KR102314001B1 - Composition for enhancing immune response comprising ginsenoside F1 - Google Patents

Abstract

The present invention relates to a composition for enhancing immunity comprising ginsenoside F1 as an active ingredient, and specifically, the composition according to the present invention promotes degranulation activity of natural killer cells, enhances cell killing activity, and It can be usefully used as an immune enhancer by increasing its expression.

Description

Composition for enhancing immune response comprising ginsenoside F1 as an active ingredient

The present invention relates to a pharmaceutical composition for enhancing immunity comprising ginsenoside F1 as an active ingredient.

In addition, the present invention relates to a food composition for enhancing immunity comprising ginsenoside F1 as an active ingredient.

In addition, the present invention relates to a method for enhancing immunity comprising administering ginsenoside F1 to a subject.

In addition, the present invention relates to a composition for producing perforin or granzyme comprising ginsenoside F1 and natural killer cells.

Immunity is largely divided into innate immunity, which is possessed from birth, and acquired immunity, which is acquired by adapting to life. Here, innate immunity is also called 'natural immunity', and it reacts non-specifically to antigens and does not show any special memory action. This innate immunity actually protects against most infections. On the other hand, the acquired immunity has a memory function for the first invading antigen, and when the invasion occurs again, it reacts specifically and effectively removes the antigen.

Recently, there is a problem in that immunity is significantly lowered due to the complex action of internal factors such as lack of exercise and stress and external factors such as air pollution, so research on substances exhibiting an immune enhancing effect is necessary, especially most of the The importance of innate immunity to protect against infection is increasing.

Korean Patent Application Laid-Open No. 10-2015-0011576 developed a pharmaceutical composition for enhancing immunity containing S. serratus root as an active ingredient, and Korean Patent Laid-Open No. 10-2014-0148087 discloses innate immunity enhancement and antiviral containing Hwangbaek extract. By developing a composition, research on a composition for enhancing immunity using a natural product among various substances is being actively conducted.

On the other hand, ginsenoside is a saponin in ginseng, and there are more than 30 different types. According to the structure, it is divided into PPD (protopanaxadiol) series and PPT (protopanaxatrio) series, and is known to exhibit different pharmacological activities depending on the chemical structure. There is ( Curr Vasc Pharmacol . 2009 July;7(3):293-302). Among the ginsenosides, the minor ginsenosides present in a very small amount in ginseng are difficult to separate, so research on them is insufficient.

Accordingly, the present inventors made diligent efforts to discover compounds with excellent immune enhancing activity. As a result, it was confirmed that ginsenoside F1 exhibits an excellent immune enhancing effect, in particular, an innate immune enhancing effect compared to other ginsenosides, and completed the present invention. .

The main object of the present invention is to provide a pharmaceutical composition for enhancing immunity comprising ginsenoside F1 as an active ingredient.

Another object of the present invention is to provide a food composition for enhancing immunity comprising ginsenoside F1 as an active ingredient.

Another object of the present invention is to provide a method for enhancing immunity comprising administering ginsenoside F1 to a subject.

Another object of the present invention is to provide a composition for producing perforin or granzyme comprising ginsenoside F1 and natural killer cells.

The inventors of the present invention evaluated the cell killing activity of natural killer cells by various methods after pre-treating ginsenoside F1 to natural killer cells (NK cells) in the course of conducting research related to immune enhancement. As a result, it was confirmed for the first time that the composition containing the ginsenoside F1 exhibits an excellent immune enhancing effect by confirming that it exhibits superior activity compared to other ginsenosides.

In order to achieve the above object, one aspect of the present invention provides a pharmaceutical composition for enhancing immunity comprising ginsenoside F1 as an active ingredient.

As used herein, the term “ginsenoside F1” is a kind of saponin, which is a major active ingredient of ginseng, such as ginseng or red ginseng, and refers to ginsenoside belonging to the PPT (protopanaxatriol) family.

As used herein, the term "immune enhancement" refers to enhancing the biological defense ability against an antigen whose internal environment is an external factor, and the immunity can be divided into innate immunity possessed from birth and acquired immunity (adaptive immunity) And, in the present invention, the immunity may be innate immunity.

The pharmaceutical composition may enhance the activity of innate immune cells.

The innate immune cell is any one selected from the group comprising natural killer cells (NK cells), T cells, B cells, peripheral blood mononuclear cells (PBMC) and dendritic cells (dendritic cells) may be, but is not limited thereto, and specifically may be a natural killer cell.

The pharmaceutical composition may promote degranulation activity of innate immune cells.

As used herein, the term "degranulation activity" refers to an activity of releasing substances accumulated in secretory granules, and in the present invention, degranulation activity may be an activity of releasing substances accumulated in innate immune cells. The degranulation activity of the innate immune cells may be measured by analyzing the expression of CD107a, a marker generally used to evaluate the degranulation activity, but is not limited thereto.

In one embodiment of the present invention, when ginsenoside F1 was pretreated to innate immune cells, it was confirmed that the expression of CD107a was increased ( FIGS. 2b and 2c ), and the ginsenoside F1 degranulation activity of natural killer cells. was found to be able to promote In particular, it was found that the degranulation activity promoting effect of ginsenoside F1 was the best compared to other ginsenosides.

The pharmaceutical composition may enhance the cell killing activity of natural killer cells.

In one embodiment of the present invention, ginsenoside F1 was pretreated to natural killer cells and the cell killing activity of the cells was evaluated. As a result, the degree of cytolysis of the target cells was high (FIG. 3a), in particular, in primary natural killer cells. Even in the case of pretreatment, it was confirmed that the degree of cytolysis of the target cells was high (FIG. 4a). In addition, it was confirmed that the reduction effect of RMA-S was excellent even when the effectiveness of the in vivo cell killing activity of ginsenoside F1 was evaluated through the reduction of RMA-S cells, which are sensitive to natural killer cells (Fig. 7). .

The pharmaceutical composition may further include ginsenoside Rg3. The ginsenoside Rg3 corresponds to one type of ginsenoside belonging to the PPD (protopanaxadiol) family.

In one embodiment of the present invention, ginsenoside Rg3 was pre-treated to natural killer cells and the cell killing activity of the cells was evaluated. As a result, the expression of CD107a in the natural killer cells was increased ( FIGS. 2b and 2c ), and the target cells It was confirmed that the degree of cell lysis was high (FIG. 3b), and in particular, even when the primary natural killer cells were pretreated, the degree of cell lysis of the target cells was confirmed to be high (FIG. 4b). Therefore, it was found that the pharmaceutical composition of the present invention may additionally include ginsenoside Rg3 having an immunostimulating activity.

The pharmaceutical composition may include ginsenoside F1 and ginsenoside Rg3 in a weight ratio of 1:0.1 to 1:1.

When the ratio of ginsenoside F1 to ginsenoside Rg3 is 1: 0.1 weight ratio or less, the immune enhancing effect by ginsenoside Rg3 is hardly seen, and when the ratio is 1:1 or more, the synergistic effect of immune enhancement according to the mixing is insignificant can do.

The pharmaceutical composition may increase the expression of cell killing factors in natural killer cells.

As used herein, the term “cell killing factor” refers to a substance exhibiting cell killing activity, and in the present invention, the cell killing factor is a substance secreted from natural killer cells and exhibiting cell killing activity, specifically perforin or granzyme may be, but is not limited thereto.

In one embodiment of the present invention, when ginsenoside F1 was pretreated to natural killer cells, it was confirmed that the expression of perforin and granzyme B was increased (FIGS. 6a and 6b), ginsenoside F1 was natural killer cells was found to increase the expression of cell killer factors.

The pharmaceutical composition may include a pharmaceutically acceptable carrier. The "pharmaceutically acceptable carrier" may mean a carrier, excipient or diluent that does not inhibit the biological activity and properties of the injected compound without irritating the organism, and specifically, non-naturally occurring carrier). The type of carrier usable in the present invention is not particularly limited, and any carrier commonly used in the art and pharmaceutically acceptable may be used. Non-limiting examples of the carrier include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and the like. These may be used alone or in mixture of two or more.

The composition comprising a pharmaceutically acceptable carrier may be in various oral or parenteral formulations. In the case of formulation, it is prepared using diluents or excipients, such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Specifically, solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient to the compound, for example, starch, calcium carbonate, sucrose, lactose. , gelatin, etc. may be mixed and prepared. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid formulations for oral use include suspensions, solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, Witepsol, Macrogol, Tween 61, cacao butter, laurin, glycerogelatin, etc. may be used.

In addition, the pharmaceutical composition of the present invention may include a pharmaceutically effective amount of ginsenoside F1. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and is generally in an amount of 0.001 to 1000 mg/kg, specifically 0.05 to 200 mg/kg, more specifically, in an amount of 0.1 to 100 mg/kg, may be administered once to several times a day. However, for the purposes of the present invention, a specific therapeutically effective amount for a particular patient depends on the type and extent of the response to be achieved, the specific composition, including whether other agents are used, if necessary, the specific composition, the patient's age, weight, general health, It is preferable to apply differently depending on various factors including sex and diet, administration time, administration route and secretion rate of the composition, treatment period, drugs used together or concurrently with a specific composition, and similar factors well known in the pharmaceutical field.

The pharmaceutical composition of the present invention may be used as an immune enhancer, an adjuvant additive capable of improving the efficacy of a vaccine, an adjuvant treatment agent capable of enhancing therapeutic efficacy (eg, an anticancer adjuvant), and the like.

Another aspect of the present invention provides a food composition for enhancing innate immunity comprising ginsenoside F1 as an active ingredient.

In the present invention, the terms "ginsenoside F1" and "immune enhancement" are the same as described above.

As used herein, the term "food" refers to meat, sausage, bread, chocolate, candy, stacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, alcohol There are beverages, vitamin complexes, health functional foods, and health foods, and includes all foods in the ordinary sense.

The functional food (functional food) is the same term as food for special health use (FoSHU), and in addition to supplying nutrients, it is processed to efficiently exhibit bioregulatory functions and has high medical effects. means food. Here, "function (sex)" means to obtain a useful effect for health purposes such as regulating nutrients or physiological action with respect to the structure and function of the human body. The food of the present invention can be prepared by a method commonly used in the art, and at the time of manufacture, it can be prepared by adding raw materials and components commonly added in the art. In addition, the formulation of the food may be prepared without limitation as long as it is a formulation recognized as a food. The composition for food of the present invention can be prepared in various forms, and unlike general drugs, it has the advantage that there are no side effects that may occur during long-term administration of the drug using food as a raw material, and has excellent portability, and the present invention Foods of can be ingested as an adjuvant to enhance the immune-boosting effect.

The health food means a food having an active health maintenance or promotion effect compared to general food, and the health supplement food means a food for the purpose of health supplementation. In some cases, the terms health functional food, health food, and dietary supplement are preferred.

Specifically, the health functional food is a food prepared by adding ginsenoside F1 to food materials such as beverages, teas, spices, gum, and confectionery, or encapsulating, powdering, suspension, etc., and when ingested, It means to bring an effect, but unlike general drugs, it has the advantage that there are no side effects that may occur when taking the drug for a long time using food as a raw material.

Since the food composition of the present invention can be ingested on a daily basis, a high immune enhancing effect can be expected and is very useful.

The composition may further include a physiologically acceptable carrier, the type of carrier is not particularly limited, and any carrier commonly used in the art may be used.

In addition, the composition may include additional ingredients that are commonly used in food compositions to improve odor, taste, vision, and the like. For example, vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, and the like may be included. Also, it may include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu), and chromium (Cr). In addition, it may include amino acids such as lysine, tryptophan, cysteine, and valine.

In addition, the composition includes a preservative (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), a disinfectant (bleaching powder and high bleaching powder, sodium hypochlorite, etc.), an antioxidant (butylhydroxyanisole (BHA), butylhydroxy Toluene (BHT), etc.), coloring agents (tar pigments, etc.), coloring agents (sodium nitrite, sodium nitrite, etc.), bleach (sodium sulfite), seasonings (MSG sodium glutamate, etc.), sweeteners (dulcin, cyclamate, saccharin, Sodium, etc.), flavorings (vanillin, lactones, etc.), expanding agents (alum, D-potassium hydrogen tartrate, etc.), strengthening agents, emulsifiers, thickeners (foams), film agents, gum base agents, foam inhibitors, solvents, food additives such as improving agents (food additives). The additive may be selected according to the type of food and used in an appropriate amount.

The ginsenoside F1 may be added as it is or may be used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixed amount of the active ingredient may be suitably determined according to the purpose of its use (prevention, health or therapeutic treatment). In general, in the production of food or beverage, the food composition of the present invention may be added in an amount of 50 parts by weight or less, specifically 20 parts by weight or less with respect to the food or beverage. However, when consumed for a long period of time for health and hygiene purposes, it may contain an amount less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

As an example of the food composition of the present invention, it may be used as a health drink composition, and in this case, it may contain various flavoring agents or natural carbohydrates as additional ingredients, like a conventional drink. The above-mentioned natural carbohydrates include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; It may be a sugar alcohol such as xylitol, sorbitol, or erythritol. Sweeteners include natural sweeteners such as taumatin, stevia extract; A synthetic sweetener such as saccharin or aspartame may be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, specifically, about 0.02 to 0.03 g per 100 mL of the composition of the present invention.

In addition to the above, the health beverage composition includes various nutrients, vitamins, electrolytes, flavoring agents, colorants, pectic acid, pectic acid salts, alginic acid, alginic acid salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, glycerin, It may contain alcohol, a carbonation agent, and the like. In addition, it may contain the pulp for the production of natural fruit juice, fruit juice beverage, or vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not very important, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

The food composition of the present invention may include various weight % as long as it can exhibit an immune enhancing effect, but specifically ginsenoside F1 may be included in an amount of 0.00001 to 100% by weight or 0.01 to 80% by weight relative to the total weight of the food composition. .

Another aspect of the present invention provides a method for enhancing immunity, comprising administering ginsenoside F1 to an individual.

In the present invention, the terms "ginsenoside F1", and "immune enhancement" are the same as described above.

In the present invention, the term "administration" means introducing the composition of the present invention to an individual by any suitable method, and the administration route of the composition may be administered through any general route as long as it can reach the target tissue. Intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, may be administered intranasally, but is not limited thereto.

As used herein, the term "individual" refers to all animals, such as rats, mice, and livestock, including humans, in need or likely to require immune enhancement. Specifically, it may be a mammal including a human.

The composition may be administered in a pharmaceutically effective amount.

The "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level depends on the subject type and severity, age, sex, activity of the drug, and the drug. Sensitivity to, administration time, administration route and excretion rate, duration of treatment, factors including concomitant drugs, and other factors well known in the medical field. For example, the pharmaceutical composition comprising ginsenoside F1 may be administered at 0.0001 to 1000 mg/kg per day, specifically 0.001 to 100 mg/kg.

The pharmaceutical composition of the present invention may be administered daily or intermittently, and the number of administrations per day may be administered once or divided into two to three times. In addition, the pharmaceutical composition of the present invention may be used alone or in combination with other drug treatments for immune enhancement. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, and can be easily determined by those skilled in the art.

Another aspect of the present invention provides a composition for producing perforin or granzyme comprising ginsenoside F1 and natural killer cells.

In the present invention, the terms "ginsenoside F1", and "natural killer cell" are the same as described above.

In one embodiment of the present invention, in one embodiment of the present invention, when ginsenoside F1 was pretreated to natural killer cells, it was confirmed that the expression of perforin and granzyme B was increased (Figs. 6a and 6b), It was found that the composition comprising ginsenoside F1 and natural killer cells can produce perforin or granzyme.

The composition according to the present invention can be usefully used as an immune enhancer by promoting degranulation activity of natural killer cells, enhancing cell killing activity, and increasing the expression of cell killing factors.

1 is a schematic diagram showing the degranulation phenomenon of natural killer cells.
Figure 2a is a graph comparing the expression level of CD107a in peripheral blood mononuclear cells (PBMC) not cultured with target cells or cultured together.
Figure 2b is a graph showing the expression of CD107a when peripheral blood mononuclear cells (peripheral blood mononuclear cells, PBMC) treated with ginsenoside Rg3, Rh2, F1 or Rg1.
Figure 2c is a graph comparing the expression level of CD107a according to the type of ginsenoside when peripheral blood mononuclear cells (PBMC) are treated with ginsenoside Rg3, Rh2, F1 or Rg1.
Figure 3a is a graph showing the degree of lysis of target cells when natural killer cells are treated with ginsenoside F1.
Figure 3b is a graph showing the degree of lysis of target cells when the natural killer cells are treated with ginsenoside Rg3.
Figure 4a is a graph showing the degree of lysis of target cells when primary natural killer cells are treated with ginsenoside F1.
Figure 4b is a graph showing the degree of lysis of target cells when primary natural killer cells are treated with ginsenoside Rg3.
Figure 4c is a graph showing the degree of lysis of target cells when primary natural killer cells are treated with ginsenoside Rg1.
5 is a graph showing that ginsenoside F1 enhances calcium flux in natural killer cells.
6a is a graph comparing the expression level of perforin (PRF1) when ginsenoside F1 or ginsenoside Rg1 is treated in natural killer cells.
6b is a graph comparing the expression level of granzyme B (GzmB) when ginsenoside F1 or ginsenoside Rg1 is treated in natural killer cells.
7 is a graph comparing the selective reduction ratio of RMA-S in mice injected intraperitoneally with RMA-S cells and RMA cells after pretreatment with ginsenoside F1 or ginsenoside Rg1.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1: Degranulation Activation Effect of Innate Immune Cells by Ginsenoside F1

The degree of degranulation activity of innate immune cells by ginsenoside F1 was measured through flow cytometry (fluorescence activated cell sorter, FACS).

Specifically, after pretreatment of ginsenoside to peripheral blood mononuclear cells (PBMC) and pure natural killer cells isolated from blood, the cells were cultured with target cells, K562 cells or 721.221 cells, respectively. did. Thereafter, the surfaces of peripheral blood mononuclear cells and natural killer cells were stained using anti-CD3, anti-CD56, and anti-CD107a antibodies conjugated with fluorochrome. On the other hand, since the degranulation activity of peripheral blood mononuclear cells or natural killer cells is proportional to the expression of CD107a on the cell surface as shown in FIG. and measured.

As a result of the measurement, it was confirmed that peripheral blood mononuclear cells cultured with target cells hardly expressed CD107a, whereas peripheral blood mononuclear cells cultured with target cells expressed CD107a (FIG. 2a). In addition, even in culture with target cells, it was confirmed that CD107a was overexpressed in the group treated with ginsenosides compared to the group treated with DMSO (vehicle) (FIG. 2b).

Specifically, when cultured with K562 cells, which are cell lines derived from chronic myeloid leukemia patients as target cells, or 721.221 cells, which are human B cells, CD107a expression was increased in all ginsenoside-treated groups compared to DMSO-treated groups, and ginsenoside It was confirmed that CD107a was most expressed in the side F1 treatment group ( FIGS. 2b and 2c ). Therefore, it was confirmed that ginsenoside F1 and Rg3 exhibited an excellent immune enhancing effect, and in particular, it was confirmed that ginsenoside F1 exhibited the most excellent immune enhancing effect.

Example 2: Cell killing activity effect of natural killer cells by ginsenoside F1

To determine whether ginsenoside F1 enhances the cell killing activity of natural killer cells, the degree of cytolysis of target cells was measured.

Specifically, after pretreatment of ginsenoside F1 or Rg3 in peripheral blood mononuclear cells (PBMC) and pure natural killer cells isolated from blood, the cells were treated with europium-labeled target Cells were cultured with K562 cells or 721.221 cells. The ratio of the natural killer cells to the target cells was mixed and cultured at 5:1, 10:1, 20:1, and 40:1. On the other hand, since the degree of fluorescence emitted from the target cells is proportional to the degree of cell killing activity of the natural killer cells, the culture medium is centrifuged and then discharged by cell lysis of the target cells using a microplate reader. fluorescence was measured.

As a result of the measurement, it was confirmed that the ginsenoside F1 and Rg3 administration group showed a higher degree of dissolution of target cells than the DMSO administration group in all culture ratios ( FIGS. 3a and 3b ). Therefore, it was confirmed that ginsenosides F1 and Rg3 exhibit excellent cell killing activity against natural killer cells.

Example 3: Cell killing activity of primary natural killer cells by ginsenoside F1

Example 3-1: Isolation of primary natural killer cells

Blood (50ml) of healthy donors was collected in a Vacuum Heparinizer Cell Preparation Tube (BD Biosciences) containing sodium heparin. Thereafter, the blood was centrifuged to recover a buffy coat, a white thin layer formed of platelets and white blood cells. Peripheral blood mononuclear cells obtained by washing the buffy coat with PBS were isolated using a human NK cell negative selection kit (Miltenyl Biotech). After mixing a part of the isolated natural killer cells with FACS buffer, using a FACS machine and anti-CD3, anti-CD56, and anti-CD107a antibodies conjugated with fluorochrome, natural killer cells (CD3-/CD16+) ) ^{and the number and ratio of CD56 dim} /CD16+, CD56 ^bright /CD16-, and CD56 ^bright /CD16+, natural killer cells with a purity of 95% or higher were used for the experiment.

Example 3-2: Cell killing activity of primary natural killer cells

It was confirmed whether ginsenoside F1 enhances the cell killing activity of primary natural killer cells in the same manner as in Example 2 using primary natural killer cells isolated through the method of Example 3-1.

As a result of the measurement, it was confirmed that in all the ginsenoside F1, Rg3, and Rg1 administration groups, the degree of dissolution of target cells was higher than that of the DMSO administration group ( FIGS. 4a to 4c ). In particular, it was confirmed that the dissolution degree of the ginsenoside F1 administration group was significantly superior to that of the ginsenoside Rg3 and Rg1 administration groups. Therefore, it was confirmed that ginsenoside F1 and Rg3 showed excellent cell killing activity against primary natural killer cells, and in particular, ginsenoside F1 showed the most excellent effect.

Example 4: Calcium flux assay according to the treatment of ginsenoside F1

To elucidate the natural killer cell-based immune enhancement mechanism of ginsenoside F1, single cell calcium flux analysis was performed by live cell imaging using confocal microscopy.

Specifically, primary natural killer cells were purely isolated (>97%) by the method of Example 3-1, and then treated with ginsenoside F1 or Rg1. After measuring the basal calcium level for 30 seconds, natural killer cells were activated with a combination of NKG2D antibody and 2B4 antibody, and then calcium flux was analyzed by confocal live cell imaging.

As a result of the analysis, it was confirmed that ginsenoside F1 more effectively promotes calcium flux in natural killer cells compared to Rg1 (FIG. 5). Therefore, it was confirmed that ginsenoside F1 exhibits an excellent immune enhancing effect compared to ginsenoside Rg1.

Example 5: Analysis of cell killing factors

In order to analyze the apoptotic activity mechanism of natural killer cells by ginsenoside F1, primary natural killer cells isolated purely by the method of Example 3-1 were treated with F1 or Rg1. After 12 hours, total RNA was isolated, and the expression of perforin and granzyme B, which are representative cell killing factors of natural killer cells, was analyzed by quantitative RT-PCR.

Specifically, total RNA was isolated from natural killer cells using TRIzol reagent, and cDNA was synthesized using Toyobo's unknown primer and reverse transcriptase. Then, quantitative RT-PCR was performed using the SYBR PCR Master Mix (Toyobo) using the primers in Table 1 below.

Primer type base sequence (5'-3') Perforin Forward CGCCTACCTCAGGCTTATCTC (SEQ ID NO: 1) Reverse CCTCGACAGTCAGGCAGTC (SEQ ID NO: 2) Granzyme B Forward CCCTGGGAAAACACTCACACA (SEQ ID NO: 3) Reverse CACAACTCAATGGTACTGT (SEQ ID NO: 4)

The conditions for performing the PCR are shown in Table 2 below.

PCR conditions Temperature (℃) hour 1 cycle 95 10 minutes 40 cycles denaturalization 95 30 seconds Combination 60 30 seconds polymerization 72 30 seconds

As a result of the analysis, it was confirmed that the expression of perforin and granzyme B was increased in all ginsenoside-treated groups. Specifically, it was confirmed that the expression level of perforin in the ginsenoside F1 treated group was increased by about 2 times compared to the untreated group, and it was confirmed that the expression level was higher than that of the ginsenoside Rg1 treated group (FIG. 6a). In addition, it was confirmed that the ginsenoside F1 treated group also increased the expression level of granzyme B by about 1.5 times or more compared to the untreated group, and it was confirmed that the expression level of granzyme B was also increased compared to the ginsenoside Rg1 treatment group (Fig. 6b). ). Therefore, it was confirmed that ginsenoside F1 exhibits an excellent immune enhancing effect compared to ginsenoside Rg1.

Example 6: Natural killer cell-based in vivo immune enhancing activity of ginsenoside F1

To evaluate the effectiveness of ginsenoside F1 in vivo cell killing activity, RMA-S (MHC class I-), which is sensitive to natural killer cells, and RMA (MHC class I+) target cell system with resistance were used.

Specifically, mice were pretreated with ginsenoside F1 at a concentration of 25 mg/kg. Then, a mixture of RMA-S/RMA cells labeled with different fluorescence was injected into the peritoneal cavity of the mice. After 8 hours, the selective reduction ratio of RMA-S by natural killer cells was analyzed by FACS.

As a result of the analysis, it was confirmed that RMA-S was selectively reduced in all ginsenoside-treated groups. Specifically, the ginsenoside F1 treated group exhibited a clearance of about 70% or more, whereas the untreated group (vehicle) exhibited a clearance of about 35%, and the ginsenoside F1 treated group was RMA-S compared to the untreated group. showed an excellent reduction effect of more than 2 times. In addition, it was confirmed that the same amount of ginsenoside Rg1 showed an excellent reducing effect compared to the treatment group (FIG. 7). Therefore, it was confirmed that ginsenoside F1 exhibits an immune enhancing effect even in vivo, and in particular, ginsenoside F1 exhibits an excellent immune enhancing effect compared to ginsenoside Rg1.

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, all changes or modifications derived from the meaning and scope of the claims described below and their equivalents.

<110> Intelligent Synthetic Biology Center <120> Composition for enhancing immune response comprising ginsenoside F1 <130> KPA160696-EN-D1 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Perforin primer F <400> 1 cgcctacctc aggcttatct c 21 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Perforin primer R <400> 2 cctcgacagt caggcagtc 19 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Granzyme B primer F <400> 3 ccctgggaaa acactcacac a 21 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Granzyme B primer R <400> 4 cacaactcaa tggtactgt 19

Claims (13)

A pharmaceutical composition for enhancing innate immunity comprising ginsenoside F1 as an active ingredient, wherein the composition enhances the activity of natural killer cells (NK cells).
delete The pharmaceutical composition of claim 1, wherein the pharmaceutical composition further comprises ginsenoside Rg3.
The pharmaceutical composition of claim 3, wherein the pharmaceutical composition contains ginsenoside F1 and ginsenoside Rg3 in a weight ratio of 1: 0.1 to 1:1.
delete delete The pharmaceutical composition according to claim 1, wherein the pharmaceutical composition promotes the degranulation activity of natural killer cells (NK cells).
The pharmaceutical composition of claim 1, wherein the pharmaceutical composition enhances the cell killing activity of natural killer cells (NK cells).
According to claim 1, wherein the pharmaceutical composition will increase the expression of the cell killing factor of natural killer cells, the pharmaceutical composition.
The pharmaceutical composition of claim 9, wherein the cell killing factor is perforin or granzyme.
A food composition for enhancing innate immunity comprising ginsenoside F1 as an active ingredient.
A method for enhancing innate immunity, comprising administering ginsenoside F1 to a subject other than a human. delete

Images