KR102304068B1 - Lycopene production by expression of highly efficient MEP pathway enzymes from Vibrio sp. dhg - Google Patents

Abstract

The present invention relates to a lycopene high-producing strain in which the lycopene biosynthesis and metabolic pathway is precisely regulated, and a lycopene production method using the same. The lycopene high-producing strain according to the present invention was introduced with the dxs and ispA genes, and it was confirmed that the productivity of lycopene was significantly increased compared to the parent strain. Therefore, the lycopene high-producing strain of the present invention can be widely applied in various industrial fields where lycopene is utilized.

Description

Lycopene production by expression of highly efficient MEP pathway enzymes from Vibrio sp. dhg}

The present invention relates to a lycopene high-producing strain in which the lycopene biosynthesis and metabolic pathway is precisely regulated, and a lycopene production method using the same.

Lycopene, a kind of carotenoid pigment, is a substance with high antioxidant effect, and for this reason, its demand is increasing in medicine and drug-related fields. Due to this potential, the market is expected to grow at a 3.5% annual growth rate and the market size will exceed $130 million by 2023. The traditional production method for lycopene is extraction from tomatoes and watermelons, which are naturally red fruits. However, the method using this extraction has problems such as limited supply and non-uniform content, so it is difficult to provide a stable supply.

Studies on the production of carotenoids including lycopene by introducing genes of different origins into non-lycopene-producing microorganisms such as E. coli have already been conducted in various places. Roche Vitamins, Inc. converted crtE, crtB, and crtI derived from Flavobacterium sp. R1534 species to create Escherichia coli with a lycopene content of 0.5 mg/gDCW (Luis Pasamontes et al.) al., US20040058410, 2004), Amoco Corporation used crtI derived from Erwinia herbicola to have a content of 0.1 mg/gDCW in yeast (Rodney L. Ausich et al. , US 5,530,189, 1996). However, since the content of lycopene mentioned in the above studies is very low, it is not easy to develop an economical production process.

Accordingly, the present inventors completed the present invention by constructing a lycopene high-producing strain into which a key gene of the lycopene production pathway, a promoter, and a synthetic 5'UTR were introduced as a result of research on a strain that produces lycopene at a high concentration.

Therefore, an object of the present invention, 5'UTR (5' Untranslated region) represented by the nucleotide sequence of SEQ ID NO: 9; crtE gene represented by the nucleotide sequence of SEQ ID NO: 6; crtB gene represented by the nucleotide sequence of SEQ ID NO: 7; and crtI gene represented by the nucleotide sequence of SEQ ID NO: 8; to provide a recombinant Escherichia coli having improved lycopene-producing ability, and a lycopene production method using the same.

In order to achieve the above object, the present invention provides a 5'UTR represented by the nucleotide sequence of SEQ ID NO: 9; crtE gene represented by the nucleotide sequence of SEQ ID NO: 6; crtB gene represented by the nucleotide sequence of SEQ ID NO: 7; and crtI gene represented by the nucleotide sequence of SEQ ID NO: 8; provides a recombinant E. coli having improved lycopene-producing ability introduced.

The present invention also provides a lycopene production method comprising the step of culturing the recombinant E. coli having the improved lycopene production ability.

The lycopene high-producing strain according to the present invention was introduced with the dxs and ispA genes, and it was confirmed that the productivity of lycopene was significantly increased compared to the parent strain. Therefore, the lycopene high-producing strain of the present invention can be widely applied in various industrial fields where lycopene is utilized.

1 is a schematic diagram showing the biosynthetic pathway and key enzymes of lycopene in microorganisms.
2 is a diagram showing the results of measuring the lycopene production and cell weight of strains L1 and L2 transformed with vectors (p1EBI, p2EBI) including a cassette in which the promoter sequences of lycopene biosynthesis pathway genes are changed.
3 is E. coli W3110 or Vibrio sp in the L2 strain of the present invention. L3 and L4 strains respectively introduced with the dxs gene of the dhg strain; L5 and L6 strains respectively introduced with the ispA gene of the strain; A diagram showing the results of confirming the lycopene production of the L7 and L8 strains respectively introduced with the dxs and ispA genes of the strain.
4 is a view showing the results of confirming the purified dxs and ispA enzymes and cell lysates of the strain producing the enzymes through SDS-PAGE and measuring the enzyme activity. More specifically, Figure 4A is a result of confirming the dxs enzyme in the strains D1 and D2, Figure 4B is a diagram showing the result of confirming the ispA enzyme in the strains V1 and V2. The arrows in FIGS. 4A and 4B indicate the size of the purified enzyme. In addition, FIG. 4C is a diagram showing the results of analyzing _{the physical properties (k cat} and K _{m ) of the dxs and ispA enzymes.}

Hereinafter, the present invention will be described in detail.

According to an aspect of the present invention, the present invention provides a 5'UTR (5' Untranslated region) represented by the nucleotide sequence of SEQ ID NO: 9; crtE gene represented by the nucleotide sequence of SEQ ID NO: 6; crtB gene represented by the nucleotide sequence of SEQ ID NO: 7; and crtI gene represented by the nucleotide sequence of SEQ ID NO: 8; provides a recombinant E. coli having improved lycopene-producing ability introduced.

In the present invention, 5'UTR (untranslated region) is an untranslated region at the 5' and 3' ends of mRNA. In general, 5'UTR of mRNA performs various functions in the gene expression process, but among these functions , the biggest characteristic is that it is involved in the regulation of mRNA translation efficiency. It has been reported that the nucleotide sequence of the 5'UTR present in the upper portion adjacent to the translation initiation codon affects the efficiency of the translation step. In addition, a sequence belonging to the 5'UTR, which can be called a ribosome binding site sequence in eukaryotes, although it is not a fixed position like the Shine-Dalgarno sequence, which is known as a ribosome binding site sequence located at 5' UTR in prokaryotes. Research results have been reported on them.

The crtE gene is a gene encoding a geranylgeranyl pyrophosphate synthase involved in converting geranylgeranyl pyrophosphate to geranylgeranyl pyrophosphate (hereinafter GGPP). and the crtB gene is a gene encoding a phytoene synthase involved in converting the GGPP into phytoene, and the crtI gene is a phytoene involved in converting the phytoene into lycopene. It is a gene that codes for phytoene desaturase.

In the present invention, a gene (gene) should be considered in the broadest sense, and may encode a structural protein or a regulatory protein. In this case, the regulatory protein includes a transcription factor, a heat shock protein, or a protein involved in DNA/RNA replication, transcription and/or translation. In the present invention, the target gene to be suppressed may exist as an extrachromosomal component.

In an embodiment of the present invention, the recombinant E. coli further comprises 5'UTR represented by the nucleotide sequence of SEQ ID NO: 10 or 11.

In a preferred embodiment of the present invention, in the recombinant Escherichia coli, crtE, crtB and crtI genes may be arranged in mono or poly cistrons, and preferably, the genes are arranged in mono cistrons.

In the present invention, cistron means a unit of a structural gene capable of performing a genetic function, and is divided into monocistron and polycistron. The monocistron refers to a gene that makes a kind of mRNA that can encode only one polypeptide, and the polycistron refers to a kind of mRNA that can generate one or more polypeptides from the same RNA molecule. Most mRNAs in eukaryotes exist as monocistrons, and mRNAs in prokaryotes mostly exist as polycistronics. An example of a typical polycistron is an E. coli operon.

In a preferred embodiment of the present invention, a dxs or ispA gene may be further introduced to further improve the lycopene production ability. The dxs gene encodes 1-deoxy-D-xylulose-5-phosphate synthase, and the ispA gene encodes a farnesyl diphosphate synthase (farnesyl diphosphate). synthase) is coded. In addition, the dxs and ispA genes are E. coli W3110 or Vibrio sp. It is preferably derived from the dhg strain, more preferably Vibrio sp. dhg strain. In addition, the dxs and ispA genes may be introduced simultaneously or sequentially with the crtEBI gene, but is not limited thereto.

In a more preferred embodiment of the present invention, the recombinant E. coli may further include a dxs gene represented by the nucleotide sequence of SEQ ID NO: 1, and preferably further include 5'UTR represented by the nucleotide sequence of SEQ ID NO: 12. can

In a more preferred embodiment of the present invention, the recombinant E. coli may further include a dxs gene represented by the nucleotide sequence of SEQ ID NO: 3, and preferably further include 5'UTR represented by the nucleotide sequence of SEQ ID NO: 13. can

In a more preferred embodiment of the present invention, the recombinant Escherichia coli may further include the ispA gene represented by the nucleotide sequence of SEQ ID NO: 2, and preferably further include 5'UTR represented by the nucleotide sequence of SEQ ID NO: 14. can

In a more preferred embodiment of the present invention, the recombinant Escherichia coli may further include an ispA gene represented by the nucleotide sequence of SEQ ID NO: 4, and preferably further include 5'UTR represented by the nucleotide sequence of SEQ ID NO: 15. can

In a more preferred embodiment of the present invention, the recombinant E. coli is a dxs gene represented by the nucleotide sequence of SEQ ID NO: 3; and ispA gene represented by the nucleotide sequence of SEQ ID NO: 4; may further include, preferably, 5'UTR represented by the nucleotide sequence of SEQ ID NO: 12 or 14.

In a more preferred embodiment of the present invention, the recombinant E. coli is a dxs gene represented by the nucleotide sequence of SEQ ID NO: 1; and ispA gene represented by the nucleotide sequence of SEQ ID NO: 2; may further include, preferably, 5'UTR represented by the nucleotide sequence of SEQ ID NO: 13 or 15.

In an embodiment of the present invention, the parent strain of recombinant E. coli having improved lycopene-producing ability may be wild-type E. coli. The wild-type E. coli refers to E. coli in a natural state to which artificial gene recombination, substitution, mutation, etc. have not been applied.

In a preferred embodiment of the present invention, the parent strain of recombinant E. coli having improved lycopene-producing ability is preferably Escherichia coli W3110 strain, but is not limited thereto.

In an embodiment of the present invention, the recombinant E. coli according to the present invention refers to one transformed with a lycopene production-related gene. Transformation in the present invention means introducing the promoter according to the present invention, or a vector including a gene encoding a target protein additionally, into a host cell. In addition, as long as the gene encoding the transformed target protein can be expressed in the host cell, it may be inserted into the chromosome of the host cell or located outside the chromosome.

According to another aspect of the present invention, the present invention provides a lycopene production method comprising the step of culturing the recombinant E. coli having the improved lycopene-producing ability.

In an embodiment of the present invention, any medium and other culture conditions may be used as long as it is a medium used for culturing E. coli. Preferably, the recombinant Escherichia coli of the present invention is cultured in a conventional medium containing an appropriate carbon source, nitrogen source, amino acid, vitamin, etc. under aerobic conditions while controlling temperature, pH, and the like.

In a preferred embodiment of the present invention, the medium may contain saccharides or sugar alcohols as a carbon source, and more specifically, glucose, mannitol, sucrose, arabinose, galactose, glycerol, xylose, mannose, fructose, It may be at least one selected from the group consisting of lactose, maltose, sucrose, alginic acid, cellulose, dextrin, glycogen, hyaluronic acid, lentinan, zymosan, chitosan, glucan, lignin and pectin, preferably glucose, mannitol, alginic acid , sucrose, arabinose, galactose, and may include one or more selected from the group consisting of glycerol, but is not limited thereto. As the inorganic compound, sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate and calcium carbonate may be used, and in addition, amino acids, vitamins and appropriate precursors may be included. These media or precursors may be added to the culture either batchwise or continuously.

During the culture, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. In addition, during culturing, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation. In addition, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected with or without gas to maintain anaerobic and aerobic conditions.

The temperature of the culture can be usually set at 27°C to 37°C, preferably 30°C to 35°C. The incubation period may be continued until a desired production amount of useful substances is obtained, and may preferably be cultured for 10 to 100 hours.

In an embodiment of the present invention, the method for producing lycopene may further include the step of further purifying or recovering lycopene produced in the culturing step, and the method for recovering lycopene from recombinant E. coli or culture is a method known in the art. , such as, but not limited to, centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC. The recovery step may include a purification process, and a person skilled in the art may select and utilize it according to need among various known purification processes.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Genes, strains and plasmids

E. coli Mach-T1R (Thermo Scientific, Waltham, MA, USA) was used for general cloning, and E. coli W3110 was used as a gene expression and lycopene production host. E. coli W3110 and Vibrio sp. The genomic DNA of the dhg strain was purified and used as a source of dxs and ispA genes. In addition, the previously constructed JYJ0 strain (Jung, Juyoung, et al. "Precise precursor rebalancing for isoprenoids production by fine control of gapA expression in Escherichia coli." Metabolic engineering 38 (2016): 401-408.) and the pCDF_crtEBI plasmid were lycopene was used for production. The RAM1 gene encoding farnesyltransferase (PFTase) was obtained from Saccharomyces cerevisiae and codon-optimized for use in E. coli. Synthetic promoter (Ptac) and terminator (BBa_B1005) were obtained from the Registry of Standard Biological Parts (http://parts.igem.org). In addition, the synthetic 5'UTR was designed with UTR Designer for maximum expression.

Gene information used in Examples to be described later is shown in Table 1, properties for plasmids and strains are shown in Table 2, and primer sequences are shown in Table 3.

Gene Sequence dxs from Vibrio sp. dhg
(SEQ ID NO: 1) atgactcttgatatttcaaagtacccaacactggcgttagcaaatacaccggaagagttgcgtcttcttcctaaagaaacattacctgctctgtgtgatgagcttcgaacgtatctgctaaattcagtgagccaatcaagcggacacttagcgtctggcttaggcacagtagagctcacagttgccctgcattatgtatataacacaccagtagaccagttaatctgggatgttggtcatcaggcttacccacataaaatcctgaccggacgtcgtgacaaaatgccgaccatccgtcagaaaggtgggcttcacccattcccttggcgctcagagagcgaatacgacacgctgtcggttggtcactcttccacttcaatcagtgctggacttggcatggccatcagtgcacagaaagaaggtaaagggcgtaaggtcgtgagtgttattggtgacggcgccattaccgcgggtatggcattcgaagcaatgaaccacgctggcgatgttcatccagatatgctggtgattctgaacgataacgaaatgtcgatttcagaaaacgttggtgcgctaaacaaccacttagcgaaattactgtctggtagcctgtatacgtcgattcgcgaaggcggtaaaaaagtgctttctggcgttccgccgatcaaagagctggttcgtcgtacagaagaacacctcaaaggcatggtcgtccctggcacactattcgaagagttcggatttaactacatcggcccaattgatgggcatgatgtcaatgaactggttcagactctgaagaacatgcgtgagttgaaaggccctcaattcctgcacatcatgaccaaaaaaggcaaaggttatgagccagcagagaaagaccctatcggttaccatgctgtaccaaagttcgcaccatcaaataacagcttgccaaagagcagcggtggtaaaccaacgttctcaaagatctttggtgacttcctatgcgatatggccg cgcaagatcctaagctgatggcgattacgccagcaatgcgtgaaggttctggcatggtgcgtttctcgaaagagttcccagaacaatatttcgatgttgctatcgctgagcagcatgcagtgacgctcgctaccggtatggcgattgctggcaataacccaatcgttgccatttactcgaccttcttacaacgcggttatgatcagctcatccacgacatcgcaattatggatttgccagtcatgttcgctatcgaccgagcaggtttggttggtgctgatggtcagactcaccaaggtgcgtttgacttgagctttatgcgctgcattccaaacatggtgatcatggcaccaagcgacgagaatgaatgtcgtcaaatgctatacactggtcacaagcacacgggtccgagcgcagttcgttaccctcgtggaaacggtatgggaaccgacatcgaaagtgaatttaccgcacttgagatcggtaaaggccgaattgtacgtcaaggcgaaaaagtcgcgatcctgagctttggtaccttcctggggaatgcgttagaagccgctgaaaaccttaatgcaacggttgctgacatgcgctttgttaagccactagatgaaacgttgattcgtcagctagcgagcgaacacgatgtactcgtgacactggaagagaatgcgattgctggcggtgccggtgcaggtgttcttgaattcatgatgaaagaaaaaatcatcaagccagtactcaaccttggcttacctgataagtttgttcatcaaggcactcaggatgagctgcatgaagagcttggtctggatgcgaaaggaattgaacaatccatcaacgattatctggcgaagtaa ispA from Vibrio sp. dhg
(SEQ ID NO: 2) atgcaacagacattgacttctttccaacaaagaaacaatcaacaattaaacttgtggctagaacagcttccttatcaagaacttccattgattgatgcaatgaaatatggccttttgctaggcgggaaacgcgttcgcccttttcttgtttacatcacaggccaaatgttcggttgtaaacctgaagatctggacacaccagccgcagcgattgaatgcattcacgcttactcacttattcatgatgacctgccagcgatggatgacgatgagttacgccgtggtcaaccgacttgccatattaagttcgatgaagcgaccgcaatactgactggtgacgctctacaaacgctcgcctttactattttggcagatggttctttaaatccagaagctgaaagccagcgtatcaatatgataaaagctctggctcattcgtctggctctaacggcatgtgtgtcggacaagcactggatttaagtgcagagaatcgtcaaatttctctcgaagaaatggaagaaatccatcgtaaaaagaccggagccctaattgactgtgcggttaaattaggcgctttggccgctggtgataagggtatcgcagttttacctcatttagagcgctattcgaaagcaattggtttggcgtttcaggttcaagacgatattcttgatatcattagtgacacagaaacattgggtaagcctcagggttctgatcaagaactcaataagagcacttacccttccctgctgggtttagagggagcgatagagaaagctcactctctgttacaggaagcacttcaagcattggaagctatcccatacaatactcagttacttgaagagttcgcccgatatgtcatcgagcgcaaaaattaa dxs from W3110
(SEQ ID NO: 3) atgagttttgatattgccaaatacccgaccctggcactggtcgactccacccaggagttacgactgttgccgaaagagagtttaccgaaactctgcgacgaactgcgccgctatttactcgacagcgtgagccgttccagcgggcacttcgcctccgggctgggcacggtcgaactgaccgtggcgctgcactatgtctacaacaccccgtttgaccaattgatttgggatgtggggcatcaggcttatccgcataaaattttgaccggacgccgcgacaaaatcggcaccatccgtcagaaaggcggtctgcacccgttcccgtggcgcggcgaaagcgaatatgacgtattaagcgtcgggcattcatcaacctccatcagtgccggaattggtattgcggttgctgccgaaaaagaaggcaaaaatcgccgcaccgtctgtgtcattggcgatggcgcgattaccgcaggcatggcgtttgaagcgatgaatcacgcgggcgatatccgtcctgatatgctggtgattctcaacgacaatgaaatgtcgatttccgaaaatgtcggcgcgctcaacaaccatctggcacagctgctttccggtaagctttactcttcactgcgcgaaggcgggaaaaaagttttctctggcgtgccgccaattaaagagctgctcaaacgcaccgaagaacatattaaaggcatggtagtgcctggcacgttgtttgaagagctgggctttaactacatcggcccggtggacggtcacgatgtgctggggcttatcaccacgctaaagaacatgcgcgacctgaaaggcccgcagttcctgcatatcatgaccaaaaaaggtcgtggttatgaaccggcagaaaaagacccgatcactttccacgccgtgcctaaatttgatccctccagcggttgtttgccgaaaagtagcggcggtttgccgagctattcaaaaatctttggcgactggttgtgcgaaacggcag cgaaagacaacaagctgatggcgattactccggcgatgcgtgaaggttccggcatggtcgagttttcacgtaaattcccggatcgctacttcgacgtggcaattgccgagcaacacgcggtgacctttgctgcgggtctggcgattggtgggtacaaacccattgtcgcgatttactccactttcctgcaacgcgcctatgatcaggtgctgcatgacgtggcgattcaaaagcttccggtcctgttcgccatcgaccgcgcgggcattgttggtgctgacggtcaaacccatcagggtgcttttgatctctcttacctgcgctgcataccggaaatggtcattatgaccccgagcgatgaaaacgaatgtcgccagatgctctataccggctatcactataacgatggcccgtcagcggtgcgctacccgcgtggcaacgcggtcggcgtggaactgacgccgctggaaaaactaccaattggcaaaggcattgtgaagcgtcgtggcgagaaactggcgatccttaactttggtacgctgatgccagaagcggcgaaagtcgccgaatcgctgaacgccacgctggtcgatatgcgttttgtgaaaccgcttgatgaagcgttaattctggaaatggccgccagccatgaagcgctggtcaccgtagaagaaaacgccattatgggcggcgcaggcagcggcgtgaacgaagtgctgatggcccatcgtaaaccagtacccgtgctgaacattggcctgccggacttctttattccgcaaggaactcaggaagaaatgcgcgccgaactcggcctcgatgccgctggtatggaagccaaaatcaaggcctggctggcataa ispA from W3110
(SEQ ID NO: 4) atggactttccgcagcaactcgaagcctgcgttaagcaggccaaccaggcgctgagccgttttatcgccccactgccctttcagaacactcccgtggtcgaaaccatgcagtatggcgcattattaggtggtaagcgcctgcgacctttcctggtttatgccaccggtcatatgttcggcgttagcacaaacacgctggacgcacccgctgccgccgttgagtgtatccacgcttactcattaattcatgatgatttaccggcaatggatgatgacgatctgcgtcgcggtttgccaacctgccatgtgaagtttggcgaagcaaacgcgattctcgctggcgacgctttacaaacgctggcgttctcgattttaagcgatgccgatatgccggaagtgtcggaccgcgacagaatttcgatgatttctgaactggcgagcgccagtggtattgccggaatgtgcggtggtcaggcattagatttagacgcggaaggcaaacacgtacctctggacgcgcttgagcgtattcatcgtcataaaaccggcgcattgattcgcgccgccgttcgccttggtgcattaagcgccggagataaaggacgtcgtgctctgccggtactcgacaagtatgcagagagcatcggccttgccttccaggttcaggatgacatcctggatgtggtgggagatactgcaacgttgggaaaacgccagggtgccgaccagcaacttggtaaaagtacctaccctgcacttctgggtcttgagcaagcccggaagaaagcccgggatctgatcgacgatgcccgtcagtcgctgaaacaactggctgaacagtcactcgatacctcggcactggaagcgctagcggactacatcatccagcgtaataaataa Codon-optimized RAM1 from S. cerevisiae
(SEQ ID NO: 5) atgcgccagcgtgttggtcgtagcattgcgcgcgcgaaatttattaacaccgccttgctgggccgcaaacgtccggtgatggaacgcgtggtggatatcgcccatgttgattccagcaaagcgattcagccgctgatgaaagaactggaaaccgataccaccgaggcgcgttataaagtgttgcagagcgtactggaaatttatgacgatgaaaaaaatattgagccggcgctgacgaaagaatttcataaaatgtatctggacgtggcgtttgaaatcagcttgccgccgcagatgaccgcactggatgccagccagccgtggatgctgtactggattgccaacagcctgaaggtaatggaccgcgactggttaagtgatgataccaaacgcaagattgttgacaaactgtttaccatttctccgagcggcggtccgttcggtggcgggccggggcaactgagccatctggcatccacctatgcggcgatcaacgccctgtcactgtgcgataacatcgatggctgctgggatcgcattgatcgtaaaggcatctatcagtggctgatcagtctgaaagagccaaacggcggcttcaaaacctgcctggaagttggcgaagtggacacccgcggcatttactgcgcgctttccatcgcgacgctgctcaatatcctcactgaagagctgaccgaaggcgtgctgaattacctgaaaaactgccagaactacgaaggtggttttggttcctgcccgcacgtcgacgaagcgcacggcggttataccttctgcgccaccgcgtcgctggctattctgcgcagcatggatcagattaatgttgaaaagctgctggagtggtcgagcgcccgtcagctgcaagaagaacgtggtttctgtggtcgcagtaacaaactggtggatggttgctacagcttctgggtgggcggcagtgccgccattctcgaagcctttggctacggtcagtgctttaataaacatg cgctgcgtgattatatcctgtattgctgtcaggaaaaagagcaaccgggcttacgcgataaaccgggtgcccacagcgatttttatcacaccaactattgtctgctgggtctggcggtggcagaaagcagctatagctgcaccccgaacgacagcccgcataacattaaatgcacgccggaccgtctgattggcagcagtaaattaaccgacgttaacccggtttatggcctgccgattgaaaacgtgcgtaaaattattcattattttaaaagcaacctgtcgtcgccgagttaa crtE gene
(SEQ ID NO: 6) atggtatctggctcaaaggctggcgtctcgccacatcgcgaaattgaagtgatgcgccagagcattgatgatcatctggcgggcctgctgccggaaaccgatagccaggatattgtgagcctggcgatgcgcgaaggcgtgatggcgccgggcaaacgcattcgcccgctgctgatgctgctggcggcgcgcgatctgcgctatcagggcagtatgccgaccctgctggatctggcgtgcgcggtggaactgacccataccgcgagcctgatgctggatgatatgccgtgcatggataacgcggaactgcgccgcggccagccgaccacccataaaaaatttggcgaaagcgtggcgattctggcgagcgtgggcctgctgagcaaagcgtttggcctgattgcggcgaccggcgatctgccgggcgaacgccgcgcgcaggcggtgaacgaactgagcaccgcggtgggcgtgcagggcctggtgctgggccagtttcgcgatctgaacgatgcggcgctggatcgcaccccggatgcgattctgagcaccaaccatctgaaaaccggcattctgtttagcgcgatgctgcagattgtggcgattgcgagcgcgagcagcccgagcacccgcgaaaccctgcacgcgtttgcgctggattttggccaggcgtttcagctgctggatgatctgcgcgatgatcatccggaaaccggcaaagatcgcaacaaagatgcgggcaaaagcaccctggtgaaccgcctgggcgcggatgcggcgcgccagaaactgcgcgaacatattgatagcgcggataaacatctgacctttgcgtgcccgcagggcggcgcgattcgccagtttatgcatctgtggtttggccatcatctggcggattggagcccggtgatgaaaattgcgtaa crtB gene
(SEQ ID NO: 7) atgtcccaaccccccttgctagaccacgcaacccagacgatggcgaacggcagcaagagctttgcgaccgcggcgaaactgtttgatccggcgacccgccgcagcgtgctgatgctgtatacctggtgccgccattgcgatgatgtgattgatgatcagacgcatggctttgcgagcgaagcggcggcggaagaagaagcgacccagcgcctggcgcgcctgcgcaccctgaccctggcggcgtttgaaggcgcggaaatgcaggacccggcgtttgcggcgtttcaggaagtggcgctgacccacggcattaccccgcgcatggcgctggatcatctggatggctttgcgatggatgtggcgcagacccgctatgtgacctttgaagataccctgcgctattgctatcatgtggcgggcgtggtgggcctgatgatggcgcgcgtgatgggcgtgcgcgatgaacgcgtgctggatcgcgcgtgcgatctgggcctggcgtttcagctgaccaacattgcgcgcgatattattgatgatgcggcgattgatcgctgctatctgccggcggaatggctgcaggatgcgggcctgaccccggaaaactatgcggcgcgcgaaaaccgcgcggcgctggcgcgcgtggcggaacgcctgattgatgcggcggaaccgtattatattagcagccaggcgggcctgcatgatctgccgccgcgctgcgcgtgggcgattgcgaccgcgcgcagcgtgtatcgcgaaattggcattaaagtgaaagcggcgggcggcagcgcgtgggatcgccgccagcataccagcaaaggcgaaaaaattgcgatgctgatggcggcgccgggccaggtgattcgcgcgaaaaccacccgcgtgaccccgcgcccggcgggcctgtggcagcgcccggtgtaa crtI gene
(SEQ ID NO: 8) atgaaaaaaacggttgtgatcggcgctgggttcggcggcctggcgctggcgattcgcctgcaggcggcgggcattccgaccgtgctgctggaacagcgcgataaaccgggcggccgcgcgtatgtgtggcatgatcagggctttacctttgatgcgggcccgaccgtgattaccgatccgaccgcgctggaagcgctgtttaccctggcgggccgccgcatggaagattatgtgcgcctgctgccggtgaaaccgttttatcgcctgtgctgggaaagcggcaaaaccctggattatgcgaacgatagcgcggaactggaagcgcagattacccagtttaacccgcgcgatgtggaaggctatcgccgctttctggcgtatagccaggcggtgtttcaggaaggctatctgcgcctgggcagcgtgccgtttctgagctttcgcgatatgctgcgcgcgggcccgcagctgctgaaactgcaggcgtggcagagcgtgtatcagagcgtgagccgctttattgaagatgaacatctgcgccaggcgtttagctttcatagcctgctggtgggcggcaacccgtttaccaccagcagcatttataccctgattcatgcgctggaacgcgaatggggcgtgtggtttccggaaggcggcaccggcgcgctggtgaacggcatggtgaaactgtttaccgatctgggcggcgaaattgaactgaacgcgcgcgtggaagaactggtggtggcggataaccgcgtgagccaggtgcgcctggcggatggccgcatttttgataccgatgcggtggcgagcaacgcggatgtggtgaacacctataaaaaactgctgggccatcatccggtgggccagaaacgcgcggcggcgctggaacgcaaaagcatgagcaacagcctgtttgtgctgtattttggcctgaaccagccgcatagccagctggcgcatcataccatttgctttggcccgcgctatcgcgaac tgattgatgaaatttttaccggcagcgcgctggcggatgattttagcctgtatctgcatagcccgtgcgtgaccgatccgagcctggcgccgccgggctgcgcgagcttttatgtgctggcgccggtgccgcatctgggcaacgcgccgctggattgggcgcaggaaggcccgaaactgcgcgatcgcatttttgattatctggaagaacgctatatgccgggcctgcgcagccagctggtgacccagcgcatttttaccccggcggattttcatgataccctggatgcgcatctgggcagcgcgtttagcattgaaccgctgctgacccagagcgcgtggtttcgcccgcataaccgcgatagcgatattgcgaacctgtatctggtgggcgcgggcacccatccgggcgcgggcattccgggcgtggtggcgagcgcgaaagcgaccgcgagcctgatgatcgaagacctgcagtaa

Name Description Source strains E. coli Mach-T1 ^R Cloning host Invitrogen E. coli W3110 Production host, source for dxs ^EC and ispA ^EC ATCC 9637 Vibrio sp. dhg Recently isolated fast-growing strain, source for dxs ^VDHG and ispA ^VDHG Lim, et, al. (2019),
KCTC 13239BP JYJ0 E. coli W3110/pCDF_crtEBI Jung, et, al. (2016) L1 E. coli W3110 / p1EBI the present invention L2 E. coli W3110 / p2EBI the present invention L3 E. coli W3110 / pdE the present invention L4 E. coli W3110 / pdV the present invention L5 E. coli W3110 / piE the present invention L6 E. coli W3110 / piV the present invention L7 E. coli W3110 / pdEiE the present invention L8 E. coli W3110 / pdViV the present invention D1 E. coli W3110 / pCdEH the present invention D2 E. coli W3110 / pCdVH the present invention V1 E. coli W3110 / pCiEH the present invention V2 E. coli W3110 / pCiVH the present invention P E. coli W3110 / pCPFT the present invention Plasmids pACYCduet_1 p15A, LacI, Cm ^R , E. coli expression vector Novagen p1EBI p15A, LacI, Cm ^R ,P _tac _synUTR _crtE _crtE_ crtB_crtI_ T _BBa _ _B1005 the present invention p2EBI p15A, LacI, Cm ^R ,P _tac _synUTR _crtE _crtE_ P _tac _synUTR _crtB _ crtB_ P _tac _synUTR _crtI _ crtI_ T _BBa _ _B1005 the present invention pdE p15A, LacI, Cm ^R ,P _tac _synUTR _dxsEC _ dxs ^EC _ P _tac _synUTR _crtE _crtE_ P _tac _synUTR _crtB _ crtB_ P _tac _synUTR _crtI _ crtI_ T _BBa _ _B1005 the present invention pdV p15A, LacI, Cm _^R, P _tac P _tac _synUTR _dxsVDHG _ _ dxs ^VDHG _synUTR _crtE _crtE_ P _tac P _tac _synUTR _crtB _ crtB_ _synUTR _crtI crtI_ _ T _ _{BBa B1005} the present invention piE p15A, LacI, Cm ^R _, P _tac _synUTR _ispAEC _ ispA ^EC _ P _tac _synUTR _crtE _crtE_ P _tac _synUTR _crtB _ crtB_ P _tac _synUTR _crtI _ crtI_ T _BBa _ _B1005 the present invention piV p15A, LacI, Cm ^R _, P _tac _synUTR _ispAVDHG _ ispA ^VDHG _ P _tac _synUTR _crtE _crtE_ P _tac _synUTR _crtB _ crtB_ P _tac _synUTR _crtI _ crtI_ T _BBa _ _B1005 the present invention pdEiE p15A, LacI, Cm ^R _, P _tac _synUTR _ispAEC _ ispA ^EC _P _tac _synUTR _dxsEC _dxs ^EC _ P _tac _synUTR _crtE _crtE_ P _tac _synUTR _crtB _ crtB_ P _tac _synUTR _crtI _ crtI_ T _BBa _ _B1005 the present invention pdViV p15A, LacI, Cm ^R _, P _tac _synUTR _ispAVDHG _ ispA ^VDHG _P _tac _synUTR _dxsVDHG _dxs ^VDHG _ P _tac _synUTR _crtE _crtE_ P _tac _synUTR _crtB _ crtB_ P _tac _synUTR _crtI _ crtI_ T _BBa _ _B1005 the present invention pCDFduet_1 CloDF13, LacI, Sm ^R , E. coli expression vector Novagen pCDF_crtEBI CloDF13, LacI, Sm ^R ,P _{BBa_J23110} _synUTR _crtE _crtE_crtB_crtI_ T _{BBa_B1005} Jung, et, al. (2016) pCdEH CloDF13, LacI, Sm ^R, P _tac _synUTR _dxsEC dxs ^EC _ _ _ 6X His_T _{BBa B1001} the present invention pCdVH CloDF13, LacI, Sm ^R, P _tac _synUTR _dxsVDHG dxs ^VDHG _ _ _ 6X His_T _{BBa B1001} the present invention pCiEH CloDF13, LacI, Sm ^R, P _tac _synUTR _{ispA EC} ^EC ispA _ _ _ T 6X His _BBa _ _B1001 the present invention pCiVH CloDF13, LacI, Sm ^R, P _tac _synUTR _ispAVDHG ispA ^VDHG _ _ _ T 6X His _BBa _ _B1001 the present invention pCPFT CloDF13, LacI, Sm ^R , P _tac _synUTR _PFTase _ RAM1_ T _BBa _ _B1001 the present invention

Name Sequence (5'->3') SEQ ID NO: pACYC_F ccatgaattggatatcggccccaccgctgagcaataacta 17 pACYC_R cattatacgagccgatgattaattgtcaaggccgcaagcttgtcgacctgc 18 Tac_crtE_F gcaggtcgacaagcttgcggccttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaattaaggaggtaaacatggtatctggctcaaaggctg 19 crtE_R cggatggaggagccacacccttacgcaattttcatcaccgg 20 crtB_F gggtgtggctcctccatccgatgtcccaaccccccttg 21 Tac_crtB_F gggtgtggctcctccatccgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaattaaggaggtgatcatgtcccaaccccccttg 22 crtB_R gggctacgacgacggcaccgttacaccgggcgctgccaca 23 crtI_F cggtgccgtcgtcgtagcccatgaaaaaaacggttgtgatcg 24 Tac_crtI_F cggtgccgtcgtcgtagcccttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaattaaggaggccctcatgaaaaaaaacggttgtgatcg 25 crtI_R ggccgatatccaattcatgggcggcgaaaccccgccgaagcggggtttgcggcgttactgcaggtcttcgatcatcttgacaattaatcatcggctcgtataatg 26 crtEBI_F gcaggtcgacaagcttgcggcc 27 crtEBI_R ggccgatatccaattcatgggc 28 dxsE_F ctgcgaaatcgcgtggctacttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaattaaggaggttgatatgagttttgatattgccaaataccc 29 dxsE_R ggccgcaagcttgtcgacctgcttatgccagccaggccttgat 30 dxsV_F ctgcgaaatcgcgtggctacttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaattaaggagggagaaatgactcttgatatttcaaagtacccaacac 31 dxsV_R ggccgcaagcttgtcgacctgcttacttcgccagataatcgtt 32 ispAE_F gcccatgaattggatatcggccttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaattaaggaggaaaatatggactttccgcagcaactcg 33 ispAE_R gtagccacgcgatttcgcagactagtttatttattacgctggatgatgtagtccg 34 ispAV_F gcccatgaattggatatcggccttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaattaaggagaaatatatgcaacaagacattgacttctttcc 35 ispAV_R gtagccacgcgatttcgcagttaattttttgcgctcgatgacatatc 36 PFT_his_F ttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttaaggaggaaatactatgcgccagcgtgttggtcgtagc 37 PFT_his_R tgactagtctatgaaaaaaaaaccccgccgaagcggggtttttttttgagctcttaatggtggtggtgatgatgactcggcgacgacaggttgc 38 dxsE_his_F ttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttggacgttcgtaatgcatcatcaccatcaccacagttttgatattgccaaatacccgac 39 dxsE_his_R tgactagtctatgaaaaaaaaaccccgccgaagcggggtttttttttgagctcttatgccagccaggccttgat 40 ispAE_his_F ttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaattcgaggtatgaaacaaaatggactttccgcagcaac 41 ispAE_his_R tgactagtctatgaaaaaaaaaccccgccgaagcggggtttttttttgagctcttaatggtggtggtgatg 42 dxsV_his_F ttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaattggtggcccaaacatgcatcatcaccatcaccacactcttgatatttcaaagtaccca 43 dxsV_his_R tgactagtctatgaaaaaaaaaccccgccgaagcggggtttttttttctctagttacttcgccagataatcgtt 44 ispAV_his_F ttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaattgagaacccacagatgcaacagacattgacttctttc 45 ispAV_his_R tgactagtctatgaaaaaaaaaccccgccgaagcggggtttttttttgagctcttaatggtggtggtgatgatg 46 pCDF_HF gggtttttttttcatagactagtcaaacctcaggcatttgagaagc 47 pCDF_HR cattatacgagccgatgattaattgtcaacataagggagagcgtcgagatc 48

Experimental Example 1. Cell culture

The strains and recombinant strains described in Examples were placed in 5 mL LB medium, and then incubated at 37 °C and 200 rpm, unless otherwise specified, and the initial cell concentration was OD _{600 of cells prepared through incubation in the same medium in advance.} It was prepared by dilution to a concentration of 0.05.

If necessary, 50 ug/ml of streptomycin, 34 ug/ml of chloroamphenicol, and 50 ug/ml of ampicillin were included in the medium for maintenance of the plasmid.

Experimental Example 2. Cell number measurement

Cell growth in culture was quantified by measuring the absorbance at a wavelength of 600 nM using a UV-1700 spectrophotometer, and the resulting value was converted to 0.252 g DCW/L per _{OD 600} or OD _{600 unit.}

Experimental Example 3. Confirmation of lycopene production

In order to check the lycopene production, 1 ml of the culture medium was centrifuged for 10 minutes at 15,814 g at 4 ℃. The cell pellet was harvested after centrifugation. The cell pellet was washed twice with phosphate buffer. To extract lycopene, the cell pellet was suspended in 1 ml of pure acetone, and incubated for 15 minutes in a heat block at 65°C. To remove cell debris, the reaction was centrifuged at 15,814 g at room temperature. After centrifugation, the supernatant was obtained. The absorbance of the supernatant was measured at 475 nm. The absorbance was measured using a UV-1700 spectrophotometer (Shimadzu, Kyoto, Japan). The concentration of lycopene was quantified with a standard curve created using real lycopene. In addition, the biomass was normalized to the dry cell weight (DCW) for the concentration of lycohen after measuring the absorbance at 600 nm with a spectrophotometer.

Example 1. crtEBI Increase lycopene production by regulating heterologous expression of genes

The biosynthetic pathway of lycopene in microorganisms is shown in FIG. 1, and key enzymes such as ispA and CrtEBI are involved. The improved strain JYJ0, developed for the production of lycopene in E. coli in the previous study, reduced the cellular burden by heterogeneously expressing the crtEBI genes introduced from the L. purpurea strain through a polycistronic sequence.

In this experiment, the design of the expression cassette containing the key enzyme gene was adjusted to further increase the lycopene production of the corresponding strain. Inducible tac to the previous JYJ0 strain By introducing the promoter and pACYCduet-1 vector with a low copy number, a strain that can increase the stability of the plasmid and reduce the burden on cells was developed. In addition, to further develop this, each gene was tac to maximize the expression of each crtE, crtB, crtI gene. It was expressed through a monocistronic arrangement under a promoter and synthetic 5'UTR.

In the case of synthetic 5'UTR, it was designed to maximize the expression level of the gene, and the predicted expression level was designed to exceed 500,000 through UTR Designer. The designed synthetic 5'UTR is shown in Table 4.

Gene 5′UTR sequence (5′-3′) order
number Predicted expression level ^a (au) crtE gcggataacaattaaggaggtaaac 9 2,630,169.02 crtB gcggataacaattaaggaggtgatc 10 2,941,466.04 crtI gcggataacaattaaggaggccctc 11 3,110,669.92 dxs ^EC gcggataacaattaaggaggttgat 12 10,353,587.83 dxs ^VDHG gcggataacaattaaggagggagaa 13 3,110,669.02 ispA ^EC gcggataacaattaaggaggaaaat 14 1,236,139.37 ispA ^VDHG gcggataacaattaaggagaaatat 15 3,110,669.92 RAM1 gataacaatttaaggaggaaatact 16 733,702.64

p1EBI was amplified using the pACYCduet-1 plasmid as a template using the pACYC_F/pACYC_R primer set, and the crtE, crtB, and crtI genes were amplified using the Tac_crtE_F/R, crtB_F/R, and crtI_F/R primer sets. Each amplified fragment was ligated by cloning using Gibson assembly to construct a pEB1 plasmid. In addition, the crtE, crtB, and crtI genes in the p2EBI plasmid were amplified using the Tac_crtE_F/crtE_R, Tac_crtB_F/crtB_R, Tac_crtI_F/crtI_R primer set, and the amplified fragment and the amplified pACYCduet-1 plasmid were ligated and constructed.

Recombinant plasmids p1EBI and p2EBI prepared through the above process were transformed into E. coli W3110 to prepare recombinant E. coli L1 and L2, respectively.

In order to confirm the production of lycopene in the above-mentioned recombinant strains, lycopene production and cell weight were confirmed by culturing for 24 hours. The results of confirming the lycopene production and cell weight are shown in FIG. 2 .

As shown in FIG. 2 , the lycopene production of the L1 strain was increased by 1.28 times compared to the JYJ0 strain at 2.32 mg/g DCW, and the cell weight was increased by 1.52 times compared to the JYJ0 strain at 1.46 DCW/L. This means that the metabolic burden is reduced.

In the case of the L2 strain, the expression of crtEBI in the L1 strain was converted to monocistronic. The L2 strain had almost no effect compared to the L1 strain with a cell weight of 1.50 g DCW/L, and the lycopene production was 4.18 mg/g DCW, which increased 2.31 times compared to the L1 strain.

The above results mean that the expression of crtB and crtI greatly increases the production of lycopene. In the examples described below, the L2 strain was further engineered.

Example 2. dxs, ispA Confirmation of increased production of lycopene through heterologous expression of genes

Considering the characteristics of the existing MEP pathway, in the case of microorganisms having a fast growth rate, it was predicted that the enzyme activity of the microorganisms would be high. Accordingly, in order to increase lycopene production, E. coli W3110 strain and Vibrio sp. dxs and ispA genes isolated from the dhg strain were introduced, respectively.

Specifically, recombinant plasmids pdE, pdV, piE, piV, pdEiE, and pdViV were constructed.

To construct a pdEiE plasmid, the dxs and ispA genes were amplified using the E. coli W3110 strain as a template. The dxs and ispA genes were amplified with dxsE_F/R and ispAE_F/R primer sets. The pEBI2 recombinant plasmid was amplified using the crtEBI_F/R primer set. A pdEiE plasmid was constructed by ligating the amplified gene and vector fragment.

The pdViV plasmid was constructed in the same manner as the pdEiE plasmid, but Vibrio sp. It was prepared using the amplified fragment of the dxs and ispA genes of the dhg strain.

The pdE and piE plasmids were constructed by amplifying the pdEiE plasmid with the dxsE_F/crtEBI_R and crtEBI_F/ispAE_R primer sets, respectively.

In addition, pdV and piV plasmids were constructed using dxsV_F/crtEBI_R, crtEBI_F/ispAV_R primer sets and pdViV recombinant plasmids.

The produced pdE, pdV, piE, piV, pdEiE and pdViV plasmids were transformed into E. coli W3110 strain, and the transformed strains were designated as L3 to L8.

In order to confirm the production of lycopene in the prepared transformed strains L3 to L8, the cells were cultured for 24 hours. The results of confirming the lycopene production of the transformed strains L3 to L8 are shown in FIG. 3 .

As shown in Figure 3, the L3 and L4 strains are W3110 strain or Vibrio sp. As a strain overexpressed by introducing the dxs gene of the dhg strain, the lycopene production was increased by 2.22 times to 9.12 and 9.16 mg/g DCW, respectively, compared to the L2 strain of Example 1.

In addition, the L5 and L6 strains are strains W3110 or Vibrio sp. This strain is overexpressed by introducing the ispA gene of the dhg strain. The L5 strain increased lycopene production by 1.11 times to 4.66 mg/g DCW, and the L6 strain increased 1.55 times to 6.47 mg/g DCW.

The L7 strain was a strain introduced with the dxs and ispA genes of the W3110 strain, and the lycopene production (10.8 mg/g DCW) increased 2.57 times than the L2 strain, but only 1.18 times more than the L3 strain.

L8 strain is Vibrio sp. As a strain expressing the dxs and ispA genes of the dhg strain, the lycopene production was 0.3 mg/g DCW. The lycopene production of the L8 strain was 4.85 times higher than that of the L2 strain, and 1.88 times higher than that of the L6 strain. This is similar to the amount of lycopene produced in conventional LB without additional carbon source or adjustment of culture conditions.

Example 3. Enzyme assay

Enzyme analysis was performed to prove that lycopene production was increased through heterologous expression of key metabolic enzymes.

The pCDFduet-1 plasmid was amplified using the pCDF_HF/R primer set. The E. coli W3110 gene was amplified with the dxsE_his_F/R and ispAE_his_F/R primer sets. The amplified vector fragment and the gene fragment were ligated to construct pCdH and pCiEH plasmids.

In the same manner as the above plasmid construction, pCdVH and pCiVH plasmids were prepared using Vibrio sp. The dhg gene was constructed by linking the fragment amplified with the dxsV_his_F/R and ispAV_his_F/R primer sets and the vector fragment.

In addition, the pCPFT plasmid was prepared using the gene fragment amplified with the PFT_his_F/R primer.

The recombinant plasmid prepared through the above process was transformed into E. coli W3110 to prepare recombinant E. coli D1, V1, D2, V2 and P, respectively.

The prepared D1, D2, V1, and V2 strains were cultured for quantification of Dxs and ispA enzymes in the same environment as in Example 1, and quantification was performed by a known method.

In the case of Dxs enzyme quantification, the concentration of DL-glyceraldehyde was adjusted to 0 to 100 mM, and the reaction was carried out at 37° C. for 0, 20, 40, and 60 minutes, respectively, and then the enzyme was inactivated at 95° C. The concentrations of the substrates pyruvate and DL-glyceraldehyde were measured using Ultimate 3000 high-performance liquid chromatography (HPLC).

_{In the case of IspA enzyme quantification, fluorescence (λ excitation} : 340 nm, λ _emission : 505 nm) was measured through continuous quantification using purified PFTase enzyme in the same environment as Dxs. The fluorescence was measured using a VICTOR ³ 1420 Multilabel Plate Reader. The activity was measured using a standard curve based on the product farnesyl pyrophosphate (FPP) instead of the substrates dimethylallyl pyrophosphate (DMAPP) and isopentenyl pyrophosphate (IPP).

_{In addition, after analyzing the physical properties (k cat} and K _m) to compare the activity of the enzymes, the experimental values for each substrate were measured.

The results of comparing the purity and activity of the purified enzyme are shown in FIG. 4 .

As shown in FIGS. 4A and 4B , in the recombinant E. coli strains D1, V1, D2 and V2, proteins were identified at the same position as the purified dxs and ispA enzymes. This means that lycopene production was increased through heterologous expression of dxs and ispA, which are key metabolic enzymes.

As shown in Fig. 4C, the Dxs enzyme is the case of using the gene of the W3110 strain, Vibrio sp. _{The k cat} value was 1.52 times higher than when the dhg strain gene was used, _{but the K m} value measured based on DL-glyceraldehyde was 1.4 times higher, so the enzyme activity was about 1.08 times higher. This was also consistent with the results of lycopene production, which did not show a significant difference between the existing L3 and L4 strains. In addition, Vibrio sp. Since the dhg strain has a _{high k cat} value, it may be usefully utilized in a method of balancing precursors.

IspA enzyme is Vibrio sp. When the gene of the dhg strain was used, the k _cat value was 1.35 times higher _{than when the gene of the W3110 strain was used, and the K m} value was slightly lower in both cases of pyrophosphate (DMAPP) and isopentenylpyrophosphate (IPP). That is, the IspA enzymatic activity was observed in Vibrio sp. The case of using the dhg strain gene was 1.38 and 1.44 times higher than that of dimethylallyl pyrophosphate (DMAPP) and isopentenyl pyrophosphate (IPP), respectively. This is consistent with the difference in lycopene production in the L5 and L6 strains, and it means that there is a synergistic effect when the Dxs and IspA genes are co-expressed.

The experimental result is Vibrio sp. It means that heterologous expression of dxs and ispA genes derived from the dhg strain in E. coli can significantly increase lycopene production.

Collectively, the present inventors described Vibrio sp. A transformed E. coli into which dxs and ispA genes derived from the dhg strain were introduced was prepared, and its remarkable lycopene-producing ability was confirmed. The transformed E. coli of the present invention can be used in various ways in the field of lycopene production.

Above, specific parts of the present invention have been described in detail, for those of ordinary skill in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

Korea Biological Resources Center KCTC13239BP 20170406

<110> POSTECH Research and Business Development Foundation <120> Lycopene production by expression of highly efficient MEP pathway enzymes from Vibrio sp. dhg <130> 1-84P <160> 48 <170> KoPatentIn 3.0 <210> 1 <211> 1866 <212> DNA <213> Vibrio sp. <400> 1 atgactcttg atatttcaaa gtacccaaca ctggcgttag caaatacacc ggaagagttg 60 cgtcttcttc ctaaagaaac attacctgct ctgtgtgatg agcttcgaac gtatctgcta 120 aattcagtga gccaatcaag cggacactta gcgtctggct taggcacagt agagctcaca 180 gttgccctgc attatgtata taacacacca gtagaccagt taatctggga tgttggtcat 240 caggcttacc cacataaaat cctgaccgga cgtcgtgaca aaatgccgac catccgtcag 300 aaaggtgggc ttcacccatt cccttggcgc tcagagagcg aatacgacac gctgtcggtt 360 ggtcactctt ccacttcaat cagtgctgga cttggcatgg ccatcagtgc acagaaagaa 420 ggtaaagggc gtaaggtcgt gagtgttatt ggtgacggcg ccattaccgc gggtatggca 480 ttcgaagcaa tgaaccacgc tggcgatgtt catccagata tgctggtgat tctgaacgat 540 aacgaaatgt cgatttcaga aaacgttggt gcgctaaaca accacttagc gaaattactg 600 tctggtagcc tgtatacgtc gattcgcgaa ggcggtaaaa aagtgctttc tggcgttccg 660 ccgatcaaag agctggttcg tcgtacagaa gaacacctca aaggcatggt cgtccctggc 720 acactattcg aagagttcgg atttaactac atcggcccaa ttgatgggca tgatgtcaat 780 gaactggttc agactctgaa gaacatgcgt gagttgaaag gccctcaatt cctgcacatc 840 atgaccaaaa aaggcaaagg ttatgagcca gcagagaaag accctatcgg ttaccatgct 900 gtaccaaagt tcgcaccatc aaataacagc ttgccaaaga gcagcggtgg taaaccaacg 960 ttctcaaaga tctttggtga cttcctatgc gatatggccg cgcaagatcc taagctgatg 1020 gcgattacgc cagcaatgcg tgaaggttct ggcatggtgc gtttctcgaa agagttccca 1080 gaacaatatt tcgatgttgc tatcgctgag cagcatgcag tgacgctcgc taccggtatg 1140 gcgattgctg gcaataaccc aatcgttgcc atttactcga ccttcttaca acgcggttat 1200 gatcagctca tccacgacat cgcaattatg gatttgccag tcatgttcgc tatcgaccga 1260 gcaggtttgg ttggtgctga tggtcagact caccaaggtg cgtttgactt gagctttatg 1320 cgctgcattc caaacatggt gatcatggca ccaagcgacg agaatgaatg tcgtcaaatg 1380 ctatacactg gtcacaagca cacgggtccg agcgcagttc gttaccctcg tggaaacggt 1440 atgggaaccg acatcgaaag tgaatttacc gcacttgaga tcggtaaagg ccgaattgta 1500 cgtcaaggcg aaaaagtcgc gatcctgagc tttggtacct tcctggggaa tgcgttagaa 1560 gccgctgaaa accttaatgc aacggttgct gacatgcgct ttgttaagcc actagatgaa 1620 acgttgattc gtcagctagc gagcgaacac gatgtactcg tgacactgga agagaatgcg 1680 attgctggcg gtgccggtgc aggtgttctt gaattcatga tgaaagaaaa aatcatcaag 1740 ccagtactca accttggctt acctgataag tttgttcatc aaggcactca ggatgagctg 1800 catgaagagc ttggtctgga tgcgaaagga attgaacaat ccatcaacga ttatctggcg 1860 1866 <210> 2 <211> 885 <212> DNA <213> Vibrio sp. <400> 2 atgcaacaga cattgacttc tttccaacaa agaaacaatc aacaattaaa cttgtggcta 60 gaacagcttc cttatcaaga acttccattg attgatgcaa tgaaatatgg ccttttgcta 120 ggcgggaaac gcgttcgccc ttttcttgtt tacatcacag gccaaatgtt cggttgtaaa 180 cctgaagatc tggacacacc agccgcagcg attgaatgca ttcacgctta ctcacttatt 240 catgatgacc tgccagcgat ggatgacgat gagttacgcc gtggtcaacc gacttgccat 300 attaagttcg atgaagcgac cgcaatactg actggtgacg ctctacaaac gctcgccttt 360 actattttgg cagatggttc tttaaatcca gaagctgaaa gccagcgtat caatatgata 420 aaagctctgg ctcattcgtc tggctctaac ggcatgtgtg tcggacaagc actggattta 480 agtgcagaga atcgtcaaat ttctctcgaa gaaatggaag aaatccatcg taaaaagacc 540 ggagccctaa ttgactgtgc ggttaaatta ggcgctttgg ccgctggtga taagggtatc 600 gcagttttac ctcatttaga gcgctattcg aaagcaattg gtttggcgtt tcaggttcaa 660 gacgatattc ttgatatcat tagtgacaca gaaacattgg gtaagcctca gggttctgat 720 caagaactca ataagagcac ttacccttcc ctgctgggtt tagagggagc gatagagaaa 780 gctcactctc tgttacagga agcacttcaa gcattggaag ctatcccata caatactcag 840 ttacttgaag agttcgcccg atatgtcatc gagcgcaaaa attaa 885 <210> 3 <211> 1863 <212> DNA <213> Escherichia coli <400> 3 atgagttttg atattgccaa atacccgacc ctggcactgg tcgactccac ccaggagtta 60 cgactgttgc cgaaagagag tttaccgaaa ctctgcgacg aactgcgccg ctatttactc 120 gacagcgtga gccgttccag cgggcacttc gcctccgggc tgggcacggt cgaactgacc 180 gtggcgctgc actatgtcta caacaccccg tttgaccaat tgatttggga tgtggggcat 240 caggcttatc cgcataaaat tttgaccgga cgccgcgaca aaatcggcac catccgtcag 300 aaaggcggtc tgcacccgtt cccgtggcgc ggcgaaagcg aatatgacgt attaagcgtc 360 gggcattcat caacctccat cagtgccgga attggtattg cggttgctgc cgaaaaagaa 420 ggcaaaaatc gccgcaccgt ctgtgtcatt ggcgatggcg cgattaccgc aggcatggcg 480 tttgaagcga tgaatcacgc gggcgatatc cgtcctgata tgctggtgat tctcaacgac 540 aatgaaatgt cgatttccga aaatgtcggc gcgctcaaca accatctggc acagctgctt 600 tccggtaagc tttactcttc actgcgcgaa ggcgggaaaa aagttttctc tggcgtgccg 660 ccaattaaag agctgctcaa acgcaccgaa gaacatatta aaggcatggt agtgcctggc 720 acgttgtttg aagagctggg ctttaactac atcggcccgg tggacggtca cgatgtgctg 780 gggcttatca ccacgctaaa gaacatgcgc gacctgaaag gcccgcagtt cctgcatatc 840 atgaccaaaa aaggtcgtgg ttatgaaccg gcagaaaaag acccgatcac tttccacgcc 900 gtgcctaaat ttgatccctc cagcggttgt ttgccgaaaa gtagcggcgg tttgccgagc 960 tattcaaaaa tctttggcga ctggttgtgc gaaacggcag cgaaagacaa caagctgatg 1020 gcgattactc cggcgatgcg tgaaggttcc ggcatggtcg agttttcacg taaattcccg 1080 gatcgctact tcgacgtggc aattgccgag caacacgcgg tgacctttgc tgcgggtctg 1140 gcgattggtg ggtacaaacc cattgtcgcg atttactcca ctttcctgca acgcgcctat 1200 gatcaggtgc tgcatgacgt ggcgattcaa aagcttccgg tcctgttcgc catcgaccgc 1260 gcgggcattg ttggtgctga cggtcaaacc catcagggtg cttttgatct ctcttacctg 1320 cgctgcatac cggaaatggt cattatgacc ccgagcgatg aaaacgaatg tcgccagatg 1380 ctctataccg gctatcacta taacgatggc ccgtcagcgg tgcgctaccc gcgtggcaac 1440 gcggtcggcg tggaactgac gccgctggaa aaactaccaa ttggcaaagg cattgtgaag 1500 cgtcgtggcg agaaactggc gatccttaac tttggtacgc tgatgccaga agcggcgaaa 1560 gtcgccgaat cgctgaacgc cacgctggtc gatatgcgtt ttgtgaaacc gcttgatgaa 1620 gcgttaattc tggaaatggc cgccagccat gaagcgctgg tcaccgtaga agaaaacgcc 1680 attatgggcg gcgcaggcag cggcgtgaac gaagtgctga tggcccatcg taaaccagta 1740 cccgtgctga acattggcct gccggacttc tttattccgc aaggaactca ggaagaaatg 1800 cgcgccgaac tcggcctcga tgccgctggt atggaagcca aaatcaaggc ctggctggca 1860 taa 1863 <210> 4 <211> 900 <212> DNA <213> Escherichia coli <400> 4 atggactttc cgcagcaact cgaagcctgc gttaagcagg ccaaccaggc gctgagccgt 60 tttatcgccc cactgccctt tcagaacact cccgtggtcg aaaccatgca gtatggcgca 120 ttattaggtg gtaagcgcct gcgacctttc ctggtttatg ccaccggtca tatgttcggc 180 gttagcacaa acacgctgga cgcacccgct gccgccgttg agtgtatcca cgcttactca 240 ttaattcatg atgatttacc ggcaatggat gatgacgatc tgcgtcgcgg tttgccaacc 300 tgccatgtga agtttggcga agcaaacgcg attctcgctg gcgacgcttt acaaacgctg 360 gcgttctcga ttttaagcga tgccgatatg ccggaagtgt cggaccgcga cagaatttcg 420 atgatttctg aactggcgag cgccagtggt attgccggaa tgtgcggtgg tcaggcatta 480 gatttagacg cggaaggcaa acacgtacct ctggacgcgc ttgagcgtat tcatcgtcat 540 aaaaccggcg cattgattcg cgccgccgtt cgccttggtg cattaagcgc cggagataaa 600 ggacgtcgtg ctctgccggt actcgacaag tatgcagaga gcatcggcct tgccttccag 660 gttcaggatg acatcctgga tgtggtggga gatactgcaa cgttgggaaa acgccagggt 720 gccgaccagc aacttggtaa aagtacctac cctgcacttc tgggtcttga gcaagcccgg 780 aagaaagccc gggatctgat cgacgatgcc cgtcagtcgc tgaaacaact ggctgaacag 840 tcactcgata cctcggcact ggaagcgcta gcggactaca tcatccagcg taataaataa 900 900 <210> 5 <211> 1296 <212> DNA <213> Saccharomyces cerevisiae <400> 5 atgcgccagc gtgttggtcg tagcattgcg cgcgcgaaat ttattaacac cgccttgctg 60 ggccgcaaac gtccggtgat ggaacgcgtg gtggatatcg cccatgttga ttccagcaaa 120 gcgattcagc cgctgatgaa agaactggaa accgatacca ccgaggcgcg ttataaagtg 180 ttgcagagcg tactggaaat ttatgacgat gaaaaaaata ttgagccggc gctgacgaaa 240 gaatttcata aaatgtatct ggacgtggcg tttgaaatca gcttgccgcc gcagatgacc 300 gcactggatg ccagccagcc gtggatgctg tactggattg ccaacagcct gaaggtaatg 360 gaccgcgact ggttaagtga tgataccaaa cgcaagattg ttgacaaact gtttaccatt 420 tctccgagcg gcggtccgtt cggtggcggg ccggggcaac tgagccatct ggcatccacc 480 tatgcggcga tcaacgccct gtcactgtgc gataacatcg atggctgctg ggatcgcatt 540 gatcgtaaag gcatctatca gtggctgatc agtctgaaag agccaaacgg cggcttcaaa 600 acctgcctgg aagttggcga agtggacacc cgcggcattt actgcgcgct ttccatcgcg 660 acgctgctca atatcctcac tgaagagctg accgaaggcg tgctgaatta cctgaaaaac 720 tgccagaact acgaaggtgg ttttggttcc tgcccgcacg tcgacgaagc gcacggcggt 780 tataccttct gcgccaccgc gtcgctggct attctgcgca gcatggatca gattaatgtt 840 gaaaagctgc tggagtggtc gagcgcccgt cagctgcaag aagaacgtgg tttctgtggt 900 cgcagtaaca aactggtgga tggttgctac agcttctggg tgggcggcag tgccgccatt 960 ctcgaagcct ttggctacgg tcagtgcttt aataaacatg cgctgcgtga ttatatcctg 1020 tattgctgtc aggaaaaaga gcaaccgggc tacgcgata aaccgggtgc ccacagcgat 1080 ttttatcaca ccaactattg tctgctgggt ctggcggtgg cagaaagcag ctatagctgc 1140 accccgaacg acagcccgca taacattaaa tgcacgccgg accgtctgat tggcagcagt 1200 aaattaaccg acgttaaccc ggtttatggc ctgccgattg aaaacgtgcg taaaattatt 1260 cattatttta aaagcaacct gtcgtcgccg agttaa 1296 <210> 6 <211> 924 <212> DNA <213> Unknown <220> <223> L. purpurea <400> 6 atggtatctg gctcaaaggc tggcgtctcg ccacatcgcg aaattgaagt gatgcgccag 60 agcattgatg atcatctggc gggcctgctg ccggaaaccg atagccagga tattgtgagc 120 ctggcgatgc gcgaaggcgt gatggcgccg ggcaaacgca ttcgcccgct gctgatgctg 180 ctggcggcgc gcgatctgcg ctatcagggc agtatgccga ccctgctgga tctggcgtgc 240 gcggtggaac tgacccatac cgcgagcctg atgctggatg atatgccgtg catggataac 300 gcggaactgc gccgcggcca gccgaccacc cataaaaaat ttggcgaaag cgtggcgatt 360 ctggcgagcg tgggcctgct gagcaaagcg tttggcctga ttgcggcgac cggcgatctg 420 ccgggcgaac gccgcgcgca ggcggtgaac gaactgagca ccgcggtggg cgtgcagggc 480 ctggtgctgg gccagtttcg cgatctgaac gatgcggcgc tggatcgcac cccggatgcg 540 attctgagca ccaaccatct gaaaaccggc attctgttta gcgcgatgct gcagattgtg 600 gcgattgcga gcgcgagcag cccgagcacc cgcgaaaccc tgcacgcgtt tgcgctggat 660 tttggccagg cgtttcagct gctggatgat ctgcgcgatg atcatccgga aaccggcaaa 720 gatcgcaaca aagatgcggg caaaagcacc ctggtgaacc gcctgggcgc ggatgcggcg 780 cgccagaaac tgcgcgaaca tattgatagc gcggataaac atctgacctt tgcgtgcccg 840 cagggcggcg cgattcgcca gtttatgcat ctgtggtttg gccatcatct ggcggattgg 900 agcccggtga tgaaaattgc gtaa 924 <210> 7 <211> 930 <212> DNA <213> Unknown <220> <223> L. purpurea <400> 7 atgtcccaac cccccttgct agaccacgca acccagacga tggcgaacgg cagcaagagc 60 tttgcgaccg cggcgaaact gtttgatccg gcgacccgcc gcagcgtgct gatgctgtat 120 acctggtgcc gccattgcga tgatgtgatt gatgatcaga cgcatggctt tgcgagcgaa 180 gcggcggcgg aagaagaagc gacccagcgc ctggcgcgcc tgcgcaccct gaccctggcg 240 gcgtttgaag gcgcggaaat gcaggacccg gcgtttgcgg cgtttcagga agtggcgctg 300 acccacggca ttaccccgcg catggcgctg gatcatctgg atggctttgc gatggatgtg 360 gcgcagaccc gctatgtgac ctttgaagat accctgcgct attgctatca tgtggcgggc 420 gtggtgggcc tgatgatggc gcgcgtgatg ggcgtgcgcg atgaacgcgt gctggatcgc 480 gcgtgcgatc tgggcctggc gtttcagctg accaacattg cgcgcgatat tattgatgat 540 gcggcgattg atcgctgcta tctgccggcg gaatggctgc aggatgcggg cctgaccccg 600 gaaaactatg cggcgcgcga aaaccgcgcg gcgctggcgc gcgtggcgga acgcctgatt 660 gatgcggcgg aaccgtatta tattagcagc caggcgggcc tgcatgatct gccgccgcgc 720 tgcgcgtggg cgattgcgac cgcgcgcagc gtgtatcgcg aaattggcat taaagtgaaa 780 gcggcgggcg gcagcgcgtg ggatcgccgc cagcatacca gcaaaggcga aaaaattgcg 840 atgctgatgg cggcgccggg ccaggtgatt cgcgcgaaaa ccacccgcgt gaccccgcgc 900 ccggcgggcc tgtggcagcg cccggtgtaa 930 <210> 8 <211> 1479 <212> DNA <213> Unknown <220> <223> L. purpurea <400> 8 atgaaaaaaa cggttgtgat cggcgctggg ttcggcggcc tggcgctggc gattcgcctg 60 caggcggcgg gcattccgac cgtgctgctg gaacagcgcg ataaaccggg cggccgcgcg 120 tatgtgtggc atgatcaggg ctttaccttt gatgcgggcc cgaccgtgat taccgatccg 180 accgcgctgg aagcgctgtt taccctggcg ggccgccgca tggaagatta tgtgcgcctg 240 ctgccggtga aaccgtttta tcgcctgtgc tgggaaagcg gcaaaaccct ggattatgcg 300 aacgatagcg cggaactgga agcgcagatt acccagttta acccgcgcga tgtggaaggc 360 tatcgccgct ttctggcgta tagccaggcg gtgtttcagg aaggctatct gcgcctgggc 420 agcgtgccgt ttctgagctt tcgcgatatg ctgcgcgcgg gcccgcagct gctgaaactg 480 caggcgtggc agagcgtgta tcagagcgtg agccgcttta ttgaagatga acatctgcgc 540 caggcgttta gctttcatag cctgctggtg ggcggcaacc cgtttaccac cagcagcatt 600 tataccctga ttcatgcgct ggaacgcgaa tggggcgtgt ggtttccgga aggcggcacc 660 ggcgcgctgg tgaacggcat ggtgaaactg tttaccgatc tgggcggcga aattgaactg 720 aacgcgcgcg tggaagaact ggtggtggcg gataaccgcg tgagccaggt gcgcctggcg 780 gatggccgca tttttgatac cgatgcggtg gcgagcaacg cggatgtggt gaacacctat 840 aaaaaactgc tgggccatca tccggtgggc cagaaacgcg cggcggcgct ggaacgcaaa 900 agcatgagca acagcctgtt tgtgctgtat tttggcctga accagccgca tagccagctg 960 gcgcatcata ccatttgctt tggcccgcgc tatcgcgaac tgattgatga aatttttacc 1020 ggcagcgcgc tggcggatga ttttagcctg tatctgcata gcccgtgcgt gaccgatccg 1080 agcctggcgc cgccgggctg cgcgagcttt tatgtgctgg cgccggtgcc gcatctgggc 1140 aacgcgccgc tggattgggc gcaggaaggc ccgaaactgc gcgatcgcat ttttgattat 1200 ctggaagaac gctatatgcc gggcctgcgc agccagctgg tgacccagcg catttttacc 1260 ccggcggatt ttcatgatac cctggatgcg catctgggca gcgcgtttag cattgaaccg 1320 ctgctgaccc agagcgcgtg gtttcgcccg cataaccgcg atagcgatat tgcgaacctg 1380 tatctggtgg gcgcgggcac ccatccgggc gcgggcattc cgggcgtggt ggcgagcgcg 1440 aaagcgaccg cgagcctgat gatcgaagac ctgcagtaa 1479 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> crtE 5 UTR sequence <400> 9 gcggataaca attaaggagg taaac 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> crtB 5 UTR sequence <400> 10 gcggataaca attaaggagg tgatc 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> crtI 5 UTR sequence <400> 11 gcggataaca attaaggagg ccctc 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dxsEC 5 UTR sequence <400> 12 gcggataaca attaaggagg ttgat 25 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dxsVDHG 5 UTR sequence <400> 13 gcggataaca attaaggagg gagaa 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ispAEC 5 UTR sequence <400> 14 gcggataaca attaaggagg aaaat 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ispAVDHG 5 UTR sequence <400> 15 gcggataaca attaaggaga aatat 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RAM1 5 UTR sequence <400> 16 gataacaatt taaggaggaa atact 25 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> pACYC_F <400> 17 ccatgaattg gatatcggcc ccaccgctga gcaataacta 40 <210> 18 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> pACYC_R <400> 18 cattatacga gccgatgatt aattgtcaag gccgcaagct tgtcgacctg c 51 <210> 19 <211> 111 <212> DNA <213> Artificial Sequence <220> <223> Tac_crtE_F <400> 19 gcaggtcgac aagcttgcgg ccttgacaat taatcatcgg ctcgtataat gtgtggaatt 60 gtgagcggat aacaattaag gaggtaaaca tggtatctgg ctcaaaggct g 111 <210> 20 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> crtE_R <400> 20 cggatggagg agccacaccc ttacgcaatt ttcatcaccg g 41 <210> 21 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> crtB_F <400> 21 gggtgtggct cctccatccg atgtcccaac cccccttg 38 <210> 22 <211> 105 <212> DNA <213> Artificial Sequence <220> <223> Tac_crtB_F <400> 22 gggtgtggct cctccatccg ttgacaatta atcatcggct cgtataatgt gtggaattgt 60 gagcggataa caattaagga ggtgatcatg tcccaacccc ccttg 105 <210> 23 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> crtB_R <400> 23 gggctacgac gacggcaccg ttacaccggg cgctgccaca 40 <210> 24 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> crtI_F <400> 24 cggtgccgtc gtcgtagccc atgaaaaaaa cggttgtgat cg 42 <210> 25 <211> 109 <212> DNA <213> Artificial Sequence <220> <223> Tac_crtI_F <400> 25 cggtgccgtc gtcgtagccc ttgacaatta atcatcggct cgtataatgt gtggaattgt 60 gagcggataa caattaagga ggccctcatg aaaaaaacgg ttgtgatcg 109 <210> 26 <211> 105 <212> DNA <213> Artificial Sequence <220> <223> crtI_R <400> 26 ggccgatatc caattcatgg gcggcgaaac cccgccgaag cggggtttgc ggcgttactg 60 caggtcttcg atcatcttga caattaatca tcggctcgta taatg 105 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> crtEBI_F <400> 27 gcaggtcgac aagcttgcgg cc 22 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> crtEBI_R <400> 28 ggccgatatc caattcatgg gc 22 <210> 29 <211> 113 <212> DNA <213> Artificial Sequence <220> <223> dxsE_F <400> 29 ctgcgaaatc gcgtggctac ttgacaatta atcatcggct cgtataatgt gtggaattgt 60 gagcggataa caattaagga ggttgatatg agttttgata ttgccaaata ccc 113 <210> 30 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> dxsE_R <400> 30 ggccgcaagc ttgtcgacct gcttatgcca gccaggcctt gat 43 <210> 31 <211> 118 <212> DNA <213> Artificial Sequence <220> <223> dxsV_F <400> 31 ctgcgaaatc gcgtggctac ttgacaatta atcatcggct cgtataatgt gtggaattgt 60 gagcggataa caattaagga gggagaaatg actcttgata tttcaaagta cccaacac 118 <210> 32 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> dxsV_R <400> 32 ggccgcaagc ttgtcgacct gcttacttcg ccagataatc gtt 43 <210> 33 <211> 111 <212> DNA <213> Artificial Sequence <220> <223> ispAE_F <400> 33 gcccatgaat tggatatcgg ccttgacaat taatcatcgg ctcgtataat gtgtggaatt 60 gtgagcggat aacaattaag gaggaaaata tggactttcc gcagcaactc g 111 <210> 34 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> ispAE_R <400> 34 gtagccacgc gatttcgcag actagtttat ttattacgct ggatgatgta gtccg 55 <210> 35 <211> 114 <212> DNA <213> Artificial Sequence <220> <223> ispAV_F <400> 35 gcccatgaat tggatatcgg ccttgacaat taatcatcgg ctcgtataat gtgtggaatt 60 gtgagcggat aacaattaag gagaaatata tgcaacagac attgacttct ttcc 114 <210> 36 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> ispAV_R <400> 36 gtagccacgc gatttcgcag ttaatttttg cgctcgatga catatc 46 <210> 37 <211> 94 <212> DNA <213> Artificial Sequence <220> <223> PFT_his_F <400> 37 ttgacaatta atcatcggct cgtataatgt gtggaattgt gagcggataa caatttaagg 60 aggaaatact atgcgccagc gtgttggtcg tagc 94 <210> 38 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> PFT_his_R <400> 38 tgactagtct atgaaaaaaa aaccccgccg aagcggggtt tttttttgag ctcttaatgg 60 tggtggtgat g 71 <210> 39 <211> 114 <212> DNA <213> Artificial Sequence <220> <223> dxsE_his_F <400> 39 ttgacaatta atcatcggct cgtataatgt gtggaattgt gagcggataa caatttggac 60 gttcgtaatg catcatcacc atcaccacag ttttgatatt gccaaatacc cgac 114 <210> 40 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> dxsE_his_R <400> 40 tgactagtct atgaaaaaaa aaccccgccg aagcggggtt tttttttgag ctcttatgcc 60 agccaggcct tgat 74 <210> 41 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> ispAE_his_F <400> 41 ttgacaatta atcatcggct cgtataatgt gtggaattgt gagcggataa caattcgagg 60 tatgaaacaa aatggacttt ccgcagcaac 90 <210> 42 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> ispAE_his_R <400> 42 tgactagtct atgaaaaaaa aaccccgccg aagcggggtt tttttttgag ctcttaatgg 60 tggtggtgat g 71 <210> 43 <211> 112 <212> DNA <213> Artificial Sequence <220> <223> dxsV_his_F <400> 43 ttgacaatta atcatcggct cgtataatgt gtggaattgt gagcggataa caattggtgg 60 cccaaacatg catcatcacc atcaccacac tcttgatatt tcaaagtacc ca 112 <210> 44 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> dxsV_his_R <400> 44 tgactagtct atgaaaaaaa aaccccgccg aagcggggtt tttttttctc tagttacttc 60 gccagataat cgtt 74 <210> 45 <211> 91 <212> DNA <213> Artificial Sequence <220> <223> ispAV_his_F <400> 45 ttgacaatta atcatcggct cgtataatgt gtggaattgt gagcggataa caattgagaa 60 cccacagatg caacagacat tgacttcttt c 91 <210> 46 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> ispAV_his_R <400> 46 tgactagtct atgaaaaaaa aaccccgccg aagcggggtt tttttttgag ctcttaatgg 60 tggtggtgat gatg 74 <210> 47 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> pCDF_HF <400> 47 gggttttttt ttcatagact agtcaaacct caggcatttg agaagc 46 <210> 48 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> pCDF_HR <400> 48 cattatacga gccgatgatt aattgtcaac ataagggaga gcgtcgagat c 51

Claims (15)

5'UTR (5' Untranslated region) represented by the nucleotide sequence of SEQ ID NO: 9;
crtE (geranylgeranyl diphosphate synthase) gene represented by the nucleotide sequence of SEQ ID NO: 6;
crtB (phytoene synthase) gene represented by the nucleotide sequence of SEQ ID NO: 7; and
crtI (phytoene desaturase) gene represented by the nucleotide sequence of SEQ ID NO: 8; is introduced,
The crtE, crtB and crtI genes are arranged in monocistronic,
Recombinant E. coli with improved lycopene-producing ability. According to claim 1,
The recombinant E. coli further comprises 5'UTR represented by the nucleotide sequence of SEQ ID NO: 10 or 11, recombinant E. coli. 3. The method of claim 2,
The recombinant E. coli will further include a dxs gene represented by the nucleotide sequence of SEQ ID NO: 1, recombinant E. coli. 4. The method of claim 3,
The recombinant E. coli further comprises 5'UTR represented by the nucleotide sequence of SEQ ID NO: 12, recombinant E. coli. 3. The method of claim 2,
The recombinant E. coli will further include a dxs gene represented by the nucleotide sequence of SEQ ID NO: 3, recombinant E. coli. 6. The method of claim 5,
The recombinant E. coli further comprises 5'UTR represented by the nucleotide sequence of SEQ ID NO: 13, recombinant E. coli. 3. The method of claim 2,
The recombinant E. coli will further include the ispA gene represented by the nucleotide sequence of SEQ ID NO: 2, recombinant E. coli. 8. The method of claim 7,
The recombinant E. coli further comprises 5'UTR represented by the nucleotide sequence of SEQ ID NO: 14, recombinant E. coli. 3. The method of claim 2,
The recombinant E. coli will further include the ispA gene represented by the nucleotide sequence of SEQ ID NO: 4, recombinant E. coli. 10. The method of claim 9,
The recombinant E. coli further comprises 5'UTR represented by the nucleotide sequence of SEQ ID NO: 15, recombinant E. coli. 3. The method of claim 2,
The recombinant E. coli is a dxs gene represented by the nucleotide sequence of SEQ ID NO: 3; and
The ispA gene represented by the nucleotide sequence of SEQ ID NO: 4; further comprising, recombinant E. coli. 12. The method of claim 11,
The recombinant E. coli further comprises 5'UTR represented by the nucleotide sequence of SEQ ID NO: 12 or 14, recombinant E. coli. 3. The method of claim 2,
The recombinant E. coli is a dxs gene represented by the nucleotide sequence of SEQ ID NO: 1; And the ispA gene represented by the nucleotide sequence of SEQ ID NO: 2; Recombinant Escherichia coli further comprising. 14. The method of claim 13,
The recombinant E. coli further comprises 5'UTR represented by the nucleotide sequence of SEQ ID NO: 13 or 15, recombinant E. coli. 15. A method for producing lycopene comprising the step of culturing the recombinant E. coli according to any one of claims 1 to 14.

Images