KR102286035B1 - Esherichia coli TRANSFORMANT AND METHOD FOR PRODUCING CUMARIN-BASED OR QUINOLINE-BASED COMPOUND USING THE SAME - Google Patents

Abstract

The present invention relates to an E. coli transformant for producing a coumarin-based or quinol-based compound, into which P. aeruginosa-derived pqsD and P. aeruginosa-derived pqsA gene are introduced, and a method for producing a coumarin-based or quinol-based compound using the same. Since the coumarin-based or quinol-based compound can be produced at high titer, the coumarin-based or quinol-based compound can be used in various ways as a raw material for food, pharmaceuticals, and cosmetics or a precursor thereof.

Description

E. coli transformant and coumarin-based or quinol-based compound production method using the same

The present invention relates to an E. coli transformant and a method for producing a coumarin-based or quinol-based compound using the same.

Microorganisms can function as systems for synthesizing various compounds. Among the many types of microorganisms used for this purpose, E. coli is a good model system for generating useful natural compounds such as alkaloids, terpenoids and phenolic compounds. Phenolic compounds have traditionally been synthesized from fossil fuels such as petroleum through chemical reactions. However, due to the high cost and time required for these processes, as an alternative approach, the biological synthesis of phenolic compounds has been extensively studied. Aromatic compounds are synthesized from shikimate, chorismate or aromatic amino acids (phenylalanine, tyrosine and tryptophan). For example, tyrosine is a substrate for flavonoid synthesis, a typical phenolic compound found in nature, and 4-hydroxybenzoic acid is synthesized from chorismate. Extensive studies of the shikimate pathway have made it possible to use them in the synthesis of various phenolic compounds.

Intermediates in the aromatic amino acid biosynthetic pathway serve as starting materials for other compounds. Chorismate, a branching point in the production of phenylalanine/tyrosine and tryptophan, is a precursor for 4-hydroxybenzoic acid (a starting material for ubiquinone), aminobenzoic acid (a folic acid precursor) and salicylic acid (SA) in microorganisms. These chorismate derivatives are important raw materials for the chemical industry.

A group of type III polyketide synthase (PKS) uses so-called cyclic acyl-Coenzymes (Co)A such as anthraniloyl-CoA, p-coumaroyl-CoA and benzoyl- or malonyl-CoA. acridone, chalcone, and benzophenone, respectively. These type III PKSs are found not only in plants but also in microorganisms, and polyketides synthesized by these PKSs have various biological activities (eg, antibacterial and anticancer activities).

An intermediate of the shikimate pathway in E. coli can serve as a substrate for type III PKS (Fig. 1). Therefore, E. coli is an excellent system for the synthesis of aromatic compounds. Chorismate, an intermediate in the shikimate pathway, is a precursor of SA that is converted to 4-hydroxycoumarin (4-HC) by type III PKS. Conversion of chorismate to SA occurs in two enzymatic steps in some microorganisms such as Pseudomonas aeruginosa or in one enzymatic step in Yersinia enterocolitica . Combination of the SA biosynthesis gene and the type III PKS gene results in the synthesis of 4-HC. Anthranilates, another intermediate in the shikimate pathway, are substrates of type III PKS in quinoline synthesis. These two aromatic compounds, 4-HC and quinoline, have been used to produce anticoagulant and antimalarial drugs, respectively.

The present invention is to use coumarin-based or quinoline-based compounds as raw materials or precursors for food, pharmaceuticals and cosmetics in various ways, Pseudomonas aeruginosa ( P. aeruginosa ) derived pqsD and Pseudomonas aeruginosa ( P. aeruginosa ) derived pqsA It is an object of the present invention to provide an E. coli transformant into which a gene is introduced, and the like for producing a coumarin-based or quinol-based compound.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

The present invention Pseudomonas aeruginosa ( P. aeruginosa ) Derived pqsD and Pseudomonas aeruginosa ( P. aeruginosa ) Pseudomonas aeruginosa ( P. aeruginosa ) Pseudomonas aeruginosa ( P. aeruginosa ) To provide an E. coli transformant for generating a coumarin-based or quinol-based compound into which the gene is introduced.

In one embodiment of the present invention, there is provided a composition for producing a coumarin-based or quinol-based compound comprising the E. coli transformant or a culture of the E. coli transformant.

In another embodiment of the present invention, using the E. coli transformant or a culture of the E. coli transformant, there is provided a method for producing a coumarin-based or quinol-based compound from a substrate. The substrate may include at least one selected from the group consisting of glucose, chorismate, salicylic acid, anthranilate, N-methylanthranilate and malonyl-CoA.

According to the present invention, Pseudomonas aeruginosa ( P. aeruginosa )-derived pqsD and Pseudomonas aeruginosa ( P. aeruginosa ) Using the introduced E. coli transformant or a culture of the E. coli transformant, coumarin Since the system or quinol-based compound can be produced at a high titer, it can be used in various ways as a raw material or a precursor thereof for food, medicine, and cosmetics.

1 is a schematic diagram of the synthesis of three bioactive aromatic compounds in E. coli. Black arrows are metabolic pathways in E. coli. Gray bold arrows indicate engineered pathways for the synthesis of phenolic compounds in E. coli. The newly introduced genes are; entC, isochorismate synthase from E. coli; pchB, isochorismate pyruvate lyase from Pseudomonas aeruginosa; pqsA, anthranilate-CoA ligase from P. aeruginosa; pqsD, anthraniloyl-CoA anthraniloyl transferase from P. aeruginosa; NMT, Ruta graveolens- derived N-methyltransferase; and acc, an acetyl-CoA carboxylase from Photorhabdus luminescens.
Figure 2 is a schematic diagram of the main plasmid structure used in the present invention. (A) pA-accABCD; (B) pC-aroL-aroE-aroD-aroB-aroG ^f -ppsA-tktA-entC-pchB; (C) pE-pqsD-pqsA; (D) pC-aroL-aroG ^f -ppsA-tktA-trpEG; and (E) pC-pqsD-pqsA.
3 shows the synthesis of SA. (A) standard salicylic acid (S1); (B) the reaction product from B-SA2 (P1); (C) standard 4-HC(S2); and (D) the reaction product from B-4HC3 (P2). P3 is SA. For panels (A and B), the initial concentration of acetonitrile was 10%, while the concentration of acetonitrile for the panel was 20%.
4 shows the synthesis of SA and 4-HC. (A) SA and (B) 4-HC were synthesized by E. coli engineered to express shikimate pathway genes. Individual E. coli strains are described in Table 1. A construct containing more shikimate pathway genes increased the synthesis of SA. Maximal production of 4-HC was achieved when the pqsD and pqsA genes were used.
Figure 5 shows the synthesis of DHQ in E. coli strain B-DHQ3. (A) Standard DHQ(S). (B) Reaction product (P) from E. coli strain B-DHQ3. The synthesized compound (P) had the same retention time as standard DHQ. In addition, the structure of the synthesized compound was determined to be DHQ using NMR.
6 shows the synthesis of DHQ in different E. coli strains. Individual E. coli strains are described in Table 1. The difference between the strains was the combination of genes in the shikimate pathway.
7 shows the synthesis of DHQ in E. coli harboring CmQNS-pqsA. (A) Standard NMQ(S). (B) Reaction products from E. coli carrying CmQNS-pqsA (P). E. coli carrying mQNS-pqsA was fed in 100 μM N-methylanthranilate, and the mixture was incubated for 24 hours. The reaction product (P) had the same retention time as standard NMQ.

Intermediates in aromatic amino acid biosynthesis can serve as substrates for the synthesis of biologically active compounds. We synthesized three biologically active compounds using two intermediates in the shikimate pathway, chorismate and anthranilate in E. coli: 4-hydroxycoumarin (4-HC), 2,4-dihydroxyquinoline (DHQ) and 4-hydroxy-1-methyl-2(1H)-quinolone (NMQ). The present inventors introduced genes for the synthesis of salicylic acid from corimate to provide a substrate for 4-HC and a gene encoding N-methyltransferase for the synthesis of N-methylanthranilate from anthranilate. did. Polyketide synthase and coenzyme (Co)A ligase were tested to determine the optimal combination of genes for the synthesis of each compound. In addition, we tested several structures and identified the optimal for increasing levels of endogenous substrates for chorismates, anthranilates and malonyl-CoA. Using these strategies, 255.4 mg/L 4-HC, 753.7 mg/L DHQ and 17.5 mg/L NMQ were synthesized. The present invention has potential medical applications and provides a basis for the synthesis of various coumarin and quinoline derivatives.

Hereinafter, the present invention will be described in detail.

The present invention Pseudomonas aeruginosa ( P. aeruginosa ) Derived pqsD and Pseudomonas aeruginosa ( P. aeruginosa ) Pseudomonas aeruginosa ( P. aeruginosa ) Pseudomonas aeruginosa ( P. aeruginosa ) To provide an E. coli transformant for generating a coumarin-based or quinol-based compound into which the gene is introduced.

The E. coli may be E. coli BL21 (DE3) or E. coli BL21 (DE3) in which trpD and tyrA genes are simultaneously deleted, but is not limited thereto. The trpD and tyrA genes preferably have the nucleotide sequences of SEQ ID NOs: 1 and 2, respectively, but functional equivalents thereof, i.e., all that achieve the object of the present invention by inducing mutations such as one or more substitutions and deletions in the base It is meant to include mutants.

The E. coli transformant may be obtained by transforming the E. coli into an expression vector containing Pseudomonas aeruginosa- derived pqsD and Pseudomonas aeruginosa-derived pqsA genes. As used herein, "expression vector" refers to a recombinant DNA molecule comprising a desired coding sequence and an appropriate nucleic acid sequence essential for expressing a coding sequence operably linked in a specific host organism. The pqsD and pqsA genes preferably have the nucleotide sequences of SEQ ID NOs: 3 and 4, respectively, but functional equivalents thereof, i.e., one or more substitutions, deletions, etc. in the base to induce mutations such as mutations to achieve the object of the present invention It is meant to include mutants. In this case, pCDFDuet or pETDuet may be used as the plasmid.

In addition, in the E. coli transformant, i) Photorhabdus luminescens ( P. luminescens )-derived accABCD gene may be further introduced, that is, Photorhabdus luminescens ( P. luminescens )-derived accABCD gene. It may be one obtained by further transforming the expression vector. The accABCD gene includes an accA gene, an accBC gene and an accD gene, each preferably having the nucleotide sequence of SEQ ID NOs: 5 to 7, but a functional equivalent thereof, that is, one or more substitutions, deletions, etc. in the base It is meant to include all mutants that achieve the object of the present invention by causing In this case, pACYCDuet may be used as a plasmid.

In addition, the E. coli transformant is ii) aroL, aroE, aroD, aroB, aroG ^f , ppsA, tktA, entC and Pseudomonas aeruginosa ( P. aeruginosa ) derived pchB genes are additionally introduced, or aroL, aroG ^f , The ppsA, tktA and trpEG genes may be further introduced. In other words, an expression vector containing aroL, aroE, aroD, aroB, aroG ^f , ppsA, tktA, entC and pchB gene from Pseudomonas aeruginosa is further transformed, or aroL, aroG ^f , The expression vector containing the ppsA, tktA and trpEG genes may be further transformed. The aroL, aroE, aroD, aroB, aroG ^f , ppsA, tktA, entC, Pseudomonas aeruginosa (P. aeruginosa )-derived pchB and trpEG genes each preferably have the nucleotide sequences of SEQ ID NOs: 8 to 17, but their functionalities Equivalent, that is, it is meant to include all mutants that achieve the object of the present invention by inducing one or more substitutions, deletions, etc., mutations in the base. In this case, pCDFDuet may be used as a plasmid.

Specifically, the E. coli transformant is an expression vector containing an accABCD gene derived from Photorhabdus luminescens by using pACYCDuet as a plasmid in the E. coli; Expression vectors containing the aroL, aroE, aroD, aroB, aroG ^f , ppsA, tktA, entC and Pseudomonas aeruginosa- derived pchB genes using pCDFDuet as a plasmid; And by using pETDuet as a plasmid, Pseudomonas aeruginosa ( P. aeruginosa ) derived pqsD and Pseudomonas aeruginosa ( P. aeruginosa ) It may be a transformed expression vector containing the derived pqsA gene, and using this, 4 -Can produce hydroxycoumarin.

In addition, the E. coli transformant is an expression vector containing the accABCD gene derived from Photorhabdus luminescens by using pACYCDuet as a plasmid in the E. coli; ^{Expression vectors containing aroL, aroG f} , ppsA, tktA and trpEG genes using pCDFDuet as a plasmid; And using pETDuet as a plasmid, Pseudomonas aeruginosa ( P. aeruginosa ) derived pqsD and Pseudomonas aeruginosa ( P. aeruginosa ) It may be a transformed expression vector containing the derived pqsA gene, and using this, 2 ,4-dihydroxyquinoline can be produced.

In addition, the E. coli transformant uses pCDFDuet as a plasmid in the E. coli, Pseudomonas aeruginosa ( P. aeruginosa ) derived pqsD and Pseudomonas aeruginosa ( P. aeruginosa ) An expression vector containing the derived pqsA gene was transformed may be used, and by using this, 4-hydroxy-1-methyl-2-quinolone can be produced.

The coumarin-based or quinol-based compound may be selected from the group consisting of the following Chemical Formulas 1 to 3:

[Formula 1]

[Formula 2]

[Formula 3]

.

.

In one embodiment of the present invention, there is provided a composition for producing a coumarin-based or quinol-based compound comprising the E. coli transformant or a culture of the E. coli transformant.

In another embodiment of the present invention, using the E. coli transformant or a culture of the E. coli transformant, there is provided a method for producing a coumarin-based or quinol-based compound from a substrate.

The substrate may include at least one selected from the group consisting of glucose, chorismate, salicylic acid, anthranilate, N-methylanthranilate and malonyl-CoA. Specifically, when the compound to be produced is [Formula 1], the substrate may be at least one selected from the group consisting of glucose, chorismate, salicylic acid and malonyl-CoA, and the compound to be produced is [Formula 2] In the case of , the substrate may be one or more selected from the group consisting of glucose, chorismate, anthranilate and malonyl-CoA, and when the compound to be produced is [Formula 3], the substrate is glucose, chorismate, It may be at least one selected from the group consisting of N-methylanthranilate and malonyl-CoA.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

<Example>

Materials and Methods

rescue

All genes except pchB from P. aeruginosa were cloned by polymerase chain reaction (PCR). After codon optimization for E. coli , a gene encoding isochorismate pyruvate lyase (gene ID: 881846) was synthesized from P. aeruginosa. EntC (gene ID: 945511) from E. coli and pchA (gene ID: 881821) from P. aeruginosa were subcloned into the BamHI / SacI site of pCDF-Duet, and pC-entC and pC-pchA were calculated, respectively. pchB containing the SacI site and the ribosome binding sequence (aaggagatatacca) was subcloned into the SacI/NotI site of pC-entC (pC-entC-pchB) or pC-pchA (pC-pchApchB). Expression of genes in all constructs was controlled by a single promoter.

The badA gene (GenBank: L42322.1) encoding a benzoyl-CoA ligase from Rhodopseudomonas palustris was cloned into the NdeI/KpnI site of the pET-Duet vector (pE-badA). The Ruta graveolens acridon synthase gene (RgACS; GenBank: AJ297786.2) was subcloned into the BamHI/NotI site of pE-badA (pE-RgACS-badA). pqsA (GenBank: AAG04385) encoding anthraniloyl-CoA ligase from P. aeruginosa was cloned into the NdeI/XhoI site of pET-Duet (pE-pqsA), and the P. aeruginosa quinolone signal synthase gene (pqsD; GenBank: AAG04388.1) was cloned into the BamHI/NotI site of pE-pqsA (pE-pqsD-pqsA). The quinolone synthase (QNS) gene (GenBank: AB823730) from Citrus microcarpa was amplified by reverse transcription PCR and subcloned into the SalI/AflII site of pE-pqsA (pE-CmQNSpqsA).

The acetyl-CoA carboxylase (ACC) gene (accABCD) from Photorhabdus luminescens was previously cloned (J. Microbiol. Biotechnol. 2014, 24, 1536-1541), as aroG ^f , ppsA and tktA. The internal EcoRI site of tktA and ^{the internal XhoI site of aroG f} were deleted by site-direct mutation without codon change. AroL (CAA27696), aroE (CAA68700), aroD (CAA42091) and aroB (CAA27495) were cloned by PCR using E. coli genomic DNA as a template. The constructs in Table 1 were constructed as described below, and a schematic diagram of the main plasmid constructs used in the present invention is shown in FIG. 2 .

Plasmid or E. coli strain Linkage traits or genetic markers plasmid pC-entC-pchB pCDFDuet + entC from E. coli + pchB from P. aeruginosa pC-pchA-pchB pCDFDuet + pchA + pchB from P. aeruginosa pE-RgACS-badA pETDuet + badA from R. palustris + RgACS from R. graveolens pE-pqsD-pqsA pETDuet + pqsD + pqsA from P. aeruginosa pC-pqsD-pqsA pCDFDuet + pqsD + pqsA from P. aeruginosa pE-CmQNS-pqsA pETDuet + QNS from Citrus microcarpa + pqsA from P. aeruginosa pA-accABCD pACYCDuet + accABCD from Photorhabdus luminescens pC-aroG ^f -ppsA-tktA-entC-pchB ^{pCDFDuet + aroG f} at the first multiple cloning site (MCS1), ppsA and tktA from E. coli + entC and pchB in MCS2 pC-aroL-aroG ^f -ppsA-tktA-entC-pchB ^{aroL, aroG f} , ppsA in pCDFDuet + MCS1 and entC and pchB in tktA + MCS2 from E. coli pC-aroL-aroE-aroD-aroB-aroG ^f -ppsAtktA-entC-pchB aroL, aroE, aroD, aroB, aroG ^f , ppsA in pCDFDuet + MCS1 and tktA in E. coli + entC and pchB in MCS2 pC-trpEG pCDFDuet + trpEG from E. coli pC-aroG ^f -ppsA-tktA-trpEG pCDFDuet + aroG ^f in MCS1, ppsA and tktA from E. coli + trpEG in MCS2 pC-aroL-aroE-aroD-aroB-aroG ^f -ppsAtktA-trpEG pCDFDuet + aroL, aroE, aroD, aroB, aroG ^f in pCDFDuet + MCS1 and tktA in E. coli + trpEG in MCS2 pC-NMT pCDFDuet + NMT from Ruta graveolens pC-NMT-trpEG pCDFDuet + NMT from R. gravealens + trpEG from E. coli pC-aroL-aroG ^f -ppsA-tktA-NMT-trpEG ^{aroL, aroG f} in pCDFDuet + MCS1, ppsA and NMT and trpEG in tktA + MCS2 from E. coli pC-aroG-trpEG pCDFDuet + aroG in MCS1 + trpEG from E. coli in MCS2 strain BL21(DE3) F ^- ompT hsdS _B (r _B ^- m _B ^- ) gal dcm lon(DE3) B-trpD E. coli BL21 (DE3) deleted from the antnarylate phosphoribosyl transferase domain of trpD B-trpD/tyrA E. coli BL21 (DE3) ΔΔ B-SA1 E. coli BL21 (DE3) harboring pC-pchA-pchB B-SA2 E. coli BL21 (DE3) harboring pC-entC-pchB B-SA3 E. coli BL21 (DE3) carrying pC-aroG ^f -ppsA-tktA-entC-pchB B-SA4 E. coli BL21 (DE3) carrying pC-aroL-aroG ^f -ppsA-tktA-entC-pchB B-SA5 E. coli BL21 (DE3) carrying pC-aroL-aroE-aroD-aroB-aroG ^f -ppsA-tktA-entC-pchB B-4HC1 E. coli BL21 (DE3) carrying pC-RgACS-badA B-4HC2 E. coli BL21 (DE3) harboring pC-pqsD-pqsA B-4HC3 E. coli BL21 (DE3) harboring pC-entC-pchB and pE-RgACS-badA B-4HC4 E. coli BL21 (DE3) carrying pC-aroL-aroE-aroD-aroB-aroG ^f -ppsA-tktA-entC-pchB and pE-RgACS-badA B-4HC5 E. coli BL21 (DE3) carrying pA-accABCD, pC-aroL-aroE-aroD-aroB-aroG ^f -ppsA-tktA-entC-pchB and pE-RgACS-badA B-4HC6 E. coli BL21 (DE3) carrying pA-accABCD, pC-aroL-aroE-aroD-aroB-aroG ^f -ppsA-tktA-entC-pchB and pE-pqsD-pqsA B-DHQ1 E. coli BL21 (DE3) harboring pC-RgACS-pqsA B-DHQ2 E. coli BL21 (DE3) harboring pC-pqsD-pqsA B-DHQ3 E. coli BL21 (DE3) carrying pA-accABCD, pC-trpEG and pE-pqsD-pqsA B-DHQ4 E. coli BL21 (DE3) carrying pA-accABCD, pC-aroG ^f -ppsA-tktA-trpEG and pE-pqsD-pqsA B-DHQ5 E. coli BL21 (DE3) carrying pA-accABCD, pC-aroL-aroG ^f -ppsA-tktA-trpEG and pE-pqsD-pqsA B-DHQ6 E. coli BL21 (DE3) carrying pA-accABCD, pC-aroL-aroE-aroD-aroB-aroG ^f -ppsA-tktA-trpEG and pE-pqsD-pqsA B-DHQ7 B-trpD with pA-accABCD, pC-aroL-aroG ^f -ppsA-tktA-trpEG and pE-pqsD-pqsA B-DHQ8 B-trpD/tyrA with pA-accABCD, pC-aroL-aroG ^f -ppsA-tktA-trpEG and pE-pqsD-pqsA B-NMQ1 E. coli BL21 (DE3) carrying pA-accABCD, pC-NMT-trpEG and pE-CmQNS-pqsA B-NMQ2 E. coli BL21 (DE3) carrying pA-accABCD, pC-NMT-trpEG and pE-pqsD-pqsA B-NMQ3 E. coli BL21 (DE3) carrying pA-accABCD, pC-aroL-aroG ^f -ppsA-tktA-NMT-trpEG and pE-CmQNS-pqsA B-NMQ4 E. coli BL21 (DE3) carrying pA-accABCD, pC-aroL-aroG ^f -ppsA-tktA-NMT-trpEG and pE-pqsD-pqsA B-NMQ5 E. coli BL21 (DE3) harboring pC-aroG-trpEG B-NMQ6 E. coli BL21 (DE3) harboring pC-NMT B-NMQ7 E. coli BL21 (DE3) harboring pC-pqsD-pqsA

aroE was amplified with a forward primer containing a BamHI site and a reverse primer containing a SalI site, and subcloned into the BamHI/SalI site of pACYC-Duet. aroD was amplified with a forward primer comprising an XhoI site and a ribosome-binding site (RBS; aggaggccatcc) and a reverse primer comprising SalI and NotI sites; The amplicon was digested with XhoI/NotI and subcloned into the SalI/NotI site of pACYC-Duet harboring aroE. aroB was amplified with a forward primer containing an XhoI site and RBS and a reverse primer containing an EcoRI and NotI site; The amplicon was digested with XhoI/NotI and subcloned into the SalI/NotI site of pA-aroE-aroD (pA-aroE-aroD-aroB). aroE-aroD-aroB was re-amplified with forward primers containing BamHI, SalI sites and RBS and reverse primers containing EcoRI and NotI sites. The amplicon was subcloned into the BamHI/NotI site of pACYCDuet. aroL was amplified with a forward primer containing a BamHI site and a reverse primer containing an XhoI site. The amplicon was digested with BamHI/XhoI and subcloned into the BamHI/SalI site of pA-RBS-aroE-aroD-aroB. As a result, the structure was named pA-aroL-aroE-aroD-aroB.

Using a similar approach, aroG ^f , ppsA and tktA were re-amplified and subcloned into the EcoRI/NotI site of pACYC-Duet (pA-RBS-aroG ^f -ppsA-tktA). aroL was re-amplified with a forward primer containing a BamHI site and a reverse primer containing an EcoRI site, and the amplicon was subcloned into the BamHI/EcoRI site ^{of pA-aroG f-ppsA-tktA.} pA-aroL-aroE-aroD-aroB to generate a structure (pA-aroL-aroE-aroD-aroB-aroG ^f -ppsA-tktA) containing aroL, aroE, aroD, aroB, aroG ^{f , ppsA and tktA} It was digested with EcoRI and NotI and ligated with EcoRI/NotI fragments containing ^{aroG f , ppsA and tktA.} A list of primers used in the present invention is confirmed in Table 2.

gene Primer name sequence (5' → 3') aroG F; EcoRI-RBS-G at gaattc AGGAGGCCATCC ATGAATTATCAGAACGACGAT tktA R; NotI-T cat gcggccgc TTACAGCAGTTCTTTTGCTTTC aroL F; BamHI-L at ggatcc aATGACACAACCTCTTTTTCTGATC R; EcoRI-L aa gaattc TCAACAATTGATCGTCTGTGC R; XhoI-L aa ctcgag TCAACAATTGATCGTCTGTGC aroE F; BamHI-E aa ggatcc aATGGAAACCTATGCTGTTTTT F; BamHI-SalI-RBS-E aa ggatcc agct gtcgac AGGAGGCCATCC ATGGAAACCTATGCTGTTTTT R; SalI-E at gtcgac CACGCGGACAATTCCT aroD F; XhoI-RBS-D aa ctcgag AGGAGGCCATCC ATGAAAACCGTAACTGTAAAAGAT R; NotI-SalI-D at gcggccgc gct gtcgac TTATGCCTGGTGTAAAATAGTTAA aroB F; XhoI-RBS-B aa ctcgag AGGAGGCCATCC ATGGAGAGGATTGTCGTTACTCT R; NotI-EcoRI-B at gcggccgc gct gaattc TTACGCTGATTGACAATCGG

* F and R represent forward and reverse primers, respectively.

* Lowercase letters are restriction enzyme sites. The RBS region is underlined.

As a result, the structures (pA-aroL-aroG ^f -ppsA-tktA and pA-aroL-aroE-aroD-aroB-aroG ^f -ppsA-tktA) were digested, respectively, and BamHI/NotI of pC-entC-pchB and pC-trpEG subcloned into

Based on previous reports, the E. coli trpEG gene was cloned. Briefly, PCR was used to clone the trpEG gene. To introduce a stop codon into Glu250 of E. coli trpD, the following two primers were used: 5'-AT GAATTC GATGCAAACACAAAAACCGACT-3' (underlined indicates EcoRI enzyme site) as forward primer and 5 as reverse primer. ' -CA TGCGGCCGC ttaCAGAATCGGTTGCAGC-3' (underline indicates NotI enzyme site, lowercase indicates codon insertion). To generate E. coli mutants deleted only in the anthranilate phosphoribosyl transferase domain (APTD) of trpD, the Quick & Easy E. coli gene deletion kit (Gene Bridges, Heidelberg, Germany) was used. Briefly, the pRedET plasmid containing the Red/ET recombinase gene was transformed into BL21(DE3) (Novagen) and used for deletion of the APTD of trpD without loss of the glutamineamidotransferase domain (GAD). The FRT-flank PGK-gb2-neocassette is a forward primer, with two primers, 5'-CTGGGCGCAGCAGAAACTAGAGCCAGCCAACACGCTGCAACCGATTCTG T aattaaccctcactaaagggcg-3' (underlined "T" is an inserted stop codon to maintain the GAD of trpD) to create a stop codon and 5'-TTACCCTCGTGCCGCCAGTGCGGTAACTCTGTCGTAAGCGGAACCACTGCtaatacgactcactatagggctc-3' as reverse primer, and the gel was purified for use in trpD-APTD gene deletion. BL21 (DE3) competent cells were prepared by inducing Red/ET recombinase by adding 10% arabinose solution. The FRT-flank PGK-gb2-neocassette targeting trpD-APTD was introduced by electroporation at 1350 V, 10 μF and 600 Ω using an Eppendorf Electroporator 2510. Mutations were selected on LB-plates supplemented with kanamycin (50 μg/mL) overnight at 37°C. Gene deletion was confirmed by PCR using two primers, 5'-AATCGCCTTGTCTGCGACGA-3' as forward primer and 5'-CACTCGCTGGTTGGCAGTAA-3' as reverse primer.

culture conditions

E. coli was grown and induced for protein expression as previously described. For the synthesis of SA, 4-HC, DHQ, or NMQ from glucose, use 1 mL M9 medium containing 2% glucose and 1% yeast extract in a test tube (15 X 145 mm) at 600 nm (OD ₆₀₀ ) = Cell concentration was adjusted to optical density at 1.0. Induction was carried out at 30° C. for 24 hours. Protein expression was induced at 18° C. for 18 hours before the addition of substrate to the culture. Cells were harvested and resuspended in 1 mL of M9 (with 2% glucose) or YM9 (M9 with 2% glucose and 1% yeast extract) medium at a cell density of _{OD 600 = 3.0, and 100 μM substrate was added if necessary.}

Analysis of reaction products

The culture (200 μL) was extracted with ethyl acetate (600 μL). The organic layer was collected after centrifugation, dried, dissolved in dimethoxysulfoxide (DMSO), followed by a photodiode array detector and a C18 reversed-phase column (4.60 X 250 mm, 3.5-μm particle size; Varian, Palo Alto, CA). , USA) equipped with an UltiMate 3000 HPLC (High Performance Liquid Chromatography) system (Thermo Fisher Scientific, MA, USA, MA). The mobile phase consisted of 0.1% formic acid in water and acetonitrile. The program was as follows: 20% acetonitrile at 0 min, 60% at 8 min, 90% at 12 min, 90% at 15 min, 20% at 15.1 min, 20% at 20 min. UV detection was performed at a flow rate of 1 min/mL, at 270 nm for 4-HC, DHQ and NMQ, at 320 nm for SA and anthranilate, and at 340 nm for N-methylanthranilate. For quantification of reaction products, commercially purchased SA, 4-HC and DHQ (Sigma-Aldrich, Yongin, Korea) were used as standards. Experiments were performed with samples prepared in triplicate, and results were reported as mean ± standard deviation.

¹ H NMR (nuclear magnetic resonance spectroscopy) analysis of the synthesized compound was performed as described above.

4-HC ( ¹ H NMR, in MeOD): 5.63 (s, H-3), 7.33 (d, J = 8.7, H-8), 7.34 (t, J = 8.5, H-7), 7.65 (t) , J = 7.9, H-6), 7.92 (d, J = 8.0, H-5).

DHQ [ ¹ H NMR (400 MHz, DMSO-d6)]: δ 5.70 (1H, s, H-3), 7.12 (1H, dd, J = 7.8, 7.5 Hz, H-7), 7.24 (1H, d , J = 8.2 Hz, H-5), 7.47 (1H, dd, J = 8.2, 7.5 Hz, H-6), 7.77 (1H, d, J = 7.8 Hz, H-8).

NMQ [ ¹ H NMR (400 MHz, DMSO-d6]: δ 3.53 (3H, s, CH3), 5.85 (1H, s, H-3), 7.23 (1H, dd, J = 8.5, 7.9 Hz, H- 6), 7.45 (1H, d, J = 8.4 Hz, H-8), 7.62 (1H, dd, J = 8.5, 8.4 Hz, H-7), 7.90 (1H, d, J = 7.9 Hz, H- 5).

result

E. coli Synthesis of 4-HC from Glucose in

4-hydroxycoumarin (4-HC) was synthesized by condensation of salicyloyl-CoA and malonyl-CoA. E. coli was prepared to express a gene for SA synthesis. The microbial synthesis of SA from chorismate was mediated by two enzymes. First, chorismate was converted to isochorismate by isochorismate synthase ( PchA from P. aeuginosa or EntC from E. coli ); Then, isochorismate was converted to SA by isochorismate pyruvate lyase (PchB from P. aeuginosa ), which is not present in E. coli. We subcloned two genes, pchA and pchB or entC and pchB, into an E. coli expression vector. As a result, it is confirmed that E. coli strains B-SA1 and B-SA2 synthesize SA with a higher titer obtained with B-SA2 (58.7 mg/L) than B-SA1 (5.1 mg/L). (Fig. 3B).

Next, a gene for the synthesis of 4-HC from SA was screened, which occurred in two steps. SA was activated by attachment of CoA, and salicylyl-CoA reacted with malonyl-CoA to generate 4-HC. We tested two CoA ligases (BadA and PqsA) and two 4-HC synthases (RgACS and PqsD). Both badA and RgACS were cloned into the pCDF-Duet vector (pC-RgACS-badA), and both pqsA and pqsD were cloned into the same vector (pC-pqsD-pqsA) to generate two constructs. When fed with SA, E. coli transformants harboring either pC-RgACS-badA (B-4HC1) or pC-pqsDpqsA (B-4HC2) synthesized 4-HC, and a transformation reaction between the two E. coli strains There was no difference in

We synthesized 4-HC from glucose by combining the SA and 4-HC synthesis pathways. E. coli was transformed with both pC-entC-pchB and pERgACS-badA and the transformant (B-4HC3) was evaluated for 4-HC synthesis, producing a product with the same retention time as 4-HC. confirmed to be (Fig. 3D). ¹ H NMR data confirmed that the synthesized compound was 4-HC, and demonstrated successful synthesis of 4-HC by introducing 4 genes into E. coli.

Manipulation of the Shikimate Pathway to Increase 4-HC Production

SA and malonyl-CoA are substrates for the synthesis of 4-HC. To increase 4-HC production in E. coli , first, the present inventors used E. coli Shikimate The pathway genes, namely ppsA, tktA, aroG, aroB, aroD, aroE and aroL, were engineered from two substrates, phosphoenolpyruvate and erythrose 4-phosphate. Involved in the synthesis of mate 3-phosphate (shikimate 3-phosphate). We generated three constructs: the first contained three genes [aroGf; feedback inhibition-free versions of aroG D146N (GAT to AAT); ppsA; and tktA], the second contained 4 genes (added aroL to 3 genes in the first structure), and the third contained 7 genes (added aroE, aroD, aroB to 4 genes in the second structure). The genes were arranged in the structure in reverse order, that is, genes acting downstream in the shikimate pathway were placed before upstream genes. All genes in the construct were controlled by a single promoter and RBS preceded each gene. These constructs were tested for SA synthesis by transforming pC-entC-pchB with E. coli. As a result, SA production was evaluated using E. coli strains (B-SA3, B-SA4 and B-SA5) and B-SA2. B-SA5 produced the highest amount of SA (421.4 mg/L), followed by B-SA4 (192.6 mg/L), B-SA3 (123.2 mg/L) and B-SA2 (76.0 mg/L). followed (Fig. 4A). These results demonstrated that the introduction of the shikimate pathway gene into E. coli improved corimate synthesis and, as a result, enhanced SA production.

Next, 4-HC was synthesized by introducing pE-RgACSbadA into an E. coli strain. As a result, strain B-4HC4 synthesized only a small amount of 4-HC, whereas most of the SA was not converted to 4-HC (Fig. 4B), and B-4HC4 did not supply a sufficient amount of malonyl-CoA. Therefore, a second substrate was required for 4-HC synthesis. Various malonyl-CoA concentrations altered the final titers of aromatic compounds. To increase the supply of malonyl-CoA, we introduced the ACC complex of P. luminescens (pA-accABCD), which converts acetyl-CoA to malonyl-CoA. As a result, strain (B-4HC5) synthesized about 100.5 mg/L 4-HC, which was much higher than strain B-4-HC4 (6.6 mg/L). However, 81.3 mg/L unreacted SA remained. The accumulation of SA appears to be due to a second enzymatic reaction of PKS. Since the reactions catalyzed by CoA ligase and 4-HC synthase in the last two steps of 4-HC synthesis can be rate-limiting, we replaced badA and RgACS with pqsA and pqsD, respectively. As a result, strain B-4HC6 converted most of the SA to 4-HC with a titer of about 178.0 mg/L, which was 10.4 times higher than that of strain B-4HC3 (Fig. 4B). 4-HC synthesis was monitored for 44 h using strain B-4HC6; At 38 hours, 255.4 mg/L 4-HC was produced.

Synthesis of DHQ

2,4-dihydroxyquinoline (DHQ) was synthesized from anthranilate through a polyketide synthesis route ( FIG. 1 ). We tested two PKS genes, RgACS and pqsD, along with pqsA, which encodes an anthranilate CoA-ligase. After feeding the cultures with anthranilate, we found that two transformants synthesize DHQ; B-DHQ2 with pqsD (B-DHQ2) had higher titers than B-DHQ1 with RgACS. The synthesized compound was identified as DHQ by ^{1 H NMR.}

We tested the synthesis of DHQ without supplying an external anthranilate. The structures, pC-trpEG and pA-accABCD, were provided to the substrates, anthranilate and malonyl-CoA, respectively. E. coli strain B-DHQ3 synthesized DHQ (FIG. 5). The trpEG gene from E. coli encodes an anthranilate synthase comprising trpE encoding an aminase and a 5'-region of trpD encoding amidotransferase activity (this region is called trpG), and trpEG The protein encoded by , converted chorismate to anthranilate.

We engineered E. coli to synthesize increased intracellular anthranilate levels. We tested four E. coli strains (B-DHQ3, B-DHQ4, B-DHQ5 and B-DHQ6), each with accumulation of pA-accABCD and anthranilate for malonyl-CoA. Shikimate pathway genes for The strain carrying only trpEG, which converts chorismate to anthranilate, synthesized small amounts of DHQ (<10 mg/L; FIG. 6), indicating that overexpression of genes upstream of chorismate synthesis is required. Indeed, expression of genes other than trpEG significantly increased DHQ titers: the strain carrying aroL, aroGf, ppsA and tktA (BDHQ5) synthesized the highest amount of DHQ (about 457.2 mg/L), followed by B-DHQ4 (436.4 mg/L) followed by B-DHQ6 (355.3 mg/L) ( FIG. 6 ).

We further investigated the effect of anthranilates on DHQ synthesis. Anthranilates were synthesized from chorismate and glutamate by anthranilate synthase encoded by the 5'-regions of trpE and trpD. To accumulate anthranilate, we deleted the C-terminal portion of trpD, including the APTD, while retaining the N-terminal domain (GAD) of trpD. GAD of trpE and trpD converted chorismate to anthranilate. The mutant resulted in accumulation of anthranilates. In addition, chorismate, a substrate of anthranilate, was used for the synthesis of prephenate by chorismate mutase (encoded by tyrA) ( FIG. 1 ). To enhance chorismate accumulation, we deleted tyrA. Therefore, we tested two mutants, trpD and trpD/tyrA (strains B-DHQ7 and B-DHQ8), and found that both produced more DHQ than wild-type E. coli (491.6 and 502.8 mg, respectively). /L) (Figure 6). We monitored DHQ synthesis by B-DHQ8 in flasks and observed that at 24 h, with a maximum DHQ titer of 753.7 mg/L, DHQ synthesis and cell growth continued to increase.

Synthesis of NMQ

4-hydroxy-1-methyl-2(1H)-quinolone (NMQ) was synthesized from N-methylanthranilate and malonyl-CoA. We tested two PKSs (pqsD and CmQNS) and one N-methylanthraniloyl-CoA ligase (pqsA). While CmQNS synthesizes NMQ, pqsD was originally identified as an enzyme involved in the synthesis of DHQ. Due to the structural similarity of anthranilate and N-methylanthranilate, we investigated whether both PKS could be used for NMQ synthesis. E. coli transformants harboring either CmQNS-pqsA or pqsD-pqsA produced a novel product, with a mass of 175.0703 Da, predicted by the molecular weight of NMQ ( FIG. 7 ). ¹ H NMR confirmed that the synthesized compound was actually NMQ.

The synthesis of NMQ required one additional step compared to that of DHQ, namely the methylation of the anthranilate. N-methyltransferase (NMT) from R. graveolens is known to convert anthranilates to N-methylanthranilates. NMQ synthesis from glucose was investigated using two E. coli transformants (B-NMQ1 and B-NMQ2). B-NMQ1 synthesized 4.9 mg/L NMQ and 1.0 mg/L DHQ, and B-NMQ2 synthesized 6.4 mg/L DHQ and 3.6 mg/L NMQ. This indicated that E. coli with CmQNS used N-methylanthraniloyl-CoA better than anthraniloyl-CoA, and E. coli with pqsD did the opposite. The present inventors have tested this by the rate anthranilate and methyl anthranilate N- rate of the same concentration (200 μM) in E. coli have the E. coli and pC-pqsD-pqsA holds the pCCmQNS-pqsA supply respectively, pC- The strain carrying pqsD-pqsA produced more DHQ than NMQ, whereas the strain carrying pC-CmQNS-pqsA did not produce either DHQ or NMQ, presumably due to the higher concentration (200 μM) of the two substrates. found

To increase the amount of product, constructs containing the shikimate pathway genes were co-expressed in two strains (producing strains B-NMQ3 and B-NMQ4). As expected from the feeding study, B-NMQ3 did not produce NMQ, with high amounts of anthranilate (225.0 mg/L) and N-methylanthranilate (68.9 mg/L) detected in the filtrate. . This was considered to be due to the inhibition of CmQNS by high concentrations of anthranilate, anthraniloyl-CoA, N-methylanthranilate or N-methylanthraniloyl-CoA.

B-NMQ4 produced more NMQ than B-NMQ2, but synthesized more DHQ (316.2 mg/L) than NMQ (26.1 mg/L). This suggests that pqsD may not be inhibited by the concentration of anthranilate synthesized in E. coli strains, and the conversion of anthranilate to N-methylanthranilate by NMT is likely to be slower than the synthesis of anthranilate. , which resulted in more synthesis of DHQ than NMQ, due to the higher concentration of anthranilate than N-methylanthranilate. Taken together, CmQNS used N-methyl anthranilate more efficiently than anthranilate at low concentrations of the two substrates, but was inhibited by high concentrations, whereas pqsD was superior to CmQNS in converting N-methylanthranilate, but N -Has a higher affinity for anthranilate than for methyl anthranilate. To confirm that CmQNS and pqsD were inhibited by high concentrations of N-methylanthranilate, E. coli carrying pC-pqsD-pqsA with different amounts of N-methylanthranilate was fed, and the synthesis of NMQ was investigated. did. E. coli harboring pC-pqsDpqsA synthesized 20.7 mg/L (118.3 μM) NMQ, which was maximal when 30 mg/L (200 μM) N-methylanthranilate was added to the culture. At 45 and 60 mg/L (300 and 400 μM, respectively) N-methylanthranilate, the titers were 16.3 (92.4 μM) and 14.5 (83.0 μM) mg/L, respectively. NMQ synthesis using E. coli carrying CmQNS reached a maximum at a lower concentration of N-methylanthranilate (15.0 mg/L, ie 100 μM). Based on these results, we used pqsD for the synthesis of NMQ.

To minimize the synthesis of DHQ and maximize the synthesis of NMQ using pqsD, we divided the reaction into three steps: first, synthesis of anthranilate from glucose; Second, the synthesis of N-methylanthranilate from anthranilate; Third, conversion of N-methylanthranilate to NMQ. The strains for steps 1 and 2 were combined in a single culture, but each step was performed on a different E. coli strain. In order to minimize anthranilate accumulation and obtain an optimal amount of N-methylanthranilate, we developed N from E. coli and anthranilate with pC-aroG-trpEG to generate anthranilate from glucose. E. coli carrying pC-NMT was used to produce -methylanthranilate. We tested three ratios of anthranilate to N-methylanthranilate synthesizing cells: 1:1, 1:2 and 1:3, which were 162.4, 62.3 and 32.1 mg/L (1081.9, 415.1 and 213.8 μM) of N-methylanthranilate was obtained. Although the 1:1 ratio resulted in the highest titers, about 9.3 mg/L (67.6 μM) anthranilate remained unreacted. Additionally, the amount of N-methylanthranilate was too high for NMQ synthesis, as it indicated that concentrations higher than 200 μM of N-methylanthranilate decreased the final titer of NMQ. Therefore, we used a 1:2 cell ratio for the synthesis of N-methylanthranilate from glucose. To adjust the N-methylanthranilate concentration at about 200 μM, the culture filtrate containing N-methylanthranilate from above was mixed with a cell suspension containing E. coli containing pC-pqsDpqsA. As a result, the mixture was incubated for 24 hours to synthesize NMQ. It is confirmed that about 17.5 mg/L (99.8 μM) NMQ was synthesized and no DHQ was detected.

We selected ideal genes for each step of 4-HC, DHQ, and NMQ synthesis by providing substrates, designing pathways to increase levels of individual substrates, allowing the reaction to proceed, and repeating this process. . The present inventors confirmed the bottleneck, and maximized the synthesis of the product by controlling the flux of each metabolite. Using this strategy, we succeeded in increasing the final titer of the target compound. Some studies have shown that manipulating promoter strength can optimize synthetic reactions. This approach was useful in balancing substrate production at each step of the pathway. In addition, we introduced different gene combinations to provide optimal concentrations and used plasmids with different copy numbers. The present results showed that these two approaches (i.e., promoter strength regulation, gene combination optimization and use of different copy number plasmids) can be combined to maximize product titer.

Multiculture systems are an efficient way to synthesize natural compounds. The present inventors have adopted this system for synthesizing N-methylanthranilate and extracting the culture filtrate containing the product from N-methylanthranilate to express a gene encoding an enzyme involved in the subsequent step of NMQ synthesis. mixed with cells. This approach, known as a two-culture system, is that metabolites in the pathway inhibit the synthesis of metabolites at later steps and/or downstream enzymes have higher affinity for upstream metabolites than downstream metabolites. Using this method, we synthesized much purer NMQ by preventing the contact between pqsD and anthraniloyl-CoA, thereby minimizing the synthesis of the by-product, DHQ.

A construct containing four genes in the shikimate pathway (aroL, aroG ^f , ppsA and tktA) was ideal for DHQ synthesis, whereas one with three additional genes (aroE, aroD and aroB) was superior to the synthesis of SA. These genes can lead to the accumulation of more chorismates. Although we did not measure the amount of corismate synthesized by the two constructs, this may vary between E. coli carrying each construct. Balancing each intermediate in the pathway is critical to the final product titer. Enzymes downstream of chorismate [isochromate synthase (entC) for SA biosynthesis and anthranilate synthase (trpEG) for anthranilate biosynthesis] have different conversions of chorismate for the synthesis of the corresponding products. Thus, each pathway requires different amounts of chorismate, as different gene combinations for chorismate synthesis are likely required for the synthesis of SA and DHQ.

Consequently, these results demonstrate that it is possible to use biological approaches to synthesize valuable natural compounds that can save time and money, as well as dependence on fossil fuels and other resources.

The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> Konkuk University Industrial Cooperation Corp <120> Esherichia coli TRANSFORMANT AND METHOD FOR PRODUCING CUMARIN-BASED OR QUINOLINE-BASED COMPOUND USING THE SAME <130> 1066964 <160> 17 <170> KoPatentIn 3.0 <210> 1 <211> 1595 <212> DNA <213> Escherichia coli <400> 1 tggctgacat tctgctgctc gataatatcg actcttttac gtacaacctg gcagatcagt 60 tgcgcagcaa tgggcataat gtggtgattt accgcaacca tattccggcg cagaccttaa 120 ttgaacgcct ggcgacgatg agcaatccgg tactgatgct ttctcctggc cccggtgtgc 180 cgagcgaagc cggttgtatg ccggaactcc tcacccgctt gcgtggcaag ctgcccatta 240 ttggcatttg cctcggacat caggcaattg tcgaagctta cgggggctat gtcggtcagg 300 cgggcgaaat tcttcacggt aaagcgtcga gcattgaaca tgacggtcag gcgatgtttg 360 ccggattaac aaacccgctg ccggtggcgc gttatcactc gctggttggc agtaacattc 420 cggccggttt aaccatcaac gcccatttta atggcatggt gatggcagta cgtcacgatg 480 cggatcgcgt ttgtggattc cagttccatc cggaatccat tctcaccacc cagggcgctc 540 gcctgctgga acaaacgctg gcctgggcgc agcagaaact agagccagcc aacacgctgc 600 aaccgattct ggaaaaactg tatcaggcgc agacgcttag ccaacaagaa agccaccagc 660 tgttttcagc ggtggtgcgt ggcgagctga agccggaaca actggcggcg gcgctggtga 720 gcatgaaaat tcgcggtgag cacccgaacg agatcgccgg agcagcaacc gcgctactgg 780 aaaacgccgc gccgttcccg cgcccggatt atctgtttgc tgatatcgtc ggtactggcg 840 gtgacggcag caacagtatc aatatttcta ccgccagtgc gtttgtcgcc gcggcctgtg 900 ggctgaaagt ggcgaaacac ggcaaccgta gcgtctccag taaatctggt tcgtccgatc 960 tgctggcggc gttcggtatt aatcttgata tgaacgccga taaatcgcgc caggcgctgg 1020 atgagttagg tgtatgtttc ctctttgcgc cgaagtatca caccggattc cgccacgcga 1080 tgccggttcg ccagcaactg aaaacccgca ccctgttcaa tgtgctgggg ccattgatta 1140 acccggcgca tccgccgctg gcgttaattg gtgtttatag tccggaactg gtgctgccga 1200 ttgccgaaac cttgcgcgtg ctggggtatc aacgcgcggc ggtggtgcac agcggcggga 1260 tggatgaagt ttcattacac gcgccgacaa tcgttgccga gctgcatgac ggcgaaatta 1320 agagctatca attgaccgct gaagattttg gcctgactcc ctaccaccag gagcaactgg 1380 caggcggaac accggaagaa aaccgtgaca ttttaacacg cttgttacaa ggtaaaggcg 1440 acgccgccca tgaagcagcc gtcgctgcga acgtcgccat gttaatgcgc ctgcatggcc 1500 atgaagatct gcaagccaat gcgcaaaccg ttcttgaggt actgcgcagt ggttccgctt 1560 acgacagagt taccgcactg gcggcacgag ggtaa 1595 <210> 2 <211> 1143 <212> DNA <213> Escherichia coli <400> 2 atggttgctg aattgaccgc attacgcgat caaattgatg aagtcgataa agcgctgctg 60 aatttattag cgaagcgtct ggaactggtt gctgaagtgg gcgaggtgaa aagccgcttt 120 ggactgccta tttatgttcc ggagcgcgag gcatctatgt tggcctcgcg tcgtgcagag 180 gcggaagctc tgggtgtacc gccagatctg attgaggatg ttttgcgtcg ggtgatgcgt 240 gaatcttact ccagtgaaaa cgacaaagga tttaaaacac tttgtccgtc actgcgtccg 300 gtggttatcg tcggcggtgg cggtcagatg ggacgcctgt tcgagaagat gctgaccctc 360 tcgggttatc aggtgcggat tctggagcaa catgactggg atcgagcggc tgatattgtt 420 gccgatgccg gaatggtgat tgttagtgtg ccaatccacg ttactgagca agttattggc 480 aaattaccgc ctttaccgaa agattgtatt ctggtcgatc tggcatcagt gaaaaatggg 540 ccattacagg ccatgctggt ggcgcatgat ggtccggtgc tggggctaca cccgatgttc 600 ggtccggaca gcggtagcct ggcaaagcaa gttgtggtct ggtgtgatgg acgtaaaccg 660 gaagcatacc aatggtttct ggagcaaatt caggtctggg gcgctcggct gcatcgtatt 720 agcgccgtcg agcacgatca gaatatggcg tttattcagg cactgcgcca ctttgctact 780 tttgcttacg ggctgcacct ggcagaagaa aatgttcagc ttgagcaact tctggcgctc 840 tcttcgccga tttaccgcct tgagctggcg atggtcgggc gactgtttgc tcaggatccg 900 cagctttatg ccgacatcat tatgtcgtca gagcgtaatc tggcgttaat caaacgttac 960 tataagcgtt tcggcgaggc gattgagttg ctggagcagg gcgataagca ggcgtttatt 1020 gacagtttcc gcaaggtgga gcactggttc ggcgattacg cacagcgttt tcagagtgaa 1080 agccgcgtgt tattgcgtca ggcgaatgac aatcgccagt aagcgaatga caaccgccag 1140 taa 1143 <210> 3 <211> 1014 <212> DNA <213> Pseudomonas aeruginosa <400> 3 atgggtaatc cgatcctggc cgggctgggt ttcagcctgc cgaaacgcca ggtcagcaat 60 catgacctgg tagggcgcat caatacgtcg gacgagttca tcgtcgaacg taccggcgtg 120 cgcacccgct atcacgtcga gccggaacag gcggtcagcg cgctgatggt gccggcggcg 180 cgccaggcca tcgaggctgc cgggctgctg ccggaggaca tcgacctgtt gctggtgaac 240 accctgtcgc cggaccacca cgacccgtcc caggcctgcc tgatccagcc gctgctgggc 300 ctgcggcaca tcccggtact ggatatccgg gcacagtgca gcgggttgct gtacggcttg 360 cagatggctc gcgggcagat cctcgccggg ctggcacggc atgtcctggt ggtctgcggc 420 gaggtgctgt ccaagcgcat ggactgttcg gaccgcggcc gcaacctgtc gatcctgctc 480 ggcgacggtg ccggcgcagt ggtggtcagc gccggcgaga gtctcgaaga cggactgctg 540 gacctgcgcc tgggcgccga cggcaactac ttcgacctgc tgatgaccgc ggcgccgggt 600 agtgcctcgc cgaccttcct cgacgagaat gtcctgcgcg agggcggggg cgagttcctc 660 atgcgcggcc ggccgatgtt cgagcatgcc agccagaccc tggtacggat cgccggcgaa 720 atgctcgcgg cccatgagct gaccctggac gacatcgacc atgtgatctg ccatcaaccg 780 aacctgcgca tcctcgatgc ggtgcaggag caactgggca ttccccagca caagttcgcg 840 gtgaccgtgg atcgtctggg caacatggct tcggcctcga ccccggtcac gctggcgatg 900 ttctggccgg acatccagcc gggacagcgg gtgctggtcc tgacctacgg ctccggcgcg 960 acctggggcg cggcgctgta ccgcaaacct gaggaggtga accggccatg ttga 1014 <210> 4 <211> 1554 <212> DNA <213> Pseudomonas aeruginosa <400> 4 atgtccacat tggccaacct gaccgaggtt ctgttccgcc tcgatttcga tcccgatacc 60 gccgtttatc actatcgggg ccagactctc agccggctgc aatgccggac ctacattctc 120 tcccaggcca gccaactggc ccgcctgctc aagcccggcg atcgcgtggt gctggcgttg 180 aacgactcgc cttcgctggc ctgcctgttc ctggcctgca tcgcggtcgg cgccattccc 240 gccgtgatca atcccaagtc ccgcgagcag gccctggccg atatcgctgc cgactgccag 300 gccagcctgg tggtgcgtga agccgatgca ccgtcgctga gcggtccttt ggcgccgttg 360 accctgcgtg cggccgccgg acgccctttg ctcgacgatt tctcgctgga cgcgctggtc 420 ggccctgcgg acctcgattg gagtgccttc catcgccagg acccggcggc agcctgtttc 480 ctgcaataca cctcgggttc caccggggcg cccaaggggg tgatgcacag cctgcgcaac 540 acgctcggtt tctgccgggc gttcgctacg gagttgctgg cattgcaggc gggagaccgg 600 ctgtattcga ttcccaagat gttcttcggc tatggcatgg gcaacagcct gttctttccc 660 tggttcagcg gagcctcggc gctgctcgac gatacctggc cgagcccgga gcgggttctg 720 gagaacctgg tcgccttccg cccccgggtc ctgtttgggg tgccggccat ctatgcctcg 780 ctgcgtccgc aggccaggga gctgttgagc agcgtgcgcc tggcgttttc cgccggctcg 840 ccgctgccgc gcggcgagtt cgaattctgg gccgcgcacg ggctggagat ctgcgacggc 900 atcggggcta ccgaggtcgg ccatgtgttc ctcgccaacc gcccgggcca ggcgcgtgcc 960 gacagcaccg ggctgccgtt gcctggctat gagtgccggc tggtggaccg cgaaggacac 1020 actatcgagg aagcgggccg gcaaggcgtg ctgttggtgc gtggcccagg gctgagtccg 1080 ggttactggc gggccagcga agagcagcag gcgcgcttcg caggtggctg gtaccgcacc 1140 ggcgacctgt tcgagcgcga cgagtcgggt gcctaccgtc actgtgggcg ggaagacgat 1200 ctgttcaagg tgaatggccg ctgggtggtg ccgacccagg tcgagcaggc gatctgccgt 1260 catctgccgg aagtgagcga ggcggttctg gttcctacct gccggctgca cgacggcttg 1320 cgtccgaccc tgttcgtcac cctggccact ccgctggacg acaaccagat cctgctggcg 1380 cagcgcatcg accagcatct cgccgaacag attccctcgc acagctgcc cagccaattg 1440 catgtgctgc cggccttgcc gcgcaacgac aacggcaagt tggcgcgcgc cgagctgcgc 1500 cacctggccg acacccttta tcacgacaac cttccggagg aacgggcatg ttga 1554 <210> 5 <211> 960 <212> DNA <213> Photorhabdus luminescens <400> 5 atgagtctga attttcttga atttgaacag ccgattgccg agctggaagc gaaaattgat 60 tcgctaaccg cagttagccg tcaaggtgaa aaattagata taaatctgga tgaagaagta 120 caacgtttgc gggaaaaaag tctggaattg actcgcaaaa tcttttcaga tttaggtgcc 180 tggcaaattg ctcagcttgc tcgtcaccca cgtcgtcctt atacgttgga ctatattcag 240 catattttta ctgattttga agagcttgct ggtgatcgtg cttatgctga tgacaaagca 300 attgtgggtg gtctggctcg tattgatgga cgtccagtga tggtgattgg tcaccaaaaa 360 ggccgtgaaa ccaaagaaaa aattcgccgt aatttcggta tgccagcgcc agaaggttat 420 cgtaaagctt tgcgcctgat ggaaatggca gagcgtttta aactgccaat tattactttc 480 attgatactc ctggtgcata tcctggggtt ggtgcagaag aacgtggtca atctgaggcg 540 atagctcgca acttgcgtga aatgtcccgc ctgtctgtgc ctgttatttg tactgtgatt 600 ggtgaaggtg gctctggtgg tgcattggcg attggtgttg gtgataaagt gaatatgctg 660 caatatagta cttattctgt tatctcccca gaaggttgtg cctcaatttt gtggaaaagc 720 gcggaaaaag cacctttggc ggcagaagct atggggatca ctgctcctcg tttgaaagag 780 ttggagttgg tcgatactgt gatttcagag ccattaggtg gtgctcatcg tgactatgaa 840 gcaatatcca cgtcgttgaa agctcagttg ttgattgacc tggcagagct tgatcatttg 900 acatctgaag aattagtcaa ccgccgatat cagcgcttga tgcaatatgg ttattgctga 960 960 <210> 6 <211> 1833 <212> DNA <213> Photorhabdus luminescens <400> 6 atggatattc gtaagataaa aaaactgatc gagctggttg aagaatctgg catttctgaa 60 ctggaaattt ctgaagggga agagtcagtg cgcatcagcc gcgcattagc tccccagagt 120 tttccggcag ctcaacaata tattcccgtt caagcacaac aacctgcgct ggctaatgtt 180 gttgcgcctt ctcaagctct accagaagcg atcagcagca gatcggctgc aatcgacggt 240 cacgttgttc gttccccaat ggtaggtacc ttctatcgta cacctagccc agatgcgaaa 300 ccatttatcg aaatcggcca gcgtgtcaat gtgggtgaca ccctatgcat cgttgaagca 360 atgaaaatga tgaatcagat cgaagccgac aaagcaggtg tggttaaaaa gattcttgtg 420 gaaagcggtc aacccgttga atttgacgag ccattagtcg tcatcgaata acgaggcgtt 480 cccatgcttg ataaaattgt aattgctaac cgtggtgaaa ttgccctgcg tatcctacga 540 gcttgtaaag agttggggat caaaaccgtt gcggtacatt cctccgcgga tcgtgactta 600 aaacacgtac tgctggcaga cgaaactatc tgtattggcc cggcagcttc tgcaaaaagc 660 tacctgaata tcccggcaat tatttctgcg gcagaaatca cgggtgctgt ggctattcac 720 cctggctacg gttttctatc tgaaaatgca gattttgctg aacaggttga gcgttctggc 780 tttattttta tcggcccaaa agcagaaacg atccgcctga tgggtgataa agtttctgct 840 atcaatgcga tgaaaaaagc aggcgttcct tgtgtacctg gctctgatgg cccattgtct 900 gatgacacgg agaaaaacaa agccttcgct aaacgcattg gctatcctgt catcatcaaa 960 gcatccggcg gcggcggcgg tcgcggtatg cgcgtcgtcc gcagtgataa agatctggaa 1020 caatcaatca atatgacccg tgcggaagca aaagctgctt tcaataacga tatggtttac 1080 atggaaaaat tccttgagaa tccacgtcat attgagatcc aagtattggc tgacggccaa 1140 ggtcaagcaa tttatctggc tgagcgtgat tgctccatgc aacgccgtca ccagaaagtt 1200 gtcgaagaag cccctgcacc aggaatcacg ccagaaatgc gtcgcagtat tggtgaacgc 1260 tgtgctaacg catgtatcga aattggctat cgtggtgccg gtactttcga attcctgtat 1320 gaaaacggtg aattctattt cattgagatg aatacccgta ttcaggttga acatccagtt 1380 acggaaatga ttaccggtgt tgatctgatt aaagagcagt tgcggattgc cgcaggtatg 1440 ccactttcaa ttaagcagaa agatgttgtt attcgtggtc acgctattga atgtcgtatc 1500 aatgccgaag atccgaacac attcctgcca agcccaggta aaattacccg cttccactcg 1560 ccgggtggat ttggtgtgcg ttgggaatcg catatttatg ctggctacac cgttccccct 1620 tactatgatt caatgattgg taagctgatt acttacggtg aaaatcgtga caatgccatt 1680 gcccgcatga aaaatgcatt ggcagaattg atcattgatg gcatcaagac aaatatcgag 1740 cttcaacagg cgataatgaa tgatgaaaac tttcagaatg gcggtactaa tatccactat 1800 ctggagaaaa aactggggtt acaggaaact taa 1833 <210> 7 <211> 945 <212> DNA <213> Photorhabdus luminescens <400> 7 atgagctgga ttgaaaaaat tcttaataaa agcaacatta cccaaacgcg taaagcgaat 60 atcccagaag gggtttggac taaatgtgat agttgcagtc aggtgctcta ccgtgctgag 120 ctagagcgca atcttgaggt ttgccctaaa tgtgatcatc acatgcgtat ttcggcgcgt 180 acccgattgg ctacattcct tgatgaagga gcaacgacgg aattaggggg ggaattagag 240 ccaaaagata ttcttaaatt ccgcgattcc aaaaagtata aagatcgtat atcagcggcg 300 cagaagcaaa cccaagaaaa agatgcgtta gtcgtgatga aaggtaccct gagtggtatg 360 tcagttgttg ctgctgcttt tgaatttgca tttatgggcg gttctatggc ttcggttgtt 420 ggtgcccgtt ttgtccgtgc cgtagaacag gcgttggcag acaattgtcc tctgatttgt 480 ttttcttcca gtggtggcgc tcgtatgcaa gaagcattga tgtcactgat gcagatggcg 540 aaaaccagtg ctgctttagc aaaaatgcag gaacgtggtt tgccttatat ctctatcatg 600 accgatccga caatgggcgg tgtttcagca agtctggcga tgttgggtga tatcaatatt 660 gctgaaccaa aagcattgat tggttttgcc gggccacgag tgattgagca gactgttcgt 720 gaaaaattac cgtccggttt ccagcgtagt gagtttttgc tggcaaaggg agcgattgac 780 atgattgttc gtcgtcctga aatgcgtgac acacttgcaa gtttactttc taaactaact 840 catcagtcgc agccaggtac taagccaatt gttgctgaat ttgtggcaga acccgctgat 900 gttgaggcgg atattcaaat aagtaccaat aaagaagatg cctga 945 <210> 8 <211> 525 <212> DNA <213> Escherichia coli <400> 8 atgacacaac ctctttttct gatcgggcct cggggctgtg gtaaaacaac ggtcggaatg 60 gcccttgccg attcgcttaa ccgtcggttt gtcgataccg atcagtggtt gcaatcacag 120 ctcaatatga cggtcgcgga gatcgtcgaa agggaagagt gggcgggatt tcgcgccaga 180 gaaacggcgg cgctggaagc ggtaactgcg ccatccaccg ttatcgctac aggcggcggc 240 attattctga cggaatttaa tcgtcacttc atgcaaaata acgggatcgt ggtttatttg 300 tgtgcgccag tatcagtcct ggttaaccga ctgcaagctg caccggaaga agatttacgg 360 ccaaccttaa cgggaaaacc gctgagcgaa gaagttcagg aagtgctgga agaacgcgat 420 gcgctatatc gcgaagttgc gcatattatc atcgacgcaa caaacgaacc cagccaggtg 480 atttctgaaa ttcgcagcgc cctggcacag acgatcaatt gttga 525 <210> 9 <211> 819 <212> DNA <213> Escherichia coli <400> 9 atggaaacct atgctgtttt tggtaatccg atagcccaca gcaaatcgcc attcattcat 60 cagcaatttg ctcagcaact gaatattgaa catccctatg ggcgcgtgtt ggcacccatc 120 aatgatttca tcaacacact gaacgctttc tttagtgctg gtggtaaagg tgcgaatgtg 180 acggtgcctt ttaaagaaga ggcttttgcc agagcggatg agcttactga acgggcagcg 240 ttggctggtg ctgttaatac cctcatgcgg ttagaagatg gacgcctgct gggtgacaat 300 accgatggtg taggcttgtt aagcgatctg gaacgtctgt cttttatccg ccctggttta 360 cgtattctgc ttatcggcgc tggtggagca tctcgcggcg tactactgcc actcctttcc 420 ctggactgtg cggtgacaat aactaatcgg acggtatccc gcgcggaaga gttggctaaa 480 ttgtttgcgc acactggcag tattcaggcg ttgagtatgg acgaactgga aggtcatgag 540 tttgatctca ttattaatgc aacatccagt ggcatcagtg gtgatattcc ggcgatcccg 600 tcatcgctca ttcatccagg catttattgc tatgacatgt tctatcagaa aggaaaaact 660 ccttttctgg catggtgtga gcagcgaggc tcaaagcgta atgctgatgg tttaggaatg 720 ctggtggcac aggcggctca tgcctttctt ctctggcacg gtgttctgcc tgacgtagaa 780 ccagttataa agcaattgca ggaggaattg tccgcgtga 819 <210> 10 <211> 759 <212> DNA <213> Escherichia coli <400> 10 atgaaaaccg taactgtaaa agatctcgtc attggtacgg gcgcacctaa aatcatcgtc 60 tcgctgatgg cgaaagatat cgccagcgtg aaatccgaag ctctcgccta tcgtgaagcg 120 gactttgata ttctggaatg gcgtgtggac cactatgccg acctctccaa tgtggagtct 180 gtcatggcgg cagcaaaaat tctccgtgag accatgccag aaaaaccgct gctgtttacc 240 ttccgcagtg ccaaagaagg cggcgagcag gcgatttcca ccgaggctta tattgcactc 300 aatcgtgcag ccatcgacag cggcctggtt gatatgatcg atctggagtt atttaccggt 360 gatgatcagg ttaaagaaac cgtcgcctac gcccacgcgc atgatgtgaa agtagtcatg 420 tccaaccatg acttccataa aacgccggaa gccgaagaaa tcattgcccg tctgcgcaaa 480 atgcaatcct tcgacgccga tattcctaag attgcgctga tgccgcaaag taccagcgat 540 gtgctgacgt tgcttgccgc gaccctggag atgcaggagc agtatgccga tcgtccaatt 600 atcacgatgt cgatggcaaa aactggcgta atttctcgtc tggctggtga agtatttggc 660 tcggcggcaa cttttggtgc ggtaaaaaaa gcgtctgcgc cagggcaaat ctcggtaaat 720 gatttgcgca cggtattaac tattttacac caggcataa 759 <210> 11 <211> 1089 <212> DNA <213> Escherichia coli <400> 11 atggagagga ttgtcgttac tctcggggaa cgtagttacc caattaccat cgcatctggt 60 ttgtttaatg aaccagcttc attcttaccg ctgaaatcgg gcgagcaggt catgttggtc 120 accaacgaaa ccctggctcc tctgtatctc gataaggtcc gcggcgtact tgaacaggcg 180 ggtgttaacg tcgatagcgt tatcctccct gacggcgagc agtataaaag cctggctgta 240 ctcgataccg tctttacggc gttgttacaa aaaccgcatg gtcgcgatac tacgctggtg 300 gcgcttggcg gcggcgtagt gggcgatctg accggcttcg cggcggcgag ttatcagcgc 360 ggtgtccgtt tcattcaagt cccgacgacg ttactgtcgc aggtcgattc ctccgttggc 420 ggcaaaactg cggtcaacca tcccctcggt aaaaacatga ttggcgcgtt ctaccaacct 480 gcttcagtgg tggtggatct cgactgtctg aaaacgcttc ccccgcgtga gttagcgtcg 540 gggctggcag aagtcatcaa atacggcatt attcttgacg gtgcgttttt taactggctg 600 gaagagaatc tggatgcgtt gttgcgtctg gacggtccgg caatggcgta ctgtattcgc 660 cgttgttgtg aactgaaggc agaagttgtc gccgccgacg agcgcgaaac cgggttacgt 720 gctttactga atctgggaca cacctttggt catgccattg aagctgaaat ggggtatggc 780 aattggttac atggtgaagc ggtcgctgcg ggtatggtga tggcggcgcg gacgtcggaa 840 cgtctcgggc agtttagttc tgccgaaacg cagcgtatta taaccctgct caagcgggct 900 gggttaccgg tcaatgggcc gcgcgaaatg tccgcgcagg cgtatttacc gcatatgctg 960 cgtgacaaga aagtccttgc gggagagatg cgcttaattc ttccgttggc aattggtaag 1020 agtgaagttc gcagcggcgt ttcgcacgag cttgttctta acgccattgc cgattgtcaa 1080 tcagcgtaa 1089 <210> 12 <211> 1053 <212> DNA <213> Escherichia coli <400> 12 atgaattatc agaacgacga tttacgcatc aaagaaatca aagagttact tcctcctgtc 60 gcattgctgg aaaaattccc cgctactgaa aatgccgcga atacggttgc ccatgcccga 120 aaagcgatcc ataagatcct gaaaggtaat gatgatcgcc tgttggttgt gattggccca 180 tgctcaattc atgatcctgt cgcggcaaaa gagtatgcca ctcgcttgct ggcgctgcgt 240 gaagagctga aagatgagct ggaaatcgta atgcgcgtct attttgaaaa gccgcgtacc 300 acggtgggct ggaaagggct gattaacgat ccgcatatgg ataatagctt ccagatcaac 360 gacggtctgc gtatagcccg taaattgctg cttgatatta acgacagcgg tctgccagcg 420 gcaggtgagt ttctcaatat gatcacccca caatatctcg ctgacctgat gagctggggc 480 gcaattggcg cacgtaccac cgaatcgcag gtgcaccgcg aactggcatc agggctttct 540 tgtccggtcg gcttcaaaaa tggcaccgac ggtacgatta aagtggctat cgatgccatt 600 aatgccgccg gtgcgccgca ctgcttcctg tccgtaacga aatgggggca ttcggcgatt 660 gtgaatacca gcggtaacgg cgattgccat atcattctgc gcggcggtaa agagcctaac 720 tacagcgcga agcacgttgc tgaagtgaaa gaagggctga acaaagcagg cctgccagca 780 caggtgatga tcgatttcag ccatgctaac tcgtccaaac aattcaaaaa gcagatggat 840 gtttgtgctg acgtttgcca gcagattgcc ggtggcgaaa aggccattat tggcgtgatg 900 gtggaaagcc atctggtgga aggcaatcag agcctcgaga gcggggagcc gctggcctac 960 ggtaagagca tcaccgatgc ctgcatcggc tgggaagata ccgatgctct gttacgtcaa 1020 ctggcgaatg cagtaaaagc gcgtcgcggg taa 1053 <210> 13 <211> 2379 <212> DNA <213> Escherichia coli <400> 13 atgtccaaca atggctcgtc accgctggtg ctttggtata accaactcgg catgaatgat 60 gtagacaggg ttgggggcaa aaatgcctcc ctgggtgaaa tgattactaa tctttccgga 120 atgggtgttt ccgttccgaa tggtttcgcc acaaccgccg acgcgtttaa ccagtttctg 180 gaccaaagcg gcgtaaacca gcgcatttat gaactgctgg ataaaacgga tattgacgat 240 gttactcagc ttgcgaaagc gggcgcgcaa atccgccagt ggattatcga cactcccttc 300 cagcctgagc tggaaaacgc catccgcgaa gcctatgcac agctttccgc cgatgacgaa 360 aacgcctctt ttgcggtgcg ctcctccgcc accgcagaag atatgccgga cgcttctttt 420 gccggtcagc aggaaacctt cctcaacgtt cagggttttg acgccgttct cgtggcagtg 480 aaacatgtat ttgcttctct gtttaacgat cgcgccatct cttatcgtgt gcaccagggt 540 tacgatcacc gtggtgtggc gctctccgcc ggtgttcaac ggatggtgcg ctctgacctc 600 gcatcatctg gcgtgatgtt ctccattgat accgaatccg gctttgacca ggtggtgttt 660 atcacttccg catggggcct tggtgagatg gtcgtgcagg gtgcggttaa cccggatgag 720 ttttacgtgc ataaaccgac actggcggcg aatcgcccgg ctatcgtgcg ccgcaccatg 780 gggtcgaaaa aaatccgcat ggtttacgcg ccgacccagg agcacggcaa gcaggttaaa 840 atcgaagacg taccgcagga acagcgtgac atcttctcgc tgaccaacga agaagtgcag 900 gaactggcaa aacaggccgt acaaattgag aaacactacg gtcgcccgat ggatattgag 960 tgggcgaaag atggccacac cggtaaactg ttcattgtgc aggcgcgtcc ggaaaccgtg 1020 cgctcacgcg gtcaggtcat ggagcgttat acgctgcatt cacagggtaa gattatcgcc 1080 gaaggccgtg ctatcggtca tcgcatcggt gcgggtccgg tgaaagtcat ccatgacatc 1140 agcgaaatga accgcatcga acctggcgac gtgctggtta ctgacatgac cgacccggac 1200 tgggaaccga tcatgaagaa agcatctgcc atcgtcacca accgtggcgg tcgtacctgt 1260 cacgcggcga tcatcgctcg tgaactgggc attccggcgg tagtgggctg tggagatgca 1320 acagaacgga tgaaagacgg tgagaacgtc actgtttctt gtgccgaagg tgataccggt 1380 tacgtctatg cggagttgct ggaatttagc gtgaaaagct ccagcgtaga aacgatgccg 1440 gatctgccgt tgaaagtgat gatgaacgtc ggtaacccgg accgtgcttt cgacttcgcc 1500 tgcctaccga acgaaggcgt gggccttgcg cgtctggaat ttatcatcaa ccgtatgatt 1560 ggcgtccacc cacgcgcact gcttgagttt gacgatcagg aaccgcagtt gcaaaacgaa 1620 atccgcgaga tgatgaaagg ttttgattct ccgcgtgaat tttacgttgg tcgtctgact 1680 gaagggatcg cgacgctggg tgccgcgttt tatccgaagc gcgtcattgt ccgtctctct 1740 gattttaaat cgaacgaata tgccaacctg gtcggtggtg agcgttacga gccagatgaa 1800 gagaacccga tgctcggctt ccgtggcgcg ggccgctatg tttccgacag cttccgcgac 1860 tgtttcgcgc tggagtgtga agcagtgaaa cgtgtgcgca acgacatggg actgaccaac 1920 gttgagatca tgatcccgtt cgtgcgtacc gtagatcagg cgaaagcggt ggttgaagaa 1980 ctggcgcgtc aggggctgaa acgtggcgag aacgggctga aaatcatcat gatgtgtgaa 2040 atcccgtcca acgccttgct ggccgagcag ttcctcgaat atttcgacgg cttctcaatt 2100 ggctcaaacg atatgacgca gctggcgctc ggtctggacc gtgactccgg cgtggtgtct 2160 gaattgttcg atgagcgcaa cgatgcggtg aaagcactgc tgtcgatggc tatccgtgcc 2220 gcgaagaaac agggcaaata tgtcgggatt tgcggtcagg gtccgtccga ccacgaagac 2280 tttgccgcat ggttgatgga agaggggatc gatagcctgt ctctgaaccc ggacaccgtg 2340 gtgcaaacct ggttaagcct ggctgaactg aagaaataa 2379 <210> 14 <211> 1992 <212> DNA <213> Escherichia coli <400> 14 atgtcctcac gtaaagagct tgccaatgct attcgtgcgc tgagcatgga cgcagtacag 60 aaagccaaat ccggtcaccc gggtgcccct atgggtatgg ctgacattgc cgaagtcctg 120 tggcgtgatt tcctgaaaca caacccgcag aatccgtcct gggctgaccg tgaccgcttc 180 gtgctgtcca acggccacgg ctccatgctg atctacagcc tgctgcacct caccggttac 240 gatctgccga tggaagaact gaaaaacttc cgtcagctgc actctaaaac tccgggtcac 300 ccggaagtgg gttacaccgc tggtgtggaa accaccaccg gtccgctggg tcagggtatt 360 gccaacgcag tcggtatggc gattgcagaa aaaacgctgg cggcgcagtt taaccgtccg 420 ggccacgaca ttgtcgacca ctacacctac gccttcatgg gcgacggctg catgatggaa 480 ggcatctccc acgaagtttg ctctctggcg ggtacgctga agctgggtaa actgattgca 540 ttctacgatg acaacggtat ttctatcgat ggtcacgttg aaggctggtt caccgacgac 600 accgcaatgc gtttcgaagc ttacggctgg cacgttattc gcgacatcga cggtcatgac 660 gcggcatcta tcaaacgcgc agtagaagaa gcgcgcgcag tgactgacaa accttccctg 720 ctgatgtgca aaaccatcat cggtttcggt tccccgaaca aagccggtac ccacgactcc 780 cacggtgcgc cgctgggcga cgctgaaatt gccctgaccc gcgaacaact gggctggaaa 840 tatgcgccgt tcgaaatccc gtctgaaatc tatgctcagt gggatgcgaa agaagcaggc 900 caggcgaaag aatccgcatg gaacgagaaa ttcgctgctt acgcgaaagc ttatccgcag 960 gaagccgctg aatttacccg ccgtatgaaa ggcgaaatgc cgtctgactt cgacgctaaa 1020 gcgaaagagt tcatcgctaa actgcaggct aatccggcga aaatcgccag ccgtaaagcg 1080 tctcagaatg ctatcgaagc gttcggtccg ctgttgccgg aattcctcgg cggttctgct 1140 gacctggcgc cgtctaacct gaccctgtgg tctggttcta aagcaatcaa cgaagatgct 1200 gcgggtaact acatccacta cggtgttcgc gagttcggta tgaccgcgat tgctaacggt 1260 atctccctgc acggtggctt cctgccgtac acctccacct tcctgatgtt cgtggaatac 1320 gcacgtaacg ccgtacgtat ggctgcgctg atgaaacagc gtcaggtgat ggtttacacc 1380 cacgactcca tcggtctggg cgaagacggc ccgactcacc agccggttga gcaggtcgct 1440 tctctgcgcg taaccccgaa catgtctaca tggcgtccgt gtgaccaggt tgaatccgcg 1500 gtcgcgtgga aatacggtgt tgagcgtcag gacggcccga ccgcactgat cctctcccgt 1560 cagaacctgg cgcagcagga acgaactgaa gagcaactgg caaacatcgc gcgcggtggt 1620 tatgtgctga aagactgcgc cggtcagccg gaactgattt tcatcgctac cggttcagaa 1680 gttgaactgg ctgttgctgc ctacgaaaaa ctgactgccg aaggcgtgaa agcgcgcgtg 1740 gtgtccatgc cgtctaccga cgcatttgac aagcaggatg ctgcttaccg tgaatccgta 1800 ctgccgaaag cggttactgc acgcgttgct gtagaagcgg gtattgctga ctactggtac 1860 aagtatgttg gcctgaacgg tgctatcgtc ggtatgacca ccttcggtga atctgctccg 1920 gcagagctgc tgtttgaaga gttcggcttc actgttgata acgttgttgc gaaagcaaaa 1980 gaactgctgt aa 1992 <210> 15 <211> 1176 <212> DNA <213> Escherichia coli <400> 15 atggatacgt cactggctga ggaagtacag cagaccatgg caacacttgc gcccaatcgc 60 tttttcttta tgtcgccgta ccgcagtttt acgacgtcag gatgtttcgc ccgcttcgat 120 gaaccggctg tgaacgggga ttcgcccgac agtcccttcc agcaaaaact cgccgcgctg 180 tttgccgatg ccaaagcgca gggcatcaaa aatccggtga tggtcggggc gattcccttc 240 gatccacgtc agccttcgtc gctgtatatt cctgaatcct ggcagtcgtt ctcccgtcag 300 gaaaaacaag cttccgcacg ccgtttcacc cgcagccagt cgctgaatgt ggtggaacgc 360 caggcaattc cggagcaaac cacgtttgaa cagatggttg cccgcgccgc cgcacttacc 420 gccacgccgc aggtcgacaa agtggtgttg tcacggttga ttgatatcac cactgacgcc 480 gccattgata gtggcgtatt gctggaacgg ttgattgcgc aaaacccggt tagttacaac 540 ttccatgttc cgctggctga tggtggcgtc ctgctggggg ccagcccgga actgctgcta 600 cgtaaagacg gcgagcgttt tagctccatt ccgttagccg gttccgcgcg tcgtcagccg 660 gatgaagtgc tcgatcgcga agcaggtaat cgtctgctgg cgtcagaaaa agatcgccat 720 gaacatgaac tggtgactca ggcgatgaaa gaggtactgc gcgaacgcag tagtgagtta 780 cacgttcctt cttctccaca gctgatcacc acgccgacgc tgtggcatct cgcaactccc 840 tttgaaggta aagcgaattc gcaagaaaac gcactgactc tggcctgtct gctgcatccg 900 acccccgcgc tgagcggttt cccgcatcag gccgcgaccc aggttattgc tgaactggaa 960 ccgttcgacc gcgaactgtt tggcggcatt gtgggttggt gtgacagcga aggtaacggc 1020 gaatgggtgg tgaccatccg ctgcgcgaag ctgcgggaaa atcaggtgcg tctgtttgcc 1080 ggagcgggga ttgtgcctgc gtcgtcaccg ttgggtgagt ggcgcgaaac aggcgtcaaa 1140 ctttctacca tgttgaacgt ttttggattg cattaa 1176 <210> 16 <211> 1443 <212> DNA <213> Pseudomonas aeruginosa <400> 16 atgaccgtga acgcgagtat tttttggtac gactacgaaa ccaccggcat cgaccctcgc 60 cgcgaccggc cgttgcagat cgccgggatc cgcacggacg aggcgctgaa cgagatcggc 120 gagccgatga acctgtattg ccgtcccagc gacgatatcc tgccccaccc tatggcttgc 180 ctgatcaccg gcatcactcc ccagcggctg gccgagcggg ggctgtccga ggccgacttc 240 atgacccggg tacacgccca gctggcgcag ccggcgacct gcgtggccgg ctacaactcc 300 ctgcgcttcg acgacgaagt gacgcgctac agcctgtacc gcaacttctt cgatccctac 360 gcccgcgagt ggcaaggcgg caatagccgc tgggacctga tcgacatggt ccgtaccgcc 420 tatgccctgc gcccggaggg catccagtgg ccgcagctgg acggccggct gtcgctgaag 480 ctggaaatgc tcaccgcggc gaacggcctg gagcatgggc aggcccacga cgcgctttcc 540 gatgtccgcg ccaccattgc cctggcccgc ctgatccgtc agcgccagcc gcgcctgtac 600 gattacctct accagttgcg cagcaagcac aaggtgctcg accaggtgcg cctgctgcag 660 ccgctggtgc atgtctccgg acgcttttcc gcggagcgcc atttcctctc ggtggtcctg 720 ccgctggcct ggcacccgcg caaccgcaat gctctgatcg tctgcgacct ctgcgccgat 780 cccgcgccgc tgctggagtt gtcggccgaa gacttgcgca ggcgcctgta tacccgtcgc 840 gacgaactgg ccgagggcga gttgccggtg ccgctgaagc agatccaggt caaccgttgc 900 ccggtggtgg cgccgctgtc ggtattgcgc gccgaggatc gccagcgaac cggcatcgaa 960 ctcgatgagt gccagcaaaa agccgagctg ttgcgccagc atcaaaccgt ctgggcggac 1020 aaactgacag cgctatatgg cgaagaaagt ttctccgcca gcgacgaccc cgagcaacag 1080 ttgtatgacg gatttattgg cgatcgggat cgacgccttt gtgaacagct gcgccttgcc 1140 gaaccggagc aattggccaa agaacaatgg cccttcgacg atgcccgttt gcaggagttg 1200 ttctttcgct atcgtgcgcg aaatttcccg gaaactttaa atgtggccga gcgccaacaa 1260 tgggaaagct tctgccgcaa tcgtttgtcc catgaagaat acggcgcacc gaatactttg 1320 ccggccttcg aggcggcgct ggaggcttgt cggcaagagc agggcggcac actgccggcg 1380 gtacttgcgg cctggcgcga ttacgccgcg gaactgcgtc aacgctattc gctggagact 1440 tga 1443 <210> 17 <211> 2177 <212> DNA <213> Escherichia coli <400> 17 atgcaaacac aaaaaccgac tctcgaactg ctaacctgcg aaggcgctta tcgcgacaat 60 cccaccgcgc tttttcacca gttgtgtggg gatcgtccgg caacgctgct gctggaatcc 120 gcagatatcg acagcaaaga tgatttaaaa agcctgctgc tggtagacag tgcgctgcgc 180 attacagctt taggtgacac tgtcacaatc caggcacttt ccggcaacgg cgaagccctc 240 ctggcactac tggataacgc cctgcctgcg ggtgtggaaa gtgaacaatc accaaactgc 300 cgtgtgctgc gcttcccccc tgtcagtcca ctgctggatg aagacgcccg cttatgctcc 360 ctttcggttt ttgacgcttt ccgtttattg cagaatctgt tgaatgtacc gaaggaagaa 420 cgagaagcca tgttcttcgg cggcctgttc tcttatgacc ttgtggcggg atttgaagat 480 ttaccgcaac tgtcagcgga aaataactgc cctgatttct gtttttatct cgctgaaacg 540 ctgatggtga ttgaccatca gaaaaaaagc acccgtattc aggccagcct gtttgctccg 600 aatgaagaag aaaaacaacg tctcactgct cgcctgaacg aactacgtca gcaactgacc 660 gaagccgcgc cgccgctgcc agtggtttcc gtgccgcata tgcgttgtga atgtaatcag 720 agcgatgaag agttcggtgg cgtagtgcgt ttgttgcaaa aagcgattcg cgctggagaa 780 attttccagg tggtgccatc tcgccgtttc tctctgccct gcccgtcacc gctggcggcc 840 tattacgtgc tgaaaaagag taatcccagc ccgtacatgt tttttatgca ggataatgat 900 ttcaccctat ttggcgcgtc gccggaaagc tcgctcaagt atgatgccac cagccgccag 960 attgagatct acccgattgc cggaacacgc ccacgcggtc gtcgcgccga tggttcactg 1020 gacagagatc tcgacagccg tattgaactg gaaatgcgta ccgatcataa agagctgtct 1080 gaacatctga tgctggttga tctcgcccgt aatgatctgg cacgcatttg cacccccggc 1140 agccgctacg tcgccgatct caccaaagtt gaccgttatt cctatgtgat gcacctcgtc 1200 tctcgcgtag tcggcgaact gcgtcacgat cttgacgccc tgcacgctta tcgcgcctgt 1260 atgaatatgg ggacgttaag cggtgcgccg aaagtacgcg ctatgcagtt aattgccgag 1320 gcggaaggtc gtcgccgcgg cagctacggc ggcgcggtag gttatttcac cgcgcatggc 1380 gatctcgaca cctgcattgt gatccgctcg gcgctggtgg aaaacggtat cgccaccgtg 1440 caagcgggtg ctggtgtagt ccttgattct gttccgcagt cggaagccga cgaaacccgt 1500 aacaaagccc gcgctgtact gcgcgctatt gccaccgcgc atcatgcaca ggagactttc 1560 tgatggctga cattctgctg ctcgataata tcgactcttt tacgtacaac ctggcagatc 1620 agttgcgcag caatgggcat aacgtggtga tttaccgcaa ccatattccg gcgcaaacct 1680 taattgaacg cctggcgacc atgagcaatc cggtgctgat gctttctcct ggccccggtg 1740 tgccgagcga agccggttgt atgccggaac tcctcacccg cttgcgtggc aagctgccca 1800 ttattggcat ttgcctcgga catcaggcga ttgtcgaagc ttacgggggc tatgtcggtc 1860 aggcgggcga aattctccac ggtaaagcct ccagcattga acatgacggt caggcgatgt 1920 ttgccggatt aacaaacccg ctgccggtgg cgcgttatca ctcgctggtt ggcagtaaca 1980 ttccggccgg tttaaccatc aacgcccatt ttaatggcat ggtgatggca gtacgtcacg 2040 atgcggatcg cgtttgtgga ttccagttcc atccggaatc cattctcacc acccagggcg 2100 ctcgcctgct ggaacaaacg ctggcctggg cgcagcagaa actagagcca gccaacacgc 2160 tgcaaccgat tctgtaa 2177

Claims (7)

Pseudomonas aeruginosa- derived pqsD and Pseudomonas aeruginosa- derived pqsA genes are introduced into Escherichia coli BL21 (DE3) in which trpD and tyrA genes are simultaneously deleted, coumarin-based or quinol-based compound production E. coli transformants.
delete According to claim 1,
The E. coli transformant is
I ) Photorhabdus luminescens (P. luminescens) derived accABCD gene is additionally introduced,
ii) aroL, aroE, aroD, aroB, aroG ^f , ppsA, tktA, entC and Pseudomonas aeruginosa ( P. aeruginosa )-derived pchB genes are additionally introduced, or aroL, aroG ^f , ppsA, trpEG genes are added Introduced into E. coli transformants.
According to claim 1,
The coumarin-based or quinol-based compound is selected from the group consisting of the following Chemical Formulas 1 to 3, E. coli transformants:
[Formula 1]

[Formula 2]

[Formula 3]

.
A composition for producing a coumarin-based or quinol-based compound comprising the E. coli transformant or the E. coli transformant culture according to any one of claims 1, 3 and 4.
A method for producing a coumarin-based or quinol-based compound from a substrate by using the E. coli transformant according to any one of claims 1, 3 and 4 or a culture of the E. coli transformant.
7. The method of claim 6,
Wherein the substrate comprises at least one selected from the group consisting of glucose, chorismate, salicylic acid, anthranilate, N-methylanthranilate and malonyl-CoA.

Images