KR102334245B1 - A Composition for Culturing Human Taste Bud Organoid - Google Patents

Abstract

The present invention relates to a medium composition for culturing human taste bud organoids and a method for preparing human taste bud organoids using the same. The present invention provides an optimal culture environment for human taste bud organoids, which has not yet been proposed, by selecting essential culture components specific to human taste buds, which are delicate sensory organs, through various experiments. Therefore, the present invention can be usefully used in the production of an efficient organoid in which major functions and phenotypes in vivo, such as the gene expression profile of the human taste bud and the response to taste circles, are completely reproduced.

Description

A composition for culturing human taste organoids {A Composition for Culturing Human Taste Bud Organoid}

The present invention relates to a medium composition for culturing a three-dimensional organoid culture, specifically, a human taste bud organoid.

Stem cells have unique multi-potency and self-renewal abilities, so they are applied to regenerative treatment for various degenerative diseases caused by irreversible tissue loss. It has been found that when cultured in a three-dimensional environment, a structure similar to an in vivo organ is formed, and this is called an organoid or organoid. By reproducing a three-dimensional environment similar to in vivo using these organoids, the test substance can be tested as if it were acting in vivo in an in vitro experimental situation, and the actions and effects of real objects, such as human organs, can be tested. Since it can be reproduced in vitro, it can be usefully used for disease modeling, pathological research, drug screening, toxicity evaluation, and genetic manipulation.

Since, in theory, all kinds of similar organs can be produced only with stem cells, organoids can be used for research on various diseases. However, the culture and maintenance technology of organoids has not yet been completely established at the initial research stage, and additional research is needed on specific culture medium components and effective culture methods.

Numerous papers and patent documents are referenced throughout this specification and their citations are indicated. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly describe the level of the technical field to which the present invention pertains and the content of the present invention.

Patent Document 1. US Patent Application No. 11/352,924

In the culturing of a three-dimensional organotypic culture to which different culture components must be applied according to the nature of the organ to be reproduced, the present inventors have proposed a method for obtaining an organoid for human taste bud, which has not yet been proposed. In order to establish an optimal culture environment, intensive research efforts were made. As a result, when the basal media for progenitor cells or pluripotent cells is supplemented with active ingredients including Wnt agonists, bone morphogenetic protein (BMP) inhibitors, TGF-β inhibitors and cAMP pathway activators, it is a culture component The present invention was completed by discovering that it is possible to obtain an efficient organoid in which the in vivo function and phenotype of human taste buds can be reproduced at a high level.

Accordingly, it is an object of the present invention to provide a medium composition for culturing human taste bud organoids.

Another object of the present invention is to provide a method for preparing a human taste bud organoid using the medium composition.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a culture medium for human taste bud organoids comprising a Wnt agonist, a bone morphogenetic protein (BMP) inhibitor, a TGF-β inhibitor, and a cAMP pathway activator as active ingredients A composition is provided.

In the culturing of a three-dimensional organotypic culture to which different culture components must be applied according to the nature of the organ to be reproduced, the present inventors have proposed a method for obtaining an organoid for human taste bud, which has not yet been proposed. In order to establish an optimal culture environment, intensive research efforts were made. As a result, when the basal media for progenitor cells or pluripotent cells is supplemented with active ingredients including Wnt agonists, bone morphogenetic protein (BMP) inhibitors, TGF-β inhibitors and cAMP pathway activators, it is a culture component It was found that efficient organoids with high levels of in vivo function and phenotype of human taste buds could be obtained.

As used herein, the term “organoid” refers to an ex vivo 3D cellular cluster composed of primary tissue, tissue subunits, or single cells (eg, stem cells). Organoids are capable of self-renewal and self-organization and reproduce phenotypes and functions similar to those of the original tissue, so they can also be termed “small-like organs” or “organ analogues”.

The organoids that can be cultured with the composition of the present invention may be, for example, organoids derived from pluripotent stem cells or organoids derived from adult stem cells, and the pluripotent stem cells are embryonic stem cells (ESCs). ) or induced pluripotent stem cells (iPSCs). Specifically, the organoid of the present invention is an organoid derived from an adult stem cell, and more specifically, an organoid derived from an adult stem cell isolated from a human taste bud.

As used herein, the term “stem cell” refers to a cell capable of differentiating into various cells constituting biological tissues, and refers to undifferentiated cells that can reproduce without limitation to form specialized cells of tissues and organs. . The term "adult stem cell" refers to a stem cell that appears in the stage of development of each organ of the embryo or at the stage of adulthood.

As used herein, the term “culture” refers to proliferation, growth, maintenance, and differentiation of cells isolated from a living body, a two-dimensional or three-dimensional aggregate thereof, a tissue, or a part of a tissue in vitro. Accordingly, the term “culture” is meant to encompass the entire process of obtaining a target material in an artificial environment using a starting material (cell, tissue, or tissue analog), and “culture composition” means “proliferation composition”, It is meant to include all of “composition for growth”, “composition for maintenance” and “composition for differentiation induction”.

According to a specific embodiment of the present invention, the medium composition further comprises a basal media composition for stem cell culture. As such a basic medium, various mediums used for stem cell culture in the art may be used, for example, IMDM (Iscove's Modified Dulbecco's Medium), α-MEM (Alpha Modification of Eagle's Medium), F12 (Nutrient Mixture F-12) ) and DMEM/F12 (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12). Specifically, the basal medium for stem cell culture used in the present invention may be Advanced DMEM/F12 medium.

According to one embodiment of the present invention, the culture composition of the present invention is a composition in which the above-described composition specific for human taste bud organoid culture is combined with a basal media composition for stem cell culture. Therefore, the meaning of "additionally comprising the basic medium composition for stem cell culture" has the same meaning as that the composition specific for the above-described organoid culture is supplemented or added to the basic medium for stem cell culture am.

According to a specific embodiment of the present invention, the Advanced DMEM/F12 medium is supplemented with one or more components selected from the group consisting of zwitterionic buffer, alanylglutamine, B-27, N2 and N-acetylcysteine. . More specifically, the zwitterionic buffer is at least one buffer selected from the group consisting of HEPES, MOPs and bicarbonate buffer, and most specifically HEPES.

As used herein, the term “Wnt agonist” refers to a substance that activates TCF/LEF-mediated transcription in cells, and binds to and activates any one of the Wnt family proteins, inhibits intracellular β-catenin degradation, or TCF/ It is meant to encompass substances that activate LEF.

According to a specific embodiment of the present invention, the Wnt agonist used in the present invention is Wnt3a, Wnt-4, Wnt-5a, Wnt-5b, Wnt-6, Wnt-7a, Wnt-7b, R-spondin (spondin )-1, R-spondin-2, R-spondin-3, R-spondin-4, and at least one agonist selected from the group consisting of Norrin. More specifically, it is selected from the group consisting of Wnt3a, R-spondin-1, and combinations thereof, and most specifically, it is a combination of Wnt3a and R-spondin-1.

When Wnt3a and/or R-spondin-1 is used as a Wnt agonist in the present invention, a basal culture medium in the form of Wnt3a-conditioned media (CM) and R-spondin-1-conditioned medium, respectively can be added to

As used herein, the term “bone morphogenetic protein (BMP) inhibitor” refers to a substance that neutralizes or inhibits BMP activity by competitively binding to a BMP molecule or BMP receptor and inhibiting the formation of a complex between BMP and BMP receptor. The BMP inhibitor used in the present invention includes various natural or synthetic molecules known in the art to form a bond with a BMP molecule or its receptor, for example, including Noggin, CER1 and Gremlin, However, the present invention is not limited thereto. Specifically, the BMP inhibitor used in the present invention is Noggin.

When Noggin is used as the BMP inhibitor in the present invention, 30 - 120 ng/ml, more specifically 50 - 120 ng/ml, still more specifically 70 - 120 ng/ml, most specifically 90 - Can be added at 110 ng/ml.

As used herein, the term “TGF-β inhibitor” refers to various natural or synthetic molecules that directly or indirectly inhibit or inhibit the TGF-β signaling pathway, for example, A83-01, SB-431542, SB-505124, SB -525334, SD-208, LY-36494, SJN-2511 and LY2157299 (galunisertib).

According to a specific embodiment of the present invention, the TGF-β inhibitor used in the present invention is at least one inhibitor selected from the group consisting of A83-01, SB-505124 and galunisertib, and more specifically, A83- 01.

When A83-01 is used as the TGF-β inhibitor in the present invention, it may be added to the basal culture medium at 2-8 μM, more specifically at 3-7 μM, and most specifically at 4-6 μM.

As used herein, the term “cAMP pathway activator” refers to various natural or synthetic molecules that directly or indirectly promote the cAMP pathway by increasing the production of cAMP or increasing the activity or expression level of adenylyl cyclase. it means. According to a specific embodiment of the present invention, the cAMP pathway activator used in the present invention is one or more activators selected from the group consisting of Forskolin, 8-bromo-cAMP, cholera toxin and NKH 477, and more Specifically, forskolin.

When forskolin is used as a cAMP pathway activator in the present invention, it may be added to the basal culture medium at 5-15 μM, more specifically 7-13 μM, and most specifically 9-11 μM.

According to a specific embodiment of the present invention, the composition of the present invention may further include a mitogenic growth factor. As used herein, the term “mitogenic growth factor” refers to a protein secreted from a specific cell to promote mitosis and differentiation of other cells. More specifically, the mitogenic growth factor is epidermal growth factor (EGF), fibroblast growth factor (FGF) 10, transforming growth factor (TGF)-α, brain-derived neurotrophic factor (BDNF) and keratinocyte growth factor (KGF). It is one or more growth factors selected from the group consisting of, more specifically, it is selected from the group consisting of EGF, FGF10, and combinations thereof, and most specifically, it is a combination of EGF and FGF10.

When EGF is used as a mitogenic growth factor in the present invention, it may be added to the basal culture medium at 30 - 70 ng/ml, more specifically 40 - 60 ng/ml, and even more specifically 45 - 55 ng/ml. have.

When FGF10 is used as a mitogenic growth factor in the present invention, 70 - 130 ng/ml, more specifically 80 - 120 ng/ml, more specifically 90 - 110 ng/ml may be added to the basal culture medium. have.

According to a specific embodiment of the present invention, the composition of the present invention further comprises nicotinamide. According to the present invention, it has been found that when nicotinamide is additionally included in the medium composition of the present invention, it is possible to more efficiently grow and expand undifferentiated cells such as human taste bud stem/progenitor cells in an aggregated three-dimensional form. Therefore, the culture medium of the present invention additionally containing nicotinamide (hereinafter referred to as the “first culture medium”) is a medium for promoting the growth or expansion of organoids, and thus referred to as “medium for growth” or “medium for expansion” can be

When nicotinamide is included, it may be added to the basal culture medium at 6-14 mM, more specifically 7-13 mM, even more specifically 8-12 mM, most specifically 9-11 mM.

According to a specific embodiment of the present invention, the composition of the present invention further comprises IL-4 (interleukin-4) and a sonic hedgehog agonist. More specifically, the sonic hedgehog agonist is a compound represented by the following formula (1):

Formula 1

wherein R is hydrogen or C ₁ -C ₃ alkyl, and X is halogen.

As used herein, the term “alkyl” refers to a straight-chain or branched saturated hydrocarbon group, and includes, for example, methyl, ethyl, propyl, isopropyl, and the like. C ₁ -C ₃ alkyl refers to an alkyl group having an alkyl unit having 1 to 3 carbon atoms, and when C ₁ -C ₃ alkyl is substituted, the carbon number of the substituent is not included.

As used herein, the term “halogen” refers to a halogen element, and includes, for example, fluoro, chloro, bromo and iodo.

Most specifically, in Formula 1, R is C ₁ alkyl, and X is Cl. The compound of Formula 1 wherein R is C ₁ alkyl and X is Cl is SAG (Smoothened Agonist).

As described above, when IL-4 and SAG are additionally included in the medium composition for culturing taste bud organoids of the present invention (hereinafter referred to as “second culture medium”), the remaining undifferentiated cells in the organoid are differentiated into adult taste bud cells. By promoting the growth, the proportion of undifferentiated cells is greatly reduced and excellent organoids that better reproduce the function and phenotype of taste buds in vivo can be obtained.

Accordingly, the second culture medium of the present invention may be referred to as “medium for inducing differentiation of organoids” or “medium for inducing differentiation of undifferentiated cells in organoids into human taste bud cells”.

When SAG is included, it may be added to the basal culture medium at 0.5-2 μM, more specifically 1-2 μM, and most specifically about 1 μM.

When IL-4 is included, it may be added to the basal culture medium at 50-150 ng/mL, more specifically 70-130 ng/mL, most specifically 90-110 ng/mL.

According to another aspect of the present invention, there is provided a method for producing a human taste bud organoid comprising the step of culturing adult stem cells isolated from tongue tissue in the above-described medium composition of the present invention.

Since the medium composition used in the present invention has already been described above, the description thereof is omitted to avoid excessive overlap.

According to a specific embodiment of the present invention, the tongue tissue is circumvallate papillae.

According to a specific embodiment of the present invention, the production method of the present invention further comprises adding a ROCK inhibitor to the medium for 2 to 5 days after initiation of culture.

As used herein, the term “ROCK inhibitor” refers to various natural or synthetic molecules that inhibit the expression or activity of rho-associated protein kinase (ROCK), for example, Y-27632, RKI-1447, GSK429286A and Y -30141, but is not limited thereto. Specifically, the ROCK inhibitor used in the present invention is Y-27632.

When Y-27632 is used as the ROCK inhibitor in the present invention, 5-30 μM, more specifically 5-20 μM, and even more specifically 5-15 μM may be added to the culture medium of the present invention.

According to a specific embodiment of the present invention, the method for preparing an organoid of the present invention comprises the following steps:

(a) culturing the adult stem cells isolated from the tongue tissue in the medium composition of the first culture medium; and

(b) culturing the resultant of step (a) in the medium composition of the second culture medium.

The present inventors do not use a uniform culture medium throughout the entire culture process to obtain taste bud organoids, but a first culture medium more optimized for growth and in vitro expansion by adding nicotinamide, IL-4 and SAG are added As described above, the production efficiency of taste bud organoids was maximized by dually and sequentially using the second culture medium more optimized for inducing differentiation into taste bud cells.

According to a specific embodiment of the present invention, the step (b), that is, replacing the first culture medium with the second culture medium is performed 5 to 12 days after the start of the culture. More specifically, it is carried out 6 to 11 days after the start of the culture, and most specifically, it is carried out after 7 to 10 days.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a medium composition for culturing human taste bud organoids and a method for preparing human taste bud organoids using the same.

(b) The present invention provides an optimal culture environment for human taste bud organoids, which has not yet been proposed, by selecting essential culture components specific to human taste buds, which are delicate sensory organs through various experiments.

(c) The present invention can be usefully used in the production of an efficient organoid in which major functions and phenotypes in vivo, such as the gene expression profile of human taste buds and the response to taste circles, are completely reproduced.

1 is a diagram showing the process of selecting the composition of the culture medium required for culturing human taste bud organoids, and is a diagram showing the normal growth, appearance, and phenotype of the organoid when each component is removed. Figure 1a shows a rich medium (A), EGF removal medium (B), SB202190 removal medium (C) and FGF removal medium (D), respectively, and Figure 1b shows Wnt3a removal medium (E), Noggin removal medium ( F), R-spondin 1 removal medium (G) and nicotinamide removal medium (H) are shown, respectively, and FIG. 1C shows A83-01 removal medium (I) and forskolin removal medium (J), respectively.
Figure 2 is a diagram showing the results of investigating the week (week) in which organoid growth stops when a single component is removed. W: Wnt3a-CM, E: EGF, N: Noggin, R: R-spondin-1-CM, F: FGF10, Ni: nicotinamide, Ti: A83-01, FSK: forskolin
3 is a diagram showing the expression of taste bud cell markers in human taste bud organoids. Lgr5 and Lgr6: stem cell markers; K8: intragemmal taste bud cell marker; NTPdase: type I taste cell marker; T1R1, T1R2, T1R3, Gustducin, PLCb2, TRPM5: type II taste cell marker; SNAP25: type III taste cell marker
4 is a diagram showing the results of H&E staining of human taste bud organoids. It shows a structure divided into a structure inside the taste bud containing taste cells in the center and a structure around the taste bud containing progenitor cells.
5 is a diagram showing the expression of functional taste bud cell progenitor cell protein markers in human taste bud organoids by immunofluorescence. SOX2: taste bud cell progenitor cell marker, Sonic Hedgehog: taste bud cell progenitor cell marker
6 is a diagram showing the expression of differentiated taste bud cell protein markers in human taste bud organoids by immunofluorescence. Car4: type III taste bud cell marker, SNAP25: type III taste bud cell marker, alpha-transducin (Gta): type II taste bud cell marker, TRPM5: type Ⅱ taste bud cell marker, K8: taste bud marker, GLAST: type I taste bud cell marker
7 is a diagram showing the calcium response of human taste bud organoids to taste stimuli.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Experimental method

human papillae specimen

Human circumvallate papillae were obtained from a patient who underwent tongue base surgery. The collection and use of clinical samples from patients were approved by the Research Review Board (IRB) of Yonsei University College of Medicine, and consent was obtained from patients participating in the study.

Human taste bud organoid culture

Immediately after surgery, the incised papilla and surrounding tissues were placed on ice and transferred to basal medium (modified Advanced DMEM/F12 supplemented with 1 x GlutaMax and 10 mM HEPES). The collected tissues were washed with basal medium and trimmed with fine scissors.

Pre-warmed Dispase II in DMEM (2mg/ml) was carefully injected subepithelially and incubated at 37°C for 15 minutes. After the epithelium including taste buds was peeled off from the tissue, it was dissolved by incubating it with 0.25% trypsin-EDTA at 37°C for 30 minutes. A single cell suspension was prepared by further dissociating the lysed epithelium by pipetting with a fire-polished glass pipette.

The obtained cell suspension was embedded in Matrigel and plated at a density of 10,000 - 50,000 cells/well in each well of a 24-well plate. After the matrigel-containing cells were coagulated, human taste bud organoid growth medium was added to each well.

Growth medium was 1X GlutaMax, 10 mM HEPES, 2% B-27, 1% N-2, 1 mM N-acetylcysteine, 50% Wnt3a-conditioned medium, 10% R-spondin-1-conditioned medium , modified Advanced DMEM/F12 supplemented with 50 ng/ml EGF, 100 ng/ml Noggin, 100 ng/ml FGF10, 10 mM nicotinamide, 5 mM A83-01 and 10 μM Forskolin. make it a composition.

In the first 3 days of culture, 10 μM Y-27632 was added to the medium. The medium was changed every 3 days and the organoids were subcultured every 4 weeks by lysing with 0.25% trypsin-EDTA for 5 minutes and reseeding in a new 24-well plate.

Thereafter, in order to optimize the differentiation into human taste bud cells, they were cultured in a growth medium for the first 7 to 10 days after subculture, and SAG (1 μM) and IL-4 (100 ng/mL) were additionally added while nicotinamide was removed. It was cultured by replacing it with an optimized medium.

RNA Isolation and Reverse Transcription PCR

RNA was isolated from human taste bud organoids using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. Reverse transcription of the isolated RNA was performed using the SuperScript™ IV First-Strand Synthesis System (Invitrogen) according to the manufacturer's instructions. The synthesized cDNA was amplified using the primers in Table 1 below.

Primers used for mRNA detection gene forward reverse Lgr4 GCTGGATGACAACAGCTTGA TTCCCCACAAAAGACAGAGG Lgr5 CTTCCAACCTCAGCGTCTTC CTGGACGGGGATTTCTGTTA Lgr6 GATGTGTGCCAGCTTCTTCA GGAAATGCCAGTCAAGGTGT K14 GAAGTGAAGATCCGTGACTGG GCAGAAGGACATTGGCATTG K8 TGCCTCTACCATGTCCATCA TCCAGGAACCGTACCTTGTC NTPDase 2 CTGGGTGACTGCCAACTACC GCTGTGGGTGTAGACTCGG TAS1R1 CGGAGTCTTCTCCTGACTTCA CCGTGGAGTTGTTTATCTCCTC TAS1R2 CGTCGTGGTCGTGTTCTCG CACTCGCGGAACTCACTGAAG TAS1R3 CCGCCTACTGCAACTACACG CTAGCACCGTAGCTGACCTG GNAT3 ATGAGGACCAACGACAAC GCGTAAGCTGCTGAGTCATTG TRPM5 GTGACCTGGAGGAGGTGATG AGCAGGCTCTTGCGTGAC PLCb2 CACCCCAGGGGCTATAAGAG GGACAGGGTTGAGCAGAGAC SNAP25 AAAAAGCCTGGGGCAATAAT AGCATCTTTGTTGCACGTTG K4 GTGGAGATTGACCCTGAGATC TCATTGCCCAAGGTATCTAGC K13 TGCCAGAACCAAGAGTACAAG GCCTACGGACATCAGAAGTG

immunofluorescence

Organoids were fixed with 4% paraformaldehyde and cryopreserved with 30% sucrose. Then, the organoids were cooled in a mold containing an Optimal Cutting Temperature (Leica). A 10 μm organoid section was prepared using a cryotome. Immunostaining was performed through standard procedures using the antibodies of Table 2 below. Images of Images of the stained organoid sections were taken using a confocal microscope (LSM 700, Zeiss).

Primary antibody used. antibody Where to get it identifier anti-human K8 DSHB Troma-I Anti-Human GLAST Chemicon AB1783 anti-human TRPM5 self-production anti-human gustducin Aviva System Biology OAEB00418 anti-human PLCβ2 Santa Cruz sc-515912 Anti-Human SNAP25 Sigma S9684 Anti-Human Car4 R&D AF2414 anti-human K13 Abcam Ab198584()

calcium image

Organoids were plated on poly-D-lysine coated coverslips to allow adsorption. Adsorbed cells were loaded with fura-2 dye in modified Tyrode buffer for 30 minutes. The cells were then placed in a perfusion chamber flowing with Tyrode buffer containing a taste stimulant. The stimulants used in the present invention are denatonium (10 mM) and sucrose (25 mM). Fluorescence images were obtained at excitation wavelengths of 340 and 380 nm.

Experiment result

Human taste bud organoid culture method and culture medium composition determination

The excised human papillary taste buds were placed in basal medium (modified Advanced DMEM/F12 supplemented with 1X GlutaMax and 10 mM HEPES) and transferred to the laboratory at a low temperature, and then the taste bud cells were dissociated into single cells by dissection and enzymatic lysis. These were mixed with Matrigel and cultured in each well of a 24-well plate in the form of a Matrigel dome. Various culture components in a culture form in which dissociated human taste bud cells are grown in a Matrigel dome to determine the composition of the culture medium that will enable growth and differentiation of organoids while maintaining the stemness of the stem cells that will make human taste bud organoids combinations were tested. The volume of the culture solution was 250 ml. First, in the common culture medium composition (Wnt3a-CM, R-spondin -1-CM, Noggin, EGF) developed for epithelial cell organoid culture by Hans Clevers et al. (GASTROENTEROLOGY 141: (2011)1762-1772), each individual organoid After making a 'rich' medium containing all of the individual factors specifically required for culturing noids (intestines, stomach, liver, pancreas, etc.) proceeded. The initial 'floating' cultures were Wnt3a-conditioned medium (CM), R-spondin-1-CM, EGF, Noggin, FGF10, gastrin in basal medium (modified Advanced DMEM/F12 supplemented with 1 x GlutaMax and 10 mM HEPES). , nicotinamide, A83-01, SB202190, and forskolin were included, and it was confirmed that human taste bud organoids were cultured when cultured with this composition (Fig. carried out. As shown in FIG. 1 , when EGF is removed, it can be seen that the shape of the human taste organoid is changed (FIG. 1B), and when FGF is removed, the growth of the human taste organoid is not maintained to the end and stops (FIG. 1A) D), when SB202190, a p38 inhibitor (FIG. 1A, C), or gastrin was removed, there was no significant difference in growth compared to when grown in a 'floating' culture medium. In particular, it can be seen that a number of passages must be passed to confirm the effect of removing FGF to stop the growth of human taste bud organoids (FIG. 1A D). In addition, as shown in FIG. 2, when Wnt3a-CM, Noggin, R-spondin-1-CM, nicotinamide, A83-01, and forskolin were removed, human taste bud organoids were not continuously cultured and stopped. It can be seen, these can be confirmed that the growth has already stopped from the second subculture (Figs. 1b and c). Wnt3a-conditioned medium (CM), R-spondin-1-CM, Noggin, FGF10, nicotinamide, A83-01 , It can be seen that, when forskolin is removed, growth cannot be continued, and growth is stopped at various time points for each factor to be removed (FIG. 2). Through this, Wnt3a-CM, R-spondin-1-CM, EGF, Noggin, FGF10 in basal medium (modified Advanced DMEM/F12 supplemented with 1 x GlutaMax and 10 mM HEPES) as the culture medium composition required for culturing human taste bud organoids. , nicotinamide, A83-01, and forskolin added were first selected as human taste bud organoid culture medium (Table 3).

Final composition of culture medium for human taste bud organoid growth Basic medium (normal medium for adult stem cell culture) Advanced DMEM/F12+Glutamax + HEPES B27 2% N2 One% N-acetylcysteine 1 mM Medium for culturing human taste bud organoids Wnt3a conditioned medium 50% (medium volume) R-spondin-1 conditioned medium 10% (medium volume) EGF 50 ng/mL Noggin 100 ng/mL FGF10 100 ng/mL nicotinamide 10 mM A83-01 5 μM Forskolin 10 μM

As a result of culturing the organoids with the growth medium, growth and stemness are well maintained and expandability is guaranteed, but the formation efficiency of taste bud cells and immediately preceding precursor cells, which are the final target cell types in the organoid, is low. was not high. Therefore, a selection experiment was performed to add a component that promotes differentiation after removing the component that interferes with differentiation. As a result, nicotinamide was removed from the differentiation-optimized medium, and the Sonic Hedgehog agonist SAG (Smoothened agonist) and IL-4 added at 1 μM and 100 ng/mL, respectively, were the most effective for differentiation induction. It was confirmed that it was selected as the final composition of the culture medium for differentiation (Table 4).

Final composition of culture medium for human taste bud organoid differentiation Basic medium (normal medium for adult stem cell culture) Advanced DMEM/F12+Glutamax + HEPES B27 2% N2 One% N-acetylcysteine 1 mM Medium for culturing human taste bud organoids Wnt3a conditioned medium 50% (medium volume) R-spondin-1 conditioned medium 10% (medium volume) EGF 50 ng/mL Noggin 100 ng/mL FGF10 100 ng/mL A83-01 5 μM Forskolin 10 μM SAG 1 μM IL-4 100 ng/mL

In conclusion, in order to differentiate organoids, sufficient growth of organoids must be preceded, so for the initial 7-10 days after subculture, culture medium for growth (Table 3), and thereafter for human taste bud organoid differentiation Through a binary, sequential culture system culturing in a medium (Table 4), it was possible to maximize the production efficiency of excellent organoids.

Human taste bud organoid expression gene validation and structural validation

As a result of performing RT-PCR in the taste organoid to confirm that human taste organoid expression genes are expressed in the human taste organoid cultured with the culture medium of the present invention, the expression of stem cell markers Lgr5 and Lgr6 was confirmed. By observing the expression of intragemmal cell markers, it was confirmed that the taste bud region containing taste cells was included ( FIG. 3 ). In addition, NTPdase, a type I taste cell marker, T1R1, T1R2, T1R3, a type II taste cell marker, Gustducin, PLCb2, TRPM5, and SNAP25, a type III taste cell marker, were all expressed (Fig. 3). ). In addition, H&E staining was performed to confirm that human taste organoids divide into extra-gemmal cells with taste cell epithelial cells and progenitors and intra-gemmal cells with taste cells. As a result, it was found that the structure was clearly divided into two structures (FIG. 4).

As a result of immunofluorescence staining, the expression of functional taste bud cell progenitor cell markers, SOX2 and Sonic Hedgehog, was confirmed (FIG. 5), and differentiated taste bud cell markers GLAST (type I taste bud cells), α-transducin (type II) taste bud cells), TRPM5 (type II taste bud cells), Car4 (type Ⅲ taste bud cells), and SNAP25 (type Ⅲ taste bud cells) were confirmed ( FIG. 6 ).

Calcium Response to Taste Sources in Human Taste Organoids

In order to determine whether human taste organoids respond to tastants to which human taste buds respond, fura-2 calcium marker dye was absorbed into human taste organoids, and sucrose (sweet) and denatonium ( bitter taste), and it was confirmed whether a calcium response appeared in the organoid cells. As a result, it was confirmed that, when stimulated with sucrose (25 mM) and denatonium (10 mM), a transient calcium response was immediately well formed in human taste bud organoids (FIG. 7). This indicates that human taste bud organoids have the same taste-responsive functionality as human taste buds.

As the specific parts of the present invention have been described in detail above, for those of ordinary skill in the art, these specific descriptions are only preferred embodiments, and it is clear that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Industry-Academic Cooperation Foundation Yonsei University <120> A Composition for Culturing Human Taste Bud Organoid <130> HPC8737 <160> 30 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Lgr4 F primer <400> 1 gctggatgac aacagcttga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Lgr4 R primer <400> 2 ttccccacaa aagacagagg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Lgr5 F primer <400> 3 cttccaacct cagcgtcttc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Lgr5 R primer <400> 4 ctggacgggg atttctgtta 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Lgr6 F primer <400> 5 gatgtgtgcc agcttcttca 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Lgr6 R primer <400> 6 ggaaatgcca gtcaaggtgt 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> K14 F primer <400> 7 gaagtgaaga tccgtgactg g 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> K14 R primer <400> 8 gcagaaggac attggcattg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> K8 F primer <400> 9 tgcctctacc atgtccatca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> K8 R primer <400> 10 tccaggaacc gtaccttgtc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NTPDase 2 F primer <400> 11 ctgggtgact gccaactacc 20 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NTPDase 2 R primer <400> 12 gctgtgggtg tagactcgg 19 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TAS1R1 F primer <400> 13 cggagtcttc tcctgacttc a 21 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TAS1R1 R primer <400> 14 ccgtggagtt gtttatctcc tc 22 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TAS1R2 F primer <400> 15 cgtcgtggtc gtgttctcg 19 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TAS1R2 R primer <400> 16 cactcgcgga actcactgaa g 21 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TAS1R3 F primer <400> 17 ccgcctactg caactacacg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TAS1R3 R primer <400> 18 ctagcaccgt agctgacctg 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GNAT3 F primer <400> 19 atgaggacca acgacaac 18 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GNAT3 R primer <400> 20 gcgtaagctg ctgagtcatt g 21 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRPM5 F primer <400> 21 gtgacctgga ggaggtgatg 20 <210> 22 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> TRPM5 R primer <400> 22 agcaggctct tgcgtgac 18 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLCb2 F primer <400> 23 caccccaggg gctataagag 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLCb2 R primer <400> 24 ggacagggtt gagcagagac 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SNAP25 F primer <400> 25 aaaaagcctg gggcaataat 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SNAP25 R primer <400> 26 agcatctttg ttgcacgttg 20 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> K4 F primer <400> 27 gtggagattg accctgagat c 21 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> K4 R primer <400> 28 tcattgccca aggtatctag c 21 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> K13 F primer <400> 29 tgccagaacc aagagtacaa g 21 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> K13 R primer <400> 30 gcctacggac atcagaagtg 20

Claims (28)

Wnt3a conditioned medium, R-spondin-1 conditioned medium, Noggin, A83-01, Forskolin, EGF, FGF10, IL-4 (interleukin-4) and SAG (Smoothened agonist) as active ingredients Human taste bud organoid comprising a medium composition for inducing differentiation.
The composition of claim 1, wherein the composition further comprises a basal media composition for stem cell culture.
The composition according to claim 2, wherein the basal medium for stem cell culture is Advanced DMEM/F12 medium.
4. The method of claim 3, wherein the Advanced DMEM/F12 medium is supplemented with one or more components selected from the group consisting of zwitterionic buffer, alanylglutamine, B-27, N2 and N-acetylcysteine. composition to do.
5. The composition of claim 4, wherein the zwitterionic buffer is at least one buffer selected from the group consisting of HEPES, MOPs and bicarbonate buffer.
delete delete delete delete delete delete delete delete delete delete delete Human taste bud organoid containing Wnt3a conditioned medium, R-spondin-1 conditioned medium, Noggin, A83-01, Forskolin, EGF, FGF10 and nicotinamide as active ingredients A medium composition for growth or expansion.
delete delete delete delete delete A method for producing human taste bud organoids comprising the step of culturing adult stem cells isolated from tongue tissue in the medium composition of any one of claims 1 to 5.
24. The method of claim 23, wherein the tongue tissue is circumvallate papillae.
24. The method of claim 23, wherein the method further comprises adding a ROCK inhibitor to the medium for 2 to 5 days after initiation of the culture.
26. The method of claim 25, wherein the ROCK inhibitor is Y-27632.
24. The method of claim 23, wherein the method comprises the steps of:
(a) culturing the adult stem cells isolated from the tongue tissue in the medium composition of claim 17; and
(b) culturing the resultant of step (a) in the medium composition of any one of claims 1 to 5.
The method according to claim 27, wherein step (b) is performed 5 to 12 days after initiation of the culture.

Images