, and includes a sequence having the same sequence as above with the amino acid sequence of the present invention. Such homology can be determined by visually comparing two sequences, but can be determined using a bioinformatic algorithm that analyzes the degree of homology by arranging sequences to be compared side by side. The homology between the two amino acid sequences can be expressed as a percentage. Useful automated algorithms are available in the GAP, BESTFIT, FASTA and TFASTA computer software modules of the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, W, USA). Automated sequencing algorithms in the module include Needleman & Wunsch and Pearson & Lipman and Smith & Waterman sequencing algorithms. Algorithms and homology determinations for other useful sequences can be automated in software including FASTP, BLAST, BLAST2, PSIBLAST and CLUSTAL W.

The "protein activity inhibitor" of the present invention may be used without limitation as long as it is a substance capable of inhibiting the kinase activity of CK2 protein, and any one or more of an antibody or fragment thereof or peptide capable of specifically binding to the CK2 protein. can

The "antibody" of the present invention may be a polyclonal or monoclonal antibody. In the present invention, the antibody against the CK2 protein is prepared by methods commonly performed in the art, for example, a fusion method (Kohler et al., European Journal of Immunology, 6:511-519 (1976)), a recombinant DNA method. (U.S. Pat. No. 4,816,56) or phage antibody library methods (Clackson et al, Nature, 352:624-628 (1991) and Marks et al., J. Mol. Biol., 222:58, 1-597 ( 1991)) can be prepared. General procedures for antibody preparation are described in Harlow, E. et al., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York, 1999; Zola, H., Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc., Boca Raton, Florida, 1984; and Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley/Greene, NY, 1991), which are incorporated herein by reference. For example, the production of moclonal antibody-producing hybridoma cells is accomplished by fusing an immortalized cell line with antibody-producing lymphocytes, and the techniques required for this process are well known to those skilled in the art and can be easily performed. . Polyclonal antibodies can be obtained by injecting the CK2 protein antigen into a suitable animal, collecting antisera from the animal, and then isolating the antibody from the antisera using known affinity techniques.

The "fragment" of the present invention means a fragment having at least an antigen-binding function, and may include Fab, F(ab'), F(ab')2 and Fv, but is not limited thereto.

The "gene expression inhibitor" of the present invention is a gene encoding a CK2 protein, that is, a CK2 gene ( CSNK2A1 , CSNK2A2 and CSNK2B ) Any material capable of inhibiting the expression of the gene by inhibiting the transcription or translation process may be used, for example, any one or more of an antisense oligonucleotide or an aptamer capable of specifically binding to the gene However, the present invention is not limited thereto.

The "antisense oligonucleotide" of the present invention means DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to a specific mRNA sequence, and binds to a complementary sequence in mRNA to convert mRNA into protein acts as an inhibitor. The antisense sequence of the present invention is complementary to the mRNA of the AmpG gene represented by SEQ ID NO: 1 and refers to a DNA or RNA sequence capable of binding to the mRNA, translation of the mRNA, translocation into the cytoplasm, maturation ( maturation) or all other essential activities for overall biological functions. For example, it may be siRNA, shRNA, etc., and may consist of the nucleotide sequence shown in SEQ ID NO: 4, but is not limited thereto.

The antisense oligonucleotides of the present invention may be modified at one or more bases, sugars or backbone positions to enhance efficacy (De Mesmaeker et al., Curr Opin Struct Biol., 5, 3, 343-55). , 1995). The backbone can be modified with phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyls, cycloalkyls, short chain heteroatomics, heterocyclic intersugar linkages, and the like. Antisense nucleic acids may also include one or more substituted sugar moieties. Antisense oligonucleotides may include modified bases. Modified bases include hypoxanthine, 6-methyladenine, 5-methylpyrimidine (particularly 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, 2-aminoadenine, 2 -Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6(6-aminohexyl)adenine, 2,6-diaminopurine, etc. There is this. In addition, the antisense oligonucleotide of the present invention may be chemically bound to one or more moieties or conjugates that enhance the activity and cell adsorption properties of the antisense oligonucleotide. Cholesterol moiety, cholesteryl moiety, cholic acid, thioether, thiocholesterol, fatty chain, phospholipid, polyamine, polyethylene glycol chain, adamantane acetic acid, palmityl moiety, octadecylamine, hexylamino-carbonyl-oxy fat-soluble moieties such as, but not limited to, cholesterol moieties. Oligonucleotides comprising a fat-soluble moiety and methods of preparation are well known in the art (US Pat. Nos. 5,138,045, 5,218,105 and 5,459,255). The modified nucleic acid may increase stability to nucleases and increase the binding affinity of antisense oligonucleotides to the targeted mRNA.

The antisense oligonucleotide of the present invention may be synthesized in vitro by a conventional method and administered in vivo, or the antisense oligonucleotide may be synthesized in vivo. An example of synthesizing antisense oligonucleotides in vitro is using RNA polymerase I. One example of allowing antisense RNA to be synthesized in vivo is to use a vector in which the origin of the recognition site (MCS) is in the opposite direction so that the antisense RNA is transcribed. Such antisense RNA preferably has a translation stop codon in the sequence so that it is not translated into the peptide sequence.

The "aptamer" of the present invention refers to an oligonucleotide molecule having binding activity to a predetermined target molecule. The aptamer can inhibit the activity of a predetermined target molecule by binding to the predetermined target molecule.

The aptamer of the present invention may be RNA, DNA, a modified (modified) oligonucleotide, or a mixture thereof. The aptamer of the present invention may also be in a linear or cyclic form. The length of the aptamer of the present invention is not particularly limited, and may be usually 15 to 200 nucleotides, for example, 15 to 100 nucleotides, preferably 18 to 80 nucleotides, more preferably 20 to 60 nucleotides, most preferably Preferably, it may be 22 to 45 nucleotides. When the total number of nucleotides is small, chemical synthesis, chemical modification, and mass production are easier, economical, and advantageous in that in vivo stability is high and toxicity is low.

The tissue of the present invention may be cartilage tissue, but is not limited thereto.

The cartilage tissue of the present invention is a flexible connective tissue found in various parts of the body of animals, including humans, and is a concept including joints between bones, rib cage, ears, nose, bronchial tubes and intervertebral discs. Unlike bone, it is hard and not rigid, but compared to muscle, it is less flexible and relatively stiff. The cartilage tissue is a collagen fiber, a proteoglycan-rich ground substance, and a chondroblast that produces a large amount of extracellular matrix composed of elastin fiber. It is made up of specialized cells called Nutrients are provided to the cartilage cells trapped in the cartilage tissue through diffusion by pumping action generated by compression of articular cartilage or bending of elastic cartilage. For this reason, the cartilage tissue, unlike other connective tissue, does not include blood vessels, so growth and recovery may be very slow.

The cartilage tissue of the present invention may be at least one selected from the group consisting of elastic cartilage, hyaline cartilage, and fibrocartilage, which can be classified according to the relative content of the three main elements. However, the present invention is not limited thereto.

The site in which the cartilage tissue of the present invention is located is hyaline cartilage (eg, hyaline cartilage located in the joint, nose, larynx or sternum), elastic cartilage (eg, elastic cartilage located in the ear) and fibrocartilage (eg, intervertebral disc), but is not limited thereto.

The regeneration of the present invention generally refers to a work in which a part of the body or its function is lost in an organism, and the tissue or organ of that part is restored to its original state or its function is restored. For the purposes of the present invention, the regeneration is inhibition of the activity of the CK2 protein; Or by suppressing the expression level of the gene encoding it, by inducing the stem cells to be differentiated into cartilage tissue, it may mean that the original state can be restored, but is not limited thereto.

The composition for tissue regeneration of the present invention may be used as a food composition or a pharmaceutical composition.

The pharmaceutical composition of the present invention may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be characterized in that it is targeted to humans.

The pharmaceutical composition of the present invention is not limited thereto, but each is formulated in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods to be used. can The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, pain-freezing agents Agents, solubilizers, isotonic agents, stabilizers, etc. may be mixed and used, and in the case of topical administration, bases, excipients, lubricants, preservatives, etc. may be used. The dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.

Meanwhile, examples of suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used. In addition, fillers, anti-agglomeration agents, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives and the like may be further included.

The route of administration of the pharmaceutical composition of the present invention is, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual or rectal. Oral or parenteral administration is preferred.

The parenteral of the present invention includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.

The pharmaceutical composition of the present invention depends on several factors including the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. The dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and 0.0001 to 50 mg/kg per day Alternatively, it may be administered at 0.001 to 50 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.

The food composition comprising the active ingredient of the present invention may be prepared in the form of various foods, for example, beverages, gums, tea, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, and the like.

When the active ingredient of the present invention is included in the food composition, the amount may be added in a proportion of 0.1 to 50% of the total weight, but is not limited thereto.

When the food composition of the present invention is prepared in the form of a beverage, there is no particular limitation except for including the food composition in the indicated ratio, and it may contain various flavoring agents or natural carbohydrates as additional ingredients, like a conventional beverage. . Specifically, as natural carbohydrates, monosaccharides such as glucose, disaccharides such as fructose, polysaccharides such as sucrose, and common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol, etc. may include The flavoring agent may be a natural flavoring agent (taumartin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agent (saccharin, aspartame, etc.).

The food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and flavoring agents such as natural flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, It may further include a pH adjuster, a stabilizer, a preservative, glycerin, alcohol, a carbonation agent used in carbonated beverages, and the like.

The above components of the present invention may be used independently or in combination. The proportion of the additive is not a key element of the present invention, but may be selected from 0.1 to about 50 parts by weight per 100 parts by weight of the food composition of the present invention, but is not limited thereto.

2. Composition for preventing, improving or treating cartilage disease

Another embodiment of the present invention provides a composition for preventing, improving or treating cartilage disease.

The composition for preventing, improving or treating cartilage disease of the present invention is a CK2 (casein kinase 2) protein activity inhibitor; Or an inhibitor of the expression of the gene encoding the CK2 protein as an active ingredient.

In the composition for preventing, improving or treating cartilage disease of the present invention, CK2 protein, CK2 protein activity inhibitor, CK2 protein-encoding gene expression inhibitor, tissue, cartilage, pharmaceutical composition, food composition, etc. It is the same as described in "Composition for tissue regeneration", and is omitted to avoid excessive complexity of the specification.

The "cartilage disease" of the present invention refers to any disease that may be caused by damage such as no cartilage or degeneration, for example, arthritis; osteoporosis; osteochondrosis; osteochondritis; incomplete osteoplasty; osteomyelitis; osteophyte; achondroplasia; chondritis; chondroma; chondrosarcoma; herniated disc; Klippel-Pyle Syndrome; osteomyelitis; cystic fibroostitis; And accidents, fractures, wounds, joint damage, autoimmune disease, diabetes or cartilage disease due to cancer may be at least one selected from the group consisting of, but is not limited thereto.

The "prevention" of the present invention may include, without limitation, any act of blocking or suppressing or delaying symptoms caused by cartilage disease using the composition of the present invention.

The "improvement" and "treatment" of the present invention may be included without limitation as long as the symptoms caused by cartilage disease are improved or beneficially changed using the composition of the present invention.

[Sequence List]

SEQ ID NO: 1: CSNK2A1

10 20 30 40 50

MSGPVPSRAR VYTDVNTHRP REYWDYESHV VEWGNQDDYQ LVRKLGRGKY

60 70 80 90 100

SEVFEAINIT NNEKVVVKIL KPVKKKKIKR EIKILENLRG GPNIITLADI

110 120 130 140 150

VKDPVSRTPA LVFEHVNNTD FKQLYQTLTD YDIRFYMYEI LKALDYCHSM

160 170 180 190 200

GIMHRDVKPH NVMIDHEHRK LRLIDWGLAE FYHPGQEYNV RVASRYFKGP

210 220 230 240 250

ELLVDYQMYD YSLDMWSLGC MLASMIFRKE PFFHGHDNYD QLVRIAKVLG

260 270 280 290 300

TEDLYDYIDK YNIELDPRFN DILGRHSRKR WERFVHSENQ HLVSPEALDF

310 320 330 340 350

LDKLLRYDHQ SRLTAREAME HPYFYTVVKD QARMGSSSMP GGSTPVSSAN

360 370 380 390

MMSGISSVPT PSPLGPLAGS PVIAAANPLG MPVPAAAGAQ Q

SEQ ID NO: 2: CSNK2A2

10 20 30 40 50

MPGPAAGSRA RVYAEVNSLR SREYWDYEAH VPSWGNQDDY QLVRKLGRGK

60 70 80 90 100

YSEVFEAINI TNNERVVVKI LKPVKKKKIK REVKILENLR GGTNIIKLID

110 120 130 140 150

TVKDPVSKTP ALVFEYINNT DFKQLYQILT DFDIRFYMYE LLKALDYCHS

160 170 180 190 200

KGIMHRDVKP HNVMIDHQQK KLRLIDWGLA EFYHPAQEYN VRVASRYFKG

210 220 230 240 250

PELLVDYQMY DYSLDMWSLG CMLASMIFRR EPFFHGQDNY DQLVRIAKVL

260 270 280 290 300

GTEELYGYLK KYHIDLDPHF NDILGQHSRK RWENFIHSEN RHLVSPEALD

310 320 330 340 350

LLDKLLRYDH QQRLTAKEAM EHPYFYPVVK EQSQPCADNA VLSSGLTAAR

SEQ ID NO: 3: CSNK2B

10 20 30 40 50

MSSSEEVSWI SWFCGLRGNE FFCEVDEDYI QDKFNLTGLN EQVPHYRQAL

60 70 80 90 100

DMILDLEPDE ELEDNPNQSD LIEQAAEMLY GLIHARYILT NRGIAQMLEK

110 120 130 140 150

YQQGDFGYCP RVYCENQPML PIGLSDIPGE AMVKLYCPKC MDVYTPKSSR

160 170 180 190 200

HHHTDGAYFG TGFPHMLFMV HPEYRPKRPA NQFVPRLYGF KIHPMAYQLQ

210

LQAASNFKSP VKTIR

SEQ ID NO: 4: shCSNK2B

5'-CCGGCCAACCAGAGTGACCTGATTGCTCGAGCAATCAGGTCACTCTGGTTGGTTTTTG-3'

SEQ ID NO: 5: forward primer

CGACTAATAGACTGGGGTTTGG

SEQ ID NO: 6: reverse primer

TCATACTTGCCAGCATACAACC

SEQ ID NO: 7: forward primer

AATGTTCGTGTAGCCTCAAAGGT

SEQ ID NO: 8: reverse primer

CTGGTCATAGTTGTCCTGTCCA

SEQ ID NO: 9: forward primer

GCCTGATGAAGAACTGGAAGAC

SEQ ID NO: 10: reverse primer

TAACCAAAGTCTCCTTGCTGGT

SEQ ID NO: 11: forward primer

ATCAAGACGGAGCAGCTGAG

SEQ ID NO: 12: reverse primer

TGGTGGTCGGTGTAGTCGTA

SEQ ID NO: 13: forward primer

GAATCAACTGCTGCAGACCA

SEQ ID NO: 14: reverse primer

ATGCTGCTCAGGTGTGACTG

SEQ ID NO: 15: forward primer

GTCTACCCCAATCCAGCAAA

SEQ ID NO: 16: reverse primer

GTGGGAGCCAGATTGTCAT

SEQ ID NO: 17: forward primer

GCTATAAATTCTTTGCTGACCTGCTG

SEQ ID NO: 18: reverse primer

AATTACTTTTATGTCCCCTGTTGACTGG

SEQ ID NO: 19: forward primer

TCTTCTGTGAGGTGGATGAAGA

SEQ ID NO: 20: reverse primer

CTCTTCATCAGGTTCCAGGTCT

SEQ ID NO: 21: forward primer

CTGGTGAAAAGGACCTCTCGAAG

SEQ ID NO: 22: reverse primer

CCAGTTTCACTAATGACACAAACG

The composition of the present invention can induce and promote the differentiation of stem cells into cartilage by inhibiting the activity of the CK2 protein or suppressing the expression level of the gene encoding the CK2 protein. Therefore, it can be very effectively used for preventing, improving or treating diseases related to bone or cartilage by promoting cartilage differentiation.

1 shows the results of confirming the chondrocyte differentiation promoting effect by CSNK2B (Casein Kinase 2 Beta) inhibition in human bone marrow-derived mesenchymal stem cells (hBMSCs) according to an embodiment of the present invention through Alcian blue staining.
2 shows the results of confirming the change in the expression level of chondrocyte differentiation-related genes by CSNK2B inhibition in chondrocytes differentiated from hBMSCs according to an embodiment of the present invention through quantitative RT-PCR.
^{3 is CSNK2B fl /fl} and CSNK2B ^prx1 according to an embodiment of the present invention From the mRNA obtained from the hindlimb of the embryo at 17.5 days of development of the mouse Shows the result of confirming the expression level of CSNK2B through quantitative RT-PCR.
^{4 is CSNK2B fl /fl} and CSNK2B ^prx1 according to an embodiment of the present invention Shows the results of confirming the degree of bone and cartilage differentiation through histological staining in embryos on day 17.5 of mouse development.
^{5 is CSNK2B fl /fl} and CSNK2B ^px1 according to an embodiment of the present invention Shows the results of confirming the degree of bone and cartilage differentiation through histological staining in the forelimb, hindlimb, and clavicle of the embryo at 17.5 days of development of the mouse.
^{6 A and B are CSNK2B fl /fl} and CSNK2B ^px1 according to an embodiment of the present invention Shows the results of confirming the degree of bone and cartilage differentiation in the humeri and femur of each mouse through safranin O staining.
^{7 is CSNK2B fl /fl} and CSNK2B ^prx1 according to an embodiment of the present invention Photographs of embryos (E16.5) and newborns (P0) at day 16.5 of mouse development are shown.
^{8 A and B are CSNK2B fl /fl} and CSNK2B ^prx1 according to an embodiment of the present invention Shows the results of confirming the degree of bone and cartilage differentiation in the whole body, forelimbs, and hind legs of a mouse neonatal (PO).
^{9 A to C are CSNK2B fl /fl} and CSNK2B ^prx1 according to an embodiment of the present invention Shows the results of confirming the degree of bone and cartilage differentiation in the skull, finger, and clavicle of a mouse newborn (PO).
^{10 A and B are CSNK2B fl /fl} and CSNK2B ^prx1 according to an embodiment of the present invention Shows the results of confirming the degree of bone and cartilage differentiation in the humeri and femur of each mouse through H&E staining.

Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited by the following examples.

Example

[Preparation Example 1] Culture of Human Bone Marrow-Derived Mesenchymal Stem Cells (hBMSCs)

All of the experiments below were conducted under the approval of the Institutional Review Board (IRB) (approval number: IRB no. 4-2018-1223). Bone marrow aspirates were obtained from the posterior iliac crest of 6 adult donors. Human bone marrow-derived mesenchymal stem cells (hBMSCs) were selected based on their ability to be adsorbed from the bone marrow puncture to the plastic cell culture flask. The selected hBMSCs were cultured in a culture medium (DMEM-LG (low-glucose Dulbecco's modified Eagle's medium; Gibco) containing 10% FBS (Gibco, Grand Island, NY, USA) and 1% antibiotic-antifungal solution (Gibco)). cultured. Here, by flow cytometry analysis according to a conventional method, only cells whose characteristics of hBMSCs were confirmed by showing that CD90 and CD105 were positive and CD34 and CD45 were negative were used in the experiment below.

[ preparation example 2] CK2 β (Casein kinase 2 β) the expression level of the gene encoding the suppressed hBMSCs produce

The nucleotide sequence shown in SEQ ID NO: 4 complementary to a part of the nucleotide sequence of CSNK2B (Casein Kinase 2 Beta), which is the gene encoding CK2 β of the lentiviral vector (pLKO.1-Puro Lentiviral Vector; Sigma-Aldrich, Korea), is inserted Thus, pLKO.1-puro-CSNK2B was prepared. Here, for the control, a control vector (shScramble, SHC016, pLKO.1-puro (Yonsei Genome Center)) into which a non-target shRNA nucleotide sequence was inserted was used instead of the nucleotide sequence shown in SEQ ID NO: 4.

The lentiviral vector was transformed into Lenti-X-293FT (Clontech, USA) cells using a viral packaging mix (Sigma-Aldrich, USA) and Lipofectamine LTX PLUS (Invitrogen, USA) according to the protocol provided by the manufacturer. Then, the transformed cells were cultured and the virus was obtained from the culture medium of the cells. Then, the obtained virus was cultured in the hBMSCs of Preparation Example for 24 hours. Thereafter, by removing the culture medium containing the virus and culturing for 24 hours or more in a new culture medium containing 10 μg/ml of puromycine antibiotic, only cells resistant to antibiotics are selected by selecting CSNK2B hBMSCs with suppressed expression and control hBMSCs were prepared.

name number base sequence shCSNK2B SEQ ID NO: 4 CCGGCCAACCAGAGTGACCTGATTGCTCGAGCAATCAGGTCACTCTGGTTGGTTTTTG

[ preparation example 3] CSNK2B Defective animal model creation

CSNK2B ^{fl /fl} mice were based on C57BL/6 mice, Nat Immunol. It was prepared according to the method described in 2015 Mar;16(3):267-75. Furthermore, for CSNK2B ^Prx1 mice, only male mice ^{with a CSNK2B Prx1} phenotype were selected among mice born by breeding Prx1-cre mice and CSNK2B ^{fl /fl mice.}

[ Example One] Cartilage by suppression of expression of gene encoding CK2 protein pluripotency change check

For micromass ^{culture, 1 × 10 5} (10 μl) of CSNK2B expression-inhibited hBMSCs or control hBMSCs pellets prepared in [Preparation Example 2] above were carefully placed in a 24-well plate, 37 It was allowed to adhere at ℃ for 2 hours. Then, chondrocyte differentiation medium (1× insulin-transferrin-selenium-A [Gibco], 1% antibiotic-antifungal solution, 50 μg/mL ascorbic acid, and 10 ng/mL transforming growth factor-β3 (TGF-β 3; R&D Systems) were cultured in DMEM-HG (High-glucose Dulbecco's modified Eagle's medium; Gibco)) for 21 days, and the microscopic pellet of the cells was fixed in 10% formalin for 24 hours. After fixation, the formalin-fixed specimens were embedded in paraffin. The paraffin-embedded sections were deparaffinized, rehydrated, and washed twice with PBS. Then, the sections were sliced to a thickness of 4 μm, and stained with Alcian Blue, and the results are shown in FIG. 1 .

As shown in FIG. 1 , compared with control hBMSCs, it was confirmed that chondrogenic differentiation capacity was significantly increased when chondrogenesis proceeded for 21 days in hBMSCs in which CSNK2B expression was suppressed.

Through the above results, differentiation into cartilage or adipocytes can be inhibited by the CK2β protein and the gene encoding it, and by suppressing the expression level of these proteins and genes, mesenchymal stem cells induce differentiation into cartilage, cartilage It can be seen that it can promote differentiation into

[ Example 2] Confirmation of gene expression level related to cartilage differentiation by suppression of expression of gene encoding CK2 protein

Total RNA was isolated using QIAzol (QIAGEN) from hBMSCs and control hBMSCs in which the expression of CSNK2B was inhibited, respectively, prepared in [Preparation Example 2]. Then, cDNA was synthesized from the isolated total RNA using a High-Capacity cDNA Reverse Transcription Kit (Reverse Transcription Kit, Applied Biosystems). Using the thus synthesized cDNA as a template, CSNK2A1 (Casein Kinase 2 Alpha 1) , CSNK2A2 (Casein Kinase 2 Alpha 2) , CSNK2B , SOX9 (SRY-Box Transcription Factor 9), ACAN (Aggrecan), Using primer sets specific for COL2A1 (Collagen, type II, alpha 1) and HPRT (Hypoxanthine-guanine phosphoribosyltransferase), SYBR® Green PCR Master Mix (Applied Biosystems) and QuantStudio Quantitative RT-PCR (realtime-Polymerase chain reaction) was performed through the 6 Flex System (Applied Biosystems), and the results are shown in FIG. 2 .

gene SEQ ID NO: Characteristic order CSNK2B SEQ ID NO: 5 forward CGACTAATAGACTGGGGTTTGG SEQ ID NO: 6 reverse TCATACTTGCCAGCATACAACC CSNK2A2 SEQ ID NO: 7 forward AATGTTCGTGTAGCCTCAAAGGT SEQ ID NO: 8 reverse CTGGTCATAGTTGTCCTGTCCA CSNK2B SEQ ID NO: 9 forward GCCTGATGAAGAACTGGAAGAC SEQ ID NO: 10 reverse TAACCAAAGTCTCCTTGCTGGT SOX9 SEQ ID NO: 11 forward ATCAAGACGGAGCAGCTGAG SEQ ID NO: 12 reverse TGGTGGTCGGTGTAGTCGTA ACAN SEQ ID NO: 13 forward GAATCAACTGCTGCAGACCA SEQ ID NO: 14 reverse ATGCTGCTCAGGTGTGACTG COL2A1 SEQ ID NO: 15 forward GTCTACCCCAATCCAGCAAA SEQ ID NO: 16 reverse GTGGGAGCCAGATTGTCAT HPRT SEQ ID NO: 17 forward GCTATAAATTCTTTGCTGACCTGCTG SEQ ID NO: 18 reverse AATTACTTTTATGTCCCCTGTTGACTGG

As shown in FIG. 2 , the expression levels of SOX9 , ACAN and COL2A1 were all significantly increased in chondrocytes differentiated from hBMSCs in which the expression of CSNK2B was suppressed, compared to control hBMSCs.

Through the above results, it can be seen that by suppressing the expression level of the CK2β protein and the gene encoding it, the mesenchymal stem cells induce differentiation into cartilage and promote differentiation into cartilage.

[Example 3] Confirmation of cartilage formation according to CSNK2B gene deletion in experimental animals

[3-1] Check for gene deletion

^{CSNK2B fl /fl} and CSNK2B ^prx1 which are the animal models of [Preparation Example 3] In order to extract total RNA from the limbs of mice, the hind limb tissues of fetal mice 17.5 days after fertilization were excised, and the tissues were sufficiently homogenized. Then, using the homogenized sample, total RNA was extracted in the same manner as in [Example 2], and quantitative RT-PCR was performed using the primer set shown in Table 3 below, and the result is shown in FIG. it was

gene SEQ ID NO: Characteristic order CSNK2B SEQ ID NO: 19 forward TCTTCTGTGAGGTGGATGAAGA SEQ ID NO: 20 reverse CTCTTCATCAGGTTCCAGGTCT HPRT SEQ ID NO: 21 forward CTGGTGAAAAGGACCTCTCGAAG SEQ ID NO: 22 reverse CCAGTTTCACTAATGACACAAACG

As shown in FIG. 3 , it was confirmed that the expression of the CSNK2B gene was lowered by more than two times in the CSNK2B ^px1 mouse compared to ^{the CSNK2B fl /fl mouse corresponding to the control group.}

[3-2] Histological analysis

In the production process of the animal model of [Preparation Example 3], CSNK2B ^{fl /fl} and CSNK2B ^prx1 After isolation of mouse embryos at day 17.5 of development, 25 mg/kg calcein (Calcein, Sigma, C0875) and 50 mg/kg alizarin-3-methyliminodiacetic dissolved in 2% sodium bicarbonate solution Acid (alizarin-3-methyliminodiacetic acid, Sigma, A3882) was subcutaneously injected into mice every 5 days. After incubation in 10% neutral buffered formalin for 2 days, the uncalcified femur sample was embedded in methyl methacrylate. Then, the proximal metaphysis is cut in the longitudinal direction (5 μm), and this is obtained by bone formation rate/bone surface (BFR/BS), mineral apposition rate (MAR), Nikon implemented as a semi-automated analysis system (Osteometrics) in which the bone area (B.Ar) and osteoclast number/bone parameter (N.Oc/B.Pm) are defined as objects of measurement It was measured using an Optiphot 2 microscope, and the results are shown in FIGS. 4 and 5 . Here, during measurement, two sections/samples were separated by ~25 μm, and summed before normalization to obtain a single measurement/sample according to the ASBMR standard.

As shown in Figures 4 and 5, compared to the control group CSNK2B ^{fl /fl} mice, CSNK2B ^px1 It was confirmed that although the cartilage indicated in blue was very well formed in the mouse, the bone was not properly formed.

[ Example 4] in laboratory animals CSNK2B Cartilage due to gene deletion pluripotency Check the inhibitory effect (1)

For histological analysis in the animal model of [Preparation Example 3], the ^{humeri and femur of each of CSNK2B fl /fl} and CSNK2B ^px1 mice were dissected and fixed in 10% neutral buffered formalin for 2 days. After that, the lime was sufficiently removed through the process of daily changing 15% tetrasodium EDTA for 1 to 2 weeks. Then, the tissue was dehydrated using ethanol, washed twice using xylene, paraffinized using paraffin, and sectioned at a thickness of 7 μm from anterior to posterior along a tubular plate. Finally, the section was stained with safranin O, and the results are shown in A and B of FIG. 6 .

As shown in A and B of Figure 6, CSNK2B prx1 ^{having a deletion in the CSNK2B gene} In both the humerus and femur of ^{mice, compared with the normal control CSNK2B fl /fl} mice, the process of cartilage-to-bone differentiation was significantly delayed.

Through the above results, it can be seen that since the CSNK2B gene deficiency inhibits the differentiation of cartilage into bone, such a phenomenon can eventually lead to an increase in cartilage differentiation ability by suppression of the CSNK2B gene.

[ Example 5] in laboratory animals CSNK2B Characterization of skeletal phenotype according to gene deletion

In the production process of the animal model of [Preparation Example 3], CSNK2B ^{fl /fl} and CSNK2B ^prx1 The pictures of embryos (E16.5) and newborns (P0) on day 16.5 of mouse development were taken and shown in FIG. 7 . In addition, the bone and cartilage of the newborn were stained in the same manner as in Example [3-2], and the results are shown in FIGS. 8A and B and FIGS. 9A to 9C.

7, 8A and B, and as shown in FIGS. 9A to 9C, when bone and cartilage tissues were observed, compared with CSNK2B ^{fl /fl} mice corresponding to the control group, CSNK2B ^prx1 It was confirmed that cartilage tissue was present at a significantly higher level than bone in the forelimb, hindlimb, skull, digit, and sternum of the mouse.

[ Example 6] in laboratory animals CSNK2B Cartilage due to gene deletion pluripotency Check the inhibitory effect (2)

For histological analysis in newborns of the animal model of [Preparation Example 3], the same steps as in [Example 4] were performed, and after obtaining a section, hematoxylin & eosin (hematoxylin and eosin) in place of safranin O eosin; H&E), and the results are shown in A and B of FIG. 10 .

^{As shown in FIGS. 10A and 10B ,} both the humerus and femur of CSNK2B prx1 mice with a deletion in the CSNK2B gene significantly delayed the process of cartilage-to-bone differentiation compared to ^{CSNK2B fl /fl mice, a normal control group.}

As the specific parts of the present invention have been described in detail above, for those of ordinary skill in the art, these specific techniques are only preferred embodiments, and it is clear that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> A Composition for regeneration of tissue <130> PDPB194255 <160> 22 <170> KoPatentIn 3.0 <210> 1 <211> 391 <212> PRT <213> homo sapiens <400> 1 Met Ser Gly Pro Val Pro Ser Arg Ala Arg Val Tyr Thr Asp Val Asn 1 5 10 15 Thr His Arg Pro Arg Glu Tyr Trp Asp Tyr Glu Ser His Val Val Glu 20 25 30 Trp Gly Asn Gln Asp Asp Tyr Gln Leu Val Arg Lys Leu Gly Arg Gly 35 40 45 Lys Tyr Ser Glu Val Phe Glu Ala Ile Asn Ile Thr Asn Asn Glu Lys 50 55 60 Val Val Val Lys Ile Leu Lys Pro Val Lys Lys Lys Lys Ile Lys Arg 65 70 75 80 Glu Ile Lys Ile Leu Glu Asn Leu Arg Gly Gly Pro Asn Ile Ile Thr 85 90 95 Leu Ala Asp Ile Val Lys Asp Pro Val Ser Arg Thr Pro Ala Leu Val 100 105 110 Phe Glu His Val Asn Asn Thr Asp Phe Lys Gln Leu Tyr Gln Thr Leu 115 120 125 Thr Asp Tyr Asp Ile Arg Phe Tyr Met Tyr Glu Ile Leu Lys Ala Leu 130 135 140 Asp Tyr Cys His Ser Met Gly Ile Met His Arg Asp Val Lys Pro His 145 150 155 160 Asn Val Met Ile Asp His Glu His Arg Lys Leu Arg Leu Ile Asp Trp 165 170 175 Gly Leu Ala Glu Phe Tyr His Pro Gly Gln Glu Tyr Asn Val Arg Val 180 185 190 Ala Ser Arg Tyr Phe Lys Gly Pro Glu Leu Leu Val Asp Tyr Gln Met 195 200 205 Tyr Asp Tyr Ser Leu Asp Met Trp Ser Leu Gly Cys Met Leu Ala Ser 210 215 220 Met Ile Phe Arg Lys Glu Pro Phe Phe His Gly His Asp Asn Tyr Asp 225 230 235 240 Gln Leu Val Arg Ile Ala Lys Val Leu Gly Thr Glu Asp Leu Tyr Asp 245 250 255 Tyr Ile Asp Lys Tyr Asn Ile Glu Leu Asp Pro Arg Phe Asn Asp Ile 260 265 270 Leu Gly Arg His Ser Arg Lys Arg Trp Glu Arg Phe Val His Ser Glu 275 280 285 Asn Gln His Leu Val Ser Pro Glu Ala Leu Asp Phe Leu Asp Lys Leu 290 295 300 Leu Arg Tyr Asp His Gln Ser Arg Leu Thr Ala Arg Glu Ala Met Glu 305 310 315 320 His Pro Tyr Phe Tyr Thr Val Val Lys Asp Gln Ala Arg Met Gly Ser 325 330 335 Ser Ser Met Pro Gly Gly Ser Thr Pro Val Ser Ser Ala Asn Met Met 340 345 350 Ser Gly Ile Ser Ser Val Pro Thr Pro Ser Pro Leu Gly Pro Leu Ala 355 360 365 Gly Ser Pro Val Ile Ala Ala Ala Asn Pro Leu Gly Met Pro Val Pro 370 375 380 Ala Ala Ala Gly Ala Gln Gln 385 390 <210> 2 <211> 350 <212> PRT <213> homo sapiens <400> 2 Met Pro Gly Pro Ala Ala Gly Ser Arg Ala Arg Val Tyr Ala Glu Val 1 5 10 15 Asn Ser Leu Arg Ser Arg Glu Tyr Trp Asp Tyr Glu Ala His Val Pro 20 25 30 Ser Trp Gly Asn Gln Asp Asp Tyr Gln Leu Val Arg Lys Leu Gly Arg 35 40 45 Gly Lys Tyr Ser Glu Val Phe Glu Ala Ile Asn Ile Thr Asn Asn Glu 50 55 60 Arg Val Val Val Lys Ile Leu Lys Pro Val Lys Lys Lys Lys Ile Lys 65 70 75 80 Arg Glu Val Lys Ile Leu Glu Asn Leu Arg Gly Gly Thr Asn Ile Ile 85 90 95 Lys Leu Ile Asp Thr Val Lys Asp Pro Val Ser Lys Thr Pro Ala Leu 100 105 110 Val Phe Glu Tyr Ile Asn Asn Thr Asp Phe Lys Gln Leu Tyr Gln Ile 115 120 125 Leu Thr Asp Phe Asp Ile Arg Phe Tyr Met Tyr Glu Leu Leu Lys Ala 130 135 140 Leu Asp Tyr Cys His Ser Lys Gly Ile Met His Arg Asp Val Lys Pro 145 150 155 160 His Asn Val Met Ile Asp His Gln Gln Lys Lys Leu Arg Leu Ile Asp 165 170 175 Trp Gly Leu Ala Glu Phe Tyr His Pro Ala Gln Glu Tyr Asn Val Arg 180 185 190 Val Ala Ser Arg Tyr Phe Lys Gly Pro Glu Leu Leu Val Asp Tyr Gln 195 200 205 Met Tyr Asp Tyr Ser Leu Asp Met Trp Ser Leu Gly Cys Met Leu Ala 210 215 220 Ser Met Ile Phe Arg Arg Glu Pro Phe Phe His Gly Gln Asp Asn Tyr 225 230 235 240 Asp Gln Leu Val Arg Ile Ala Lys Val Leu Gly Thr Glu Glu Leu Tyr 245 250 255 Gly Tyr Leu Lys Lys Tyr His Ile Asp Leu Asp Pro His Phe Asn Asp 260 265 270 Ile Leu Gly Gln His Ser Arg Lys Arg Trp Glu Asn Phe Ile His Ser 275 280 285 Glu Asn Arg His Leu Val Ser Pro Glu Ala Leu Asp Leu Leu Asp Lys 290 295 300 Leu Leu Arg Tyr Asp His Gln Gln Arg Leu Thr Ala Lys Glu Ala Met 305 310 315 320 Glu His Pro Tyr Phe Tyr Pro Val Val Lys Glu Gln Ser Gln Pro Cys 325 330 335 Ala Asp Asn Ala Val Leu Ser Ser Gly Leu Thr Ala Ala Arg 340 345 350 <210> 3 <211> 215 <212> PRT <213> homo sapiens <400> 3 Met Ser Ser Ser Glu Glu Val Ser Trp Ile Ser Trp Phe Cys Gly Leu 1 5 10 15 Arg Gly Asn Glu Phe Phe Cys Glu Val Asp Glu Asp Tyr Ile Gln Asp 20 25 30 Lys Phe Asn Leu Thr Gly Leu Asn Glu Gln Val Pro His Tyr Arg Gln 35 40 45 Ala Leu Asp Met Ile Leu Asp Leu Glu Pro Asp Glu Glu Leu Glu Asp 50 55 60 Asn Pro Asn Gln Ser Asp Leu Ile Glu Gln Ala Ala Glu Met Leu Tyr 65 70 75 80 Gly Leu Ile His Ala Arg Tyr Ile Leu Thr Asn Arg Gly Ile Ala Gln 85 90 95 Met Leu Glu Lys Tyr Gln Gln Gly Asp Phe Gly Tyr Cys Pro Arg Val 100 105 110 Tyr Cys Glu Asn Gln Pro Met Leu Pro Ile Gly Leu Ser Asp Ile Pro 115 120 125 Gly Glu Ala Met Val Lys Leu Tyr Cys Pro Lys Cys Met Asp Val Tyr 130 135 140 Thr Pro Lys Ser Ser Arg His His His Thr Asp Gly Ala Tyr Phe Gly 145 150 155 160 Thr Gly Phe Pro His Met Leu Phe Met Val His Pro Glu Tyr Arg Pro 165 170 175 Lys Arg Pro Ala Asn Gln Phe Val Pro Arg Leu Tyr Gly Phe Lys Ile 180 185 190 His Pro Met Ala Tyr Gln Leu Gln Leu Gln Ala Ala Ser Asn Phe Lys 195 200 205 Ser Pro Val Lys Thr Ile Arg 210 215 <210> 4 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shCSNK2B <400> 4 ccggccaacc agagtgacct gattgctcga gcaatcaggt cactctggtt ggtttttg 58 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 5 cgactaatag actggggttt gg 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 6 tcatacttgc cagcatacaa cc 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 7 aatgttcgtg tagcctcaag gt 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 8 ctggtcatag ttgtcctgtc ca 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 9 gcctgatgaa gaactggaag ac 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 10 taaccaaagt ctccttgctg gt 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 11 atcaagacgg agcagctgag 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 12 tggtggtcgg tgtagtcgta 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 13 gaatcaactg ctgcagacca 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 14 atgctgctca ggtgtgactg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 15 gtctacccca atccagcaaa 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 16 gttgggagcc agattgtcat 20 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 17 gctataaatt ctttgctgac ctgctg 26 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 18 aattactttt atgtcccctg ttgactgg 28 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 19 tcttctgtga ggtggatgaa ga 22 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 20 ctcttcatca ggttccaggt ct 22 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 21 ctggtgaaaa ggacctctcg aag 23 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 22 ccagtttcac taatgacaca aacg 24

Claims (13)

As a pharmaceutical composition for cartilage tissue regeneration comprising as an active ingredient an expression inhibitor of a gene encoding human CK2 β (casein kinase 2 β) protein,
The expression inhibitor of the gene encoding the CK2 β protein comprises an antisense oligonucleotide represented by SEQ ID NO: 4 that complementarily binds to a part of the nucleotide sequence of CSNK2B (Casein Kinase 2 Beta), a gene encoding CK2 β. Phosphorus, composition. delete The method of claim 1,
The cartilage tissue is at least one selected from the group consisting of hyaline cartilage (Hyaline cartilage), elastic cartilage (Elastic cartilage) and fibrocartilage (Fibrocartilage), the composition. delete delete delete As a pharmaceutical composition for the prevention or treatment of cartilage disease comprising an inhibitor of expression of a gene encoding a human CK2 β (casein kinase 2 β) protein as an active ingredient,
The expression inhibitor of the gene encoding the CK2 β protein comprises an antisense oligonucleotide represented by SEQ ID NO: 4 that complementarily binds to a portion of the nucleotide sequence of CSNK2B (Casein Kinase 2 Beta), which is a gene encoding CK2 β. ,
The cartilage disease is arthritis; osteoporosis; osteochondrosis; osteochondritis; incomplete osteoplasty; osteomyelitis; osteophyte; achondroplasia; chondritis; chondroma; chondrosarcoma; herniated disc; Klippel-Pyle Syndrome; osteomyelitis; cystic fibroostitis; Fracture; And at least one selected from the group consisting of cartilage damage due to an accident, the composition. delete delete As a food composition for cartilage tissue regeneration comprising an expression inhibitor of a gene encoding human CK2 β (casein kinase 2 β) protein as an active ingredient,
The expression inhibitor of the gene encoding the CK2 β protein comprises an antisense oligonucleotide represented by SEQ ID NO: 4 that complementarily binds to a part of the nucleotide sequence of CSNK2B (Casein Kinase 2 Beta), a gene encoding CK2 β. Phosphorus, composition. delete As a food composition for the prevention or improvement of cartilage disease comprising an expression inhibitor of a gene encoding a human CK2 β (casein kinase 2 β) protein as an active ingredient,
The expression inhibitor of the gene encoding the CK2 β protein comprises an antisense oligonucleotide represented by SEQ ID NO: 4 that complementarily binds to a part of the nucleotide sequence of CSNK2B (Casein Kinase 2 Beta), which is a gene encoding CK2 β. ,
The cartilage disease is arthritis; osteoporosis; osteochondrosis; osteochondritis; incomplete osteoplasty; osteomyelitis; osteophyte; achondroplasia; chondritis; chondroma; chondrosarcoma; herniated disc; Klippel-Pyle Syndrome; osteomyelitis; cystic fibroostitis; Fracture; And at least one selected from the group consisting of cartilage damage due to an accident, the composition. delete

Images