KR102282341B1 - Composition for preventing or treating behcet's diseases containing cd83 inhibitor - Google Patents
Composition for preventing or treating behcet's diseases containing cd83 inhibitor Download PDFInfo
- Publication number
- KR102282341B1 KR102282341B1 KR1020190096228A KR20190096228A KR102282341B1 KR 102282341 B1 KR102282341 B1 KR 102282341B1 KR 1020190096228 A KR1020190096228 A KR 1020190096228A KR 20190096228 A KR20190096228 A KR 20190096228A KR 102282341 B1 KR102282341 B1 KR 102282341B1
- Authority
- KR
- South Korea
- Prior art keywords
- disease
- behcet
- present
- sirna
- inhibitor
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70596—Molecules with a "CD"-designation not provided for elsewhere in G01N2333/705
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/32—Cardiovascular disorders
- G01N2800/328—Vasculitis, i.e. inflammation of blood vessels
Abstract
본 발명은 CD83 억제제를 유효성분으로 포함하는 베체트병의 예방 또는 치료용 조성물을 제공한다. 본 발명에 따르면, 베체트병 마우스에서 CD83을 발현하는 세포의 빈도가 유의하게 높고, CD83 발현 세포의 증감과 베체트병 증상 사이에 관련성이 있음을 확인한 바, 본 발명에 따른 CD83 억제제를 이용하여 CD83의 발현을 조절함으로써, 베체트병 진단, 예방, 및 치료에 효과적으로 사용될 수 있다. 또한, CD83 또는 CD83을 발현하는 세포에 의해 야기되거나 이와 연관되는 질환 또는 질병 등에 기존 치료제와 병행하여 사용함으로써 치료 효과를 더욱 증대시킬 수 있다.The present invention provides a composition for preventing or treating Behcet's disease comprising a CD83 inhibitor as an active ingredient. According to the present invention, it was confirmed that the frequency of CD83-expressing cells was significantly high in Behcet's disease mice, and there was a relationship between the increase in CD83-expressing cells and Behcet's disease symptoms. By regulating the expression, it can be effectively used for diagnosis, prevention, and treatment of Behcet's disease. In addition, the therapeutic effect can be further increased by using in combination with existing therapeutic agents for diseases or diseases caused by or associated with CD83 or CD83-expressing cells.
Description
본 발명은 CD83 억제제를 유효성분으로 포함하는 베체트병의 예방 또는 치료용 조성물에 관한 것이다.The present invention relates to a composition for preventing or treating Behcet's disease comprising a CD83 inhibitor as an active ingredient.
베체트병(Behcet's disease)은 희귀난치성 염증성 질환으로 구강 및/또는 생식기의 반복적인 아프타성 궤양, 포도막염(uveitis) 및 피부 병변을 증상으로 한다. 임상 증상은 피부궤양 뿐만 아니라 관절, 중추신경계(central nervous system), 위장, 신장, 비뇨생식기, 폐, 심혈관, 장출혈, 장천공 등의 소화기계 관련, 상하대 정맥증후군, 대동맥 역류 등의 증상이 동반된 심각한 만성적 염증이 다면적으로 나타난다. 이러한 증상은 전신성의 혈관염과 관련된 것으로, 베체트병의 중심적인 병리 생리학적 특징이다.Behcet's disease (Behcet's disease) is a rare, intractable inflammatory disease characterized by recurrent aphthous ulcers, uveitis and skin lesions of the oral and/or genital organs. Clinical symptoms are not only skin ulcers, but also joints, central nervous system, stomach, kidneys, genitourinary system, lungs, cardiovascular system, intestinal bleeding, intestinal perforation and other digestive system related symptoms, upper and lower vena cava syndrome, and serious symptoms such as aortic regurgitation. Chronic inflammation is multifaceted. These symptoms are associated with systemic vasculitis and are a central pathophysiological feature of Behcet's disease.
베체트병의 정확한 발병 원인은 밝혀지지 않았지만, 헤르페스 바이러스 감염이 촉발한 자가 면역(autoimmune)과 자가 염증성(autoinflammatory) 반응과 관련이 있다. 베체트병에서 세포의 침입형태는 대식세포(macrophage)와 수지상세포(dendritic cell)를 비롯하여, CD4+, CD8+, T세포, 호중구(neutrophil) 등이 관여한다. 또한 사이토카인(cytokine) 생산의 증가와도 연관된다. Although the exact cause of Behcet's disease is unknown, it is associated with the autoimmune and autoinflammatory responses triggered by herpes virus infection. In Behcet's disease, cell invasion types include macrophages and dendritic cells, as well as CD4+, CD8+, T cells, and neutrophils. It is also associated with an increase in cytokine production.
베체트병은 피부 점막 염증이나 관절염 등 가벼운 증상만 보이는 경우도 있으나, 심한 포도막염이나 뇌, 폐, 심장, 신장 등 주요 장기를 침범하여 심각한 후유증을 동반할 수 있다. Behcet's disease sometimes shows only mild symptoms such as inflammation of the skin mucosa or arthritis, but it can be accompanied by severe sequelae due to severe uveitis or invasion of major organs such as brain, lung, heart, and kidney.
상기와 같은 문제점을 해결하기 위하여, 본 발명은 CD83 억제제를 유효성분으로 포함하는 베체트병의 예방 또는 치료용 약학 조성물 및 약물 스크리닝 방법을 제공한다.In order to solve the above problems, the present invention provides a pharmaceutical composition for preventing or treating Behcet's disease and a drug screening method comprising a CD83 inhibitor as an active ingredient.
또한, 본 발명은 베체트병 진단용 바이오마커 조성물, 진단용 조성물, 및 진단용 키트를 제공한다.In addition, the present invention provides a biomarker composition for diagnosing Behcet's disease, a diagnostic composition, and a diagnostic kit.
본 발명에 따른 베체트병의 예방 또는 치료용 약학 조성물은 CD83 억제제를 유효성분으로 포함할 수 있다.The pharmaceutical composition for preventing or treating Behcet's disease according to the present invention may include a CD83 inhibitor as an active ingredient.
본 발명에 따른 베체트병의 예방 또는 치료용 약물 스크리닝 방법은 인체에서 분리된 생물학적 시료에 시험물질을 처리하는 제1 단계; 상기 시험물질을 처리한 시료에서 CD83 또는 CD83 mRNA의 발현 또는 활성 수준을 측정하는 제2 단계; 및 대조구 시료와 비교하여 상기 CD83 또는 상기 CD83 mRNA의 발현 또는 활성 수준이 감소한 시험물질을 선별하는 제3 단계;를 포함할 수 있다.A drug screening method for preventing or treating Behcet's disease according to the present invention comprises a first step of treating a test substance in a biological sample isolated from the human body; a second step of measuring the expression or activity level of CD83 or CD83 mRNA in the sample treated with the test substance; and a third step of selecting a test substance in which the expression or activity level of the CD83 or the CD83 mRNA is decreased compared to the control sample.
본 발명에 따른 베체트병 진단용 바이오마커 조성물은 CD83 또는 CD83 mRNA를 유효성분으로 포함할 수 있다.The biomarker composition for diagnosing Behcet's disease according to the present invention may include CD83 or CD83 mRNA as an active ingredient.
본 발명에 따른 베체트병 진단용 조성물은 CD83 또는 CD83 mRNA의 발현 또는 활성 수준을 측정하는 제제를 유효성분으로 포함할 수 있다.The composition for diagnosing Behcet's disease according to the present invention may include an agent for measuring the expression or activity level of CD83 or CD83 mRNA as an active ingredient.
본 발명에 따른 베체트병 진단용 키트는 베체트병 진단용 조성물을 포함할 수 있다.The kit for diagnosing Behcet's disease according to the present invention may include a composition for diagnosing Behcet's disease.
본 발명에 따른 약학 조성물은 CD83 억제제를 유효성분으로 포함하여 효과적으로 희귀난치성 베체트병을 예방할 수 있고, 발병된 경우 치료할 수 있다. 또한, 본 발명에 따른 바이오마커 조성물, 진단용 조성물, 및 진단용 키트를 이용하여 베체트병의 발병 가능성 및 질병 정도를 유의적으로 예측 또는 파악할 수 있다. The pharmaceutical composition according to the present invention can effectively prevent rare and intractable Behcet's disease by including a CD83 inhibitor as an active ingredient, and can treat when it occurs. In addition, by using the biomarker composition, the diagnostic composition, and the diagnostic kit according to the present invention, the likelihood of developing Behcet's disease and the degree of the disease can be significantly predicted or grasped.
이 외에도, CD83 또는 CD83을 발현하는 세포에 의해 야기되거나 이와 연관되는 질환 또는 질병 등에 기존 치료제와 병행하여 사용함으로써 치료 효과를 더욱 증대시킬 수 있다.In addition, the therapeutic effect can be further increased by using in combination with existing therapeutic agents for diseases or diseases caused by or related to CD83 or CD83-expressing cells.
도 1은 본 발명의 일 실험예에 따른 베체트병 유사 마우스 모델의 CD83 siRNA 처리 전 후 증상 변화를 나타낸다.
도 2는 본 발명의 일 실험예에 따른 베체트병 유사 마우스 모델의 복강 내 대식세포(macrophage)의 CD83 발현(CD83+) 세포의 빈도를 나타낸 그래프이다.
도 3은 본 발명의 일 실험예에 따른 베체트병 유사 마우스 모델에 CD83 siRNA 처리를 중단한 경우의 변화를 나타낸다.
도 4는 본 발명의 일 실험예에 따른 베체트병 유사 마우스 모델에서 분리한 수지상 세포에 CD83 siRNA 처리 후 투과전자현미경으로 관찰한 이미지이다.1 shows the change in symptoms before and after CD83 siRNA treatment in a Behcet's disease-like mouse model according to an experimental example of the present invention.
2 is a graph showing the frequency of CD83-expressing (CD83+) cells in the intraperitoneal cavity of a Behcet's disease-like mouse model according to an experimental example of the present invention.
3 shows changes when CD83 siRNA treatment is stopped in a Behcet's disease-like mouse model according to an experimental example of the present invention.
4 is an image observed with a transmission electron microscope after CD83 siRNA treatment in dendritic cells isolated from a Behcet's disease-like mouse model according to an experimental example of the present invention.
이하, 본 발명을 상세하게 설명하기로 한다. Hereinafter, the present invention will be described in detail.
본 발명은 베체트병 마우스와 증상이 없는 대조군 마우스를 비교하였을 때, 베체트병 마우스에서 CD83을 발현하는 세포의 빈도가 유의하게 높은 것으로 나타났고, CD83의 억제제가 CD83을 발현하는 세포의 빈도를 감소시켜 베체트병 치료법으로 활용될 수 있음을 확인함으로써, 본 발명을 완성하였다.The present invention showed that the frequency of CD83-expressing cells in Behcet's disease mice was significantly higher when comparing the Behcet's disease mice with asymptomatic control mice, and an inhibitor of CD83 reduced the frequency of CD83-expressing cells. By confirming that it can be utilized as a treatment for Behcet's disease, the present invention has been completed.
본 명세서에서 "예방"이란, 본 발명에 따른 약학 조성물의 투여에 의해 베체트병 또는 베체트병의 적어도 하나 이상의 증상의 발생을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다. 또한, 재발을 예방하거나 방지하기 위해 베체트병에 차도가 있는 대상의 치료를 포함한다.As used herein, "prevention" refers to any action of suppressing or delaying the onset of Behcet's disease or at least one symptom of Behcet's disease by administration of the pharmaceutical composition according to the present invention. Also includes treatment of subjects in remission of Behcet's disease to prevent or prevent recurrence.
본 명세서에서 "치료"란, 본 발명에 따른 약학 조성물의 투여에 의해 베체트병 또는 베체트병의 적어도 하나 이상의 증상을 완화, 감소 또는 소멸시키는 등 그 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다.As used herein, "treatment" refers to any action that improves or advantageously changes the symptoms, such as alleviating, reducing or eliminating at least one symptom of Behcet's disease or Behcet's disease by administration of the pharmaceutical composition according to the present invention .
본 명세서에서 "진단"이란, 베체트병의 발병 여부 또는 발병 가능성(위험성)을 확인하는 것으로, 베체트병 또는 베체트병의 적어도 하나 이상의 증상에 대한 대상(subject)의 감수성(susceptibility)을 판정하는 것, 대상이 베체트병을 현재 가지고 있는지 여부를 판정하는 것, 베체트병에 걸린 대상의 예후(prognosis)를 판정하는 것, 또는 테라메트릭스(therametrics)(예를 들어, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링 하는 것)을 포함한다. 또한, 임상 상태의 일차 진단 또는 재발한 질병의 진단을 포함한다.As used herein, "diagnosis" is to determine whether or not the onset of Behcet's disease or the possibility (risk) of the onset, and to determine the subject's susceptibility to at least one symptom of Behcet's disease or Behcet's disease, To determine whether a subject currently has Behcet's disease, to determine the prognosis of a subject with Behcet's disease, or to use therametrics (e.g., an object to provide information about efficacy of treatment) monitoring the status of the Also includes primary diagnosis of clinical condition or diagnosis of recurrent disease.
본 명세서에서 "약학 조성물"이란, 특정한 목적을 위해 투여되는 조성물로, 본 발명의 목적상 베체트병을 예방하거나 또는 치료하기 위해 투여되는 것을 의미한다.As used herein, the term "pharmaceutical composition" refers to a composition administered for a specific purpose, which is administered to prevent or treat Behçet's disease for the purpose of the present invention.
본 명세서에서 "바이오마커"란, 몸 안의 변화를 알아낼 수 있는 지표로서, 생명체의 정상 또는 병리적인 상태, 즉, 베체트병에 대한 진단, 약물에 대한 반응 정도 등을 측정할 수 있다.As used herein, the term "biomarker" is an indicator that can detect changes in the body, and can measure a normal or pathological state of a living organism, that is, a diagnosis of Behcet's disease, a degree of response to a drug, and the like.
본 발명은 CD83 억제제를 유효성분으로 포함하는 베체트병의 예방 또는 치료용 약학 조성물을 제공한다. The present invention provides a pharmaceutical composition for preventing or treating Behcet's disease comprising a CD83 inhibitor as an active ingredient.
본 발명에서 "CD83(세포표면항원무리, Cluster of Differentiation 83)"은 CD83 유전자에 의해 암호화된 인간 단백질로, 면역 글로불린 슈퍼 패밀리에 속하는 싱글-패스 유형I(single-pass type I)의 막 당단백질(glycoprotein)이다. CD83은 성숙한 수지상 세포(dendritic cell, DC) 상에서 주로 발현되는 세포 표면 마커로, 수지상 세포의 성숙 과정에서 CD80 및 CD86과 같은 공동자극 분자와 함께 강하게 발현된다. 이 외에도 CD83은 활성화된 B 및 T 세포에서도 발현될 수 있고, 미성숙한 혈액 수지상 세포(BDC) 및 단핵구 유래 수지상 세포(MoDC) 상에서는 최소한으로 발현될 수 있다. In the present invention, "CD83 (Cluster of Differentiation 83)" is a human protein encoded by the CD83 gene, and is a single-pass type I membrane glycoprotein belonging to the immunoglobulin superfamily. (glycoprotein). CD83 is a cell surface marker mainly expressed on mature dendritic cells (DCs), and is strongly expressed along with costimulatory molecules such as CD80 and CD86 during the maturation of dendritic cells. In addition, CD83 can also be expressed on activated B and T cells and minimally on immature blood dendritic cells (BDC) and monocyte-derived dendritic cells (MoDC).
본 발명에서 "수지상 세포(dendritic cell, DC)"란, 포유류의 면역계를 구성하는 면역세포로, 전문적 항원제시세포(professional antigen presenting cell)로 작용한다. 이들의 주 기능은 항원 물질을 처리하고 이를 세포 표면에 발현하여 T 세포에게 제시한다. 이로써 이들은 선천성 면역계와 적응성 면역계를 연결해 주는 전달자로서 역할을 한다. In the present invention, "dendritic cells (dendritic cells, DC)" is an immune cell constituting the immune system of a mammal, and acts as a professional antigen presenting cell (professional antigen presenting cell). Their main function is to process antigenic substances, express them on the cell surface and present them to T cells. In this way, they act as messengers between the innate and adaptive immune systems.
수지상 세포 분화 및 활성화시 발현되기 시작하는 분자는 선천적 면역과 후천적 면역을 연결하는 것을 보조한다. 수지상 세포가 면역 반응에 대한 통제를 발휘하기 때문에, 활성화된 수지상 세포는 악성 질병 및 자가 면역 질환을 비롯한 다수의 면역학적 질병에 걸쳐 중재를 위한 표적이 될 수 있다. 본 발명에 따른 CD83 억제제는 이러한 수지상 세포의 활성화 및 면역 반응을 조절할 수 있다.Molecules that begin to be expressed upon dendritic cell differentiation and activation assist in linking innate and adaptive immunity. Because dendritic cells exert control over the immune response, activated dendritic cells can be a target for intervention across a number of immunological diseases, including malignant and autoimmune diseases. The CD83 inhibitor according to the present invention can modulate the activation and immune response of these dendritic cells.
본 발명에 따른 조성물에 있어서, 상기 CD83 억제제는 CD83에 특이적으로 결합하는 항체, 펩타이드, 펩타이드 미메틱스, 앱타머, 화합물 및 천연물로 이루어진 군에서 선택될 수 있다.In the composition according to the present invention, the CD83 inhibitor may be selected from the group consisting of an antibody that specifically binds to CD83, a peptide, a peptide mimetics, an aptamer, a compound, and a natural product.
또한, 상기 CD83 억제제는 CD83 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(small interfering RNA; siRNA), 및 짧은 헤어핀 RNA(short hairpin RNA; shRNA)로 이루어진 군에서 선택될 수 있으나, 이에 한정되는 것은 아니다.In addition, the CD83 inhibitor may be selected from the group consisting of antisense nucleotides complementary to CD83 mRNA, small interfering RNA (siRNA), and short hairpin RNA (shRNA), but is limited thereto. it's not going to be
본 발명에 따른 조성물에 있어서, 상기 작은 간섭 RNA(이하, siRNA)는 서열번호 1 또는 2로 표시되는 염기서열을 가질 수 있다. 상기 siRNA의 전체 길이는 10 내지 80 염기, 바람직하게는 15 내지 60 염기, 더욱 바람직하게는 20 내지 40 염기일 수 있다. 상기 서열번호 1과 2의 염기서열은 하기와 같다.In the composition according to the present invention, the small interfering RNA (hereinafter, siRNA) may have a nucleotide sequence represented by SEQ ID NO: 1 or 2. The total length of the siRNA may be 10 to 80 bases, preferably 15 to 60 bases, more preferably 20 to 40 bases. The nucleotide sequences of SEQ ID NOs: 1 and 2 are as follows.
서열번호 1 : 5'- GUGCUUUUCAGUCAUCUACAAGCTA -3'SEQ ID NO: 1: 5'-GUGCUUUUCAGUCAUCUACAAGCTA -3'
서열번호 2 : 5'- UAGCUUGUAGAUGACUGAAAAGCACUC -3'SEQ ID NO:2: 5'-UAGCUUGUAGAUGACUGAAAAGCACUC-3'
본 발명에서 "siRNA(small interfering RNA)"는 21-25nt 크기의 작은 RNA조각으로, 세포 내에서 RISC(RNA-induced silencing complex)와 복합체를 형성하여 상보적인 서열을 갖는 mRNA에 특이적으로 결합하여 표적 mRNA를 절단시킨 후 단백질 발현을 저해하는 RNA 간섭(RNA interfering, RNAi)을 유도하는 물질 중 하나이다. 본 발명에 따른 CD83의 억제제로서 상기 siRNA는 RNA 간섭을 통해 수지상 세포에서의 상기 CD83 발현을 억제할 수 있다. CD83 발현이 억제되면, 수지상 세포에 의한 T 세포의 활성화가 억제될 수 있다.In the present invention, "siRNA (small interfering RNA)" is a small RNA fragment with a size of 21-25 nt, which forms a complex with RISC (RNA-induced silencing complex) in a cell and specifically binds to mRNA having a complementary sequence. It is one of the substances inducing RNA interfering (RNAi) that inhibits protein expression after cleaving the target mRNA. As an inhibitor of CD83 according to the present invention, the siRNA can inhibit the CD83 expression in dendritic cells through RNA interference. When CD83 expression is inhibited, activation of T cells by dendritic cells can be inhibited.
본 발명에 따른 조성물에 있어서, 상기 siRNA는 상기 서열번호 1 또는 2(센스, sence)의 상보적 서열(안티센스, antisense)의 염기서열을 포함할 수 있다. 또한, 상기 siRNA는 상기 서열번호 1 또는 2 및 상기 서열번호 1 또는 2의 상보적 서열이 루프에 의해 연결된 스템-루프 구조의 단일 RNA 가닥일 수도 있다. In the composition according to the present invention, the siRNA may include a nucleotide sequence of a complementary sequence (antisense) of SEQ ID NO: 1 or 2 (sense, sence). In addition, the siRNA may be a single RNA strand of a stem-loop structure in which SEQ ID NO: 1 or 2 and the complementary sequence of SEQ ID NO: 1 or 2 are linked by a loop.
상기 siRNA는 화학적 합성, 중합효소 연쇄 반응(PCR)에 의한 요구되는 뉴클레오타이드 서열의 증폭, 또는 재조합 합성에 의해 이미 존재하는 siRNA를 정제함으로써 형성될 수 있다.The siRNA may be formed by chemical synthesis, amplification of a required nucleotide sequence by polymerase chain reaction (PCR), or purifying an existing siRNA by recombinant synthesis.
본 발명에 따른 조성물에 있어서, 상기 siRNA는 상기 RNA의 당 부분, 뉴클레오베이스 부분 또는 인터뉴클레오타이드 구조 내에 하나 이상의 화학적 변형을 포함할 수 있다. 상기 화학적 변형은 생체 내 안정성 향상, 뉴클레아제(nuclease)에 대한 저항성 부여, 및 비특이적 면역 반응 감소를 위한 것이다. 상기 siRNA는 상기 화학적 변형을 통해, RNAi 능력에는 영향을 미치지 않고, 뉴클레아제에 대한 저항성 증진, 세포내 흡수(uptake) 증가, 세포 표적화 향상, 안정성 증가, 인터페론 활성 감소, 면역 반응, 및 센스(sense) 효과와 같은 타겟 이외의(off-target) 특성을 변형되지 않은 siRNA 보다 향상시킬 수 있다. 본 발명에 따른 siRNA의 안정성과 생적합성을 생체 내에서 향상시킬 수 있는 모든 화학적 변형이 본 발명의 범위에 포함될 수 있다. 상기 화학적 변형은 어느 한 가지 형태의 변형만 이루어질 수도 있고, 여러 가지 화학적 변형이 함께 이루어질 수도 있다.In the composition according to the present invention, the siRNA may include one or more chemical modifications in the sugar portion, nucleobase portion or internucleotide structure of the RNA. The chemical modification is for improving in vivo stability, conferring resistance to nucleases, and reducing non-specific immune responses. Through the chemical modification, the siRNA does not affect RNAi ability, but increases resistance to nucleases, increases intracellular uptake, improves cell targeting, increases stability, decreases interferon activity, immune response, and sense ( off-target properties such as sense) effect can be improved over unmodified siRNA. Any chemical modification capable of improving the stability and biocompatibility of the siRNA according to the present invention in vivo may be included in the scope of the present invention. The chemical transformation may be made in only one form of transformation, or various chemical transformations may be made together.
본 발명에서 "항체"는 당해 기술분야에 공지된 용어로서 항원성 부위에 대하여 지시되는 특이적인 면역글로불린을 의미한다. 본 발명에서의 항체는 CD83에 대해 특이적으로 결합하는 항체를 의미하며, 당해 기술분야의 통상적인 방법에 따라 항체를 제조할 수 있다.As used herein, "antibody" is a term known in the art and refers to a specific immunoglobulin directed against an antigenic site. The antibody in the present invention refers to an antibody that specifically binds to CD83, and the antibody can be prepared according to a conventional method in the art.
본 발명에서 "펩타이드"는 표적 물질에 대한 결합력이 높은 장점이 있고, 열/화학 처리 시에도 변성이 일어나지 않는다. 또한 분자 크기가 작기 때문에 다른 단백질에 붙여서 융합 단백질로의 이용이 가능하다. 구체적으로 고분자 단백질 체인에 붙여서 이용이 가능하므로 진단 키트 및 약물전달 물질로 이용될 수 있다.In the present invention, "peptide" has the advantage of high binding strength to the target material, and does not undergo denaturation even during heat/chemical treatment. In addition, since the molecular size is small, it can be attached to other proteins and used as a fusion protein. Specifically, it can be used as a diagnostic kit and drug delivery material because it can be used by attaching it to a polymer protein chain.
본 발명에서 "앱타머(aptamer)"는 그 자체로 안정된 삼차 구조를 가지면서 표적 분자에 높은 친화성과 특이성으로 결합할 수 있는 특징을 가진 특별한 종류의 단일가닥 핵산(DNA, RNA, 또는 변형핵산)으로 구성된 폴리뉴클레오티드의 일종을 의미한다. 상술한 바와 같이, 앱타머는 항체와 동일하게 항원성 물질에 특이적으로 결합할 수 있으면서도, 단백질보다 안정성이 높고, 구조가 간단하며, 합성이 용이한 폴리뉴클레오티드로 구성되어 있으므로, 항체를 대체하여 사용될 수 있다.In the present invention, "aptamer" is a special type of single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure and can bind to a target molecule with high affinity and specificity. It refers to a kind of polynucleotide composed of As described above, the aptamer can specifically bind to an antigenic substance in the same way as an antibody, but has higher stability than a protein, has a simple structure, and is composed of a polynucleotide that is easy to synthesize, so it can be used as an alternative to an antibody. can
본 발명에 따른 약학 조성물에 있어서, 상기 약학 조성물은 CD83 또는 CD83을 발현하는 세포에 의해 야기되거나 이와 연관되는 임의의 질환 또는 질병을 대상으로 할 수 있다. 예를 들어, 베체트병을 포함할 수 있다. 베체트병(Behcet's disease, BD)은 구강 궤양, 음부 궤양, 안구 염증 외에도 피부, 혈관, 위장관, 중추신경계, 심장 및 폐 등 여러 장기를 침범할 수 있는 희귀난치성 만성 염증성 질환으로, 본 발명이 예방 또는 치료하려는 표적이 베체트병에 한정되는 것은 아니다. 베체트병은 CD83의 발현이 높게 나타나는 질환으로, 이러한 베체트병과 관련되거나 베체트병에 의해 유발된 염증 질환, 및 CD83의 발현이 높게 나타나는 다른 질환들도 포함될 수 있다.In the pharmaceutical composition according to the present invention, the pharmaceutical composition may target any disease or disease caused by or associated with CD83 or a cell expressing CD83. For example, it may include Behcet's disease. Behcet's disease (BD) is a rare and incurable chronic inflammatory disease that can invade multiple organs, such as the skin, blood vessels, gastrointestinal tract, central nervous system, heart and lungs, in addition to oral ulcers, genital ulcers, and eye inflammation. The target to be treated is not limited to Behcet's disease. Behcet's disease is a disease in which CD83 expression is high, and inflammatory diseases related to or caused by Behçet's disease and other diseases in which CD83 expression is high may also be included.
본 발명에 따른 약학 조성물은 상기 제형에 따라 약학적으로 허용가능한 적절한 담체, 부형제 또는 희석제를 더 포함하여 제조할 수 있다. 상기 "약학적으로 허용가능한"이란, 상기 약학 조성물에 노출되는 세포나 인간에게 독성이 없는 특성을 나타내는 것을 의미한다.The pharmaceutical composition according to the present invention may be prepared by further including an appropriate pharmaceutically acceptable carrier, excipient or diluent according to the formulation. The "pharmaceutically acceptable" refers to exhibiting properties that are not toxic to cells or humans exposed to the pharmaceutical composition.
본 발명에서 사용가능한 담체, 부형제 또는 희석제로는, 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등을 들 수 있다.Carriers, excipients or diluents usable in the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil.
본 발명에 따른 약학 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.The pharmaceutical composition according to the present invention may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injection solutions according to conventional methods, respectively. there is.
본 발명에 따른 약학 조성물을 상기 형태로 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구 투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트(calciumcarbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제할 수 있다.When the pharmaceutical composition according to the present invention is formulated in the above form, it may be prepared using a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, and a surfactant. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient, for example, starch, calcium carbonate, sucrose or lactose. (lactose), gelatin, etc. can be mixed to prepare it.
또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. .
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
본 발명에 따른 약학 조성물에 있어서, 상기 약학 조성물은 약학적으로 유효한 양으로 투여될 수 있다. 상기 "약학적으로 유효한 양"이란, 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분하며 부작용을 일으키지 않을 정도의 양을 의미하며, 유효 용량 수준은 환자의 건강상태, 궤양의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 방법, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.In the pharmaceutical composition according to the present invention, the pharmaceutical composition may be administered in a pharmaceutically effective amount. The "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not to cause side effects, and the effective dose level is determined by the patient's health condition, Type, severity, drug activity, sensitivity to drug, administration method, administration time, administration route and excretion rate, treatment period, factors including drugs used in combination or concurrently, and other factors well known in the medical field. .
본 발명에 따른 약학 조성물의 유효성분의 사용량은 환자의 나이, 성별, 체중, 질환에 따라 달라질 수 있으나, 0.001 내지 100mg/kg으로, 바람직하게는 0.01 내지 10mg/kg을 일일 1회 내지 수회 투여할 수 있다. 또한, 본 발명에 따른 조성물의 투여량은 투여경로, 질병의 정도, 성별, 체중, 나이 등에 따라서 증감될 수 있다. 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.The amount of the active ingredient used in the pharmaceutical composition according to the present invention may vary depending on the patient's age, sex, weight, and disease, but is 0.001 to 100 mg/kg, preferably 0.01 to 10 mg/kg, administered once or several times a day. can In addition, the dosage of the composition according to the present invention may be increased or decreased depending on the route of administration, the degree of disease, sex, weight, age, and the like. Accordingly, the above dosage does not limit the scope of the present invention in any way.
상기 약학 조성물은 쥐, 생쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 기관지내 흡입, 자궁내 경막 또는 뇌혈관내(intracere-broventricular) 주사에 의해 투여될 수 있다.The pharmaceutical composition may be administered to mammals such as rats, mice, livestock, and humans by various routes. Any mode of administration can be envisaged, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, endobronchial inhalation, intrauterine dural or intracerebroventricular injection.
본 발명은 인체에서 분리된 생물학적 시료에 시험물질을 처리하는 제1 단계; 상기 시험물질을 처리한 시료에서 CD83 또는 CD83 mRNA의 발현 또는 활성 수준을 측정하는 제2 단계; 및 대조구 시료와 비교하여 상기 CD83 또는 상기 CD83 mRNA의 발현 또는 활성 수준이 감소한 시험물질을 선별하는 제3 단계;를 포함하는 베체트병의 예방 또는 치료용 약물 스크리닝 방법을 제공한다.The present invention provides a first step of treating a test substance in a biological sample isolated from the human body; a second step of measuring the expression or activity level of CD83 or CD83 mRNA in the sample treated with the test substance; and a third step of selecting a test substance in which the expression or activity level of the CD83 or the CD83 mRNA has decreased compared to the control sample; provides a method for screening a drug for preventing or treating Behcet's disease, including.
상기 인체에서 분리된 생물학적 시료는 상기 CD83 또는 상기 CD83 mRNA의 발현 또는 활성 수준에 있어서 상기 대조구와 차이가 나는 조직, 세포, 혈청 등의 시료를 포함할 수 있으나, 이에 한정되는 것은 아니다.The biological sample isolated from the human body may include, but is not limited to, a tissue, cell, serum, etc. sample that is different from the control in the expression or activity level of the CD83 or CD83 mRNA.
상기 시험물질은 상기 CD83 또는 상기 CD83 mRNA의 발현 또는 활성에 영향을 미치는지 여부를 검사하기 위하여 스크리닝에서 이용되는 물질로, 본 발명에 따른 CD83 억제제, 예를 들어, CD83 siRNA일 수 있다.The test substance is a substance used in screening to examine whether the CD83 or the CD83 mRNA expression or activity is affected, and may be a CD83 inhibitor according to the present invention, for example, CD83 siRNA.
상기 단백질 발현 또는 활성 수준은 웨스턴 블랏, 효소면역분석법(Enzyme-linked immunosorbent assay; ELISA), 방사선면역분석(Radioimmunoassay; RIA), 방사면역확산법(Radioimmunodiffusion), 오우크테로니 면역 확산법, 로케트(rocket) 면역 전기영동, 조직면역염색, 면역침전 분석법(Immunoprecipitation assay), 보체고정분석법(Complement Fixation Assay), 유세포 분석법(FACS) 및 단백질 칩으로 이루어진 군에서 선택된 어느 하나 이상의 방법으로 측정할 수 있으나, 이에 한정되는 것은 아니다.The protein expression or activity level was determined by Western blot, Enzyme-linked immunosorbent assay (ELISA), Radioimmunoassay (RIA), Radioimmunodiffusion, Oukteroni immune diffusion method, rocket Immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, flow cytometry (FACS) and protein chip can be measured by any one or more methods selected from the group consisting of, but limited thereto it's not going to be
상기 유전자의 발현 수준은 RT-PCR, 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RPA: RNase protection assay), 노던 블랏팅(Northern blotting) 및 DNA 마이크로 어레이 칩으로 이루어진 군에서 선택된 어느 하나 이상의 방법으로 측정할 수 있으나, 이에 한정되는 것은 아니다.The expression level of the gene was determined by RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting. blotting) and DNA microarray chip may be measured by any one or more methods selected from the group consisting of, but is not limited thereto.
본 발명은 CD83 또는 CD83 mRNA를 유효성분으로 포함하는 베체트병 진단용 바이오마커 조성물을 제공한다.The present invention provides a biomarker composition for diagnosing Behcet's disease comprising CD83 or CD83 mRNA as an active ingredient.
또한, 본 발명은 CD83 또는 CD83 mRNA의 활성 또는 발현 수준을 측정하는 제제를 포함하는 베체트병 진단용 조성물을 제공한다. 상기 제제는 상기 CD83에 특이적으로 결합하는 항체, 펩타이드, 펩타이드 미메틱스, 앱타머, 또는 화합물이거나, 또는 상기 CD83 mRNA에 특이적으로 결합하는 프라이머 또는 프로브일 수 있으나, 이제 한정되는 것은 아니다.In addition, the present invention provides a composition for diagnosing Behcet's disease, comprising an agent for measuring the activity or expression level of CD83 or CD83 mRNA. The agent may be an antibody, peptide, peptide mimetics, aptamer, or compound that specifically binds to the CD83, or a primer or probe that specifically binds to the CD83 mRNA, but is not limited thereto.
본 발명에서 "프라이머"는 짧은 자유 3말단 수산화기(free 3'hydroxl group)를 가지는 핵산 서열로, 상보적인 주형과 염기쌍을 형성할 수 있고 주형 가닥 복사를 위한 시작 시점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오타이드 트리포스페이트의 존재 하에서 DNA 합성을 개시할 수 있다. 본 발명에 따른 조성물에서, 상기 프라이머는, 상기 유전자 특이적인 프라이머로 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산일 수 있고, DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지않는 한, 추가의 특징을 혼입할 수 있다.In the present invention, "primer" refers to a nucleic acid sequence having a short free 3'hydroxl group, a short nucleic acid sequence capable of forming a base pair with a complementary template and serving as a starting point for template strand copying. it means. Primers are capable of initiating DNA synthesis in the presence of different 4 nucleotide triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature. In the composition according to the present invention, the primer may be a sense and antisense nucleic acid having a sequence of 7 to 50 nucleotides as the gene-specific primer, and does not change the basic properties of the primer serving as the starting point of DNA synthesis. As long as it is possible, additional features may be incorporated.
본 발명에서 "프로브"는 mRNA와 특이적으로 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며, 라벨링되어 있어서 특정 mRNA의 존재 유무, 발현양을 확인할 수 있다. 프로브는 올리고뉴클레오타이드(oligonucleotide) 프로브, 단쇄 DNA(single strand DNA) 프로브, 이중쇄 DNA(double strand DNA) 프로브, RNA 프로브 등의 형태로 형성될 수 있다. 적절한 프로브 및 혼성화 조건은 당해 기술 분야에 공지된 기술에 따라 적절히 선택될 수 있다.In the present invention, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases in length that can specifically bind to mRNA, and is labeled to determine the presence or absence of a specific mRNA, expression quantity can be checked. The probe may be formed in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, or the like. Appropriate probes and hybridization conditions may be appropriately selected according to techniques known in the art.
또한, 본 발명은 상기 진단용 조성물을 포함하는 베체트병 진단용 키트를 제공한다.In addition, the present invention provides a kit for diagnosing Behcet's disease comprising the diagnostic composition.
본 발명에 따른 진단용 키트는 CD83에 특이적인 항체를 포함하거나, CD83 mRNA의 센스, 안티센스 프라이머, 또는 상보적인 프로브를 포함할 수 있다.The diagnostic kit according to the present invention may include an antibody specific for CD83, or a sense, antisense primer, or complementary probe of CD83 mRNA.
이하, 실시예를 들어 본 발명을 보다 상세하게 설명하기로 한다. 다만 하기의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이며 본 발명의 내용을 예시하는 것일 뿐이므로 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail by way of examples. However, the following examples are provided to more completely explain the present invention to those with average knowledge in the art, and are only illustrative of the contents of the present invention, so that the scope of the present invention is limited to the following examples no.
[실험예][Experimental example]
베체트병 유사 마우스 모델Behcet's disease-like mouse model
ICR strain 5주령 마우스에 헤르페스 바이러스(Herpes simplex virus) 1형을 상처낸 귀이개에 접종하였다. 상기 마우스 중 피부 궤양, 홍반 등의 염증 증상을 동반하여 베체트병 특징을 보이는 마우스를 베체트병 유사 마우스 모델로 선정하여 본 실험에 사용하였다.ICR strain 5-week-old mice were inoculated with herpes
투여방법Administration method
CD83 siRNA 1.0μmol을 4일 간격으로 3회, 형질전환 시약(transfection reagent)에 섞어 복강 내 주사 하였다. 투여 시작 14일 후에 호전 여부를 확인하였다.1.0 μmol of CD83 siRNA was intraperitoneally injected three times with an interval of 4 days mixed with a transfection reagent. Improvement was confirmed 14 days after the start of administration.
CD83 siRNA sequence: CD83 siRNA sequence:
5'- GUGCUUUUCAGUCAUCUACAAGCTA -3'5'-GUGCUUUUCAGUCAUCUACAAGCTA -3'
3'- CUCACGAAAAGUCAGUAGAUGUUCGAU -5' 3'-CUCACGAAAAGUCAGUAGAUGUUCGAU -5'
실험결과Experiment result
도 1은 본 발명의 일 실험예에 따른 베체트병 유사 마우스 모델의 CD83 siRNA 처리 전 후 증상 변화를 나타낸다.1 shows the change in symptoms before and after CD83 siRNA treatment in a Behcet's disease-like mouse model according to an experimental example of the present invention.
도 1을 참조하면, 베체트병 유사 마우스 모델에서 CD83 siRNA 복강 내 주사 투여 전, 투여 시작 14일 후의 증상을 촬영하여 호전 여부를 비교한 결과, CD83 siRNA 복강 내 주사 투여 14일 후에 피부 발진과 피부 부종 증상이 확연한 호전을 보였고, 피부 궤양 증상이 호전되는 양상을 보였다.Referring to FIG. 1 , in a Behcet's disease-like mouse model, symptoms were photographed before CD83 siRNA intraperitoneal injection and 14 days after the start of administration to compare whether improvement was achieved. As a result, skin rash and
베체트병 마우스와 증상이 없는 대조군 마우스에서 CD83를 발현하는 세포의 빈도를 비교하였을 때, 베체트병 마우스에서 유의하게 높은 것으로 나타났고, CD83 siRNA는 정상 마우스의 말초혈액 세포의 세포막 위에서 CD83을 발현하는 세포의 빈도를 감소시켰으며, 베체트병 마우스의 말초혈액세포에서도 CD83를 발현하는 세포의 빈도를 감소시켰다. When the frequency of CD83-expressing cells was compared in Behcet's disease mice and asymptomatic control mice, it was found to be significantly higher in Behcet's disease mice, and CD83 siRNA was found on the cell membrane of peripheral blood cells of normal mice. also decreased the frequency of CD83-expressing cells in the peripheral blood cells of Behcet's disease mice.
도 2는 본 발명의 일 실험예에 따른 베체트병 유사 마우스 모델의 복강 내 대식세포(macrophage)의 CD83 발현(CD83+) 세포의 빈도를 나타낸 그래프이다.2 is a graph showing the frequency of CD83-expressing (CD83+) cells in the intraperitoneal cavity of a Behcet's disease-like mouse model according to an experimental example of the present invention.
도 2를 참조하면, 베체트병 마우스 복강에 CD83 siRNA 0.5μmol 또는 1.0μmol을 주사한 다음, 복강 내 대식세포를 분리하여 유세포 분석법(FACS)으로 CD83+ 세포 빈도를 조사한 결과, CD83 siRNA를 주사한 마우스에서 대조군보다 CD83+ 세포 빈도가 감소된 것으로 나타났다. 이를 통해, CD83 발현 세포의 증감과 베체트병 증상 사이에 관련성이 있음을 확인할 수 있다.Referring to FIG. 2 , after injecting 0.5 μmol or 1.0 μmol of CD83 siRNA into the abdominal cavity of a Behcet's disease mouse, intraperitoneal macrophages were isolated and the CD83+ cell frequency was investigated by flow cytometry (FACS). As a result, in mice injected with CD83 siRNA, It was found that the frequency of CD83+ cells was reduced compared to the control group. Through this, it can be confirmed that there is a relationship between the increase in CD83-expressing cells and the symptoms of Behcet's disease.
도 3은 본 발명의 일 실험예에 따른 베체트병 유사 마우스 모델에 CD83 siRNA 처리를 중단한 경우의 변화를 나타낸다.3 shows changes when CD83 siRNA treatment is stopped in a Behcet's disease-like mouse model according to an experimental example of the present invention.
도 3을 참조하면, 베체트병 마우스에 CD83 siRNA를 주사하여 증상이 호전된 후, 상기 마우스에 CD83 siRNA 처리를 중단하였을 때 증상이 다시 악화되는 것으로 나타났다. 이를 통해, 상기 마우스의 증상 호전이 CD83 siRNA 투여에 따른 치료 효과임을 확인할 수 있다.Referring to FIG. 3 , after CD83 siRNA injection into Behçet's disease mice improved symptoms, the symptoms worsened again when CD83 siRNA treatment was stopped in the mice. Through this, it can be confirmed that the improvement of the symptoms in the mice is a therapeutic effect according to the administration of CD83 siRNA.
도 4는 본 발명의 일 실험예에 따른 베체트병 유사 마우스 모델에서 분리한 수지상 세포에 CD83 siRNA 처리 후 투과전자현미경으로 관찰한 이미지이다.4 is an image observed with a transmission electron microscope after CD83 siRNA treatment in dendritic cells isolated from a Behcet's disease-like mouse model according to an experimental example of the present invention.
도 4를 참조하면, 베체트병 마우스의 골수(bone marrow)에서 분리한 단핵구(monocyte)를 인비트로(in vitro) 배양하여 수지상 세포로 분화시키는 과정에서 CD83 siRNA 0.5μmol 처리하여 투과전자현미경으로 관찰한 결과, 대조군(Scramble siRNA 처리)에 비하여 세포막의 수지상 돌기(dendrite)가 감소된 것으로 확인되었다.4, in the process of in vitro culture of monocytes isolated from the bone marrow of Behcet's disease mice and differentiating them into dendritic cells, 0.5 μmol of CD83 siRNA was treated and observed with a transmission electron microscope. As a result, it was confirmed that the dendrite of the cell membrane was reduced compared to the control (Scramble siRNA treatment).
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 즉, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다.As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.
<110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> COMPOSITION FOR PREVENTING OR TREATING BEHCET'S DISEASES CONTAINING CD83 INHIBITOR <130> ADP-2018-0309 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> CD83 siRNA <400> 1 gugcuuuuca gucaucuaca agcta 25 <210> 2 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> CD83 siRNA <400> 2 uagcuuguag augacugaaa agcacuc 27 <110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> COMPOSITION FOR PREVENTING OR TREATING BEHCET'S DISEASES CONTAINING CD83 INHIBITOR <130> ADP-2018-0309 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> CD83 siRNA <400> 1 gugcuuuuca gucaucuaca agcta 25 <210> 2 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> CD83 siRNA <400> 2 uagcuuguag augacugaaa agcacuc 27
Claims (10)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/KR2019/010015 WO2020054979A1 (en) | 2018-09-12 | 2019-08-08 | Composition comprising cd83 inhibitor as effective ingredient for preventing or treating behcet's disease |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020180108874 | 2018-09-12 | ||
KR20180108874 | 2018-09-12 |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20200030444A KR20200030444A (en) | 2020-03-20 |
KR102282341B1 true KR102282341B1 (en) | 2021-07-27 |
Family
ID=69958102
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020190096228A KR102282341B1 (en) | 2018-09-12 | 2019-08-07 | Composition for preventing or treating behcet's diseases containing cd83 inhibitor |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102282341B1 (en) |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1645290A1 (en) * | 1999-05-07 | 2006-04-12 | Genentech, Inc. | Treatment of autoimmune diseases with antagonists which bind to B cell surface markers |
KR20160104101A (en) | 2008-05-23 | 2016-09-02 | 아고스 쎄라퓨틱스, 인코포레이티드 | Novel soluble cd83 polypeptides, formulations and methods of use |
EP2530088A1 (en) * | 2011-05-30 | 2012-12-05 | Klinikum rechts der Isar der Technischen Universität München | Means and methods for diagnosing and treating multiple sclerosis |
KR20140141200A (en) * | 2013-05-31 | 2014-12-10 | 가톨릭대학교 산학협력단 | Pharmaceutical Composition Comprising RSK2 Inhibitor for Preventing or Treating Skin Cancer |
-
2019
- 2019-08-07 KR KR1020190096228A patent/KR102282341B1/en active IP Right Grant
Also Published As
Publication number | Publication date |
---|---|
KR20200030444A (en) | 2020-03-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP6527565B2 (en) | Method for treating hair loss disorders | |
CN107530431B (en) | Biomarkers | |
WO2013155980A1 (en) | Auto-immune disease-related microrna and use thereof | |
KR20170069262A (en) | Methods and compositions for treating a subject with a smad7 antisense oligonucleotide | |
JP6437467B2 (en) | Molecular targets and compounds useful in the treatment of fibrotic diseases and methods for identifying them | |
WO2017144689A1 (en) | Methods of treating celiac disease using smad7 inhibition | |
JP2022521997A (en) | Use of circular RNA in the preparation of drugs to treat systemic lupus erythematosus | |
US20200181620A1 (en) | Inhibitors of dek protein and related methods | |
ES2731232T3 (en) | Method and pharmaceutical composition for use in the treatment and prediction of myocardial infarction | |
US20140161769A1 (en) | Methods for treating inflammatory autoimmune disorders | |
US20180113139A1 (en) | Methods and compositions for diagnosing and treating inflammatory bowel disorders | |
EP3380615B1 (en) | Il-34 antisense oligonucleotides and methods of using same | |
KR20160130986A (en) | Asymmetric interfering rna compositions that silence k-ras and methods of uses thereof | |
KR102282341B1 (en) | Composition for preventing or treating behcet's diseases containing cd83 inhibitor | |
US20230002770A1 (en) | Il-34 antisense agents and methods of using same | |
WO2020054979A1 (en) | Composition comprising cd83 inhibitor as effective ingredient for preventing or treating behcet's disease | |
WO2014064192A1 (en) | Method and pharmaceutical composition for use in the treatment and prediction of myocardial infraction | |
US20240093197A1 (en) | Il-34 antisense agents and methods of using same | |
CN105886653B (en) | Molecular marker of endometrial cancer | |
US20220364184A1 (en) | Compositions and methods for treatment of a poor prognosis subtype of colorectal cancer | |
JP2024518602A (en) | IL-34 ANTISENSE AGENTS AND METHODS OF USING SAME - Patent application | |
KR101807590B1 (en) | Aptamer to il-17 and use thereof | |
WO2022243299A1 (en) | Il-34 antisense agents and methods of using same | |
US20220348916A1 (en) | Composition for diagnosis or treatment of a condition associated with increased activity of eif4e comprising an eif4e inhibitor | |
CN116983413A (en) | Application of PLEKHH2 in pulmonary arterial hypertension diagnosis and treatment |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |