KR102320684B1 - Use of nanocomposite comprising a combination of calcium and natural substance for treatment of osteoporosis - Google Patents

Abstract

The present invention relates to a nanocomposite material comprising calcium, vitamin D, and Rhodiola rosea, and a pharmaceutical composition for preventing or treating osteoporosis comprising the same as an active ingredient. When Rhodiola rosea is further included, the present invention synergistically improves calcium absorption to promote osteoblast differentiation and inhibit osteoclast differentiation, thereby inhibiting the onset of osteoporosis, as well as exhibiting a more excellent therapeutic effect on an osteoporosis animal model.

Description

Calcium and natural product combination nanocomposite for preventing or treating osteoporosis {Use of nanocomposite comprising a combination of calcium and natural substance for treatment of osteoporosis}

The present invention relates to a nanocomposite material comprising calcium, vitamin D and Rhodiola rosea , and a pharmaceutical composition for preventing or treating osteoporosis comprising the same as an active ingredient.

BACKGROUND OF THE INVENTION Osteoporosis is a systemic disease that affects bone density and causes bone resorption by reducing calcium and phosphate levels in the bone. In addition, osteoporosis progresses for more than several years without any symptoms in the patient, leading to sudden fractures and bone damage mainly in the hip, spine, and wrist. Furthermore, it can impair human health and quality of life and pose potential risks to society. The most representative causes of this are calcium deficiency, imbalanced thyroid hormone, and heredity. However, the underlying physiological cause of osteoporosis is a change in the rate of bone resorption and bone formation. During the osteoporosis process, the bone-forming ability of osteoblasts is reduced, but the osteoclast's bone resorption function is activated, leading to loss of bone density. Therefore, the pharmacological effects of antiosteoporotic drugs need to inhibit osteoclast differentiation and promote osteoblast function in order to increase bone density and hardness.

Compared to other drugs or supplements, calcium and vitamin D (Vit D) are widely used in the treatment of osteoporosis. In general, calcium prevents loss of bone matrix and accelerates remodeling of bone structures through blood calcium homeostasis. Additionally, vitamin D plays an important role in increasing intestinal absorption of calcium and phosphoric acid. In addition, along with calcium, vitamin D helps maintain bone strength.

On the other hand, nanoscale helps to improve drug dissolution. Nanoscale calcium helps to improve ion release patterns, prevent damage to the stomach, and prevent kidney stone formation.

R. rosea has angiogenesis and adaptogenicity, helping improve mood, alleviate depression, fight stress, and strengthen the body's immunity. ) is known to have a therapeutic effect for inducing The active compound of R. rosea is salidroside, which has been studied to promote osteogenic differentiation. Shilajit has been studied and used in Ayurvedic medicine for several pharmacological effects, including bone healing and prevention. Shilajit has also been shown to support bone mineralization, promote complete calcium deposition, and further enhance bone formation or osteogenesis due to its rich source of minerals such as silicon, magnesium, and calcium. These therapeutic ions are well-known chemical components for angiogenesis and bone formation.

As a result of intensive research efforts to discover a combination that exhibits better prevention or treatment effects of osteoporosis by adding a natural substance to the combination of natural calcium and vitamin D, the present inventors have made intensive research efforts to discover a combination of vitamin D containing calcium and Rhodiola rosea, a kind of herb. When additionally included, it synergistically enhances calcium absorption to promote differentiation into osteoblasts and inhibits differentiation into osteoclasts, thereby inhibiting the onset of osteoporosis and exhibiting a more excellent therapeutic effect in osteoporosis animal models. was confirmed, and the present invention was completed.

As one aspect for achieving the above object, the present invention provides a nanocomposite material comprising calcium, vitamin D and Rhodiola rosea.

According to the present invention, the nanocomposite material further comprising R. rosea, a kind of herb, in addition to calcium and vitamin D exhibits synergistically significantly improved calcium absorption, osteoblast formation promotion and/or osteoclast formation inhibitory effect. Based on the discovery that a material containing silajit, a natural mineral, instead of R. rosea, can exert a better prevention or treatment effect for osteoporosis than when additionally containing silajit together with R. rosea do.

The term of the present invention, " Rhodiola rosea (Rhodiola rosea)" is a perennial plant also called rhododendron (紅景天), and is known by various names such as arctic root and golden root in addition to the above scientific name. Relieves stress, lowers fatigue, reduces symptoms of depression, improves brain function and/or mobility, and is known to have anticancer effects, and is also used as a medicinal in traditional medicine. Currently, health supplements containing Rhodiola rosea extract are commercially available in the United States for this purpose.

The nanocomposite material of the present invention may include the Rhodiola rosea in an amount of 0.05 to 5 wt% based on the weight of the total composition, but is not limited thereto. In a specific embodiment of the present invention, a desired effect could be sufficiently achieved even with a small amount of 1 wt%. In this case, Rhodiola rosea can be prepared and used in powder form. For example, a powder obtained by cutting the raw material into small pieces and drying the moisture by a spray drying method may be used, but the present invention is not limited thereto.

The nanocomposite material of the present invention may utilize natural calcium as the calcium. Unlike other calcium sources such as purified calcium or commonly used calcium carbonate or calcium citrate, natural calcium can exhibit synergistic effects with calcium such as osteoblast differentiation or neovascularization, such as _{MgO and SiO 2 .} By additionally including substances, ancillary effects can be expected.

Furthermore, the calcium may use particles adjusted to an average size of 100 to 700 nm. As described above, by using calcium adjusted to nanoscale particles, the surface area is widened to promote absorption, and it has the advantage of being able to formulate in various forms later. In this case, the control of the particle size may be achieved by reducing the size by a method known in the art, such as ball milling, and filtering it through a sieve in a desired size range, but is not limited thereto. By using such small nanoscale particles, absorption can be improved by increasing the surface area. On the other hand, when micro-scale calcium having a particle size larger than this is used, for example, several to tens of μm in size, it can stimulate the stomach to damage the inner wall and in severe cases can transform the shape of the stomach to the extent that it can be seen with the naked eye, Overdosage due to the rate of absorption may lead to the formation of stones in the kidneys.

The calcium component contained in the nanocomposite material of the present invention may be natural calcium fortified with sintered and/or skim milk. Calcium absorption in the body can be accelerated by using calcium fortified with skim milk as described above. Furthermore, the calcium content can be increased through the above process, and calcium carbonate can be converted into calcium oxide through the sintering. Changes in these components can be confirmed through XRD (FIG. 1B). At this time, no change in particle size and/or shape is involved (FIG. 1A).

In addition, the nanocomposite material of the present invention may further include silajit, which is a kind of natural mineral.

As used herein, the term "shilajit" refers to blackish-brown powder or exudate from alpine rock, also called mumijo or momiyo, a mineral, humic acid. , fulvic acid, and about 85 kinds of ingredients. It is found in the highlands of the Himalayas and is considered one of the most important ingredients in Ayurveda, the ancient system of traditional Indian medicine. Its main ingredient, fulvic acid, is known to have excellent active oxygen removal and sterilization action as essential minerals such as calcium, magnesium, iron, vitamins, and amino acids, as well as many nutrients and a large amount of dissolved oxygen. no side effects on In particular, it is believed to be able to prevent various diseases based on its strong antioxidant effect, and has beneficial effects on the human body, such as neutralizing and detoxifying toxic substances and heavy metals, excreting them out of the body, and restoring the body's electrochemical balance with powerful natural electrolytes. It is a known material that is attracting attention in the BT field.

In another aspect, the present invention provides a pharmaceutical composition for the prevention or treatment of osteoporosis comprising a nanocomposite material comprising calcium, vitamin D and Rhodiola rosea as an active ingredient.

As used herein, the term “osteoporosis” refers to a disease in which a decrease in bone strength increases the risk of fracture, and the sites prone to fracture by this are the vertebrae, forearm, hip, and the like. Osteoporosis usually shows no symptoms until the actual fracture occurs, but it is weakened by minor stress or spontaneously to the extent that it can break. After a fracture, chronic pain may accompany or the ability to perform daily activities may decrease. Osteoporosis can be caused by a lower-than-normal bone volume or by excessive bone loss, and when estrogen levels improve after menopause, bone loss can increase. Osteoporosis can also be caused by diseases or treatments such as alcoholism, anorexia, hyperthyroidism, kidney disease, and surgical resection of the ovaries. Some drugs, such as anticancer drugs, chemotherapy, proton pump inhibitors, selective serotonin reuptake inhibitors, and glucose tolerance inhibitors, increase bone loss, and lack of exercise and smoking are also risk factors for osteoporosis. Osteoporosis is defined as 2.5 times the standard deviation of bone density in young adults.

In order to treat osteoporosis, basic lifestyle changes can be considered, but if the treatment is not sufficient, drugs such as female hormones, SERM (selective estrogen receptor modulator), bisphosphonates, and parathyroid hormone can be used. . Lifestyle improvement is important prior to drug treatment. First of all, osteoporosis patients need a balanced intake of nutrients such as calcium, vitamin D, and protein. For calcium, 1,000 to 1,500 mg per day should be consumed, and for vitamin D, 400 IU per day. In the case of vitamin D, intake is important, but it is good to increase synthesis in the body through proper exposure to sunlight. Furthermore, in order to prevent fractures in osteoporotic patients, it is desirable to remove various risk factors that can cause falls in advance, refrain from smoking and excessive drinking, and continuous exercise helps to prevent loss of bone density.

As described above, the nanocomposite material containing calcium, vitamin D and a predetermined Rhodiola rosea of the present invention contains ingredients that are not cytotoxic and harmless to the human body as active ingredients, and synergistically improves calcium absorption It can be useful for preventing or treating osteoporosis because it can promote the formation of osteoblasts and inhibit osteoclasts. As described above, since the nanocomposite material of the present invention exhibits the effect of promoting bone formation by improving calcium absorption, osteoporosis as a disease to which it can be applied is not only osteoporosis in a narrow sense according to literal interpretation. In addition, it may include a wide range of bone defect diseases that may occur in dentistry and/or orthopedics.

As another aspect, the present invention provides a method for preventing or treating osteoporosis, comprising administering the pharmaceutical composition to an individual in need thereof.

The term "prevention" of the present invention refers to any action that inhibits or delays the occurrence, spread, and recurrence of osteoporosis by administration of the pharmaceutical composition of the present invention, and "treatment" refers to the It refers to any action that improves or beneficially changes the symptoms of a disease.

In a specific embodiment of the present invention, the treatment comprises reducing or alleviating the signs of osteoporosis, reducing the severity of the disease, delaying or slowing the disease, palliation or stabilization of the disease state, and others. It may mean, but is not limited to, beneficial results.

As used herein, the term "individual" refers to an individual suspected of having osteoporosis invented or may develop osteoporosis, including humans, monkeys, cattle, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, It refers to all animals, including rats, rabbits, or guinea pigs, and by administering the pharmaceutical composition of the present invention to these individuals, the disease can be effectively prevented or treated. In addition, the pharmaceutical composition of the present invention may exhibit a synergistic effect by administering in parallel with the existing therapeutic agent.

The term "administration" of the present invention means providing a predetermined substance to a patient by any suitable method, and the administration route of the composition of the present invention may be administered through any general route as long as it can reach the target tissue. have. Intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, may be administered intrarectally, but is not limited thereto. In addition, the pharmaceutical composition of the present invention may be administered by any device capable of transporting an active substance to a target cell. Preferred administration modes and formulations are intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections, and the like. For injection, aqueous solvents such as physiological saline solution and Ringer's solution, vegetable oil, higher fatty acid esters (eg, ethyl oleate), and non-aqueous solvents such as alcohols (eg, ethanol, benzyl alcohol, propylene glycol, glycerin, etc.) Stabilizers for preventing deterioration (e.g., ascorbic acid, sodium hydrogen sulfite, sodium pyrosulfite, BHA, tocopherol, EDTA, etc.), emulsifiers, buffers for pH control, to inhibit the growth of microorganisms Pharmaceutical carriers such as preservatives (eg, phenylmercuric nitrate, thimerosal, benzalkonium chloride, phenol, cresol, benzyl alcohol, etc.) may be included.

For example, the composition of the present invention may further include a pharmaceutically acceptable carrier, diluent or excipient, and may be powder, granule, tablet, capsule, suspension, emulsion, It can be formulated and used in various forms such as oral formulations such as syrups and aerosols, injections of sterile injection solutions, etc. . Examples of suitable carriers, excipients or diluents that may be included in such compositions include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, and cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, the composition of the present invention may further include a filler, an anti-agglomeration agent, a lubricant, a wetting agent, a fragrance, an emulsifier, a preservative, and the like.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient in the composition, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc. are mixed and formulated. In addition to simple excipients, lubricants such as magnesium stearate and talc may be used.

Oral liquid formulations may include suspensions, solutions, emulsions, syrups, etc., and various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. in addition to water and liquid paraffin, which are commonly used simple diluents, may be included. can

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. The suppositories are Witepsol, Macrogol, and Tween61. Cacao butter, laurin fat, glycerogelatin, etc. may be used. On the other hand, the injection may contain conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifiers, stabilizers, preservatives, and the like.

The formulation may be prepared by a conventional mixing, granulating or coating method and may contain the active ingredient in the range of about 0.1 to 75% by weight, preferably about 1 to 50% by weight. A unit dosage form for a mammal weighing about 50 to 70 kg contains about 10 to 200 mg of active ingredient.

In this case, the composition of the present invention is administered in a pharmaceutically effective amount. As used herein, the term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not to cause side effects, and the effective dose level depends on the patient's health condition, disease type, severity, drug activity, sensitivity to drug, administration method, administration time, administration route and excretion rate, duration of treatment, factors including drugs used in combination or concomitantly, and other factors well known in the medical field. can The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

For example, the dosage may be increased or decreased depending on the route of administration, the severity of the disease, sex, weight, age, etc., and thus the dosage is not intended to limit the scope of the present invention in any way.

The preferred dosage of the compound of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the form of the drug, the route and duration of administration, but may be appropriately selected by those skilled in the art. However, for a desirable effect, it is preferable to administer the compound of the present invention at 0.0001 to 100 mg/kg (body weight) per day, preferably 0.001 to 100 mg/kg (body weight). Administration may be administered once a day or in divided doses via oral or parenteral routes.

The composition for preventing or treating osteoporosis of the present invention may be prepared into a pharmaceutical formulation using a method well known in the art to provide rapid, sustained or delayed release of an active ingredient after administration to a mammal. In the preparation of formulations, the active ingredient may be mixed or diluted with a carrier or enclosed in a carrier in the form of a container.

Accordingly, the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier, diluent or excipient, and powder, granule, tablet, capsule, suspension according to a conventional method for each purpose of use. Oral formulations such as emulsions, syrups, aerosols, etc., can be formulated and used in various forms such as injections of sterile injection solutions. can be Examples of suitable carriers, excipients or diluents that may be included in such compositions include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, and cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, the composition of the present invention may further include a filler, an anti-agglomeration agent, a lubricant, a wetting agent, a fragrance, an emulsifier, a preservative, and the like.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient in the composition, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc. are mixed and formulated. In addition to simple excipients, lubricants such as magnesium stearate and talc may be used.

Oral liquid formulations may include suspensions, solutions, emulsions, syrups, etc., and various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. in addition to water and liquid paraffin, which are commonly used simple diluents, may be included. can

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. The suppositories are Witepsol, Macrogol, and Tween61. Cacao butter, laurin fat, glycerogelatin, etc. may be used. On the other hand, the injection may contain conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifiers, stabilizers, preservatives, and the like.

The formulation may be prepared by a conventional mixing, granulating or coating method and may contain the active ingredient in the range of about 0.1 to 75% by weight, preferably about 1 to 50% by weight. A unit dosage form for a mammal weighing about 50 to 70 kg contains about 10 to 200 mg of active ingredient.

In this case, the composition of the present invention is administered in a pharmaceutically effective amount. As used herein, the term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not to cause side effects, and the effective dose level depends on the patient's health condition, disease type, severity, drug activity, sensitivity to drug, administration method, administration time, administration route and excretion rate, duration of treatment, factors including drugs used in combination or concomitantly, and other factors well known in the medical field. can

The preferred dosage of the compound of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the form of the drug, the route and duration of administration, but may be appropriately selected by those skilled in the art. However, for a desirable effect, it is preferable to administer the compound of the present invention at 0.0001 to 100 mg/kg (body weight) per day, preferably 0.001 to 100 mg/kg (body weight). Administration may be administered once a day or in divided doses via oral or parenteral routes.

For example, the dosage may be increased or decreased depending on the route of administration, the severity of the disease, sex, weight, age, etc., and thus the dosage is not intended to limit the scope of the present invention in any way.

In addition, the pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, hormone therapy, drug therapy, and biological response modifiers for the prevention and treatment of osteoporosis. For the purposes of the present invention, the pharmaceutical composition according to the present invention may be administered in combination with one or more additional drugs commonly used for the treatment of osteoporosis.

When the pharmaceutical composition according to the present invention is administered for the treatment of osteoporosis, it may be administered in combination and/or in combination with one or more ingredients and/or drugs effective for the treatment or prevention of osteoporosis. At this time, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects in consideration of all of the above factors, which can be easily determined by those skilled in the art.

Specifically, the combination and/or combination administration may include simultaneous, sequential, or reversed administration of the compound of the present invention or a pharmaceutically acceptable salt thereof and the one or more additional drugs, and may be administered simultaneously in an appropriate effective amount in combination, or , can be administered concurrently, sequentially, or in reverse order after storing each in a separate container.

As another aspect, the present invention provides a food composition for preventing or improving osteoporosis, comprising a nanocomposite material comprising calcium, vitamin D and Rhodiola rosea as an active ingredient.

The “osteoporosis” and “prevention” are the same as described above.

"Improvement" of the present invention refers to any action in which the symptoms of the subject disease and the subject of the invention are improved or beneficial by using the composition comprising the compound of Formula 1 or a pharmaceutically acceptable salt thereof.

The food composition according to the present invention includes the form of pills, powders, granules, needles, tablets, capsules or liquids, and the food to which the composition of the present invention can be added, for example, various foods, for example , beverages, gum, tea, vitamin complexes, and health supplements.

As an essential ingredient that can be included in the food composition of the present invention, there is no limitation on other ingredients other than the inclusion of the compound of Formula 1 or a pharmaceutically acceptable salt thereof, and various herbal extracts, food supplement additives or natural carbohydrates, such as conventional food may be contained as an additional component.

In addition, the food supplement additives include food supplement additives conventional in the art, for example, flavoring agents, flavoring agents, coloring agents, fillers, stabilizers, and the like.

Examples of the natural carbohydrate include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. Natural flavoring agents (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used as flavoring agents other than those described above.

In addition to the above, the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and fillers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. In addition, it may contain the flesh for the production of natural fruit juice and fruit juice beverages and vegetable beverages. These components may be used independently or in combination.

In the present invention, the food composition includes health functional food and health supplement food.

The functional food (functional food) is the same term as food for special health use (FoSHU), and food manufactured and/or processed using raw materials or ingredients having useful functionality in the human body. As such, it refers to foods with high medical and medical effects that are processed to efficiently exhibit bioregulatory functions in addition to nutritional supply. Here, "function (sex)" means to obtain a useful effect for health purposes such as regulating nutrients or physiological action with respect to the structure and function of the human body. As described above, foods that contain ingredients useful to the human body and whose functions and safety have been recognized by the Ministry of Food and Drug Safety are called health functional foods. It is classified as (supplementary) food. The food of the present invention can be prepared by a method commonly used in the art, and at the time of manufacture, it can be prepared by adding raw materials and components commonly added in the art. In addition, the formulation of the food may be prepared without limitation as long as it is a formulation recognized as a food. The food composition of the present invention can be prepared in various forms, and unlike general drugs, it has the advantage of not having side effects that may occur during long-term administration of the drug using food as a raw material, and has excellent portability.

As yet another aspect, the present invention provides a feed composition for preventing or improving osteoporosis comprising a nanocomposite material comprising calcium, vitamin D and Rhodiola rosea as an active ingredient.

The "osteoporosis", "prevention", and "improvement" are as described above.

As used herein, the term "feed" means any natural or artificial diet, meal, etc., or a component of said meal, intended for or suitable for eating, ingestion, and digestion by an animal.

The type of feed is not particularly limited, and feed commonly used in the art may be used. Non-limiting examples of the feed include plant feeds such as grains, root fruits, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, gourds or grain by-products; and animal feeds such as proteins, inorganic materials, oils and fats, minerals, oils and fats, single cell proteins, zooplankton or food. These may be used alone or in mixture of two or more.

The feed of the present invention may be powder feed, solid feed, moist pellet feed, dry pellet feed, EP (Extruder Pellet) feed, raw feed, etc., but is not limited thereto.

The composition for feed of the present invention may include a binder, an emulsifier, a preservative, etc. added to prevent quality deterioration, and the composition for feed may include a feed additive. There may be amino acids, vitamins, enzymes, flavoring agents, non-protein nitrogenous compounds, silicates, buffers, extractants, oligosaccharides, etc. added to feed to increase the efficacy. In addition, it may further include a feed mixture and the like, but is not limited thereto.

The nanocomposite material comprising calcium, vitamin D and a predetermined Rhodiola rosea of the present invention can synergistically improve calcium absorption, promote the formation of osteoblasts, and inhibit osteoclasts, and in particular, substances that are harmless to the human body. Since it is included as an active ingredient, it can be usefully used as a pharmaceutical composition for the prevention or treatment of osteoporosis, as well as a food composition or a feed composition.

1 is a diagram showing the characterization and ion release potential of natural Ca. (A) is an SEM image, particle size, and elemental analysis results of natural Ca before/after sintering, (B) is an X-ray diffraction analysis result showing the peak shift from calcium carbonate to calcium oxide after sintering, (C) ) shows the tendency of calcium ion release from the experimental group including Ca nanocomposite and R. rosea (Ca+R), silaget (Ca+S), and combinations thereof (Ca+R+S).
2 is a diagram showing a method for measuring cytotoxicity and the results for Ca nanocomposite. (A) shows the cell viability up to 3 days, and there was a significant difference between the cell-only group and the Ca+R group. (B) shows the live-and-dead staining results, which did not show severe cytotoxicity (*p < 0.05 & **p < 0.01 compared with the control group, n = 3).
3 is a diagram showing the osteogenic differentiation potential of Ca nanocomposite material. (A) shows the results of qRT-PCR quantitative analysis of gene expression (OCN, ALP, and BSP) related to osteogenic differentiation. (B) shows the detection result of BMP2 protein expression by immunostaining. (C) shows the results of ALP staining, indicating that osteogenic differentiation was improved in the Ca+R group compared to the o/c group. (D) shows the results of quantitative analysis of cell mineralization by ARS staining, and the degree of mineralization was significantly increased in the Ca+R group compared to the cell-only group (*p < 0.05 and **p < 0.01 cells). compared to control alone, n = 3).
Figure 4 is a diagram showing the inhibition of osteoclasts by the Ca nanocomposite material. (A) shows the morphological changes of osteoclasts in the Ca+R group and the Ca+S group through the TRAP assay. (B) shows quantification and average size of TRAP-positive cells (**p<0.01 and ***p<0.001 vs o/c group).
5 is a diagram showing the analysis results of the osteoporosis rat model after Ca nanocomposite delivery through oral administration. (A) shows the low and high magnification images of the femur by H&E staining, and the results show the porous structure of the bone in the OVX group and the increased bone density in the other groups. (B) is a result of staining the bone-related protein marker, the Ca + R group compared to the OVX group showed significantly increased expression (OCN and Col1), and the nanocomposite group (Ca + R and Ca + S) In the osteoclast expression was decreased. C) shows the results of quantifying protein expression based on the staining intensity (n=4, p < 0.05 and **p < 0.01 compared to OVX control).
6 is a view showing the μ CT analysis results of the femur after Ca nanocomposite treatment. (A) shows a representative 2D image of the femur. (B) is a representative 3D illustration of the upper and inner density of the femur (red), indicating that the BMD of the Ca-treated group was increased compared to that of the OVX group.
7 is a diagram showing H&E staining results for confirming toxicity to internal organs after oral administration for 45 days. The biocompatibility of the internal organs was similar to that of the control group, and no serious damage was observed in the organs of each group. Scale bar: 200 μm.
8 is a diagram showing the results of H&E and TUNEL-AP staining for confirming the biocompatibility of the stomach and kidney. All compared groups showed similar trends.
9 is a diagram showing changes in body weight and blood calcium concentration measured in a rat model. (A) shows the change in body weight over time. Although the weight of rats in the OVX group increased, the body weight decreased after oral administration of the labeled compound, and the body weight was close to that of the healthy group rats. (B) shows the blood calcium concentration, and the blood calcium concentration increased after oral delivery of the labeled compound.
10 is a diagram showing the effect of the particle size of the composite material when administered to a rat model. (A) is an image showing the shape and size of a Ca nanocomposite material (left) according to an embodiment of the present invention and a micro-particle composite material (right) as a comparative example, (B) is each of these composite materials The form of the stomach extracted from the administered rat is shown.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1: Ca fortification and addition of natural products

Natural calcium was provided by a drug research institute in Mongolia. In order to increase the calcium content, raw Ca was sintered at 900° C. and mixed with zirconia balls for compaction. The sintered Ca was sieved and incubated in a drying oven for 24 hours. Further, Ca was fortified with 0.25% skim milk, and Vit D was added to the fortified Ca to prepare a final product. Additionally, R. rosea (1 wt %) and Shilajit (1 wt %) were each added to the Ca. The daily Ca uptake was 1200 mg and the daily Vit D uptake was 400 IU. With reference to this, tablets were prepared to contain calcium and Vit D in amounts corresponding to the daily recommended amount per individual tablet. The experimental groups were divided into 4 groups and labeled as follows: Ca (Ca with Vit D), Ca + R + S (all cocktails with Ca and Vit D), Ca + R ( R. rosea with Ca and Vit D) and Ca+S (Shillajit with Ca and Vit D).

Example 2: Characterization of Ca

The size and shape of Ca was observed with a scanning electron microscope (SEM, JEOL JSM 6510). The particle size distribution was measured based on the SEM image, and elemental analysis of the nanocomposite was performed by energy dispersive spectroscopy (EDS) measurement. In addition, X-ray diffraction (XRD) was performed to observe the crystallographic phase of Ca (Philips MRD CuKa, 40 kV, 20 mA). To detect calcium ion release, each tablet was immersed in 10 ml culture medium and the supernatant was recovered. Nitric acid was added to the supernatant prior to inductively coupled plasma-atomic emission spectrometry (ICP-AES) analysis. In order to identify the components of each inorganic compound, X-ray fluorescence spectroscopy (XRF) measurement was performed.

Example 3: Osteogenic Differentiation Potential

To study osteogenic differentiation, rat bone marrow-derived MSCs were used. The cells were isolated from adult rat femora and tibiae according to guidelines approved by the Animal Ethics Committee of Dankook University. The isolated cells were centrifuged and filtered several times to remove red blood cells. Furthermore, the supernatant is recovered and an alpha-minimum essential medium (alpha-) containing 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 mg/mL streptomycin (streptomycin). It was suspended in minimal essential medium (αMEM). Cells were maintained at 37° C. in a humidified atmosphere of _{5% CO 2 .} MSCs were used for 3 to 4 passages. To prepare the osteogenic cell differentiation medium, 50 ng/ml sodium ascorbate, 10 mM b-glycerol phosphate, and 100 nM dexamethasone were added to αMEM medium. did. To study the cells, samples of each group were prepared as tablets and immersed in 10 ml cell medium for 24 hours. The recovered supernatant was stored at 4°C and diluted with fresh medium.

The formulated tablet was first sterilized and then immersed in 10 ml of cell medium or osteogenic differentiation medium at 37° C. for 24 hours. The supernatant was collected, filtered, and used for cell research. In order to test the cell viability, 3×10 ⁴ MSCs were aliquoted in a 24-well plate for 24 hours, and the medium was exchanged with an extract medium and cultured for up to 3 days. A cell viability assay was performed using a cell counting kit assay (CCK-8; DOJINDO, Japan). After CCK solution was added to the cells and incubated for 2 hours, absorbance was measured at a wavelength of 450 nm using a microplate reader (iMark; BIO-RAD, USA). Furthermore, the effect of the calcium nanocomposite on cytotoxicity was confirmed with a live and dead staining kit.

Bone-associated genes (octeocalcein; OCN), alkaline phosphatase (ALP) and bone sialoprotein (BSP) were analyzed by RT-PCR, and osteogenic differentiation was analyzed by RT-PCR. decided. Accordingly, MSCs (7.5×10 ⁵ cells) were dispensed in a 12-well plate, and the supernatant recovered from the osteogenic medium containing the tablets was added. After culturing for 14 days, cells were harvested and total RNA was purified by RNeasy mini kit (Gene all, South Korea, 304-150) according to the manufacturer's instructions. Next, the isolated RNA was reverse transcribed into cDNA using AccuPower RT-PCR premix (Bioneer, South Korea) using a thermal cycler. PCR amplification was performed using Sensimix Plus SYBR master mix (Gene all, South Korea). A comparative computed tomography (CT) technique was performed to analyze gene expression, and the expression of each gene was normalized to the GAPDH housekeeping gene. The primers used for osteogenic differentiation gene amplification are shown in Table 1.

Gene Forward(5'-3') Reverse(5'-3') housekeeping gene Rat GAPDH CAAGGATACTGAGAGCAAGAG ATGGAATTGTGAGGGAGATG Osteogenic markers ALP CTCTGCCGTTGTTTCTCTAT AGGTGCTTTGGGAATCTG BSP GTACATCTGAACGGCTAAGG GTTTGGTAAAATCTGGCAACTC OCN GCTTCAGCTTTGGCTACT CGTTCCTCATCTGGACTTTAT

Osteogenic differentiation was assessed by immunostaining, ALP activity (at day 14), and Alizarin red staining (at day 21). Cells (3.0×10 ⁴ cells/well) were aliquoted in a 24-well plate, and the extracted medium was replaced every 2 days, and culture continued until days 14 and 21.

Bone morphogenic protein-2 (BMP2) protein expression was detected according to the following protocol: cells washed, fixed with 4% paraformaldehyde solution, and fixed for cell membrane permeabilization 0.05% Triton X-100 was applied for 10 minutes. Furthermore, the cells were washed twice, and a primary antibody against BMP2 (1:200, polyclonal, Santa Cruz Biotechnology, USA) was added and incubated overnight. The next day, the cells were treated with Alexa Fluor 555-labeled secondary antibody (1:200, Life Technologies), and phalloidin for labeling the cytoskeleton and DAPI for labeling the cell nucleus (P36935, Invitrogen) was co-stained.

For ALP staining, cells were treated with the extracted medium for 14 days, washed with PBS, and incubated with ALP buffer (0.6 ml) for 1 hour. Then, the stained cells were visualized with a light microscope (IX71, Olympus, Tokyo, Japan) to detect ALP activity. Alizarin red S (ARS) staining was performed to observe cell mineralization after treatment with the osteogenic medium extracted for 21 days. Cells were captured and quantified after incubation with 40 mM (pH 4.2) ARS solution for 10 min from the assay kit. In order to separate the stained calcium from the cells, 400 ml of 10% cetylpyridinium chloride (CPC) was added to the sample, and the OD value was measured at 405 nm.

Example 4: Study of osteoclast inhibition using RAW 267.4 cells

RAW 264.7 cells were selected for study as model cells for osteoclast differentiation. Osteoclasts are involved in the bone resorption process or breakdown of the bone structure. First, RAW264.7 cells were cultured in DMEM containing 10% FBS and 1% PS. Furthermore, osteoclast differentiation was induced by daily addition of 50 ng/ml receptor activator of nuclear factor-κligand (RANKL) to the medium of RAW 264.7 cells. The tablets of each group were pre-soaked in 10 ml cell medium for 24 hours, and 1 ml supernatant containing 50 ng/ml RANKL was added to the cells for 5 days. After culturing for 5 days, the cells were washed with PBS, fixed with paraformaldehyde for 5 minutes, and then TRAP (Tartrate-resistant acid phosphatase ) staining assay (Cosmo Bio) was performed. Furthermore, cells were captured with an optical microscope (IX71, Olympus, Japan) to observe osteoclast inhibition. The number of osteoclasts was quantified based on the microscopic image, and the average size of the cells was measured with ImageJ software.

Example 5: Osteoporosis model in vivo Experiment

To study the possibility of osteoporotic drugs, 16-week-old ovariectomized female Sprague-Dawley rats were used. Daily, the drug was delivered by oral administration at a dose of 15 mg/rat to rats. Experimental animals were maintained in a 12-hour light/dark cycle of condition humidity (30-70%) and temperature (20-24° C.) under a controlled environment. The experimental protocol for animal experiments and laboratory animal care was reviewed and approved according to guidelines established by the Animal Care and Use Committee (Dankook University, Cheonan, Korea).

Example 6: Micro-CT and Histological Analysis

Blood samples were collected from the jugular vein and confirmed for biochemical analysis of serum (Ca ions) on days 30 and 45. The rats were anesthetized by intramuscular injection (a mixture of ketamine, 80 mg/kg) and xylazine (10 mg/kg), and bone density was measured by micro-CT (μCT scanner 1176; Skyscan, Belgium). evaluated. The femur and tibia were scanned with a camera pixel size of 12.56 mm/1 mm aluminum, a rotation step of 0.5°, and a rotation angle of 180°. The scanned X-ray tube had an exposure time of 279 ms, a voltage of 65 kV and a current of 385 mA. The center of the femur was selected as a region of interest (ROI), and a newly formed femur in the femur head was selected. The percentage of new bone volume in the ROI area was measured, and the 3D μCT image was reconstructed with a computer analysis program, CTAn (Skyscan). Bone volume percentage (%), bone area (mm), and bone surface density (1/mm) of new bone in the ROI were quantified based on the 3D constructed image.

On day 45, the rats were sacrificed, and after being fixed by submersion in neutral formalin for 24 hours, the tissues were transferred to a decalcification solution (RapidCal solution, USA) for 2 weeks. After treatment with xylene and ethanol series, histological staining was continued and the samples were embedded in paraffin. For histological analysis, isolated tissue samples were deparaffinized and immersed in a series of xylene and ethanol solutions. Furthermore, hydrated tissue slides were stained with hematoxyylene and eosin and visualized under a light microscope.

For immunohistochemical staining, sectioned tissues were prepared as follows, and the tissues were treated with OCN (1:200, Santa Cruz), Col 1 (1:200, Santa Cruz), and RANKL (1: 200, Santa Cruz) after overnight incubation with each antibody; Incubated with Alexa Fluor 555-labeled secondary antibody (1:200, Life Technologies) and co-stained with phalloidin for cytoskeleton and DAPI (P36935, Invitrogen) for cell nucleus. To visualize the tissue, each sample was imaged with a fluorescence microscope (IX71, Olympus, Japan), and the intensity was quantified with ImageJ software.

Example 7: Statistical Analysis

Experimental assays were performed three times, and the data were expressed as mean ± one standard deviation. Statistical analysis was performed by one-way analysis of variance (ANOVA) with Bonferroni post hoc correction. p<0.05 and p<0.001 showed significant differences unless otherwise noted.

Experimental Example 1: Characterization of Ca nanocomposite material

First, Ca was sintered and the size was reduced by a ball-milling method. The morphology of Ca was observed by SEM, and particles were quantified based on the SEM image ( FIG. 1A ). According to the SEM image, there was no significant difference in particle size after sintering, but as confirmed based on EDS measurement, the calcium content was significantly increased by 10%. Specifically, the average particle size was about ~400 nm both before and after sintering. Next, the XRD result showed the conversion of calcium carbonate to calcium oxide, and the change in the crystal structure is shown in FIG. 1B . The average peak of CaCO ₃ shifted after sintering, indicating the conversion of CaO during calcination.

Sintered Ca and Vit D were selected as base materials for osteoporotic drug formulation, and R. rosea (golden root) and Shilajit were independently added. R. rosea is known to induce bone formation based on the active compound salidroside, and Shilajit is composed of minerals that promote bone formation. For the experiment, all ingredients were mixed and molded to obtain a tablet form. To test Ca ²⁺ ion release, each tablet was immersed in 10 ml culture medium. The initial release was about ∼250 ppm and then increased somewhat with time ( FIG. 1C ). However, the Ca group showed an increased release of ^{Ca 2+} ions, released up to higher concentrations of Ca content.

1 wt % of R. Rosea and Shilajit were added to fortified Ca nanocomposites, and compositional differences were studied by XRF ( Table 2 ).

According to the compositional difference, the Ca + R group contained more silicon oxide, iron oxide and calcium oxide than the Ca alone group. Furthermore, the Ca+S group showed more potassium oxide and phosphoric acid groups than other formulations.

Experimental Example 2: Osteoblast differentiation and osteoclast inhibition

After immersing the obtained purified form in the cell medium for 24 hours, the supernatant was recovered for indirect use in the cells. For cell viability, conditioned media was added to the cells and replaced every 2 days. CCK assay results did not show severe toxicity in any group ( FIG. 2A ). Moreover, live-and-dead staining showed very few dead cells after 3 days of incubation ( Fig. 2B ).

Next, osteogenic differentiation studies were performed by an indirect method up to day 14 and quantified by qRT-PCR ( FIG. 3A ). The results showed a significant upregulation of OCN, ALP, and BSP gene expression in the Ca + R group compared to the cell alone group, and increased expression compared to the other combinations of Ca, Ca + S and Ca + R + S groups. (*p<0.05 or **p<0.01). Immunostaining revealed BMP-2 expression, and as in the above gene expression, higher protein expression was observed in the Ca + R group compared to other groups ( FIG. 3B ). In general, there were no significant differences in BMP2 protein expression in the different groups, which may be related to the similar calcium oxide content in all formulations. Furthermore, the Ca+R group showed more ALP expression than the other groups ( FIG. 3C ). Similarly, the Ca+R group showed increased levels of ARS expression, which may be related to higher calcium ion content and the effect of active saridroside compounds on cellular mineralization ( FIG. 3D ).

Using RAW267.4 cells, osteoclast cell regulation from Ca nanocomposite was studied, and RANKL was added to the RAW267.4 cells to induce osteoclast differentiation. Osteoclasts were stained with a TRAP assay kit ( FIG. 4 ). Based on the stained images, multinucleated cells were clearly observed in the RANKL-treated control, indicating that RAW267.4 cells were successfully differentiated into osteoclasts ( FIG. 4A ). Interestingly, the experiment provided clear evidence of multinucleated cell size reduction and fewer TRAP-positive cells in the Ca+R group on day 5 (**p<0.01 or ***p<0.001) ( FIG. 4B ).

Therefore, the combination with R. rosea may have a positive effect on the inhibition of osteoclast differentiation. Several reports support this assumption; Saridroside is an active compound of R. rosea , and has been studied to inhibit osteoclasts and promote osteoblast differentiation. Additionally, Shilajit has been studied to inhibit osteoclastogenesis and is a potent stimulator of osteoblast differentiation of MSCs. In addition, evidence from other reports suggested that Shilajit at a dose of 0.1 g/kg promotes callus formation in bone and increases phosphorus absorption. Similarly, the Ca+R group of the present invention inhibited osteoclasts and further reduced aggregate resorption. Therefore, it can be said that the results of the present invention indicate the modulation of aggregate resorption and the induction of osteogenic differentiation.

Experimental Example 3: Osteoporosis disease model study

Ca nanocomposite was orally delivered to osteoporotic rats at a daily dose of 62 mg/kg for 45 days. Key parameters of the osteoporosis model (femur and tibia) were analyzed by histological staining and µCT (n=4).

The samples were further histologically analyzed by H&E and immunohistochemistry (IHC) staining. According to histopathological observations, the femur in the OVX group was deteriorated. Compared to the healthy group, the OVX group exhibited broken femoral trabeculae and increased bone trabecular spacing ( FIG. 5A ). However, compared with the healthy group, the Ca+R group showed a healed structure of trabecular bone and showed a similar pattern, and the Ca+S group showed a thickened cortical bone structure (thickened). cortical bone structure) was shown. IHC staining showed higher OCN and Col1 protein expression in the Ca+R group compared to other groups ( FIG. 5B ). RANKL, a protein involved in the process of bone resorption and regulating the activation and differentiation of osteoclasts, was highly expressed in the OVX group, indicating activated osteoclasts in the osteoporosis model, and the treated group showed significantly reduced expression of RANKL. . Previous cell data showed similar results to in vivo experimental results, such as osteoblast activation and osteoclast inhibition, highlighting the pharmacological effect of the nanocomposite on the R. rosea group. This may prove that natural products, as used in traditional ways, may be good candidates for treating diseased tissue.

Next, the structures of the femur and tibia were evaluated using micro-CT (μCT). All femoral head samples were scanned to construct two-dimensional (2D) ( FIG. 6A ) and three-dimensional ( 3D) trabecular microstructures ( FIG. 6B ). The constructed 2D and 3D images showed a possible outcome of estrogen deficiency for cancellous bone in the OVX group compared to the healthy group, and the femoral head was blocked by many spaces and lost its interconnection.

The biocompatibility of internal organs (liver, spleen, lung, stomach and kidney) was analyzed by histological staining. H&E staining did not show serious toxic effects in any group, and did not show specific changes in tissue structure ( FIG. 7 ). Furthermore, almost no apoptotic cells were detected in the stomach and kidneys by TUNEL-AP staining ( FIG. 8 ), indicating that there was no serious damage to the stomach and kidneys after drug delivery.

According to the hormonal change, the body weight of the OVX rats was higher than that of the healthy control group, and compared to the body weight of the healthy rats, the body weight of the OVX rats did not decrease until day 45 (p<0.01) ( FIG. 9A ). However, the body weight of the treatment group rats started to decrease from the first week and continued to decrease as a result, but at 45 days there was no significant difference compared with the body weight of the healthy group rats, especially the Ca+R group and Ca+S group rats. . It can be assumed that after treatment with calcium and natural ingredients, the hormones will be in balance. Furthermore, serum was collected from each group before and after treatment, and the blood calcium concentration was significantly increased in the treatment group on day 45 compared to the OVX group (*p<0.05 or **p<0.01) ( FIG. 9B ).

These results suggest that natural compounds such as R. rosea may have a positive effect when administered with calcium, and that these compounds may be good candidates for the treatment of osteoporosis. In particular, the Ca + R group may have a synergistic effect in the differentiation of osteoblasts and inhibition of osteoclasts.

Experimental Example 4: Effects of Particle Size

In order to check the effect of the particle size used, the nanocomposite material prepared according to Example 1 and the composite material having an average particle size of 20 μm prepared according to Example 1 were orally administered to rats, and after death, the gastric was extracted and the shape thereof was confirmed, and is shown in FIG. 10 . As shown in FIG. 10 , the stomach of the rat administered with the nanocomposite material of Example 1 maintained a normal shape, but the stomach of the rat administered with the microparticle composite material was significantly altered. This indicates that providing the composite material at the nanoscale is preferable in terms of improving the absorption rate by increasing the surface area, as well as in terms of the safety of the individual.

<Conclusion>

The present inventors devised a natural Ca-based nanocomposite formulation for osteoporosis that modulates osteogenic differentiation and osteoclast inhibition potential. When additional ayurvedic ingredients were added to Ca, it showed a positive effect on the treatment of osteoporosis model rats. Ca-based agents, particularly Ca+R, upregulate osteogenic gene expression and inhibit osteoclast function.

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, all changes or modifications derived from the meaning and scope of the claims described below and their equivalents.

Claims (8)

Calcium controlled with particles of size 100-700 nm; vitamin D; and 0.5 to 2 wt% of Rhodiola rosea based on the weight of the total composition. A calcium-based nanocomposite material comprising: Rhodiola rosea.
According to claim 1,
The calcium is natural calcium (natural calcium), a calcium-based nanocomposite material.
According to claim 1,
The calcium is a sintered natural calcium, calcium-based nanocomposite material.
delete According to claim 1,
Calcium-based nanocomposite material that further comprises Shilajit.
Osteoporosis comprising a calcium-based nanocomposite containing as an active ingredient calcium, vitamin D, and 0.5 to 2 wt% of Rhodiola rosea based on the weight of the total composition, adjusted to particles having a size of 100-700 nm A pharmaceutical composition for prophylaxis or treatment.
Osteoporosis comprising a calcium-based nanocomposite containing as an active ingredient calcium, vitamin D, and 0.5 to 2 wt% of Rhodiola rosea based on the weight of the total composition, adjusted to particles having a size of 100-700 nm A food composition for prevention or improvement.
Osteoporosis comprising a calcium-based nanocomposite containing as an active ingredient calcium, vitamin D, and 0.5 to 2 wt% of Rhodiola rosea based on the weight of the total composition, adjusted to particles having a size of 100-700 nm Feed composition for prevention or improvement.

Images