KR102320688B1 - Method of screening material inhibiting chromatin condensation of sperm cell targeting ubiquitination of histon3 by PHF7 - Google Patents

Abstract

Disclosed herein is a method for screening a sperm chromatin condensation inhibitor which targets histone 3 ubiquitination of PHF7. A substance identified by the method according to the present application can inhibit the activity of PHF7 E3 ubiquitin ligase on histone H3K14 to disturb the stabilization of BRDT without affecting a transcriptional regulatory function of the BRDT, thereby reducing concentration thereof and thus effectively inhibiting a function thereof in removal of the histone. Specific inhibition of the PHF7 using the substance identified through the mechanism can be usefully used as a male contraceptive.

Description

{Method of screening material inhibiting chromatin condensation of sperm cell targeting ubiquitination of histon3 by PHF7}

The present application is a field related to a drug screening technology based on a molecular mechanism that elucidates the regulation of sperm nucleus condensation by regulating histone 3 ubiquitination of PHF7.

Spermatogenesis is a complex process that produces sperm with half the paternal genome. After meiosis, in which a diploid spermatid derived from a spermatocyte divides into four haploid spermatocytes, the circular spermatocyte undergoes sperm maturation to become a sperm, which is accompanied by cytoplasmic removal, nuclear condensation, acrosome formation, and tail growth.

Somatic chromatin is composed of histones, whereas sperm chromatin is mainly composed of arginine-rich protamine. The more condensed chromatin in the sperm protects the genome from DNA damage and allows the paternal genome to be passed on to offspring. During sperm maturation, histones in elongated sperm cells are removed from chromatin, replaced with a transfer protein (TNP) and finally replaced with protamine (Wang et al. (2019a) Front Genet 10 , 962.). Sperm with a problem in this histone-promatin exchange shows abnormal morphology and reduced motility due to failure of nuclear condensation, resulting in problems with fertility (Wang et al., (2016). Journal of cellular biochemistry 117 , 1429) -1438).

Histone H4 hyperacetylation, which occurs in kidney sperm cells prior to histone-protamine exchange, plays a role in the transcriptional regulation of genes required for histone removal and sperm maturation (Goudarzi et al., 2014). Several studies have identified several regulatory proteins involved in H4 hyperacetylation. PIWI regulates the subcellular localization of RNF8, which promotes ubiquitination of H2A and H2B required for H4 hyperacetylation in kidney spermatocytes, and whether RNF8 is involved in H4 hyperacetylation is still under debate (Gou et al., ( 2017) Cell 169 , 1090-1104.e1013.; Lu et al. (2010) Nature 466 , 508-512.; Sin et al. (2012). Genes Dev 26 , 2737-2748.). CHD5, a chromatin remodeler, plays a role in sperm head development through H4 hyperacetylation and transcriptional regulation. After H4 hyperacetylation, BRDT recognizes H4K5/K8 acetylation of the hyperacetylated H4 terminus through the BD1 domain, and is involved in histone clearance and transcriptional regulation together with a chromatin remodeler. Recognition of acetylated chromatin through BD1 is enhanced by the interaction of DNA with the bromo domain. Furthermore, PA200, one of the units of the sperm proteasome, is required for acetylation-mediated degradation of histones during sperm maturation (Qian et al. (2013) Cell 153 , 1012-1024).

However, studies on the molecular mechanism of histone removal during sperm maturation are not sufficient, and it is necessary to elucidate this and develop a drug for male reproductive system based on it.

The present application aims to provide a method for screening sperm nucleus condensation inhibitors based on a mechanism for regulating the activity of PHF7 E3 ubiquitin ligase on histone H3K14 during spermatogenesis.

In one aspect, the present application provides a eukaryotic cell (over) expressing PHF7 (PHD finger protein 7) and BRDT (Bromodomain testis-specific) protein; contacting the cell with a test substance expected to inhibit the ubiquitination activity of the 14th lysine residue of histone 3 (H3) of PHF7; after the contact, measuring the degree of ubiquitination of the H3 protein in the cell; and when the ubiquitination of H3 is reduced in cells contacted with the test substance in the measuring step compared to cells not contacted, the test substance is selected as a histone-protamine exchange inhibitor required for sperm chromatin condensation. It provides a method for screening a sperm chromatin condensation inhibitor comprising the steps of.

In one embodiment, various cells expressing (over) PHF7 may be used as the cells used in the method according to the present application. In one embodiment, the cell is a Human Embroynic Kidney (HEK) 293T cell overexpressing PHF7.

In one embodiment of the method according to the present application, the cell is provided as an animal model other than humans, and in the measuring step, the ubiquitination of the BRDT protein or the concentration of the BRDT protein in the condensed spermatid of the animal model Further comprising measuring, when the BRDT protein ubiquitination is increased compared to cells not treated with the test substance, or the concentration of the BRDT protein is decreased compared to cells not treated with the test substance, the and selecting the test substance as a histone-chromatin exchange inhibitor required for sperm nucleus condensation.

Sperm nucleus condensation inhibitor candidates screened according to the method according to the present application can be effectively developed as male contraceptives.

The screening method based on the mechanism identified herein and the substance identified through it can inhibit the activity of PHF7 E3 ubiquitin ligase on histone H3K14, thereby interfering with the stabilization of BRDT without affecting the transcriptional regulatory function of BRDT. By reducing its concentration, it can effectively inhibit its function in histone removal and it can inhibit the generation of sperm.

In particular, cyenotrizolodiazepine JQ1 (CAS Number: 1268524-70-4), an inhibitor of the BRD family to which BRDT, BRD2,3 and 4 belong, has previously been proposed as a male contraceptive by targeting BRDT in mice. However, there is a risk of side effects because JQ1 inhibits BRD2,3,4 expressed throughout the body. While BRDT plays a role from the beginning of the spermatogenesis process, PHF7, which has been identified in this study, is predominantly expressed in sperm cells after meiosis and acts late in the spermatogenesis process, so there may be fewer side effects than when BRDT is targeted. . In addition, since the E3 ubiquitin ligase activity of PHF7 is required for sperm maturation, PHF7 can be used as a diagnostic marker for male infertility tests.

1 is The ^{result is that Phf7 tKO} male mice show spermatogenesis defects. (A) Schematic of the mouse spermatogenesis process. (B) Relative Phf7 mRNA levels in the testis of mice of different ages. (C) PHF7 protein levels in the testis of mice of different ages. (D) PHF7 protein levels in testis cells of 8-week-old control and Phf7 ^{tKO mice.} (E) Fertilization capacity of control and Phf7 ^tKO male mice crossed with wild-type female mice. (F) Testicular tissue analysis of control and Phf7 ^tKO mice using hematoxylin-PAS staining. (G) Anaphylactic tissue analysis of ^{control and Phf7 tKO} mice using hematoxylin-eosin staining. (H) Phase-contrast microscopy images of sperm from control and Phf7 ^{tKO mice.} (I) Motility of sperm in control and Phf7 ^{tKO mice.} (J) In vitro fertilization assay. Relative fertilization capacity of sperm from control and Phf7 ^{tKO mice.} (K) ^Confocal microscopy images of sperm from control and Phf7 tKO mice. (L) Confocal microscopy images of control and Phf7 ^tKO mouse sperm using histone H2A, TH2B, H3, H4 antibodies. (M) Histone and protamine protein levels in sperm extracts from control and Phf7 ^{tKO mice.} (N) ^{Immunostaining} with H3 and PRM2 antibodies in testis sections from control and Phf7 tKO mice. Arrows indicate condensed sperm cells expressing both H3 and PRM2. (O) ^Immunoblot analysis performed on control and Phf7 tKO mouse sperm cell extracts.
2 is a result of identifying PHF7 is an E3 ubiquitin ligase for lysine 14 of histone H3. (A) ^Immunoblot analysis performed on control and Phf7 tKO mouse testicular cell extracts. Long exposure data from H3 immunoblots contain shifted H3 bands below 25 kDa. (B) Immunoprecipitation analysis performed on control and Phf7 ^tKO mouse testicular cell extracts. (C) Immunoblot analysis after transfection of Flag-PHF7 and Hismax-Ub into HEK293T cells. (D) In vitro ubiquitination assay for E2 screening using PHF7 purified from E. coli and recombinant nucleosomes. Relative levels of histone ubiquitination are shown below each immunoblot. (E) In vitro ubiquitination assay of nucleosomes with different reaction times. Relative levels of H3 ubiquitination are shown below the H3 immunoblot. (F) In vitro ubiquitination assay using GST-H3 deletion mutants with or without Ub. The H3 ubiquitination rate is shown below the GST immunoblot. Asterisk (*) indicates polyubiquitination of H3. (G) Screening for H3 ubiquitination residues after transfection of HA-PHF7 and H3-Flag KR mutants in HEK293T cells. (H) In vitro ubiquitination assay using histone extracts obtained from HEK293T cells overexpressing H3-Flag WT and K14R mutations.
3 is a result of finding out that C160A stigma mice without Phf7 enzyme activity show defects in the spermatogenesis process and H3 ubiquitination. (A) Schematic of PHF7 WT, ΔPHD, ΔRING mutants. Comparison of E3 ubiquitin ligase activity of Flag-PHF7 WT, ΔPHD, and ΔRING in HEK293T cells. (B and C) Defects in E3 ubiquitin ligase activity of PHD domain mutants (B) and RING domain mutants (C) of PHF7 in HEK293T cells. (D) In vitro ubiquitination assay using the RING domain mutant of GST-PHF7. (E) Schematic of Phf7 C160A KI mice. The KI allele has restriction sites for BamHI (GGATTC) and Afe I (AGCGCT). (F) Fertilization capacity of control and Phf7 ^CA/CA male mice crossed with wild-type female mice. (G) Sperm motility of control and Phf7 ^{CA/CA male mice.} (H) IVF assay. Fertilization ability of sperm from control and Phf7 ^{CA/CA male mice.} (I) Confocal microscopy images of sperm from control and ^{Phf7 CA/CA male mice.} (J) Confocal microscopy images of histones H2A, TH2B, H3, and H4 immunostaining in sperm from control and Phf7 ^{CA/CA male mice.} (K) Confocal microscopy images of immunostaining with H3 antibody and PRM2 antibody in testis sections from control and Phf7 ^{CA/CA male mice.} Arrows indicate condensed sperm cells expressing both H3 and PRM2. (L) Immunoblot analysis performed on sperm cell extracts from control and ^{Phf7 CA/CA male mice.} (M) Immunoblot analysis performed on testis cell extracts from control and ^{Phf7 CA/CA male mice.} Long exposure data from H3 immunoblot included H3ub band below 25 kDa.
4 is a result of confirming that the E3 ubiquitin ligase activity of PHF7 is required for histone removal after H4 hyperacetylation. (A and B) t-SNE analysis of testis cells from mice of both genotypes, color-coded by named cell type obtained from single-cell RNA sequencing (A) and corrected expression levels of highly diverse genes in all cells ( B). All genes and cells in the heatmap were sorted using Euclidean distance. Metadata of each cell was indicated above the heatmap (genotype, Phf7 ^f/f , gray; Phf7 ^tKO , red and cell type used for t-SNE analysis). (C) Relative mRNA levels of Tnp1/2 and Prm1/2 in testis cells of control and Phf7 ^{tKO mice.} (D) Immunoblot ^analysis of TNPs and PRMs performed on sperm cell extracts from control and Phf7 tKO mice. (E) Immunoblot analysis for TNPs and PRMs performed on sperm cell extracts from control and Phf7 ^{CA/CA mice.} (F) ^Immunoblot analysis for H4ac and H4 performed on sperm cell extracts from control and Phf7 tKO mice. (G) Immunoblot analysis for H4ac and H4 performed on sperm cell extracts from control and Phf7 ^{CA/CA mice.} (H) Confocal microscopy images of immunostaining performed using H4ac antibody and PRM2 antibody on testis sections of mice of each genotype. (I) Schematic model of the function of PHF7 in histone clearance following H4 hyperacetylation.
Figure 5 is the result of finding out that PHF7 plays a role in maintaining the level of BRDT in the initial condensed sperm cell. (A and B) Protein levels and relative mRNA levels of BRDT in sperm cells of Phf7 ^f/f and Phf7 ^tKO mice (A), Phf7 ^+/CA and Phf7 ^{CA/CA mice (B).} (C and D) Confocal microscopy images of immunostaining with H4ac antibody and BRDT antibody in testis sections from ^{Phf7 f/f} and Phf7 ^tKO mice (C), Phf7 ^+/CA and Phf7 ^{CA/CA mice (D).} Roman numerals indicate the stages of the spermatogenesis process in the tubules. (E) Quantification of the ratio of H4ac and BRDT staining in the nucleus of elongated or condensed spermatozoa.
6 is the result of finding out that the E3 ubiquitin ligase activity of PHF7 regulates the stability of BRDT. (A) Confocal microscopy image of immunostaining using BRDT antibody and Flag antibody in testis sections from ^{Phf7 Flag/+ mice.} Roman numerals indicate the stages of the spermatogenesis process in the tubules. Arrows indicate nuclei of sperm cells expressing both BRDT and Flag-PHF7. (B) Conserved SPOP degron (D) sequence of the BET family. (C) After transfection of Flag-BRDT (1-555 amino acids) wild-type and ΔD mutants into HEK293T cells, immunoblot analysis with or without MG132 treatment. (D) Immunoblot analysis performed after transfection of the wild-type and C160A mutants of Flag-BRDT, SPOP, and PHF7 into HEK293T cells. (E) Protein levels of SPOP, Cul3, BRD4, and PTEN in sperm cells of Phf7 ^f/f , Phf7 ^tKO , Phf7 ^+/CA , Phf7 ^{CA/CA mice.} (F) Ubiquitination assay performed after transfection of Flag-BRDT, SPOP, PHF7 wild-type and C160A mutants into HEK293T cells and MG132 treatment. (G) Confocal microscopic image of transfected HEK293T cells immunostained with HA or PHF7 antibody and Flag antibody. (H) In vitro ubiquitination assay using BRDT, SPOP-Cul3-Rbx1, and PHF7.
7 is the result of finding out that PHF7-mediated histone ubiquitination attenuates BRDT ubiquitination. (A) Immunoprecipitation experiments of BRDT and PHF7 in HEK293T cells. (B) In vitro pull-down assay using E. coli-derived GST-BRDT and biotinylated nucleosomes containing H3ub or H4ac and streptavidin beads. Relative proportions of pulled-down GST-BRDT are shown below the immunoblot. (C) In vitro ubiquitination assay using BRDT, SPOP-Cul3-Rbx1, and modified nucleosomes. (D) Model for BRDT stability regulation through PHF7-mediated H3ub in early condensed spermatozoa (step 12).
Fig. 8 shows the production results of deletion mice. ( A ) Schematic of how to target the Phf7 gene. Phf7 exons 4, 5, 6 and 7 alleles (grey boxes) and lacZ gene (purple boxes), loxP (green arrows), FRT (blue boxes), neomycin selection marker (yellow green boxes), diphtheria toxin gene (DT, targeting vectors (including light blue boxes). ( B ) Phf7 ^f/f and Phf7 ^tKO Image of testis in mice and the ratio of testis weight to body weight. Error bars represent mean ± SD. ( C and D ) Confocal microscopy images of immunostaining for H3 (green), PRM1 (red, C), TNP2 (red, D), DAPI (blue) in testis sections from ^{Phf7 f/f} and Phf7 ^{tKO mice.} Arrows indicate sperm cells in which either PRM1 or TNP2 co-expressed with H3.
9 shows the results of LC-MS/MS analysis of H3K14ub. ( A ) In vitro LC-MS/MS analysis using modified histone H3 protein. MS/MS analysis spectra corresponding to the indicated peptide sequences and modifications. ( B ) Differences in number of peptide spectral matches (PSM) for the named peptide sequences in LC-MS/MS analysis. In two replicates, PHF7 overexpression and control samples are indicated. ( C ) Phf7 ^f/f and Phf7 ^tKO LC-MS/MS analysis of ubiquitinated H2A and H2B proteins in the testis of mice.
10 shows the analysis results of Phf7 ^{CA/CA mice.} ( A ) Hematoxylin- PAS staining of testis sections from ^{Phf7 +/CA} and Phf7 ^{CA/CA mice.} ( B ) Hematoxylin -eosin staining of ^{Phf7 +/CA} and Phf7 ^{CA/CA mouse testicular sections.} ( C ) Phase- contrast microscopy images of ^{Phf7 +/CA} and Phf7 ^{CA/CA mouse sperm.} ( D and E ) Confocal microscopy of immunostaining for H3 (green), PRM1 (red, D), TNP2 (red, E), DAPI (blue) in testis sections from ^{Phf7 +/CA} and ^{Phf7 CA/CA mice.} image. Arrows indicate sperm cells in which either PRM1 or TNP2 co-express H3.
11 shows that single cell RNA sequencing shows that Phf7 -deleted mice have transcript profiles similar to wild-type mice. ( A ) UMAP plots colored with graph-based clusters. ( B ) Mouse cells distributed on the UMAP plot. Red dots indicate cells derived from each sample in each plot. ( C ) Corrected expression levels of marker genes on UMAP plots. ( D ) Distribution of the total number of UMIs (Unique Molecular Identifiers) in cells.
Fig. 12 shows that H4 acetylation remains abnormal in condensed sperm cells of mice in which Phf7 is disrupted. ( A ) Schematic of the sperm maturation process in the spermatogenesis cycle. Arabic numerals represent the steps (1-16) of the sperm maturation process. Circular spermatocytes (steps 1-8), elongate spermatocytes (steps 9-11), condensed spermatocytes (steps 12-13), post-condensation spermatocytes (steps 14-16). ( B and C ) Phf7 ^f/f , Phf7 ^tKO ( B ), Phf7 ^+/CA and Phf7 ^CA/CA ( C ) for H4ac (green), PNA (red), and DAPI (blue) on testis sections from mice. Confocal microscopy image of staining. Roman numerals indicate spermatogenesis stages (I - XII) within the tubules.
13 is a result related to FIG. 4 as a result of co-immunostaining of PRM1 or TNP2 and H4ac in a testis section. ( A ) Confocal microscopy images of immunostaining for H4ac (red), PRM1 (green), DAPI (blue) on testis sections from ^{Phf7 f/f} , Phf7 ^tKO , Phf7 ^+/CA and Phf7 ^{CA/CA mice.} ( B ) Confocal microscopy images of immunostaining for H4ac (red), TNP2 (green), DAPI (blue) on testis sections from ^{Phf7 f/f} , Phf7 ^tKO , Phf7 ^+/CA and Phf7 ^{CA/CA mice.}
14 shows the construction of a Flag-Phf7 branded mouse. ( A ) Schematic of Flag- Phf7 knock-in mice. Phf7 exon 2 allele (grey box), 3xFlag (red). 3xFlag (red), a spacer (orange), a knock-in sequence comprising a silent mutation (sky blue). ( B ) Protein levels of Flag-PHF7 in testis cell extracts from Phf7 ^+/+ (wild-type) and Phf7 ^{Flag/+ mice.} Asterisks (*) indicate non-specific bands. ( C ) Confocal microscopy images of immunostaining for Flag (green), PNA (red), DAPI (blue) of testis sections from ^{Phf7 Flag/+ mice.} Roman numerals indicate spermatogenesis stages (I - XII) within the tubules. ( D ) Confocal microscopy images of immunostaining for Flag (green) and DAPI (blue) of testis sections from ^{Phf7 Flag/+ mice.} ( E ) Confocal microscopy image of immunostaining for Flag (green), H4ac (red), DAPI (blue) of testis sections from ^{Phf7 Flag/+ mice.} Roman numerals indicate spermatogenesis stages (I - XII) within the tubules. Arrows indicate sperm cells co-expressing Flag-PHF7 and H4ac.

This study is based on the discovery that PHF7 (PHD finger protein 7) is important for maintaining the stability of BRDT (Bromodomain testis-specific), a histone removal factor during sperm maturation. The process of spermatogenesis is a complex process of making sperm that includes mitosis, meiosis, and sperm maturation. Among them, during sperm maturation, histones are removed from chromatin of spermatids after meiosis and replaced with protamine. In this spermatogenesis process, histone-promatin exchange is important for sperm nucleus condensation, but the study is lacking, and the control mechanism for this needs to be elucidated.

Herein, specifically, the PHF7 protein acts as an E3 ubiquitin ligase for the 14th lysine (K14) residue of histone H3 in sperm cells after meiosis, and histone ubiquitination by PHF7 reduces the protein amount of BRDT, a histone removal factor. By increasing it, it is based on the discovery that the PHF7 protein is an important epigenetic factor of chromatin condensation that regulates histone-promatin exchange.

Specifically, in this study, we produced Phf7-deleted mice and Phf7 C160A mutant mice with impaired E3 ubiquitin ligase activity, and these mice exhibited abnormal histone-protamine exchange and abnormal sperm maturation due to abnormal regulation of the histone removal factor BRDT in early condensed sperm cells. said to show In addition, the protein amount of the histone removal factor BRDT decreased in sperm cells of mice, and differences in the expression level of BRDT were confirmed at specific developmental times through immunoblot and tissue immunostaining. In addition, in the present application, the activity of E3 ubiquitin ligase of PHF7 on histone ubiquitination contributes to stabilization of BRDT, ie, increase in concentration, by inhibiting ubiquitination of BRDT.

Therefore, the defect or inhibition of expression or activity of PHF7 induces a deficiency of histone 3 (H3K14ub) in which the 14th lysine residue is ubiquitinated, followed by a decrease in the amount of BRDT protein in the early condensed spermatogonial cells, so that the histone is not replaced with protamine, It can induce the development of the remaining abnormal sperm.

Accordingly, in one aspect, the present application provides a method for screening a sperm chromatin condensation inhibitor, comprising the step of selecting PHF7 as a histone-protamine exchange inhibitor required for sperm chromatin condensation.

Somatic chromatin is composed of histones, whereas sperm chromatin is mainly composed of arginine-rich protamine. The more condensed chromatin in the sperm protects the genome from DNA damage and allows the paternal genome to be passed on to offspring. During sperm maturation, histones in elongated spermatozoa are removed from chromatin, replaced with a transfer protein (TNP) and finally replaced with protamine (Wang et al. (2019a) Front Genet 10 , 962.). Sperm with a problem in this histone-promatin exchange shows abnormal morphology and reduced motility due to failure of nuclear condensation, resulting in problems with fertility (Wang et al., (2016). Journal of cellular biochemistry 117 , 1429) -1438).

In one embodiment, the method comprises providing a eukaryotic cell expressing PHF7 and BRDT; contacting or treating the cell with a test substance expected to inhibit the ubiquitination activity of the 14th lysine residue of histone 3 (H3) of PHF7; measuring the degree of ubiquitination of the BRDT protein in the cells treated with the test substance; and selecting the test substance as a male contraceptive candidate when the ubiquitination of the BRDT is increased in the cells treated with the test substance in the measuring step compared to the untreated cells.

The target PHF7 according to the present application is a member of the PHF family with a PHD domain known as histone methyl leader, the human and mouse protein and gene sequences of which are known from the NCBI as follows: Human protein sequence of PHF7: NP_057567.3 , gene sequence: NC_000003.12, mouse protein sequence: NP_082225.1, gene sequence: NC_000080.6.

Previously, there was a study result that disruption of the phf7 gene leads to a defect in sperm production and reduces H2A ubiquitination (Wang et al., 2019b). However, in sperm cells after meiosis, the result that PHF7 acts as an E3 ubiquitin ligase of H3K14ub to maintain the stability of the BRDT protein for histone removal during spermatogenesis was identified here for the first time.

H3, a substrate of the PHF7 E3 ubiquitin ligase identified herein, is a histone protein. Human and mouse H3 protein and gene sequences are known from the NCBI as follows: human protein sequence of H3: NP_003520.1, gene sequence: NC_000006.12, mouse protein sequence: NP_038578.2, gene sequence: NC_000079.6 . In the numbering of the amino acid residues, since the first amino acid of a protein is usually Met, the residue numbering of histones herein is that the next amino acid is numbered 1 except for Met.

In general, histone proteins are basic proteins that pack DNA in eukaryotic cells to make structural units called nucleosomes. There are five families of histones: H1/H5, H2A, H2B, H3, and H4, and H2A, H2B, H3 and H4 constitute the core of the nucleosome, and are H1/H5 linker histones. Core histones exist as dimers. PHF7 E3 ubiquitin ligase according to the present application ubiquitinates the 14th lysine residue of H3. Ubiquitin is a protein consisting of 76 amino acids, and ubiquitin of ubiquitinated proteins regulates the activity of itself or other proteins by promoting protein degradation or regulating interactions with other proteins.

BRDT is first expressed in early spermatocytes and has various functions depending on the time of development. It is known that transcription starts to be suppressed in circular sperm cells from the beginning of the sperm maturation process, and all transcription stops in sperm. However, the association with PHF7 has not been established. In this paper, it was verified that Phf7 deletion does not affect BRDT transcription through experiments such as single-cell RNA sequencing. It was found to act as an important epigenetic factor of Martin condensation. The sequence of BRDT is known from the NCBI as follows: human protein sequence: NP_001717.3, gene sequence: NC_000001.11, mouse protein sequence: NP_473395.2, gene sequence: NC_000071.6.

In order to select a candidate in the method according to the present application, the method includes measuring the degree of ubiquitination of the histone protein in cells treated with a test substance. Methods for measuring the ubiquitination of histone 3 are known, for example, reference may be made to those described in the Examples herein (Zhang et al. Nat. Commun 8:14799 (2017)). When the ubiquitination of the histone 3 is decreased in the cells treated with the test substance in the measuring step, compared to the untreated cells, the test substance is used as a histone-promatin exchange inhibitor required for sperm chromatin condensation. select

In one embodiment, the cell used in the method according to the present application is a cell derived from a mammal, including a human or mouse, a eukaryotic cell overexpressing PHF7, for example, an established cell line HEK (Human Embryonic Kidney) 293T overexpressing PHF7. The established cell line is commercially available. Methods for overexpressing a specific gene in an established cell line are known and can be used, for example, by transfecting a plasmid encoding the human PHF7 gene into a cell line of interest. However, the cell line is not limited thereto, and various cells capable of achieving the object according to the present disclosure may be used.

In another embodiment the cells used in the method according to the invention are part of an animal model, for example a mouse. A mouse is used in the method according to the invention.

When the ubiquitination of H3 is reduced in cells contacted with the test substance in the step of measuring in the method according to the present application, compared to cells not contacted, the test substance is used as a histone-protamine exchange inhibitor required for sperm chromatin condensation selection step.

In one embodiment, in the method according to the present application, the cells are provided as a non-human animal model. In this case, in the measuring step of the method, ubiquitination of BRDT protein or BRDT in testis cells of the animal, for example, a wild-type mouse. measuring the concentration of the protein instead of or in addition to histone ubiquitination, wherein the BRDT protein ubiquitination is increased compared to cells not treated with the test substance, or the concentration of the BRDT protein is treated with the test substance and selecting the test substance as a histone-chromatin exchange inhibitor required for sperm nucleus condensation when it is decreased compared to the untreated cells. As described in FIGS. 7 and 6 herein, ubiquitination of BRDT promotes its degradation and lowers its concentration. Therefore, in the method according to the present application, the increase in ubiquination by the test substance reduces the concentration of the BRDT protein.

Accordingly, in the method according to the present application, a candidate substance capable of inhibiting the ubiquitination activity of PHF7 on the 14th lysine residue of histone 3 (H3) ultimately increases ubiquitination of BRDT, which leads to a decrease in BRDT concentration, eventually It induces a defect in chromatin condensation in the spermatogenesis process, inhibits spermatogenesis, and can be effectively used as a male contraceptive.

The cells used in the method according to the present disclosure may be provided as organoids containing such cells or as non-human animal models. Such an animal model may be prepared using the examples herein or methods known in the art. As used herein, an organoid is a mini-organ produced in vitro in a three-dimensional environment representing the microstructure of an actual organ. Cells with self-renewal and differentiation ability are created in a three-dimensional culture environment. A method for preparing an organoid may refer to a known (Organoid Culture handbook, Ambiso).

The test substance used in the method according to the present application is an epigenetic factor regulating chromatin condensation in the process of sperm maturation through H3 ubiquitination of PHF7 ubiquitin ligase identified herein, in particular, ubiquitin of H3 K14. Substances expected to result in inhibition of digestion, such as low molecular weight compounds, high molecular weight compounds, mixtures of compounds (eg natural extracts or cell or tissue cultures), or biopharmaceuticals (eg proteins, antibodies, peptides, DNA , RNA, antisense oligonucleotides, RNAi, aptamers, RNAzyme and DNAzyme) or sugars and lipids, and the like.

In one embodiment according to the present application, a low molecular weight compound may be used as a test substance. The test substance may be obtained from a library of synthetic or natural compounds, and methods for obtaining a library of such compounds are known in the art. Synthetic compound libraries are available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA), and natural compound libraries are available from Pan Laboratories (USA) and It can be purchased from MycoSearch (USA). Test substances can be obtained by various combinatorial library methods known in the art, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution It can be obtained by the required synthetic library method, the "1-bead 1-compound" library method, and the synthetic library method using affinity chromatography selection. Methods for synthesizing molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, et al. For example, for drug screening purposes, compounds having a low molecular weight therapeutic effect may be used. For example, a compound having a weight of about 1000 Da, such as 400 Da, 600 Da, or 800 Da, may be used. Depending on the purpose, these compounds may form a part of a compound library, and the number of compounds constituting the library varies from tens to millions. Such compound libraries include peptides, peptoids and other cyclic or linear oligomeric compounds, as well as template-based small molecule compounds such as benzodiazepines, hydantoins, biaryls, carbocycles and polycyclic compounds such as naphthalene, phenothi azine, acridine, steroids, etc.), carbohydrates and amino acid derivatives, dihydropyridine, benzhydryl and heterocycles (such as triazine, indole, thiazolidine, etc.), but these are merely exemplary. However, the present invention is not limited thereto.

Also, for example, biologics can be used for screening. Biologics refers to cells or biomolecules, and biomolecules refer to proteins, nucleic acids, carbohydrates, lipids, or substances produced using cell systems in vivo and in vitro. The biomolecule may be provided alone or in combination with other biomolecules or cells. Biomolecules include, for example, polynucleotides, peptides, antibodies, or other proteins or biological organisms found in plasma.

In one embodiment, the increase or decrease that can select a candidate substance in the method according to the present application can be appropriately selected by those skilled in the art in consideration of the results disclosed herein and common knowledge of those skilled in the art, for example, but not limited thereto, with the test substance and the test substance. About 10% or more reduction, about 20% or more reduction, about 30% or more reduction, about 40% or more reduction, about 50% or more reduction, about 60% or more reduction, about 70 compared to non-contact control % or more, a decrease of about 80% or more, a decrease of about 80% or more, a decrease of about 100% or more, or a range in between may be selected as candidate substances, but the range outside the above is not excluded.

Hereinafter, examples are presented to help the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the present invention is not limited thereto.

Example

Experimental materials and methods

Construction of Phf7 Conditional Knock-Out Mice: Three embryonic stem cells (ES cells) bearing the first allele deletion (tm1a) of Phf7 were obtained from the International Mouse Phenotyping Consortium (IMPC) and microinjected into C57BL/6 blastocysts. To remove the lacZ and neomycin cassettes, heterozygous F1 was crossed with FLPeR mice. Progeny mice were crossed with Stra8-Cre mice to obtain testis-specific Phf7 deletion mice. Phf7 ^f/f and Phf7 ^tKO male mice were used for experiments after 8 weeks of age. Genotype primers are as follows.

Forward 5’-ATCAGTTGTGTCCAGAACTTCCATC-3’

Reverse 5’-TTATC GAGTGGAGGGACAGATGTG-3’.

All animal studies and procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Seoul National University.

Construction of Phf7 C160A labeled mice and Flag-Phf7 labeled mice: Phf7 C160A KI mice were prepared from ES cells transfected with sgRNA/Cas9 by the previous method. In particular, EGR-G01 [129S2 × C57BL/6NCr-Tg( CAG/Acr-Egfp ) ES cells were used for genome modification. The target sequence of sgRNA is 5'-GAACATCCACCAGGGGAGTT-3. An HDR donor plasmid (pBluescript II SK (+) vector) was designed to introduce a point mutation (TGT→GCT, C160A) in the 7th exon of Phf7. Chimeric progeny carrying the C160A allele were crossed with wild-type B6D2F1 mice to obtain heterozygous (Phf7 ^{+/CA) mice.} Next, Phf7 ^+/CA mice were crossed with C57BL/6J mice. Phf7 ^CA/CA mice were obtained by crossing between Phf7 ^{+/CA mice.} Phf7 ^+/CA , Phf7 ^CA/CA mice were used in the experiment after 8 weeks. Genotypic primers for the C160A allele are as follows.

Forward; 5’-TCACTGAGCACCAAGCAAATAGAC-3’

Reverse; 5'-TCTGAATCTTACACATACTTGAGCA-3'.

The KI allele has an AfeI restriction site ( FIG. 3E ), and genotypes are distinguished via the AfeI response. Flag-Phf7 KI mice were constructed by injecting the gRNA/Cas9 mixture and reference DNA into eggs. The gRNA sequence is 5'-AAAACAAACATCCAAGATTG-3'. Genotypic primers for the Flag-Phf7 allele are as follows.

Forward 5’-GGGTGGGACGACAAGAAGAG -3’

Reverse 5'- CTTGTCATCGTCATCCTTGT -3'.

All animal studies and procedures were approved by Seoul National University's Institutional Animal Care and Use Committee (IACUC) and Osaka University's Animal Care and Use Committee of the Research Institute for Microbial Diseases. Frozen sperm of these KI mice (STOCK Phf7<em2(C160A)Osb> Tg(CAG/Acr-EGFP)C3-N01-FJ002Osb, RBRC#11032, CARD#2939; and C57BL/6J-Phf7<em3(FLAG/Phf7) )Osb>, RBRC#11056, CARD#2963) are RIKEN BRC (https://mus.brc.riken.jp/en/) and Kumamoto University CARD (http://card.medic.kumamoto-u.ac. It will be available at jp/card/english/). STOCK Phf7<em2(C160A)Osb>, and C57BL/6J Phf7<em3(3xFLAG/Phf7)Osb> are Prof. Obtained from Masahito Ikawa, Research Institute for Microbial Diseases, OSAKA UNIVERSITY.

Cell culture: HEK293T cells (ATCC) were cultured in DMEM media containing 10% FBS and antibiotics in a wet incubator containing _{5% CO 2 .} All cells used in this study were routinely tested for mycoplasma contamination.

Sperm Mobility: Sperm obtained from the spermatozoa was spread in TYH drops. After 10 min incubation, sperm motility was analyzed using a computer-assisted sperm analysis (CASA) system (CEROS II).

In vitro fertilization assay: Pregnant mare serum gonadotropin (PMSG) was injected into the abdominal cavity of B6D2F1 female mice, and after 48 hours, human chorionic gonadotropin (hCG) was injected. At 14 hours post hCG injection, eggs were extracted from the fallopian tubes of each fallopian tube and cultured in TYH drops. Cervical spermatozoa are pre-incubated in TYH drops for 2 h. Sperm were added to TYH drops with eggs. After 6 hours, the cumulus cells around the egg were removed by treatment with hyaluronidase for 5 minutes, and the pronuclei were observed under a phase-contrast microscope.

Histology: Testicular tissue analysis was done by previous methods. Sanitization was done overnight at 4° C. with 10% formalin. After fixation, the tissue was dehydrated while increasing the ethanol concentration from 50 to 100%. The dehydrated specimens were passed through 100% xylene and placed in paraffin wax. For hematoxylin-eosin (H&E) staining, tissues were cut to a thickness of 7 μm, deparaffinized, rehydrated, and stained with hematoxylin for 3 minutes and eosin for 1 minute. Images were obtained with a digital microscope.

Isolation of mouse testis cells: Mouse testis tissues were digested with collagenase A, DNase I, and trypsin in DMEM-F12 media. Trypsin was blocked with FBS and the cells were filtered with 70 μm and 40 μm strainers. After centrifugation, red blood cells were removed with RBC lysis buffer. Cells were washed with HBSS. Sperm cells were separated by gravity precipitation method STA-PUT by modifying the previous protocol. After placing 4% BSA in DMEM-F12 media on the column and slowly stacking 2% BSA, testis cells dissolved in 0.5% BSA are loaded thereon. Precipitation was performed at room temperature for 150 minutes. Each fraction was identified through cell morphology by phase-contrast microscopy.

Tissue immunostaining: Sperm obtained from the amygdala is dried on a slide, and sperm cells on a PLL-treated coverslip are incubated in PBS containing 1M DTT for 30 minutes and fixed in PBS containing 4% PFA for 10 minutes at room temperature. . The fixed sample is permeabilized in PBS (PBS-T) containing 0.1% Triton X-100 at room temperature for 10 minutes. For staining, cells are incubated with an antibody at room temperature for 2 hours and incubated with a fluorescently labeled secondary antibody for 1 hour. Tissue immunostaining using testis sections was performed in the same way from blocking to mounting. Samples were observed under a confocal microscope. For double staining using two antibodies obtained from the same host, testis sections were first incubated with BRDT antibody at 4° C. overnight, and then the following antibodies were incubated at room temperature for 1 hour. Alexa 488 AffiniPure Fab Fragment Donkey Anti-Rabbit IgG (H+L), H4ac Antibody, Alexa 594 Donkey Anti-Rabbit IgG (H+L). The mounted samples were observed under a confocal microscope.

Transfection and cell lysis (lysis): Transfection was performed using PEI. All cells were collected after washing with cold PBS and lysed in Laemmli sample buffer. All extracts were analyzed by SDS-PAGE.

In vitro ubiquitination assay: Recombinant proteins PHF7, UBE1, GST-H3, GST-BRDT and SPOP were purified from E. coli strain Rosetta. Recombinant nucleosome, GST-H3, ubiquitin in histone ubiquitination assay using histone extracts assay buffer (50 mM Tris-HCl [pH 7.5], 5 mM MgCl 2, 2 mM ATP, and 2 mM DTT), UBE1, UbcH5b, UbcH5c, and PHF7 were used at 30° C. for 1 hour. Flag-Cul3 and HA-Rbx1 were purified from transfected HEK293T cells using Flag-M2 agarose beads and 3xFlag peptide. GST-BRDT, His-SPOP, Flag-Cul3, HA-Rbx1, and PHF7 were incubated in the same buffer at 30°C for 30 minutes, and ubiquitin, UBE1, and UbcH5a were added to perform a BRDT ubiquitination assay at 30°C for 1 hour. did. After the ubiquitination assay with PHF7 and recombinant nucleosomes, the modified nucleosomes were filtered with Amicon Ultra Centrifugal Filters 50K membrane to remove PHF7, ubiquitin, UbcH5b and 5c. BRDT ubiquitination assay using modified nucleosomes was performed in the same way.

In vivo ubiquitination assay: Testicular cells were lysed with denaturation buffer (50 mM Tris-HCl [pH 7.5], 1% SDS, 70 mM β-mercaptoethanol) and boiled at 95°C for 5 minutes. All extracts were diluted with denaturation buffer (20 mM Tris-HCl [pH 7.5], 200 mM NaCl, 1 mM EGTA, 1 mM EDTA, 1% Triton X-100, protease inhibitor) and then 4 with H3 antibody. Immunoprecipitation was performed overnight at °C. HEK293T cells were transfected with Hismax-Ub, treated with MG132 for 6 hours, and then disrupted in the same manner. Immunoprecipitation was performed with Flag antibody at 4°C for 2 hours.

Immunoprecipitation: The transfected HEK293T cells were disrupted with EBC200 buffer (50 mM Tris-HCl [pH 8.0], 200 mM NaCl, 0.5% NP-40, protease inhibitor) and centrifuged. The supernatant was incubated with Flag antibody at 4°C for 2 hours. Thereafter, protein A/G sepharose beads were added and incubated at 4° C. for 1 hour. Beads were washed with EBC200 buffer and boiled with sample buffer for 10 min.

In vitro biotin-streptavidin pull-down assay: The recombinant protein GST-BRDT was purified from E. coli strain Rosetta. Recombinant biotinylated nucleosomes were used in an in vitro ubiquitination assay using PHF7 and pull-down buffer (50 mM Tris-HCl [pH 7.4], 125 mM KCl, 5 mM MgCl ₂ , 0.5 mM EDTA, 0.5% Triton X-100). , 5 mM DTT) and incubated with streptavidin agarose resin at 4°C for 1 hour. The nucleosomes attached to the beads were washed with pull-down buffer and incubated with GST-BRDT protein at 4°C for 2 hours. The beads were washed and boiled for 10 minutes.

LC-MS/MS analysis: LC-MS/MS analysis of the in- gel peptide sample preparations and the in vitro modified histone samples was performed by previous methods. Peptide sample preparation and immunoaffinity purification of PHF7-overexpressing HEK293T cells and Phf7 ^f/f and Phf7 ^tKO mouse testis cells were performed with the PTMSCan Ubiquitin Remnant Motif (K-ε-GG) kit. The peptide sample was separated into an in-house packed long capillary column (100 cm x 75 μm id) and a trap column (3 cm x 150 μm id) using 3 μm Jupiter C18 particles. Nano liquid UPLC (water) Orbitrap Fusion Lumos mass with a flow rate of 300 nl/min and a linear gradient ranging from solvent A (water with 0.1% formic acid) to 40% solvent B (acetonitrile with 0.1% formic acid) for 60 minutes In combination with an analyzer (Thermo Scientific) it was run using the following parameters. m/z 300-1800 of precursor scan range, 1.4 Th of precursor isolation window, 30% of high-level collision energy (NCE)-energy collision dissociation (HCD), dynamic exclusion period of 30 s, full MS or MS/MS respectively Datasets obtained at 60k or 7.5k resolution at m/z 200 for scans were searched by the MS-GF+ algorithm or MaxQuant software at a precursor ion mass resistance of 10 ppm based on the SwissProt Homo sapiens proteome database. The above discovery rate was set to 1% at the protein and peptide level. The number of peptide spectral matches was aggregated for each identified peptide sequence. The intensity of the peptide sequence of interest was either obtained from MaxQuant search results or determined through manual annotation at the extracted ion chromatogram (XIC) level using Qual Browser software.

Quantitative RT-PCR: RNA was extracted using Trizol and reverse transcription was performed using M-MLV cDNA synthesis kit with 2.5 mg of RNA. mRNA levels were measured with SYBR TOPreal qPCR 2x PreMix and BioRad CFX384. Quantification of mRNA was calculated by the ddCt method, and all reactions were performed in three identical experimental groups. Expression was corrected using 18S rRNA and Hprt.

Single-cell RNA sequencing experiment: A single-cell RNA sequencing library was prepared by isolating thousands of testis cells into nanoliter-sized droplets using Chromium Single Cell 3' Library & Gel Bead Kit v2. In each drop, cDNA was made by reverse transcription. Consequently, a barcode sequence and a Unique Molecular Identifier (UMI) were added to each cDNA molecule. cDNA was pooled and sequencing libraries were prepared manually. Libraries were sequenced on the Nextseq 550 platform and Novaseq 6000 platform.

Analysis of single cell RNA sequencing data: The sequencing data was demultiplexed using bcl2fastq to create a fastq file. After demultiplexing, reads were aligned to a mouse reference genome and a matrix of feature barcodes was created using cellranger counts being trimmed and aggregated into cellranger aggr with default parameters. The following analysis was done using the Seurat program. After generation of the feature barcode matrix, genes expressing less than 3 cells and cells showing expression of less than 200 genes were removed. In addition, cells showing more than 20% of mitochondrial gene expression and cells showing expression of less than 2,000 molecules were removed. The data were corrected through the dimension reduction method. To visualize high-dimensional data, PCA (principle component analysis) was performed through a wide variety of genes selected by FindVariableFeature with 'mean.var.plot'. Cells were assigned to clusters separated by 10 PCs and a resolution parameter of 0.5 using FindCluster. Cells based on 10 PCs were inserted using UMAP and cell cluster information was visualized.

Quantification and Statistical Analysis: Quantification of immunoblots was done with Image J software. Statistical analysis was performed using Mann-Whitney U-test and Student's t-test to show group differences using GraphPad Prism software.

Example 1. Phf7 ^tKO Investigation of involvement in PHF7 spermatogenesis using male mice

Based on the high expression of Phf7 in testis, the function of PHF7 in spermatogenesis was analyzed. First, to find out when Phf7 is expressed during spermatogenesis, we analyzed testis extracts from mice at different developmental times. Depending on age, the following developmental stages are observed; Spermatids at 7 dpp, spermatocytes at 14 dpp, round spermatocytes at 21 dpp, elongated spermatocytes at 28 dpp, condensed spermatocytes at 30 dpp, spermatocytes at 35 dpp ( FIG. 1A ). Since the Phf7 mRNA level increased at 21 dpp ( FIG. 1B ) and the PHF7 protein level increased at 28 dpp ( FIG. 1C ), it was found that Phf7 was expressed in round and elongated spermatogonial cells.

To investigate the role of PHF7 in spermatogenesis, testis-specific Phf7 knockout (KO) mice (hereafter, Phf7 ^tKO ) were constructed ( FIG. 8A ). It was observed that PHF7 protein expression was deleted in testis cells of Phf7 ^tKO mice compared to control ( Phf7 ^{f/f ) mice ( FIG. 1D ).} Here, control mice and Phf7 ^tKO mice were crossed with wild-type females, and Phf7 ^tKO males were infertile compared to control males ( FIG. 1E ). Control males and Phf7 ^f/f There was no significant difference in the ratio of testis weight to male body weight (FIG. 8B). In addition, in the present application, when hematoxylin-PAS staining, Phf7 ^tKO No obvious defects were observed in the male tubules (FIG. 1F).

In histological analysis through hematoxylin-eosin staining in the ^testis , it was observed that the number of sperms in Phf7 tKO was lower than in the control group (FIGS. 1G, 1H). Sperm from Phf7 ^tKO mice showed lower motility compared to controls (Fig. 1I). In IVF experiments, Phf7 ^tKO sperm showed a lower fertilization rate compared to control sperm (Fig. 1J). Then, the sperm morphology was observed, and it was found that most of the Phf7 ^tKO sperm had a round and large head compared to the control group (FIG. 1K). This indicates that the Phf7 ^tKO sperm have less condensed chromatin in the head compared to the control.

During sperm maturation, the nucleus of the progenitor sperm cell is condensed by chromatin condensation including histone-protamine exchange. Sperm with less condensed heads is indicated by an abnormal ratio of histones and protamines in chromatin. Therefore, in the present application, the amount of histone and protamine in sperm was measured. Higher ^{amounts of histones were detected in Phf7 tKO} sperm compared to controls (Fig. 1L, 1M). Besides, more PRM1 and less PRM2 were observed in Phf7 ^{tKO sperm (Fig. 1M).} Next, sperm cells in which histone-protamine exchange occurred were analyzed. In order to determine whether histones remain in condensed sperm cells in which histones were not originally detected, co-immunostaining of histones H3, PRM1, PRM2, and TNP2 was performed in testis sections. In the stage VII-VIII tubules of the control mice, H3 was not detected in the condensed sperm cells expressing PRM1 and PRM2, but in the Phf7 ^tKO mice, sperm cells expressing both H3, PRM1, and PRM2 were observed ( FIGS. 1N and 8C ) . Condensed sperm cells in stage I tubules of control mice express TNP2 but not H3. However, in some condensed sperm cells of Phf7 ^tKO mice, H3 and TNP2 were expressed together ( FIG. 8D ). When the protein levels of histones in the sperm fraction were analyzed, the histone levels decreased as development progressed in the sperm cells of the control mice, but not in the Phf7 ^tKO mice (FIG. 10). Therefore, histones are removed from the condensed sperm cells of the control mice, but the histones remain in the condensed sperm cells of the Phf7 ^{tKO mice.} These data show that Phf7 ^tKO males are defective in histone-protamine exchange during sperm maturation, leading to infertility due to decreased sperm count and abnormal morphology.

Example 2. It was found that PHF7 acts as an E3 ubiquitin ligase for lysine 14 of histone H3.

Herein, it was observed that the H3 band below 25 kDa was reduced in testis cells of Phf7 ^tKO mice compared to control mice ( FIG. 2A ). To determine whether the band shifted upward was ubiquitinated H3, immunoprecipitation was performed with the H3 antibody in the testis cell extract, followed by detection with the Ub antibody. At the same size, ubiquitinated H3 was detected in the control testis cell extract, and the amount of ubiquitinated H3 was decreased in the Phf7 ^tKO testis cells ( FIG. 2B ).

Based on the results of the H3 ubiquitination, the possibility of PHF7 as an E3 ubiquitin ligase of H3 was analyzed in detail. Specifically, PHF7 and ubiquitin were overexpressed in HEK293T cells, and H3 ubiquitination was confirmed by PHF7. Interestingly, 28 kDa Hismax-Ub-H3 and 22 kDa endogenous H3ub were observed in the group containing PHF7 and Hismax-Ub ( FIG. 2C ). It is known that PHF7 induces H2A K119ub, and it was observed that H2A K119ub was increased in the presence of PHF7. H2B and H4 were not ubiquitinated by overexpression of PHF7 (Fig. 2C). An in vitro ubiquitination assay of H3 was performed using recombinant nucleosomes. To this end, we screened the E2 ubiquitin conjugating enzyme and revealed that UbcH5B and 5C are E2 enzymes when PHF7 ubiquitinates H3 (Fig. 2D). Under the same conditions, PHF7 ubiquitinated H2A K119, H2B, and H4, but when H2B K120ub antibody was used, ubiquitination of H2B K120 was not detected (Fig. 2D). And the addition of PHF7, E1, UbcH5B/C, and Ub increased H3 ubiquitination in a time-dependent manner ( FIG. 2E ). Next, residues of H3 ubiquitination mediated by PHF7 were identified. In vitro ubiquitination experiments using deletion mutants of H3 show that ubiquitination occurs within the N-terminus of H3 (FIG. 2F). LC-MS/MS of H3ub obtained in an in vitro ubiquitination experiment showed that the ubiquitination residue of H3 was K14 (FIG. 9A). And, only the K14R mutant of H3 was not ubiquitinated by PHF7 when the mutant was made (FIG. 2G). The K14 residue of H3 was also demonstrated in an in vitro ubiquitination experiment ( FIG. 2H ). In addition, it was confirmed that the overexpression of PHF7 increased the modified H3K14 peptide compared to the control through LC-MS/MS analysis of the ubiquitinated protein in the HEK293T cell extract overexpressing PHF7 ( FIG. 9B ). H2A and H2B ubiquitination decreased by 30% in LC-MS/MS using testis cells from control and Phf7 ^{tKO mice ( FIG. 9C ).} However, H3K14ub in testis cells was not detected in LC-MS/MS analysis. This is presumably because H3K14ub is present in a small amount or in a small proportion of sperm cells. These data show that PHF7 has E3 ubiquitin ligase activity on lysine 14 of H3.

PHF7 has a PHD domain and a RING domain. Previous studies have shown that the N-terminal PHD domain of PHF7 specifically binds to H3K4me2 and that the RING domain of PHF7 acts on E3 ubiquitin ligase activity. In order to determine whether the PHD domain and the RING domain of PHF7 are required for H3 ubiquitination, deletion mutants of each domain were constructed, and deletion of each domain did not induce H3 ubiquitination (FIG. 3A). PHF7 mutants that disrupted the conserved amino acid residues of the RING domain and the PHD domain lost E3 ubiquitin ligase activity (FIGS. 3B, 3C). Mutations in the RING domain of PHF7 did not ubiquitinate H3 in vitro ( FIG. 3D ). Taken together, the PHD domain and the RING domain of PHF7 are required for H3 ubiquitination, and when each domain is disrupted, H3 ubiquitination by PHF7 is lost.

Example 3. Construction and analysis of C160A knock-in mice without Phf7 enzymatic activity

In order to investigate whether the E3 ubiquitin ligase activity of PHF7 is important for spermatogenesis, a Phf7 knock-in (KI) mouse having a C160A mutation in the RING domain in which the enzymatic activity of PHF7 is disrupted (here Phf7 ^CA ) was constructed ( Figure 3E). When control ( Phf7 ^+/CA ) and Phf7 ^CA/CA males were crossed with wild-type females, Phf7 ^CA/CA males were infertile compared to control males ( FIG. 3F ). Control males showed similar fertility to wild-type males, indicating that the C160A mutation was recessive. Although ^{the testis of Phf7 CA/CA} mice showed no visible defects, small numbers of sperm were observed in the testis of Phf7 ^{CA/CA mice ( FIGS. 10A and B).} Sperm of Phf7 ^CA/CA mice showed abnormal morphology, low motility, and low fertility compared to the control group (FIGS. 3G, 3H, and 10C). Similar to the sperm of the Phf7 ^tKO mice, the sperm and sperm cells of the Phf7 ^CA/CA mice showed incomplete histone clearance during sperm maturation (Fig. 3J-3L), indicating that the Phf7 ^CA/CA mice exhibited a phenotype similar to that of the ^{Phf7 tKO mice.} indicates visible. Importantly, H3 ubiquitination was reduced in testis cells of Phf7 ^CA/CA mice compared to control ( FIG. 3M ). Taken together, these data indicate that the E3 ubiquitin ligase activity of PHF7 is important for H3 ubiquitination during sperm maturation.

Example 4. E3 ubiquitin ligase activity of PHF7 was found to be important for histone removal after H4 hyperacetylation

In Drosophila, PHF7 is known to play a role in the transcriptional regulation of subgenes in germ cells. To investigate whether deletion of Phf7 in mouse spermatogenesis induces transcriptome changes at the genomic level, transcriptomes were analyzed in testis cells of control and Phf7 ^{tKO mice using 10X genomics analysis.} The single-cell RNA sequencing results were highly reproducible in two biological replicates and classified as well as known cell populations from spermatogonia to spermatogonia (Fig. 4A, Fig. 11). Cell population shows that the composition of cells involved in spermatogenesis is similar in control and Phf7 ^{tKO mice.} However, surprisingly, we did not find any significant differences in gene expression patterns within each population between the two mice (Fig. 4B), indicating that a defect in Phf7 does not cause significant changes in the transcriptome during spermatogenesis in mice. Based on this, changes in chromatin condensation during sperm maturation were analyzed.

Therefore, the expression of Tnp and Prm was first analyzed. Representing the single-cell RNA sequencing results, qRT-PCR analysis showed no significant differences in the mRNA levels of these genes (Fig. 4C). However, immunoblot analysis using sperm cell extract showed that the protein levels of TNP1/2 and PRM2 were decreased in ^{Phf7 tKO} and Phf7 ^{CA/CA mice compared to the control ( FIGS. 4D and 4E ).} Next, we analyzed H4 hyperacetylation, an epigenetic event that occurs before histone-protamine exchange in kidney sperm cells. Surprisingly, sperm cells from Phf7 ^tKO and Phf7 ^CA/CA mice showed a very high level of H4 acetylation compared to the control group ( FIGS. 4F and 4G ). To determine how a defect in Phf7 increased H4 acetylation in the testis, we performed immunostaining experiments in testis sections. The spermatogenesis cycle in mice consists of 12 stages, and after the 12th stage, it becomes the first stage of the next cycle (FIG. 12). After meiosis, the sperm maturation process is divided into 16 steps. As spermatogonial cells at the base of the tubules move inward during the spermatogenesis process, condensed spermatozoa are present in the tubules of stages 12 and 1-8 (steps 12-16), and in the tubules of stages 9-11 (step 9). -11) kidney-shaped sperm cells are present. In control testis, H4 acetylation first appeared in step 9 elongated spermatozoa from stage 9 ^tubules and decreased in step 12 condensed spermatocytes from stage 12 tubules, whereas in testis from Phf7 ^{tKO and Phf7 CA/CA} mice, H4 acetylation was normally remains until step 13-16 condensed spermatozoa of step 1-8 lavage in the absence of H4 acetylation (Fig. 12B, C). H4 hyperacetylation that occurs in elongated spermatocytes induces histone clearance, which leads to decreased levels of H4 acetylation in condensed spermatocytes. For more accurate verification, H4ac was used as a marker for condensed sperm cells, TNP2 (step 11-14 sperm cell, step 11-2), PRM1 (step 11-16 sperm cell, step 11-8), and PRM2 (step 14-16 sperm cell, step 2). -8) and co-immunostaining was performed. In the control group, H4ac and PRM2 on testis sections showed opposite expression, but in testis of Phf7 ^tKO and Phf7 ^CA/CA mice, H4ac was detected in all tubules and co-stained with PRM2 ( FIG. 4H ). Since TNP2 and PRM1 are expressed from step 11 sperm cells (step 11), H4ac and the two proteins are co-stained only in step 11-12 sperm cells (step 11-12) in the control group. However, since H4ac is expressed in all tubules in Phf7 ^tKO and ^{Phf7 CA/CA} mice, all sperm cells expressing TNP2 and PRM1 are co-stained with H4ac ( FIGS. 13A and 13B ). Because we observed that histones remain at Condensing sperm of Phf7 ^tKO and Phf7 ^{CA / CA} mice, which H4ac will remain at Condensing sperm of Phf7 ^tKO and Phf7 ^{CA / CA} mice.

To investigate the relationship between PHF7 and H4ac, Flag-PHF7 KI mice were constructed ( Phf7 ^Flag from here) (FIG. 14A). The expression of Flag-PHF7 protein was confirmed by immunoblot analysis using testis cells of Phf7 ^{Flag/+ mice ( FIG. 14B ).} When tissues were immunostained with Flag antibody, Flag-PHF7 was detected in the nuclei of step 11-12 sperm cells in step 11 to step 2 lavage tubes (FIGS. 14C, D). When ^{testis sections from Phf7 Flag/+} mice were co-immunostained with H4ac and Flag, Flag-PHF7 was expressed after H4ac induction and was expressed as H4ac in step 11-12 sperm cells (FIG. 14E). The timing of expression of PHF7 shows that the defect in PHF7 does not affect the induction of H4 hyperacetylation.

Taken together, the abnormal H4 acetylation in condensed sperm cells of Phf7 ^tKO and Phf7 ^CA/CA mice can be considered to be due to incomplete removal of histones during sperm maturation. These results indicate that there is a problem in histone removal after H4 hyperacetylation in Phf7 ^tKO and ^{Phf7 CA/CA mice ( FIG. 4I ).}

Example 5. It was identified that the defect of PHF7 causes a decrease in BRDT in early condensed sperm cells and leads to incomplete histone removal

In order to investigate the molecular mechanism of why histone removal was disrupted after H4 hyperacetylation in ^{Phf7 tKO} and ^{Phf7 CA/CA} mice, the level of BRDT, a histone removal factor that recognizes H4 acetylation, was first measured. Surprisingly, the protein level mRNA level of BRDT in sperm cells of Phf7 ^tKO and Phf7 ^CA/CA mice was lower than that of the control group without any difference ( FIGS. 5A and 5B ). To ^determine at which sperm maturation period BRDT decreased in Phf7 tKO and Phf7 ^CA/CA mice, tissue immunostaining was performed for BRDT and H4ac. BRDT is known to be detected from spermatocytes to kidney-shaped spermatocytes in mice and spermatozoa in humans. We confirmed that BRDT was expressed up to step 12 spermatocytes in control mice and decreased in step 13 spermatocytes (Fig. 5C). , 5D). H4ac was co-stained with BRDT in the nuclei of Step 11 and Step 12 sperm cells and their levels decreased in Step 13 sperm cells ( FIG. 5E ). Surprisingly, it was ^{observed that} the level of BRDT was decreased in step 12 sperm cells of Phf7 tKO and Phf7 ^CA/CA mice, and more H4ac remained in the nucleus of step 12 sperm cells and step 13 sperm cells ( FIGS. 5C-5E ). Histones are cleared from the late elongated spermatocytes to the early condensed spermatocytes and H4ac is not detected in step 13 spermatocytes. These data indicate that the co-expression of H4ac and BRDT up to step 12 sperm cells is important for histone clearance, and that the E3 ubiquitin ligase activity of PHF7 is required to maintain BRDT levels in step 12 sperm cells. Therefore, it was hypothesized that a defect in PHF7 failed to maintain BRDT levels in step 12 sperm cells, resulting in incomplete histone clearance.

Example 6. E3 ubiquitin ligase activity of PHF7 was found to be important for BRDT stability

To analyze the relationship between PHF7 and BRDT in sperm cells after meiosis, we first confirmed the co-expression of PHF7 and BRDT in sperm cells of Phf7 ^{Flag/+ mice.} The tissue immunostaining result shows that PHF7 and BRDT are expressed together in step 11-12 sperm cells (FIG. 6A). The BET family, which includes BRD2, 3, and 4, has a SPOP degron between BD1 and BD2, whose stability is regulated by Cul3-SPOP E3 ubiquitin ligase. Importantly, we found that one of the same family, BRDT, had a SPOP degron sequence (Fig. 6B). Immunoblot results performed after overexpression of BRDT and SPOP in HEK293T cells showed that BRDT degradation by SPOP was inhibited by MG132 treatment ( FIG. 6C ). The BRDT mutation without the SPOP degron sequence was not affected by SPOP, indicating that Cul3-SPOP is an E3 ubiquitin ligase that degrades BRDT.

To determine whether PHF7 affects BRDT stability, BRDT, SPOP, and PHF7 were overexpressed in HEK293T cells. PHF7 WT increased the amount of BRDT protein by attenuating SPOP-mediated degradation, whereas PHF7 C160A did not ( FIG. 6D ). BRD4 and PTEN, known substrates of SPOP, were not increased by PHF7, suggesting that PHF7 did not affect the activity of SPOP. SPOP and Cul3 were expressed in sperm cells, and BRD4 and PTEN in PHF7 mutant sperm cells were also not significantly different from the control group (FIG. 6E). Next, only WT, but not PHF7 C160A, attenuated the ubiquitination of BRDT in the ubiquitination assay (Fig. 6F). Cell immunostaining analysis showed that BRDT, SPOP, and PHF7 were co-expressed in the nucleus (FIG. 6G). In the in vitro ubiquitination assay, PHF7 itself did not attenuate SPOP-induced ubiquitination of BRDT ( FIG. 6H ). This shows that PHF7 does not directly regulate ubiquitination of BRDT. Collectively, these data show that the E3 ubiquitin ligase activity of PHF7 is important for maintaining BRDT stability by attenuating the degradation of BRDT by SPOP.

In order to investigate how PHF7 affects BRDT protein stability, the binding of PHF7 to BRDT was first confirmed. However, PHF7 did not bind directly to BRDT ( FIG. 7A ), which led to investigate whether PHF7-mediated histone ubiquitination is related to the regulation of BRDT. In vitro pull-down assay using GST-BRDT and histone ubiquitination or nucleosomes having H4ac, PHF7-mediated histone ubiquitination slightly increased the binding of nucleosomes with H4ac to BRDT ( FIG. 7B ). Nevertheless, PHF7-mediated histone ubiquitination and H4ac-bearing nucleosomes inhibited SPOP-induced BRDT ubiquitination, while one each did not (Fig. 7C). These data show that PHF7-mediated histone ubiquitination interacts with BRDT in the presence of H4ac and modulates ubiquitination of BRDT. It was hypothesized that BRDT recognized H4ac after H4 hyperacetylation in elongated spermatogonial cells, and that PHF7-mediated histone ubiquitination contributed to stabilization of BRDT in early condensed spermatogonial cells to promote histone removal (Fig. 7D).

In Drosophila, PHF7 is known to regulate spermatogenesis by activating male-specific gene expression in early germ cells. In mice, previous studies have focused on PHF7-mediated H2Aub in prototypical spermatocytes and subsequently postulated that RNF8-mediated H2Aub and H2Bub, processes required for histone-protamine exchange, will occur in elongated spermatocytes.

Here, it was revealed that H3K14ub is another substrate of PHF7 and is important for histone-protamine exchange during sperm maturation. After H4 hyperacetylation in elongate spermatogonial cells, PHF7-mediated histone ubiquitination in combination contributes to the stabilization of BRDT, that is, PHF7 plays an important role in maintaining BRDT in early condensed spermatocytes. Defect of PHF7 induces H3K14ub deficiency and subsequently decreases the amount of BRDT protein in early condensed spermatozoa, leading to the generation of abnormal sperm with histones. The present invention proposes to promote histone clearance for abundant BRDT histone-protamine exchange on chromatin via histone ubiquitination.

Although the exemplary embodiments of the present application have been described in detail above, the scope of the present application is not limited thereto, and various modifications and improvements by those skilled in the art using the basic concept of the present application as defined in the following claims are also included in the scope of the present application. will belong to

All technical terms used in the present invention, unless otherwise defined, have the meaning as commonly understood by one of ordinary skill in the art of the present invention. The contents of all publications herein incorporated by reference are incorporated herein by reference.

Claims (4)

providing a eukaryotic cell expressing PHF7 (PHD finger protein 7) and BRDT (Bromodomain testis-specific) proteins;
contacting the cell with a test substance expected to inhibit the ubiquitination activity of the 14th lysine residue of histone 3 (H3) of PHF7;
after the contact, measuring the degree of ubiquitination of the H3 protein in the cell; and
In the measuring step, when the ubiquitination of H3 is reduced in cells contacted with the test substance compared to cells not contacted in the measuring step, selecting the test substance as a histone-protamine exchange inhibitor required for sperm chromatin condensation Containing, sperm chromatin condensation inhibitor screening method.
The method of claim 1,
The method for screening a sperm chromatin condensation inhibitor, wherein the cell is a HEK293T cell overexpressing PHF7.
The method of claim 1,
The cells are provided as animal models other than humans,
In the measuring step, it further comprises measuring the ubiquitination of BRDT protein or the concentration of the BRDT protein in sperm cells of the animal model,
When the BRDT protein ubiquitination is increased compared to cells not treated with the test substance, or the concentration of the BRDT protein is decreased compared to cells not treated with the test substance, the test substance is required for sperm nucleus condensation A method for screening a sperm chromatin condensation inhibitor, comprising the step of screening with a histone-chromatin exchange inhibitor.
4. The method according to any one of claims 1 to 3,
The sperm chromatin condensation inhibitor is used for male contraceptives, the sperm chromatin condensation inhibitor screening method.

Images