KR102282663B1 - Recombinant microorganism with retinoid production ability and method for preparing retinoid using the same - Google Patents

Abstract

The present invention relates to a recombinant microorganism having retinoid-producing ability and a method for producing a retinoid using the same. Using the recombinant vector for producing retinoid according to the present invention, a recombinant microorganism having retinoid production ability, and a method for producing retinoid, it is possible to produce retinol and other various types of retinoid in high yield only by culturing and extracting the microorganism in one step, so that the pharmaceutical industry , can be widely used in the cosmetic industry and health functional food field.

Description

Recombinant microorganism having retinoid production ability and method for producing retinoid using same {Recombinant microorganism with retinoid production ability and method for preparing retinoid using the same}

The present invention relates to a recombinant microorganism having retinoid-producing ability and a method for producing a retinoid using the same.

Retinoids composed of retinol (vitamin A) and its derivatives have many functions in cells, for example, regulation of embryonic reproduction, vision and growth.

Retinoids are a class of lipophilic isoprenoid molecules chemically related to vitamin A. Retinoids are β- with an alcohol (eg, retinol), aldehyde (eg, retinal), carboxylic acid (eg, retinoic acid), or ester (eg, retinyl acetate) functional group. It consists of an inone ring and polyunsaturated side chains. They are known to play essential roles in human health, such as protecting eyesight, bone development and regeneration, and antioxidant effects, as well as preventing skin aging, and reducing the risk of certain cancers.

The first step in the retinoid biosynthetic pathway is cleavage of β-carotene by β-carotene-15, 15'-oxygenase (BCO I) for retinal synthesis in animals. Retinol formed by this reaction is reduced to retinol (vitamin A) by retinol reductase. Reduced retinol can be bound to intracellular cellular retinol binding protein-1 (CRBP1) before esterification to retinyl palmitate by LRAT in intestinal cells.

Some microorganisms, such as Halobacterium salinarium , have bacteriorhodopsin and retinal biosynthetic pathways. Retinol in its protein-bound form can be produced by bacteriorhodopsin-related protein-like proteins. However, unlike animals, the microorganism cannot produce retinoid derivatives such as retinol, retinyl ester, and retinoic acid.

Retinoids have received great attention in recent years as effective cosmetic and pharmaceutical ingredients for wrinkle improvement and skin disease treatment. The size of the retinoid market is estimated to be about 16 billion dollars worldwide. Chemically synthesized retinoids are representative commercial raw materials. Retinol is produced from acidification or hydrolysis of chemically synthesized retinal by reduction of pentadiene derivatives. However, this chemical process has disadvantages such as complicated purification steps and the formation of undesirable by-products. Animals produce retinoids from carotenoids obtained from fruits and vegetables, whereas plants cannot synthesize retinoids. So far, there have been some limited attempts to synthesize retinoids using enzymes for biological production, but without successful results. Therefore, there is a need to develop a biotechnological method for the production of retinoids using transformed microorganisms.

Accordingly, the present inventors confirmed that retinol is produced when Blh derived from Salinibacter ruber is transformed into a microorganism producing beta-carotene while researching a biotechnological method for retinoid production, and further, lecithin: Retinoids such as retinyl palmitate in a microorganism additionally transformed with the retinol acyltransferase gene ( lecithin:retinol acyltransferase, LRAT ) and cellular retinol binding protein-1 (CRBP1) in one simple step By confirming that it can be produced only by the process, the present invention was completed.

It is therefore an object of the present invention Blh To provide a recombinant vector for manufacturing retinoid containing a gene.

In order to achieve the above object, the present invention Blh It provides a recombinant vector for production of a retinoid comprising a gene.

In addition, the present invention provides a recombinant microorganism having retinoid-producing ability, characterized in that transformed with the recombinant vector.

In addition, the present invention comprises the steps of (1) culturing a recombinant microorganism transformed with the recombinant vector; And (2) recovering the retinoid from the microbial culture obtained in step (1); provides a method for producing retinoid comprising a.

Using the recombinant vector for manufacturing retinoid according to the present invention, a recombinant microorganism having retinoid manufacturing ability, and a retinoid manufacturing method, retinol and other various types of retinoids can be produced in high yield only by culturing and extracting the microorganism in one step, It can be widely used in industry, cosmetics industry and health functional food field.

1 is a diagram illustrating a retinoid biosynthesis pathway.
Figure 2 is a measure of the synthesis of retinol from the recombinant microorganism incorporating Blh _SR, Brp _SR or _SR Bcox gene.
3 is Blh _SR A diagram comparing the amount of retinol biosynthesis when the m12UTR, m37UTR or m46UTR sequence is added during transformation of a recombinant microorganism into which the gene is introduced.
4 is pUCM- Blh _SR - is an analysis of the retinoid production of recombinant E. coli Recombinant E. coli, and introducing pUCM- Blh _SR -CRBP1-RALDH1A the introduction of LRAT - CRBP1.

The present invention is Salinibacter ruber derived Blh It provides a recombinant vector for production of a retinoid comprising a gene.

In the present invention, the retinoid may be a compound having a skeleton of vitamin A (retinol) or a compound that binds to the retinoic acid receptor by having the same effect or similar action as retinoic acid (all trans and 9-cis), which is an active agent of retinol, , Preferably it may be any one of retinal, retinol, retinyl palmitate, retinoic acid and retinyl acetate.

In the present invention, the Blh catalyzes cleavage of the central double bond site of beta-carotene to generate two molecules of retinal, and the Blh gene is a gene encoding Blh.

In the present invention, the Blh gene may be a bacterial-derived gene, preferably Salinibacter ruber- derived Blh gene (SRU_2210 gene, Genebank accession: ABC44773.1).

In the present invention, the Salinibacter ruber- derived Blh gene (SRU_2210 gene) is a gene registered in NCBI, but the function is not clearly identified, so the annotation score is 2 out of 5. It is a gene whose function cannot be reasonably predicted. On the other hand, in the present invention, salrini bakteo louvers were (Salinibacter ruber) performed experiments to confirm the functionality of a Blh _SR, Brp _SR or Bcox _SR gene of origin, and as a result Brp _SR or similar of Salinibacter ruber origin such as Bcox _SR gene It was clearly confirmed that the gene did not exhibit the function of generating retinoids, and that only Blh _SR exhibited the function of generating retinoids. According to these results, the present invention can effectively produce a retinoid using a vector containing Blh _{SR capable of producing a retinoid from beta-carotene, and a recombinant microorganism.}

As a result of confirming in an embodiment of the present invention, it was clearly found that the Blh gene (SRU_2210 gene) derived from Salinibacter ruber biosynthesizes retinoids from beta-carotene.

In the present invention, the term 'vector' refers to a gene construct containing the nucleotide sequence of a gene operably linked to a suitable regulatory sequence so as to express a target gene in a suitable host, wherein the regulatory sequence initiates transcription. capable promoters, optional operator sequences for regulating such transcription, and sequences regulating the termination of transcription and translation.

In the present invention, 'operably linked' means that a nucleic acid expression control sequence and a nucleic acid sequence encoding a target protein are functionally linked to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the coding sequence. The operable linkage with the recombinant vector can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation using enzymes generally known in the art.

In the present invention, 'expression of the target gene' may mean producing a protein encoded by the target gene by expressing the target gene. The method of expressing a target gene in the present invention is a method of expressing a protein encoded by the target gene by culturing a transformant host cell transformed with a vector containing the target gene, through which the protein is involved biosynthesis The end product of the pathway can be manufactured.

The vector of the present invention is not particularly limited as long as it can replicate in cells, and any vector known in the art may be used, for example, a plasmid, a cosmid, a phage particle, a viral vector, and preferably a plasmid. .

The recombinant vector of the present invention may further include an untranslated region (UTR) sequence to control the expression of a target gene, and the UTR may include, without limitation, a sequence capable of regulating the expression of the target gene, Blh _{SR, according to the purpose.} there is. For example, the target gene including m37UTR represented by SEQ ID NO: 2 may be low-expressed, and preferably, the target gene, including m12UTR represented by SEQ ID NO: 1 or m46UTR represented by SEQ ID NO: 3, may be highly expressed there is. More preferably, the retinoid production may be increased, including m12UTR represented by SEQ ID NO: 1 or m46UTR represented by SEQ ID NO: 3.

The recombinant vector of the present invention may additionally include a gene encoding an enzyme for producing various retinoids using retinal produced from beta-carotene as a precursor, for example, retinol, all-trans retinoic acid (all- trans-retinoic acid), 13-cis retinoic acid, 9-cis-retinoic acid, ethretinate, acitretin, adapalene, bexarotene or tazarotene It may further include a gene encoding an enzyme for biosynthesis. The recombinant vector of the present invention is preferably a lecithin: retinol acyl transferase gene (lecithin: retinol acyltransferase , LRAT) gene, cellular retinol binding protein 1 gene (retinol binding protein-1, CRBP1 ) and / or retinoic acid biosynthetic enzyme (retinal dehydrogenase-1a, RALDH1A) a may further include, and wherein the lecithin: retinol acyl transferase gene (lecithin: retinol acyltransferase, LRAT), cellular retinol-binding protein 1 gene (retinol binding protein-1, CRBP1 ) and / Or retinoic acid biosynthetic enzyme (retinal dehydrogenase-1a, RALDH1A ) If further included, retinal, retinol, retinyl palmitate, retinyl acetate and / or retinoic acid may be biosynthesized.

In the present invention, the lecithin: retinol acyl transferase gene (lecithin: retinol acyltransferase, LRAT), cellular retinol-binding protein 1 gene (retinol binding protein-1, CRBP1 ) and / or a retinoic acid synthesis enzyme (retinal dehydrogenase-1a , RALDH1A ) may be cloned downstream of the promoter of the recombinant vector, preferably cloned downstream of the lac promoter, but is not limited thereto.

When the recombinant vector of the present invention is introduced into a microorganism, various retinoids can be produced in high yield with only one simple process consisting of culturing and extracting the microorganism without a complicated manufacturing process compared to the chemical synthesis of retinoid. .

In addition, the present invention provides a recombinant microorganism having retinoid-producing ability, characterized in that transformed with the recombinant vector.

In the present invention, the microorganism may be selected from the group consisting of Escherichia coli, bacteria, yeast and mold, and may preferably be a beta-carotene-producing microorganism, more preferably crtE gene, crtB gene, crtI gene and The crtY gene may be a transformed microorganism, and more preferably, the crtE gene, the crtB gene, the crtI gene and the crtY gene may be transformed E. coli.

For beta-carotene-producing Escherichia coli, the entire literature of Song et al, 2013 can be referred to.

In the present invention, a method for introducing a recombinant vector into a cell may use a method known in the art, preferably a transformation method. Here, 'transformation' means introducing DNA into a host so that the DNA becomes replicable as an extrachromosomal factor or by chromosomal integration completion. Transformation includes any method of introducing a nucleic acid molecule into an organism, cell, tissue or organ, and can be performed by selecting an appropriate standard technique according to the host cell, as is known in the art. These methods include electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE (diethylaminoethyl)-dextran method, cationic liposome method. , and lithium acetate-DMSO method, but is not limited thereto.

By culturing and extracting the recombinant microorganism having the retinoid-producing ability of the present invention, it may be possible to produce retinoid in a high yield with only one simple process.

In addition, the present invention comprises the steps of (1) culturing a recombinant microorganism transformed with the recombinant vector; And (2) recovering the retinoid from the microbial culture obtained in step (1); provides a method for producing retinoid comprising a.

In the present invention, the step of culturing the recombinant microorganism can be performed using a commonly known culture method. In the present invention, separation and recovery of retinoids from the culture medium may use a suitable known method according to the physical and chemical properties of the protein, for example, distillation, electrodialysis, pervaporation, chromatography, solvent extraction, reaction extraction , HPLC, etc. may be used, and a combination thereof may be used, but is not limited thereto.

In the present invention, the retinoid may be a compound having a skeleton of vitamin A (retinol) or a compound that binds to the retinoic acid receptor by having the same effect or similar action as retinoic acid (all trans and 9-cis), which is an active agent of retinol, , Preferably it may be any one of retinal, retinol, retinyl palmitate, retinoic acid and retinyl acetate.

In the present invention, the microorganism in step (1) may use one selected from the group consisting of Escherichia coli, bacteria, yeast and mold, and may preferably be a beta-carotene-producing microorganism, more preferably crtE gene, crtB The gene, the crtI gene and the crtY gene may be a transformed microorganism, and more preferably, the crtE gene, the crtB gene, the crtI gene and the crtY gene may be transformed E. coli.

Using the retinoid production method of the present invention, it may be possible to produce retinoid in high yield only with a simple one-step process of culturing and extracting a recombinant microorganism.

Duplicate content is omitted in consideration of the complexity of the present specification, and terms not defined otherwise in the present specification have the meanings commonly used in the art to which the present invention pertains.

Example 1. Preparation of strains and plasmids for production of retinoid biosynthetic strains

E. coli TOP10 was used for gene cloning and plasmid maintenance, and E. coli XIASR was used as a host strain for expression of retinoid biosynthesis genes. Salinibacter ruber M31 strain was purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ, Germany). Enterococcus faecalis GF2 ( Enterococcus faecalis GF2 ) and Bacillus subtilis subspecies spizizeni W23 ATCC 6633 (Bacillus subtilis subsp.spizizenii W23 ATCC 6633) were purchased from the Korea Center for Biological Resources (KCTC, Korea). The microorganism strains used in the present invention are shown in Table 1, and the primers for plasmid construction are shown in Table 2.

[Table 1]

[Table 2]

Example 2. Confirmation of recombinant E. coli production and retinol production for expression of retinoid biosynthetic enzymes

2.1 Construction of plasmid for gene introduction of retinoid biosynthesis enzyme

The retinoid biosynthesis pathway is shown in FIG. 1 .

Blh _SR (SRU_2210, Genebank accession: ABC44773.1) , _{Brp SR} (SRU_0742, Genebank accession: ABC43854.1) or Bcox _SR (SRU_0127, Genebank accession: ABC44374.1) as an enzyme for producing retinal from beta-carotene did. That in strains that produce beta-carotene not identify the origin of the S.ruber function experimentally gene Blh _SR, by introducing Brp _SR or _SR Bcox to verify that retinol biosynthesis, each gene (Blh _{SR, SR} Brp, Bcox _SR ) was prepared a plasmid for introducing into E. coli. The low copy plasmid pUCMr modified from pUCM was used as the backbone plasmid for cloning.

Specifically, the construction of the low copy plasmid pUCMr is as follows. The entire plasmid pUCM for biosynthetic pathway construction was amplified using primers pUCN-ori- fr and pUCN- ori- r, and in the pET21a plasmid, the rop gene that controls the copy number was modified with primers pET- rop- F and pET- ori -R was used to amplify. In the primers pUCN- ori- fr and pET- rop- F, a phosphate group was substituted at 5' of each primer using T4 polynucleotide kinase. The amplified parts of the two types of DNA fragments obtained were treated with Dpn I restriction enzyme to remove the backbone plasmid, and then ligated using T4 DNA ligase to finally modified low copy (low copy). ) Plasmid pUCMr was constructed.

Blh _SR, Brp _SR or Bcox _SR Plasmid pUCM- Blh _SR, pUCM- Brp for introducing a gene and _SR pUCM- Bcox _SR was constructed. Specifically _{SRU_2210 (Blh SR), SRU_0742 (} Brp SR) and SRU_0127 (Bcox _SR) gene was amplified by PCR from Salinibacter ruber genomic DNA. Blh _SR was cloned under the lac promoter of pUCM using the Blh _SR- F-Xba I and Blh _SR- R-EcoR I primers, and the PCR product digested by Xba I and EcoRI was cloned under the pUCM lac promoter to construct pUCMr-Blh _SR. . In the same way as Brp _SR Bcox _SR Also gene using primers Brp _SR -F-Xba I and _{Brp SR -R-EcoR I, Bcox} SR -F-Xba I and EcoR I-Bcox -R _{SR, SR} pUCMr- Brp and The pUCMr- Bcox _SR plasmid was constructed.

It was produced LRAT - CRBP1 - pUCM- Blh _SR plasmid for introducing and CRBP1 LRAT gene. Specifically LRAT and CRBP1 gene was cloned downstream of the one amplified by PCR from the cDNA of Hep3B following pUCM of the lac promoter. In order to amplify the LRAT gene was used as primer in LRATH-Xba1-F-R-EcoR I and LRATH primers of CRBP1H-Xba1-F and CRBP1H-R-EcoR I were used to amplify the gene CRBP1. Plasmid pUCM- Blh _SR is primers pUC-sub-USER-1-F and pUC-sub-USER-2-R, Plasmid pUCM- CRBP1 is primers pUC-sub-USER-2-F and pUC-sub-USER-5 -R Finally, the plasmid was amplified pUCM- LRAT gene overall, including the lac promoter using primers pUC-sub-USER-5- F and pUC-sub-USER-3- R. In addition, the remainder except for the promoter of pUCM was amplified using primers pUC-USER-1R and pUC-USER-3F. Three kinds of DNA fragments and the plasmid backbone, is amplified and then processed Dpn I, were bonded to the four fragments using the USER enzyme product of the plasmid pUCM- Blh _SR - prepare a LRAT - CRBP1.

A plasmid for producing retinoic acid, pUCM- Blh _SR - CRBP1 - RALDH1A was prepared. First, primers of RALDH1A2H -F-Xba1 and RALDH1A2H-R-EcoRI were used to amplify the RALDH1A gene from the obtained Hep3B cDNA. The PCR products cleaved by Xba I and EcoR I were cloned under the lac promoter of pUCM. To obtain plasmid pUCM- Blh _SR - CRBP1 - RALDH1A , plasmid pUCM- Blh _SR is primers pUC-sub-USER-1-F and pUC-sub-USER-2-R, and plasmid pUCM- CRBP1 is primer pUC-sub- USER-2-F and pUC-sub-USER-5-R Finally, the plasmid pUCM- RALDH1A is a gene containing the lac promoter using primers pUC-sub-USER-5-F and pUC-sub-USER-3-R. The whole was amplified. In addition, the remainder except for the promoter of pUCM was amplified using primers pUC-USER-1R and pUC-USER-3F. After the three amplified DNA fragments and the plasmid backbone were treated with Dpn I, the four fragments were spliced using the USER enzyme to construct the product, plasmid pUCM- Blh _SR - CRBP1 - RALDH1A .

Table 3 shows the plasmids prepared for the introduction of the retinoid biosynthesis enzyme prepared through the above process.

[Table 3]

2.2 Production of Retinol Biosynthesis Gene Introduced Recombinant E. coli

Recombinant E. coli was prepared to produce retinol. First, a strain capable of producing beta-carotene, XIASR (pAC-EBIY) was prepared. As a method of making competent cells for transformation, a chemical method using a TSS solution was used. Collect only the cells in the logarithmic growth phase (OD600 0.4-0.6) by centrifugation and remove all the culture medium in the supernatant. After adding 100 ul of cold TSS solution per 1 ml of the culture medium, mix well with a pipette. First, in order to make XIASR cells XIASR (pAC-EBIY), a strain capable of producing beta-carotene, 0.5 ul of plasmid pAC-EBIY (at a concentration of about 100 ng/ul) was transformed into the XIASR strain. Strain XIASR (pAC-EBIY) capable of producing beta-carotene was obtained by selection on LB agar solid medium containing chloramphenicol. In order to transform this strain XIASR (pAC-EBIY) a strain which can produce retinol again using the chemical method using a TSS solution such as the above manner to create competent cells, the plasmid pUCM- Blh _SR, pUCM- Brp _SR and pUCM- Bcox _SR were transformed to prepare a recombinant E. coli into which a retinol biosynthesis gene was introduced.

2.3 Retinol Biosynthesis Fermentation for Retinol Production in Recombinant E. coli

The recombinant E. coli into which the retinol biosynthesis gene prepared in Example 2.2 was introduced was cultured with shaking for 3 days. The medium was cultured in LB medium containing 10 g/L tryptone, 5 g/L yeast extract and 5 g/L sodium chloride. Flask fermentation for retinol production was performed in 50 ml of Terrific Broth (TB) medium in a 300 ml baffle flask at 30° C. for 48 hours while shaking at 250 rpm. TB medium contains 20 g/L of glycerol, 12 g/L of tryptone, 24 g/L of yeast extract _{, 2.31 g/L of KH 2} PO ₄ , and 16.41 g/L of K ₂ HPO ₄ 3H ₂ O. Ampicillin (100 mg/L) and chloramphenicol (50 mg/L) were added as needed.

2.4 Confirmation of retinol production in recombinant E. coli introduced with retinol biosynthesis enzyme gene

As in Example 2.3, an experiment was performed to confirm whether retinol biosynthesis was performed by recombinant E. coli in which flask fermentation for retinol production was completed. In Example 2.3, the flask fermentation for retinol production was performed for 48 hours, and the recombinant E. coli microbial cell pellet containing about 0.5 g of water (wet cell) was phosphate-buffered saline (PBS, 137 mM NaCl, 2.7 mM KCl, 10 After washing twice with mM Na2HPO4, 2 mM KH2PO4, pH 7.4), retinol was extracted according to a known method (Kane, MA, et al. 2005). 3 ml of 25 mM KOH in methanol solution was added and mixed with the extracted sample. After adding and mixing 5 ml of hexane, the hexane layer separated by centrifugation was collected. All the collected extracts were washed 3 times with ultrapure water. After dehydration by adding 0.1 g of sodium sulfate, it was incubated for 20 minutes. The sample was centrifuged and the supernatant was collected. After evaporation of the solvent by Genevac EZ2 (Fisher scientific, United Kingdom), the residue was resuspended in 1 ml of methanol. The resuspended samples were analyzed using an Agilent 1260 series high performance liquid chromatography with a photodiode array detector. As the analytical column, poroshell 120 EC-18 (2.1 X 50 mm, 2.7 μm, Agilent Technology, USA) was used. Methanol and acetoacetic acid (70:30:0.1 v/v/v) are used as mobile phases, and methanol, ultrapure water, isopropanol and acetic acid (60:20:19:5:0.1, v/v/v) are used as mobile phases. used as B. The injection volume of the sample was 5 μl, the flow rate was 0.4 ml/min, and the column temperature was maintained at 23°C. The gradient mobile phase is: 0-5 min, 100% B; 5-6 min, 100% B to 100% A; 6-28 min, 100% A; 28-29 min, 100% B to 100% B; 29-35 min, conditioned to 100% B. Retinol and retinyl ester were detected at 325 nm, beta-carotene was detected at 450 nm, and the detection results are shown in FIG. 2 .

When FIG sikyeoteul expressing the like, the three genes that are believed to be strains that beta-carotene produced retinol biosynthesis function of Salinibacter ruber derived from any one of (Blh _SR, Brp _SR, Bcox _SR) shown in Fig. 2, Blh of three genes It was confirmed that retinol was generated in the sample extracted with _SR- introduced recombinant E. coli, and it was confirmed that Blh _SR had a retinol biosynthesis function.

Example 3. By addition of UTR sequences Bhls _R Confirmation of the effect of increasing expression level and increasing retinol production

The expression of the Blh _SR gene was controlled by adding a 26-bp sequence between the lac promoter and the RBS sequence (AGGAGGATTACAAA) as an mRNA stabilizing sequence (mRS) to increase the production of retinol. m12UTR (SEQ ID NO: 1, GTTTAAACTGACTGACGCACCAAAAG), m37UTR (SEQ ID NO: 2, GTTTAAACAATAAATTACGAGCCAGT) and m46UTR (SEQ ID NO: 3, GTTTAAACCGAATTGGTGGGGCG) were used, and plasmids constructed based on this were named pUCMr37 and pUCMr46. Primers used to construct each plasmid were mRS12-pUCM-R, mRS37-pUCM-R and mRS46-pUCM-R shown in Table 2, and pUCM-F was commonly used. For comparison of retinol production, amplified Blh _SR Genes were inserted into pUCMr12, pUCMr37 and pUCMr46, respectively, to prepare pUCMr12- Blh _SR , pUCMr37- Blh _SR and pUCMr46- Blh _SR , and recombine into beta-carotene-producing E. coli in the same manner as in Example 2.2, in the same manner as in Examples 2.3 and 2.4. The production of retinol was measured and compared by the method, and pUCMr- Blh _SR without UTR sequence was used as a control. The measurement results are shown in FIG. 3 .

As shown in FIG. 3, pUCMr- Blh _SR , pUCMr12- Blh _SR , pUCMr37- Blh _SR and pUCMr46- Blh _SR were treated with 57.3±29.9, 96.9±18.6, 43.4±28.9 and 89.3±24.6 μg Retinol/mg DCW, respectively. It was confirmed that it was produced in a yield of . Therefore, it was confirmed that when the m12UTR and m46UTR sequences were added, retinol could be produced in a higher yield.

Example 4. Retinyl palmitate, retinyl acetate, retinal, production of recombinant E. coli for the production of retinoic acid

To produce the retinyl palmitate (retinyl palmitate) from retinol, lecithin in E. coli expressing the beta-carotene: retinol acyl transferase gene (lecithin: retinol acyltransferase, LRAT, Genebank accession: AAD13529.1) and / or cellular retinol The binding protein 1 gene ( retinol binding protein-1, CRBP1, Genebank accession: AAA60257.1) and the Blh _SR gene were introduced. Specifically, the pUCMr-Blh _SR- CRBP1-LRAT plasmid prepared in Example 2.1 was transformed into the XIASR (pAC-EBIY) strain in the same manner as in Example 2.2 to prepare a recombinant E. coli.

In addition, in order to produce retinoic acid, beta-carotene-expressing E. coli retinaldedhyde dehydrogenase ( RALDH1A, Genebank accession: AB015226.1) gene and/or cellular retinol binding protein 1 gene ( retinol binding protein-1, CRBP1 ) and Blh _SR genes were introduced. Specifically, the pUCM-Blh _SR- CRBP1-RALDH1A plasmid prepared in Example 2.1 was introduced and expressed. Specifically The pUCM-Blh _SR- CRBP1-RALDH1A plasmid prepared in Example 2.1 was transformed into the XIASR (pAC-EBIY) strain in the same manner as in Example 2.2 to prepare recombinant E. coli.

The prepared one pUCMr- Blh _SR -CRBP1-LRAT plasmid introduced into E. coli and recombinant pUCM- Blh _SR -CRBP1-RALDH1A the plasmid introduced into the recombinant Escherichia coli group, and the group that is inserted into control and nothing pUCMr- Blh _SR Using the recombinant E. coli group introduced with the plasmid, culture, extraction and HPLC were performed in the same manner as in Examples 2.3 and 2.4 to analyze the production of retinol, retinyl palmitate, retinyl acetate, and retinoic acid, and the analysis results were 4 is shown.

As shown in FIG. 4, in recombinant E. coli in which the Blh _SR , LRAT, and CRBP1 genes were introduced using the pUCM-Blh _SR- CRBP1-LRAT plasmid, in addition to retinyl palmitate, retinyl acetate, retinoic acid (retinoic acid) acid) and retinal were produced, and the yield of retinyl palmitate was measured as 2.0±0.3 ug retinyl palmitate/mg DCW. In addition, it was confirmed that retinoic acid was mainly produced in recombinant E. coli into which the Blh _SR , RALDH1A and CRBP1 genes were introduced using the pUCM-Blh _SR- CRBP1-RALDH1A plasmid, and the retinoic acid yield was 1.9 ± 0.4 ug retinoic/ measured in mg DCW. That is, using the retinoid biosynthesis system of the present invention, in the production of retinoids such as retinyl palmitide, retinyl acetate, retinal, or retinoic acid, there is no need to produce through an intermediate product, only one step of culturing and extracting microorganisms It was confirmed that a high yield of retinoid can be produced.

Above, specific parts of the present invention have been described in detail, for those of ordinary skill in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Recombinant microorganisms with retinoid production ability and method for preparing retinoid using the same <130> ajou1-87P <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> m12UTR <400> 1 gtttaaactg actgacgcac caaaag 26 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> m37UTR <400> 2 gtttaaacaa taaattacga gccagt 26 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> m46UTR <400> 3 gtttaaaccg aattggtggg gcg 23

Claims (14)

Salinibacter ruber ( Salinibacter ruber ) Recombinant vector for producing a retinoid containing the Blh gene (SRU_2210 gene, Genebank accession: ABC44773.1).
delete The recombinant vector of claim 1, wherein the recombinant vector further comprises an untranslated region (UTR) sequence.
The recombinant vector for preparing a retinoid according to claim 3, wherein the UTR sequence is m12UTR represented by SEQ ID NO: 1 or m46UTR represented by SEQ ID NO: 3.
The method of claim 1 wherein the lecithin: retinol acyl transferase gene (lecithin: retinol acyltransferase, LRAT, Genebank accession: AAD13529.1), cellular retinol-binding protein 1 gene (retinol binding protein-1, CRBP1, Genebank accession: AAA60257. 1) or retinal daed dehydrogenase (Retinaldedhyde dehydrogenase-1a, RALDH1A, Genebank accession: AB015226.1) characterized in that it further comprises, retinoid production recombinant vector.
The recombinant vector for preparing retinoid according to claim 5, wherein the retinoid is at least one selected from the group consisting of retinal, retinol, retinyl palmitate, retinyl acetate and retinoic acid.
A recombinant microorganism having retinoid-producing ability, characterized in that it is transformed with the recombinant vector of any one of claims 1, 3 to 6.
The recombinant microorganism of claim 7, wherein the microorganism is at least one selected from the group consisting of Escherichia coli, bacteria, yeast and mold.
The recombinant microorganism of claim 7, wherein the microorganism is a beta-carotene-producing microorganism.
10. The recombinant microorganism of claim 9, wherein the beta-carotene-producing microorganism is a microorganism transformed with a crtE gene, a crtB gene, a crtI gene and a crtY gene.
(1) culturing the recombinant microorganism transformed with the recombinant vector of any one of claims 1, 3 to 6; and
(2) recovering the retinoid from the microbial culture solution obtained in step (1); method for producing retinoid comprising a.
The method of claim 11, wherein the retinoid is at least one selected from the group consisting of retinal, retinol, retinyl palmitate, retinyl acetate, and retinoic acid.
The method of claim 11, wherein the microorganism in step (1) is a beta-carotene-producing microorganism.
The method of claim 13, wherein the beta-carotene-producing microorganism is a microorganism transformed with a crtE gene, a crtB gene, a crtI gene, and a crtY gene.

Images