KR102277406B1 - Novel excinuclease ABC subunit A variant and a method for producing L-glutamic acid using the same - Google Patents

Abstract

The present application relates to a novel exinuclease ABC subunit A variant, a Corynebacterium glutamicum strain comprising the variant and an L-glutamic acid production method using the strain. Provided is the exinuclease ABC subunit A variant, consisting of an amino acid sequence set forth in SEQ ID NO: 1, in which amino acid glycine corresponding to 575th position of an amino acid sequence of SEQ ID NO: 3 is substituted with aspartic acid.

Description

Novel excinuclease ABC subunit A variant and L-glutamic acid production method using the same {Novel excinuclease ABC subunit A variant and a method for producing L-glutamic acid using the same}

The present application relates to a novel exinuclease ABC subunit A variant, a Corynebacterium glutamicum strain comprising the variant, and a method for producing L-glutamic acid using the strain.

In order to produce L-amino acids and other useful substances, various studies are being conducted for the development of high-efficiency production microorganisms and fermentation process technology. For example, a target substance-specific approach such as increasing the expression of a gene encoding an enzyme involved in L-glutamic acid biosynthesis or removing a gene unnecessary for biosynthesis is mainly used (US 8206954 B2).

However, as the demand for L-glutamic acid increases, there is still a need for research to effectively increase the production capacity of L-glutamic acid.

One object of the present application is that glycine, which is an amino acid corresponding to position 575 of the amino acid sequence of SEQ ID NO: 3, is substituted with aspartic acid, consisting of the amino acid sequence set forth in SEQ ID NO: 1, exinuclea to provide a first ABC subunit A variant.

Another object of the present application is to provide a polynucleotide encoding the variant of the present application.

Another object of the present application is to provide a strain of Corynebacterium glutamicum, which includes the variant of the present application or a polynucleotide encoding the variant, and has L-glutamic acid production ability.

Another object of the present application is to include a variant or a polynucleotide encoding the variant, and having L-glutamic acid-producing ability, including the step of culturing a Corynebacterium glutamicum strain in a medium, L- To provide a method for producing glutamic acid.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below. In addition, a number of papers and patent documents are referenced throughout this specification and their citations are indicated. The disclosure contents of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly describe the level of the technical field to which the present invention pertains and the content of the present invention.

One aspect of the present application provides a variant, consisting of the amino acid sequence set forth in SEQ ID NO: 1, in which glycine, an amino acid corresponding to position 575 of the amino acid sequence of SEQ ID NO: 3, is substituted with aspartic acid do.

The variant of the present application may have or include the amino acid sequence set forth in SEQ ID NO: 1, or may consist essentially of the amino acid sequence.

In addition, in the variant of the present application, the amino acid corresponding to position 575 based on the amino acid sequence of SEQ ID NO: 3 in the amino acid sequence set forth in SEQ ID NO: 1 is aspartic acid, and at least 70% of the amino acid sequence set forth in SEQ ID NO: 1, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or an amino acid sequence having at least 99.9% homology or identity. In addition, as long as it is an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the variant of the present application, variants having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added are also included within the scope of the present application. is self-evident

For example, sequence additions or deletions, naturally occurring mutations, silent mutations or conservation in the N-terminus, C-terminus and/or within the amino acid sequence that do not alter the function of the variants of the present application It is a case of having an enemy substitution.

The term "conservative substitution" means substituting an amino acid for another amino acid having similar structural and/or chemical properties. Such amino acid substitutions may generally occur based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.

As used herein, the term "variant" means that one or more amino acids are conservatively substituted and/or modified so that they differ from the amino acid sequence before the mutation of the variant, but have functions or properties. refers to a polypeptide that is maintained. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. In addition, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, are removed. Other variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein. The term "variant" may be used interchangeably with terms such as mutant, modified, mutant polypeptide, mutated protein, mutant and mutant (in English, modified, modified polypeptide, modified protein, mutant, mutein, divergent, etc.) and, as long as it is a term used in a mutated sense, it is not limited thereto. For the purposes of the present application, the variant may be a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 in which glycine, which is an amino acid corresponding to position 575 of the amino acid sequence of SEQ ID NO: 3, is substituted with aspartic acid.

In addition, variants may contain deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, a signal (or leader) sequence involved in protein translocation may be conjugated to the N-terminus of the mutant, either co-translationally or post-translationally. The variants may also be conjugated with other sequences or linkers for identification, purification, or synthesis.

As used herein, the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage. The terms homology and identity can often be used interchangeably.

Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of the sequence under moderate or high stringent conditions. It is apparent that hybridization also includes hybridization with a polynucleotide containing a common codon in a polynucleotide or a codon in consideration of codon degeneracy.

Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444, using a known computer algorithm such as the “FASTA” program. or, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine (GCG program package (Devereux, J., et al, Nucleic Acids) Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop , [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073).For example, BLAST of the National Center for Biotechnology Information Database, or ClustalW can be used to determine homology, similarity or identity.

Homology, similarity or identity of polynucleotides or polypeptides is described, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, see, for example, Needleman et al. (1970), J Mol Biol. can be determined by comparing sequence information using a GAP computer program such as 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.

As an example of the present application, the variant of the present application may have exinuclease ABC subunit A activity. In addition, the mutant of the present application may have an activity such that the ability to produce L-glutamic acid is increased compared to the wild-type polypeptide having exinuclease ABC subunit A activity.

As used herein, the term "Excinuclease ABC subunit A" is a polypeptide that repairs DNA caused by UV damage. Specifically, exinuclease ABC subunit A of the present application may be used interchangeably as exciton nuclease subunit A, UvrABC endonuclease subunit A, or UvrA. In the present application, the sequence of the exinuclease ABC subunit A can be obtained from GenBank of NCBI, a known database. Specifically, it may be a polypeptide having exinuclease ABC subunit A activity encoded by uvrA, but is not limited thereto.

As used herein, the term “corresponding to” refers to an amino acid residue at a listed position in a polypeptide, or an amino acid residue that is similar, identical to, or homologous to a listed residue in a polypeptide. Identifying the amino acid at the corresponding position may be determining the specific amino acid of a sequence that refers to the specific sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

For example, any amino acid sequence is aligned with SEQ ID NO: 3, and based on this, each amino acid residue of the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 3 . For example, a sequence alignment algorithm such as that described in this application can identify the position of an amino acid, or a position at which modifications, such as substitutions, insertions, or deletions, occur compared to a query sequence (also referred to as a "reference sequence").

Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277), etc., but is not limited thereto, and a sequence alignment program, pairwise sequence comparison algorithm, etc. known in the art may be appropriately used.

Another aspect of the present application is to provide a polynucleotide encoding the variant of the present application.

As used herein, the term "polynucleotide" refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are linked in a long chain by covalent bonds, and more specifically, encoding the variant. polynucleotide fragments.

The polynucleotide encoding the variant of the present application may include a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1. As an example of the present application, the polynucleotide of the present application may have or include the sequence of SEQ ID NO: 2. In addition, the polynucleotide of the present application may consist of, or consist essentially of, the sequence of SEQ ID NO: 2.

In consideration of codon degeneracy or preferred codons in organisms that want to express the variants of the present application, the polynucleotides of the present application are various in the coding region within the range that does not change the amino acid sequence of the variants of the present application. Deformation can be made. Specifically, the polynucleotide of the present application has 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more homology or identity to the sequence of SEQ ID NO: 2 Having or including a nucleotide sequence that is more than, 98% or more, and less than 100%, or homology or identity with the sequence of SEQ ID NO: 2 is 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% of the base sequence may consist of or consist essentially of, but is not limited thereto. In this case, in the sequence having the homology or identity, the codon encoding the amino acid corresponding to the 575th position of SEQ ID NO: 1 may be one of the codons encoding aspartic acid.

In addition, the polynucleotide of the present application is a probe that can be prepared from a known gene sequence, for example, a sequence that can hybridize under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application, without limitation. may be included. The "stringent condition" refers to a condition that enables specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, polynucleotides with high homology or identity, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or a condition in which polynucleotides having 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize, or 60 ° C., which is a washing condition of conventional Southern hybridization, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, more specifically 68°C, 0.1×SSC, 0.1% SDS at a salt concentration and temperature equivalent to once, specifically twice The conditions for washing to 3 times can be enumerated.

Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the overall sequence.

Specifically, a polynucleotide having homology or identity to the polynucleotide of the present application can be detected using the hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60 °C, 63 °C or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.

The appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (eg, J. Sambrook et al., supra).

Another aspect of the present application is to provide a vector comprising the polynucleotide of the present application. The vector may be an expression vector for expressing the polynucleotide in a host cell, but is not limited thereto.

The vector of the present application may include a DNA preparation comprising a base sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) so that the target polypeptide can be expressed in a suitable host. can The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.

The vector used in the present application is not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors may be used. , pBluescript II-based, pGEM-based, pTZ-based, pCL-based, pET-based and the like can be used. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.

For example, a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion. The insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted. The selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. Markers to be given can be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.

As used herein, the term “transformation” refers to introducing a vector including a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell. In addition, the polynucleotide includes DNA and/or RNA encoding a target polypeptide. The polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression. The expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.

In addition, the term “operably linked” as used herein means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target variant of the present application and the polynucleotide sequence are functionally linked.

Another aspect of the present application, Corynebacterium glutamicum ( Corynebacterium glutamicum ) It is to provide a strain comprising the mutant of the present application or the polynucleotide of the present application.

The strain of the present application may include a vector comprising the variant polypeptide of the present application, a polynucleotide encoding the polypeptide, or the polynucleotide of the present application.

As used herein, the term "strain (or microorganism)" includes both wild-type microorganisms or microorganisms in which genetic modification has occurred naturally or artificially, and causes such as insertion of an external gene or enhanced or inactivated activity of an intrinsic gene Due to this, as a microorganism with a weakened or enhanced specific mechanism, it may be a microorganism containing genetic modification for the production of a desired polypeptide, protein or product.

The strain of the present application includes a strain comprising any one or more of a mutant of the present application, a polynucleotide of the present application, and a vector including the polynucleotide of the present application; a strain modified to express a variant of the present application or a polynucleotide of the present application; a variant of the present application, or a strain expressing the polynucleotide of the present application (eg, a recombinant strain); Or it may be a strain having the mutant activity of the present application (eg, a recombinant strain), but is not limited thereto.

The strain of the present application may be a strain having the ability to produce L-glutamic acid.

The strain of the present application is a microorganism naturally having exinuclease ABC subunit A or L-glutamic acid producing ability, or a mutant or It may be a microorganism into which a polynucleotide encoding the same (or a vector including the polynucleotide) has been introduced and/or imparted with L-glutamic acid production ability, but is not limited thereto.

As an example, the strain of the present application is transformed with a vector containing the polynucleotide of the present application or a polynucleotide encoding the variant of the present application, and expresses the variant of the present application as a cell or microorganism, The strains of the application may include all microorganisms capable of producing L-glutamic acid, including the variants of the present application. For example, in the strain of the present application, the exinuclease ABC subunit A variant is expressed by introducing a polynucleotide encoding the variant of the present application into a natural wild-type microorganism or a microorganism producing L-glutamic acid, and L-glutamic acid It may be a recombinant strain with increased production capacity. The recombinant strain having an increased ability to produce L-glutamic acid is a natural wild-type microorganism or exinuclease ABC subunit A unmodified microorganism (ie, a microorganism expressing wild-type exinuclease ABC subunit A (SEQ ID NO: 3) or The mutant (SEQ ID NO: 1) may be a microorganism having an increased ability to produce L-glutamic acid compared to a microorganism that does not express the protein, but is not limited thereto. For example, the target strain, exinuclease ABC subunit A unmodified microorganism for comparing the increase in the L-glutamic acid production ability, is the ATCC13869 strain or the ATCC13869 ΔodhA strain (Appl Environ Microbiol. 2007 Feb; 73(4)) :1308-19. Epub 2006 Dec 8.), but is not limited thereto.

For example, the recombinant strain with increased production capacity is about 1% or more, specifically 1% or more, about 2.5% or more, about 5% or more, about 6 compared to the L-glutamic acid production capacity of the parent strain or unmodified microorganism before mutation. % or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 10.5% or more, about 11% or more, about 11.5% or more, about 12% or more, about 12.5% or more, about 13 % or more, about 13.5% or more, about 14% or more, about 14.5% or more, about 15% or more, about 15.5% or more, about 16% or more, about 16.5% or more, about 17% or more, about 17.5% or more, about 18 % or more, about 18.5% or more, about 19% or more, about 19.5% or more, about 20% or more, about 20.5% or more, or about 21% or more (the upper limit is not particularly limited, for example, about 200% or less, about 150% or more) or less, about 100% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, or about 22% or less) , as long as it has an increased amount of + value compared to the production capacity of the parent strain or unmodified microorganism before mutation, but is not limited thereto. In another example, the recombinant strain with increased production capacity has an L-glutamic acid production capacity of about 1.1 times or more, about 1.12 times or more, about 1.13 times or more, 1.15 times or more, 1.16 times or more, compared to the parent strain or unmodified microorganism before mutation. , 1.17 times or more, 1.18 times or more, 1.19 times or more, 1.2 times or more, or 1.21 times or more (the upper limit is not particularly limited, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less. Yes) may be increased, but is not limited thereto. The term “about” is a range including all of ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all values in a range equal to or similar to the value following the term about, but not limited

As used herein, the term "unmodified microorganism" does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a wild-type strain or a natural-type strain itself, or a genetic variation caused by natural or artificial factors. It may mean the strain before being changed. For example, the unmodified microorganism may refer to a strain in which the exinuclease ABC subunit A variant described herein has not been introduced or has been introduced. The "unmodified microorganism" may be used interchangeably with "strain before modification", "microbe before modification", "unmodified strain", "unmodified strain", "unmodified microorganism" or "reference microorganism".

In another example of the present application, the microorganism of the present application is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Cory Nebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium callunae ( Corynebacterium callunae ), Corynebacterium stationis , Corynebacterium stationis , Corynebacterium singulare ( Corynebacterium singulare ), Corynebacterium halo Toledo lance (Corynebacterium halotolerans), Corynebacterium registry Atum (Corynebacterium striatum), Corynebacterium ammoniagenes to Ness (Corynebacterium ammoniagenes), Corynebacterium pole Ruti Solid (Corynebacterium pollutisoli), Corynebacterium already Tansu (Corynebacterium imitans ), Corynebacterium testudinoris ) or Corynebacterium flavescens ).

The microorganism of the present application may be a microorganism in which the activity of the OdhA protein is further weakened or inactivated.

As used herein, the term "weakening" of a polypeptide is a concept that includes both reduced or no activity compared to intrinsic activity. The attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, attenuation, and the like.

The attenuation is when the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., inhibiting the expression of the gene encoding the polynucleotide or translation into a polypeptide When the overall polypeptide activity level and/or concentration (expression amount) in the cell is lower than that of the native strain due to (translation) inhibition, etc., when the expression of the polynucleotide is not made at all, and/or when the expression of the polynucleotide is However, it may also include cases in which there is no activity of the polypeptide. The "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type or unmodified microorganism before the transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification". "Inactivation, deficiency, reduction, downregulation, reduction, attenuation" of the activity of the polypeptide compared to the intrinsic activity means that the activity of the specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation is lowered.

Attenuation of the activity of the polypeptide may be performed by any method known in the art, but is not limited thereto, and may be achieved by application of various methods well known in the art (eg, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

Specifically, the attenuation of the polypeptide of the present application is

1) deletion of all or part of a gene encoding a polypeptide;

2) modification of the expression control region (or expression control sequence) to reduce the expression of the gene encoding the polypeptide;

3) modification of the amino acid sequence constituting the polypeptide such that the activity of the polypeptide is eliminated or attenuated (eg, deletion/substitution/addition of one or more amino acids on the amino acid sequence);

4) modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or attenuated (e.g., one or more nucleobases on the nucleotide sequence of the polypeptide gene to encode a polypeptide modified such that the activity of the polypeptide is eliminated or attenuated) deletion/replacement/addition of);

5) modification of the nucleotide sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide;

6) introduction of an antisense oligonucleotide (eg, antisense RNA) that complementarily binds to the transcript of said gene encoding the polypeptide;

7) addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of the gene encoding the polypeptide to form a secondary structure that cannot be attached to the ribosome;

8) addition of a promoter transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE); or

9) It may be a combination of two or more selected from 1) to 8) above, but is not particularly limited thereto.

for example,

1) The deletion of a part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide in which some nucleotides are deleted, or replacement with a marker gene.

In addition, the above 2) modification of the expression control region (or expression control sequence), deletion, insertion, non-conservative or conservative substitution, or a combination thereof, mutation in the expression control region (or expression control sequence) occurs, or weaker replacement with an active sequence. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

In addition, 3) the base sequence modification encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base encoding another start codon having a lower polypeptide expression rate than the intrinsic start codon It may be substituted with a sequence, but is not limited thereto.

In addition, the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above deletes, inserts, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide. Or a combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto. For example, by introducing a mutation in the polynucleotide sequence to form a stop codon, the expression of a gene may be inhibited or attenuated, but is not limited thereto.

6) The introduction of an antisense oligonucleotide (eg, antisense RNA) complementary to the transcript of the gene encoding the polypeptide is described, for example, in Weintraub, H. et al., Antisense-RNA as a molecular tool. for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

7) The addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of the gene encoding the polypeptide to form a secondary structure that cannot be attached to the ribosome is mRNA translation It may make it impossible or slow it down.

8) the addition of a promoter transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) is an antisense complementary to the transcript of the gene encoding the polypeptide It may be to attenuate activity by making nucleotides.

As used herein, the term "enhancement" of a polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The reinforcement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, upregulation, overexpression, and increase may include those that exhibit an activity that was not originally possessed, or that exhibit improved activity compared to intrinsic activity or activity before modification. The “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. It can be used interchangeably.To "enhance", "upregulate", "overexpress" or "increase" the activity of a polypeptide compared to its intrinsic activity means that the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation. And / or concentration (expression amount) means improved compared to.

The enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and/or concentration (expression amount) of the endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from the increase in the level of activity, expression, or the amount of product excreted from the polypeptide.

The enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target polypeptide compared to the microorganism before modification. Specifically, it may be one using genetic engineering and/or protein engineering well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (eg, Sitnicka et al. Functional Analysis of Genes. Advances in Cell). Biology 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

Specifically, the enrichment of the polypeptide of the present application is

1) increasing the intracellular copy number of a polynucleotide encoding the polypeptide;

2) replacing the gene expression control region on the chromosome encoding the polypeptide with a sequence with strong activity;

3) modification of the nucleotide sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide;

4) modification of the amino acid sequence of said polypeptide to enhance polypeptide activity;

5) modification of the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide (eg, modification of the polynucleotide sequence of the polypeptide gene to encode a polypeptide modified to enhance the activity of the polypeptide);

6) introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

7) codon optimization of the polynucleotide encoding the polypeptide;

8) by analyzing the tertiary structure of the polypeptide to select an exposed site for modification or chemical modification; or

9) It may be a combination of two or more selected from 1) to 8) above, but is not particularly limited thereto.

More specifically,

1) The increase in the intracellular copy number of the polynucleotide encoding the polypeptide is achieved by introduction of a vector to which the polynucleotide encoding the polypeptide is operably linked, which can replicate and function independently of the host, into a host cell. it may be Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into a chromosome in a host cell. The introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome in the host cell into the host cell, but is not limited thereto. The vector is the same as described above.

2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence with strong activity is, for example, deletion, insertion, non-conservative or Conservative substitution or a combination thereof may result in a mutation in the sequence, or replacement with a sequence having a stronger activity. The expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence for regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a strong promoter, but is not limited thereto.

Examples of known strong promoters include CJ1 to CJ7 promoter (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but is not limited thereto.

3) The modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a nucleotide sequence encoding another start codon having a higher expression rate of the polypeptide compared to the intrinsic start codon. It may be a substitution, but is not limited thereto.

The modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide; A combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto. The replacement may be specifically performed by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto. In this case, the vector used may further include a selection marker for confirming whether or not the chromosome is inserted. The selection marker is the same as described above.

6) The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide may be introduction of the foreign polynucleotide encoding the polypeptide exhibiting the same/similar activity as the polypeptide into a host cell. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same/similar activity as the polypeptide. The method used for the introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a polypeptide and increase its activity.

7) Codon optimization of the polynucleotide encoding the polypeptide is codon-optimized so that the transcription or translation of the endogenous polynucleotide is increased in the host cell, or the transcription and translation of the foreign polynucleotide are optimized in the host cell. It may be that its codons are optimized so that the

8) Selecting an exposed site by analyzing the tertiary structure of the polypeptide and modifying or chemically modifying it, for example, compares the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored. Accordingly, it may be to determine a template protein candidate, check the structure based on it, select an exposed site to be modified or chemically modified, and modify or modify it.

Such enhancement of polypeptide activity may be an increase in the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or microbial strain prior to modification, or an increase in the amount of product produced from the polypeptide. However, the present invention is not limited thereto.

More specifically, the Corynebacterium glutamicum strain of the present application is a microorganism in which a polypeptide comprising SEQ ID NO: 17, a nucleotide encoding a polypeptide comprising SEQ ID NO: 17, or a nucleotide comprising SEQ ID NO: 18 is further deleted. can

Modification of part or all of the polynucleotide in the microorganism of the present application is (a) homologous recombination using a vector for chromosome insertion in the microorganism or genome correction using engineered nuclease (eg, CRISPR-Cas9) and/or (b) It may be induced by light and/or chemical treatments such as, but not limited to, ultraviolet and radiation. The method for modifying part or all of the gene may include a method by DNA recombination technology. For example, by injecting a nucleotide sequence or a vector including a nucleotide sequence homologous to a target gene into the microorganism to cause homologous recombination, a part or all of a gene may be deleted. The injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.

In the microorganism of the present application, variants, polynucleotides, L-glutamic acid, and the like are as described in the other aspects above.

Another aspect of the present application provides a method for producing L-glutamic acid, comprising the step of culturing a Corynebacterium glutamicum strain comprising a mutant of the present application or a polynucleotide of the present application in a medium.

The L-glutamic acid production method of the present application may include culturing a Corynebacterium glutamicum strain comprising the mutant of the present application or the polynucleotide of the present application or the vector of the present application in a medium.

In the present application, the term "cultivation" means growing the Corynebacterium glutamicum strain of the present application under moderately controlled environmental conditions. The culturing process of the present application may be made according to a suitable medium and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art according to the selected strain. Specifically, the culture may be a batch, continuous and/or fed-batch, but is not limited thereto.

As used herein, the term "medium" refers to a material in which nutrients required for culturing the Corynebacterium glutamicum strain of the present application are mixed as a main component, and nutrients including water essential for survival and growth and growth factors. Specifically, any medium and other culture conditions used for culturing the Corynebacterium glutamicum strain of the present application may be used without particular limitation as long as it is a medium used for culturing conventional microorganisms, but Corynebacterium glutamicum of the present application Lium glutamicum strain can be cultured while controlling temperature, pH, etc. under aerobic conditions in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid and / or vitamin and the like.

Specifically, the culture medium for the Corynebacterium sp. strain can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)].

As the carbon source in the present application, carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included. In addition, natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.

Examples of the nitrogen source include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.

The phosphorus may include potassium first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto. As the inorganic compound, sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or appropriate precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.

In addition, during the culture of the Corynebacterium glutamicum strain of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during culturing, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation. In addition, in order to maintain the aerobic state of the medium, oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without injection of gas or without injection of gas to maintain anaerobic and microaerobic conditions, which are limited thereto. it is not

In the culture of the present application, the culture temperature may be maintained at 20 to 45°C, specifically, 25 to 40°C, and may be cultured for about 10 to 160 hours, but is not limited thereto.

L-glutamic acid produced by the culture of the present application may be secreted into the medium or may remain in the cell.

The L- glutamic acid production method of the present application includes the steps of preparing the Corynebacterium glutamicum strain of the present application, preparing a medium for culturing the strain, or a combination thereof (regardless of the order, in any order) ), for example, prior to the culturing step, may further include.

The method for producing L- glutamic acid of the present application may further include recovering L- glutamic acid from the culture medium (cultured medium) or the Corynebacterium glutamicum strain. The recovering step may be further included after the culturing step.

The recovery may be to collect the desired L-glutamic acid using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method. . For example, centrifugation, filtration, treatment with a crystallized protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity Various chromatography such as island chromatography, HPLC, or a combination thereof may be used, and the desired L-glutamic acid may be recovered from the medium or microorganism using a suitable method known in the art.

In addition, the L-glutamic acid production method of the present application may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, when the L-glutamic acid production method of the present application includes both the recovery step and the purification step, the recovery step and the purification step are performed continuously or discontinuously, regardless of the order, or are integrated simultaneously or in one step may be performed, but is not limited thereto.

In the method of the present application, variants, polynucleotides, vectors, strains, and the like are as described in the other aspects above.

Another aspect of the present application is a Corynebacterium glutamicum strain comprising a variant of the present application, a polynucleotide encoding the variant, a vector including the polynucleotide or the polynucleotide of the present application; the culture medium; Or to provide a composition for the production of L- glutamic acid comprising a combination of two or more of them.

The composition of the present application may further include any suitable excipients commonly used in compositions for the production of amino acids, and these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc. However, the present invention is not limited thereto.

In the composition of the present application, variants, polynucleotides, vectors, strains, media and L-glutamic acid are the same as those described in the other aspects above.

In the case of culturing a Corynebacterium glutamicum strain comprising a variant of the exinuclease ABC subunit A of the present application, it is possible to produce L-glutamic acid in a high yield compared to a microorganism having an existing unmodified polypeptide.

1 is a schematic diagram of a pDCM2 plasmid.

Hereinafter, the present application will be described in more detail by way of Examples. However, the following examples are merely preferred embodiments for illustrating the present application, and therefore, are not intended to limit the scope of the present application thereto. On the other hand, technical matters not described in this specification can be sufficiently understood and easily implemented by those skilled in the art or similar technical fields of the present application.

Example 1: Construction of Plasmids

A plasmid (pDCM2, FIG. 1, SEQ ID NO: 19) for the insertion and replacement of genes in the Corynebacterium chromosome was designed, and the plasmid was synthesized using the Gene-synthesis service of Bionics Co., Ltd. A plasmid was designed to include a restriction enzyme that is easy to use for cloning with reference to the generally known sacB system related paper [Gene, 145 (1994) 69-73]. The thus synthesized pDCM2 plasmid has the following characteristics.

1) Since it has a replication origin that works only in E. coli, self-replication is possible in E. coli, but self-replication is impossible in Corynebacterium.

2) It has a kanamycin resistance gene as a selectable marker.

3) It has a Levan sucrose gene (sacB) as a secondary positive-selection marker.

4) No genetic information derived from the pDCM2 plasmid is left in the finally constructed strain.

Example 2: Exinuclease ABC Subunit A in Microorganisms Vector construction for mutant expression

In order to confirm the effect of the glycine at position 575 of the exinuclease ABC subunit A amino acid sequence (SEQ ID NO: 3) with aspartic acid on the production of L-glutamic acid, the mutant (G575D; SEQ ID NO: 1) was produced. A vector was prepared as follows.

Using the gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13869 as a template, PCR was performed using a pair of primers of SEQ ID NOs: 5 and 6 and a pair of primers of SEQ ID NOs: 7 and 8, respectively. Using the mixture of the two fragments obtained above as a template, overlapping PCR was performed again using the primer pair of SEQ ID NO: 5 and SEQ ID NO: 8 to obtain a fragment. After denaturing at 94°C for 5 minutes, PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes. The pDCM2 vector was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting plasmid was named pDCM2-uvrA (G575D).

Example 3: Production of wild-type Corynebacterium glutamicum-derived L-glutamic acid production strain and exinuclease ABC subunit A mutant introduction strain production

Example 3-1: Preparation of Corynebacterium glutamicum strain having L-glutamic acid-producing ability derived from wild-type Corynebacterium glutamicum

Corynebacterium glutamicum ATCC13869-derived odhA based on the prior literature (Appl Environ Microbiol. 2007 Feb; 73(4): 1308-19. Epub 2006 Dec 8.) to produce a strain having L-glutamic acid-producing ability derived from ATCC13869. A strain of Corynebacterium glutamicum ATCC13869 ΔodhA in which the gene was deleted was prepared.

Specifically, PCR was performed using the primer pairs of SEQ ID NO: 11 and SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14 using Corynebacterium glutamicum ATCC13869 chromosomal DNA as a template for odhA deletion. Using the mixture of the two fragments obtained above as a template, overlapping PCR was performed again using the primer pair of SEQ ID NO: 11 and SEQ ID NO: 14 to obtain a fragment. After denaturing at 94°C for 5 minutes, PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes. The pDCM2 vector was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting plasmid was named pDCM2-ΔodhA.

The prepared pDCM2-ΔodhA vector was transformed into the Corynebacterium glutamicum ATCC13869 strain by electroporation, and then a strain in which the odhA gene was deleted on the chromosome was obtained through a secondary crossover process. The gene deletion was confirmed through PCR and genome sequencing using SEQ ID NO: 15 and SEQ ID NO: 16, and the prepared strain was named ATCC13869 ΔodhA.

The primer sequences used herein are shown in Table 1 below.

SEQ ID NO: designation order 11 odhA_up_F TGAATTCGAGCTCGGTACCCTTGAACGGAATTGGGTGG 12 odhA_up_R CCCAGGTGGCATCGGTACCTTCACCCAGCCGCCACGCAG 13 odhA_down_F CGCTGGGTGAAGGTACCGATGCCACCTGGGTTGGTCAAG 14 odhA_down_R GTCGACTCTAGAGGATCCCCGGACAAGGAATGGAGAGA 15 odhA_del_F CTTACCGTTGTTGCCCTT 16 odhA_del_R CTCCTTCACCCACATCATT

Example 3-2: Exinuclease ABC Subunit A Production of variant expression strains

The vector prepared in Example 2 was transformed into ATCC13869ΔodhA prepared in Example 3-1.

In the strain in which the homologous recombination occurred, the strain into which the mutant was introduced was selected using SEQ ID NOs: 9 and 10. Each selected strain was named ATCC13869 ΔodhA_uvrA_G575D.

Example 3-3: Comparison of L-glutamic acid production ability of exinuclease ABC subunit A mutant expression strains

In order to confirm the L-glutamic acid production ability of the strain prepared in Example 3-1, the strain ATCC13869 ΔodhA was used as a control and cultured in the following manner.

Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium, and incubated at 30° C. for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium and cultured with shaking at 30° C. for 40 hours at 200 rpm. After completion of the culture, L-glutamic acid production capacity was measured using high performance liquid chromatography (HPLC), and the measurement results are shown in Table 2 below. The glutamic acid concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 2 below.

<Servant Place>

Glucose 1%, broth 0.5%, polypeptone 1%, sodium chloride 0.25%, yeast extract 0.5%, agar 2%, urea 0.2%, pH 7.2

<Production medium>

Raw sugar 6%, calcium carbonate 5%, ammonium sulfate 2.25%, potassium monophosphate 0.1%, magnesium sulfate 0.04%, iron sulfate 10 mg/L, thiamine hydrochloride 0.2 mg/L, biotin 50㎍/L

strain name L-glutamic acid concentration (g/L) L-glutamic acid concentration increase rate (%) ATCC13869 △odhA 1.9 - ATCC13869 △odhA_uvrA_G575D 2.3 21.1

As shown in Table 2, it was confirmed that the concentration of L-glutamic acid was significantly increased in ATCC13869 ΔodhA_uvrA_G575D into which the uvrA_G575D gene was introduced compared to the ATCC13869 ΔodhA strain.

The ATCC13869 △odhA_uvrA_G575D was named CA02-1612, and was deposited with the Korea Microorganism Conservation Center, a trustee institution under the Budapest Treaty on November 30, 2020, and was given an accession number KCCM12853P.

From the above description, those skilled in the art to which the present application pertains will understand that the present application may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present application should be construed as including all changes or modifications derived from the meaning and scope of the claims to be described later rather than the above detailed description and equivalent concepts thereof.

Korea Microorganism Conservation Center (Overseas) KCCM12853P 20201130

<110> CJ CheilJedang Corporation <120> Novel excinuclease ABC subunit A variant and a method for producing L-glutamic acid using the same <130> KPA201585-KR <160> 19 <170> KoPatentIn 3.0 <210> 1 <211> 949 <212> PRT <213> Unknown <220> <223> excinuclease ABC subunit A variant amino acid sequence <400> 1 Met Ala Asp Arg Leu Val Val Arg Gly Ala Arg Glu His Asn Leu Lys 1 5 10 15 Gly Val Asp Ile Asp Leu Pro Arg Asp Ser Met Val Val Phe Thr Gly 20 25 30 Leu Ser Gly Ser Gly Lys Ser Ser Leu Ala Phe Asp Thr Ile Phe Ala 35 40 45 Glu Gly Gln Arg Arg Tyr Val Glu Ser Leu Ser Ser Tyr Ala Arg Met 50 55 60 Phe Leu Gly Gln Met Asp Lys Pro Asp Val Asp Leu Ile Asp Gly Leu 65 70 75 80 Ser Pro Ala Val Ser Ile Asp Gln Lys Ser Thr Asn Arg Asn Pro Arg 85 90 95 Ser Thr Val Gly Thr Ile Thr Glu Val Tyr Asp Tyr Leu Arg Leu Leu 100 105 110 Tyr Ala Arg Ala Gly Thr Ala His Cys Pro Val Cys Asp Ala Arg Val 115 120 125 Glu Arg Gln Thr Pro Gln Gln Met Val Asp Gln Ile Leu Gly Met Glu 130 135 140 Glu Gly Leu Lys Phe Gln Ile Leu Ala Pro Val Val Arg Thr Arg Lys 145 150 155 160 Gly Glu Phe Val Asp Leu Phe Ala Asp Leu Ala Ser Gln Gly Tyr Ser 165 170 175 Arg Val Arg Val Asp Gly Glu Val His Gln Leu Ser Asp Pro Lys 180 185 190 Leu Glu Lys Gln Ile Lys His Asp Ile Asp Val Val Val Asp Arg Leu 195 200 205 Gln Val Lys Ala Ser Gln Lys Gln Arg Leu Thr Asp Ser Met Glu Thr 210 215 220 Ala Leu Arg Leu Ala Asp Gly Val Ala Val Leu Glu Phe Val Gly Leu 225 230 235 240 Glu Glu Asp Asp Pro Asn Arg Leu Arg Arg Phe Ser Glu Lys Met Ser 245 250 255 Cys Pro Asn Gly His Ala Leu Thr Val Asp Glu Leu Glu Pro Arg Ala 260 265 270 Phe Ser Phe Asn Ser Pro Tyr Gly Ala Cys Pro Ala Cys Asp Gly Leu 275 280 285 Gly Val Arg Thr Glu Val Asp Ile Asp Leu Ile Ile Pro Asp Pro Asp 290 295 300 Ala Pro Ala Thr Lys Ala Val Gln Pro Trp Asn Ser Ser Pro Asn His 305 310 315 320 Ser Tyr Phe Glu Lys Leu Ile Glu Gly Leu Ala Lys Ala Leu Gly Phe 325 330 335 Asp Pro Glu Thr Pro Tyr Ser Glu Leu Thr Ala Ala Gln Lys Lys Ala 340 345 350 Leu Val Tyr Gly Ser Lys Glu Glu Val Ser Val Arg Tyr Lys Asn Arg 355 360 365 Tyr Gly Arg Val Arg Ser Trp Thr Ala Pro Phe Glu Gly Val Met Gly 370 375 380 Tyr Phe Asp Arg Lys Leu Glu Gln Thr Asp Ser Glu Thr Gln Lys Asp 385 390 395 400 Arg Leu Leu Gly Tyr Thr Arg Glu Val Pro Cys Pro Thr Cys Lys Gly 405 410 415 Ala Arg Leu Lys Pro Glu Ile Leu Ala Val Arg Leu Asp Ser Gly Ser 420 425 430 His Gly Ala Leu Ser Ile Ala Gly Leu Thr Ala Leu Ser Val His Glu 435 440 445 Ala Phe Glu Phe Leu Asp Asn Leu Thr Leu Gly Lys Arg Glu Glu Met 450 455 460 Ile Ala Gly Ala Val Leu Arg Glu Ile His Ala Arg Leu Lys Phe Leu 465 470 475 480 Leu Asp Val Gly Leu Ser Tyr Leu Thr Leu Asp Arg Ala Ala Gly Thr 485 490 495 Leu Ser Gly Gly Glu Ala Gln Arg Ile Arg Leu Ala Thr Gln Ile Gly 500 505 510 Ser Gly Leu Ala Gly Val Leu Tyr Val Leu Asp Glu Pro Ser Ile Gly 515 520 525 Leu His Gln Arg Asp Asn Gln Arg Leu Ile Thr Thr Leu Glu His Leu 530 535 540 Arg Asp Ile Gly Asn Thr Leu Ile Val Val Glu His Asp Glu Asp Thr 545 550 555 560 Ile Arg Arg Ala Asp Trp Leu Val Asp Ile Gly Pro Arg Ala Asp Glu 565 570 575 Phe Gly Gly Glu Val Val Tyr Gln Gly Glu Pro Lys Gly Ile Leu Asp 580 585 590 Cys Glu Glu Ser Leu Thr Gly Ala Tyr Leu Ser Gly Arg Arg Thr Leu 595 600 605 Gly Val Pro Asp Thr Arg Arg Glu Ile Asp Lys Glu Arg Gln Leu Lys 610 615 620 Val Val Gly Ala Arg Glu Asn Asn Leu Arg Gly Ile Asp Val Lys Ile 625 630 635 640 Pro Leu Gly Val Leu Cys Cys Ile Thr Gly Val Ser Gly Ser Gly Lys 645 650 655 Ser Thr Leu Val Asn Gln Ile Leu Ala Lys Val Leu Ala Asn Lys Leu 660 665 670 Asn Arg Ala Arg Gln Val Pro Gly Arg Ala Lys Arg Val Glu Gly Leu 675 680 685 Glu His Leu Asp Lys Leu Val Gln Val Asp Gln Ser Pro Ile Gly Arg 690 695 700 Thr Pro Arg Ser Asn Pro Ala Thr Tyr Thr Gly Val Phe Asp Lys Val 705 710 715 720 Arg Asn Leu Phe Ala Glu Thr Thr Glu Ala Lys Val Arg Gly Tyr Lys 725 730 735 Pro Gly Arg Phe Ser Phe Asn Ile Lys Gly Gly Arg Cys Glu Ala Cys 740 745 750 Gln Gly Asp Gly Thr Leu Lys Ile Glu Met Asn Phe Leu Pro Asp Val 755 760 765 Tyr Val Pro Cys Glu Val Cys Asp Gly Gln Arg Tyr Asn Arg Glu Thr 770 775 780 Leu Glu Val Lys Tyr Lys Gly Lys Asn Ile Ala Glu Val Leu Gly Met 785 790 795 800 Pro Ile Ser Glu Ala Ala Asp Phe Phe Glu Pro Ile Thr Ser Ile His 805 810 815 Arg Tyr Leu Ala Thr Leu Val Asp Val Gly Leu Gly Tyr Val Arg Leu 820 825 830 Gly Gln Ala Ala Thr Thr Leu Ser Gly Gly Glu Ala Gln Arg Val Lys 835 840 845 Leu Ala Ala Glu Leu Gln Lys Arg Ser Asn Gly Arg Thr Val Tyr Ile 850 855 860 Leu Asp Glu Pro Thr Thr Gly Leu His Phe Glu Asp Ile Arg Lys Leu 865 870 875 880 Met Met Val Ile Gln Gly Leu Val Asp Lys Gly Asn Ser Val Ile Ile 885 890 895 Ile Glu His Asn Leu Asp Val Ile Lys Ala Ala Asp Trp Ile Val Asp 900 905 910 Met Gly Pro Glu Gly Gly Ser Gly Gly Gly Thr Val Val Ala Glu Gly 915 920 925 Thr Pro Glu Gln Val Ala Glu Val Ala Gly Ser Tyr Thr Gly Gln Phe 930 935 940 Leu Lys Glu Leu Leu 945 <210> 2 <211> 2850 <212> DNA <213> Unknown <220> <223> excinuclease ABC subunit A variant nucleotide sequence <400> 2 ttggctgatc gcctcgtagt gcgcggagcg cgtgaacaca acctaaaagg cgtggatatt 60 gatctgccac gcgactcgat ggtggtgttc accggcctgt caggttccgg taaatcatca 120 ctggcctttg acaccatctt tgcggaaggc cagcgccgtt acgtggagtc gttgtccagt 180 tacgcccgca tgttcttggg gcagatggac aagccggacg tggatttgat tgatggatta 240 tccccagcgg tctccattga ccaaaagtcc accaaccgca accctcggtc caccgtcggt 300 accatcacgg aagtctatga ctacctgcgt cttctgtatg cccgcgctgg taccgcacac 360 tgcccagtgt gtgatgcccg cgtggagcgt caaaccccgc agcagatggt ggaccagatc 420 cttggcatgg aggagggact gaagttccaa atccttgcgc ctgtggtgcg tacccgtaaa 480 ggtgagttcg ttgatctttt cgcagatctt gcatcccaag gttattcccg cgtgcgggtt 540 gatggggaag tgcaccagct ctcggatcct ccaaagctag aaaagcagat caagcacgat 600 attgatgttg tggttgaccg tctgcaggta aaagccagcc aaaagcagcg cctgacagac 660 tctatggaaa ccgcacttcg cctggccgat ggcgtggctg tgctggagtt cgttggcctg 720 gaggaagatg atccgaatag gcttcgtcga ttctctgaaa agatgagctg ccctaacggt 780 cacgcgttga cggttgatga gctggagcct cgtgcttttt ccttcaactc tccttatggc 840 gcgtgtcctg cctgtgatgg cttgggtgtg cgcaccgaag ttgatattga tctgatcatc 900 ccagatccag atgcacctgc aactaaagcg gttcagccct ggaactccag cccaaaccac 960 tcttactttg aaaagctcat tgaaggcctg gcgaaagccc tcggatttga tccggaaact 1020 ccgtacagtg agctcaccgc agctcaaaag aaggctctgg tctatggatc gaaggaagaa 1080 gtaagcgttc gatacaagaa ccgctacgga cgcgtgcgtt cttggactgc gccttttgaa 1140 ggtgtcatgg gctactttga tcgcaagttg gagcagactg attccgaaac ccaaaaagac 1200 cgactgttgg gctacacccg tgaagtgccc tgcccaacct gtaaaggcgc acgcctcaag 1260 ccggaaatct tggccgtacg cctagactcc ggaagccatg gagcgttgtc cattgctgga 1320 ctaaccgcgc tgtcggtgca tgaagcattc gagtttttgg ataacctcac actgggcaag 1380 cgcgaggaaa tgatcgcggg agctgtgctg agggaaattc acgcccgcct gaaattcttg 1440 cttgacgtgg gcctttccta cctcaccctt gatcgcgccg caggcaccct gtctggtggt 1500 gaagcgcagc gtatccgcct ggctactcaa attggttccg gtctggctgg tgtgctctac 1560 gtcttggatg agccatccat tggtctgcac caacgtgaca accagcgctt aatcactacc 1620 cttgagcatc tccgagatat cggaaacaca ctcattgttg tggaacacga tgaagacacc 1680 atcaggcgcg cagattggct cgtggatatt ggtcctcgag ctgatgaatt tggtggtgaa 1740 gtggtctacc aaggtgagcc gaagggcatt ttggactgcg aagaatccct cacaggtgct 1800 tacttgtctg gtcgtcgaac cctgggtgtt cctgatactc gccgtgagat cgacaaagag 1860 cgacagctca aggtggttgg tgctagggaa aacaacctgc ggggcatcga tgtgaaaatc 1920 ccactgggtg tgctgtgctg catcactggt gtgtcgggat ctggtaaatc cacgctggtc 1980 aatcagattt tggccaaggt tctggccaac aaactcaacc gcgcacgcca agtgcctggt 2040 cgcgcaaagc gggtggaagg cctcgagcac ttggataagt tggtccaggt ggatcagtcg 2100 ccaattggtc gtactccacg ttcaaaccca gcgacgtaca cgggtgtgtt tgataaagtc 2160 cgtaaccttt ttgccgagac cactgaagcg aaggtccgcg gttacaagcc tggccgcttc 2220 tccttcaata ttaagggtgg acgctgcgaa gcatgtcagg gcgatggcac gctgaagatc 2280 gaaatgaact tcctgcccga cgtgtatgtt ccgtgtgaag tctgtgatgg tcagcgctac 2340 aaccgcgaga ccctcgaggt gaagtacaag ggcaaaaaca tcgctgaagt attgggcatg 2400 ccgatctctg aggctgcgga cttctttgag cccatcacct caattcaccg atacctagca 2460 acgctggttg atgtcggcct tggctatgtc cgtttgggcc aggcagcaac aaccttgtct 2520 ggtggtgaag cccagcgtgt gaaacttgcc gctgagctgc agaagcgttc caacggtcgc 2580 accgtttaca tcctcgatga gccaactact ggtttgcact ttgaagatat tcgcaaactc 2640 atgatggtga tccaaggcct ggtggacaag ggtaactccg tgatcatcat cgagcacaac 2700 ctcgacgtga tcaaggctgc cgactggatc gtggacatgg gtccagaagg cggaagcggc 2760 ggtggaactg tggtcgctga aggaacccca gagcaagttg ctgaagttgc gggttcctac 2820 accggccaat tccttaaaga gttgttgtag 2850 <210> 3 <211> 949 <212> PRT <213> Unknown <220> <223> excinuclease ABC subunit A amino acid sequence <400> 3 Met Ala Asp Arg Leu Val Val Arg Gly Ala Arg Glu His Asn Leu Lys 1 5 10 15 Gly Val Asp Ile Asp Leu Pro Arg Asp Ser Met Val Val Phe Thr Gly 20 25 30 Leu Ser Gly Ser Gly Lys Ser Ser Leu Ala Phe Asp Thr Ile Phe Ala 35 40 45 Glu Gly Gln Arg Arg Tyr Val Glu Ser Leu Ser Ser Tyr Ala Arg Met 50 55 60 Phe Leu Gly Gln Met Asp Lys Pro Asp Val Asp Leu Ile Asp Gly Leu 65 70 75 80 Ser Pro Ala Val Ser Ile Asp Gln Lys Ser Thr Asn Arg Asn Pro Arg 85 90 95 Ser Thr Val Gly Thr Ile Thr Glu Val Tyr Asp Tyr Leu Arg Leu Leu 100 105 110 Tyr Ala Arg Ala Gly Thr Ala His Cys Pro Val Cys Asp Ala Arg Val 115 120 125 Glu Arg Gln Thr Pro Gln Gln Met Val Asp Gln Ile Leu Gly Met Glu 130 135 140 Glu Gly Leu Lys Phe Gln Ile Leu Ala Pro Val Val Arg Thr Arg Lys 145 150 155 160 Gly Glu Phe Val Asp Leu Phe Ala Asp Leu Ala Ser Gln Gly Tyr Ser 165 170 175 Arg Val Arg Val Asp Gly Glu Val His Gln Leu Ser Asp Pro Lys 180 185 190 Leu Glu Lys Gln Ile Lys His Asp Ile Asp Val Val Val Asp Arg Leu 195 200 205 Gln Val Lys Ala Ser Gln Lys Gln Arg Leu Thr Asp Ser Met Glu Thr 210 215 220 Ala Leu Arg Leu Ala Asp Gly Val Ala Val Leu Glu Phe Val Gly Leu 225 230 235 240 Glu Glu Asp Asp Pro Asn Arg Leu Arg Arg Phe Ser Glu Lys Met Ser 245 250 255 Cys Pro Asn Gly His Ala Leu Thr Val Asp Glu Leu Glu Pro Arg Ala 260 265 270 Phe Ser Phe Asn Ser Pro Tyr Gly Ala Cys Pro Ala Cys Asp Gly Leu 275 280 285 Gly Val Arg Thr Glu Val Asp Ile Asp Leu Ile Ile Pro Asp Pro Asp 290 295 300 Ala Pro Ala Thr Lys Ala Val Gln Pro Trp Asn Ser Ser Pro Asn His 305 310 315 320 Ser Tyr Phe Glu Lys Leu Ile Glu Gly Leu Ala Lys Ala Leu Gly Phe 325 330 335 Asp Pro Glu Thr Pro Tyr Ser Glu Leu Thr Ala Ala Gln Lys Lys Ala 340 345 350 Leu Val Tyr Gly Ser Lys Glu Glu Val Ser Val Arg Tyr Lys Asn Arg 355 360 365 Tyr Gly Arg Val Arg Ser Trp Thr Ala Pro Phe Glu Gly Val Met Gly 370 375 380 Tyr Phe Asp Arg Lys Leu Glu Gln Thr Asp Ser Glu Thr Gln Lys Asp 385 390 395 400 Arg Leu Leu Gly Tyr Thr Arg Glu Val Pro Cys Pro Thr Cys Lys Gly 405 410 415 Ala Arg Leu Lys Pro Glu Ile Leu Ala Val Arg Leu Asp Ser Gly Ser 420 425 430 His Gly Ala Leu Ser Ile Ala Gly Leu Thr Ala Leu Ser Val His Glu 435 440 445 Ala Phe Glu Phe Leu Asp Asn Leu Thr Leu Gly Lys Arg Glu Glu Met 450 455 460 Ile Ala Gly Ala Val Leu Arg Glu Ile His Ala Arg Leu Lys Phe Leu 465 470 475 480 Leu Asp Val Gly Leu Ser Tyr Leu Thr Leu Asp Arg Ala Ala Gly Thr 485 490 495 Leu Ser Gly Gly Glu Ala Gln Arg Ile Arg Leu Ala Thr Gln Ile Gly 500 505 510 Ser Gly Leu Ala Gly Val Leu Tyr Val Leu Asp Glu Pro Ser Ile Gly 515 520 525 Leu His Gln Arg Asp Asn Gln Arg Leu Ile Thr Thr Leu Glu His Leu 530 535 540 Arg Asp Ile Gly Asn Thr Leu Ile Val Val Glu His Asp Glu Asp Thr 545 550 555 560 Ile Arg Arg Ala Asp Trp Leu Val Asp Ile Gly Pro Arg Ala Gly Glu 565 570 575 Phe Gly Gly Glu Val Val Tyr Gln Gly Glu Pro Lys Gly Ile Leu Asp 580 585 590 Cys Glu Glu Ser Leu Thr Gly Ala Tyr Leu Ser Gly Arg Arg Thr Leu 595 600 605 Gly Val Pro Asp Thr Arg Arg Glu Ile Asp Lys Glu Arg Gln Leu Lys 610 615 620 Val Val Gly Ala Arg Glu Asn Asn Leu Arg Gly Ile Asp Val Lys Ile 625 630 635 640 Pro Leu Gly Val Leu Cys Cys Ile Thr Gly Val Ser Gly Ser Gly Lys 645 650 655 Ser Thr Leu Val Asn Gln Ile Leu Ala Lys Val Leu Ala Asn Lys Leu 660 665 670 Asn Arg Ala Arg Gln Val Pro Gly Arg Ala Lys Arg Val Glu Gly Leu 675 680 685 Glu His Leu Asp Lys Leu Val Gln Val Asp Gln Ser Pro Ile Gly Arg 690 695 700 Thr Pro Arg Ser Asn Pro Ala Thr Tyr Thr Gly Val Phe Asp Lys Val 705 710 715 720 Arg Asn Leu Phe Ala Glu Thr Thr Glu Ala Lys Val Arg Gly Tyr Lys 725 730 735 Pro Gly Arg Phe Ser Phe Asn Ile Lys Gly Gly Arg Cys Glu Ala Cys 740 745 750 Gln Gly Asp Gly Thr Leu Lys Ile Glu Met Asn Phe Leu Pro Asp Val 755 760 765 Tyr Val Pro Cys Glu Val Cys Asp Gly Gln Arg Tyr Asn Arg Glu Thr 770 775 780 Leu Glu Val Lys Tyr Lys Gly Lys Asn Ile Ala Glu Val Leu Gly Met 785 790 795 800 Pro Ile Ser Glu Ala Ala Asp Phe Phe Glu Pro Ile Thr Ser Ile His 805 810 815 Arg Tyr Leu Ala Thr Leu Val Asp Val Gly Leu Gly Tyr Val Arg Leu 820 825 830 Gly Gln Ala Ala Thr Thr Leu Ser Gly Gly Glu Ala Gln Arg Val Lys 835 840 845 Leu Ala Ala Glu Leu Gln Lys Arg Ser Asn Gly Arg Thr Val Tyr Ile 850 855 860 Leu Asp Glu Pro Thr Thr Gly Leu His Phe Glu Asp Ile Arg Lys Leu 865 870 875 880 Met Met Val Ile Gln Gly Leu Val Asp Lys Gly Asn Ser Val Ile Ile 885 890 895 Ile Glu His Asn Leu Asp Val Ile Lys Ala Ala Asp Trp Ile Val Asp 900 905 910 Met Gly Pro Glu Gly Gly Ser Gly Gly Gly Thr Val Val Ala Glu Gly 915 920 925 Thr Pro Glu Gln Val Ala Glu Val Ala Gly Ser Tyr Thr Gly Gln Phe 930 935 940 Leu Lys Glu Leu Leu 945 <210> 4 <211> 2850 <212> DNA <213> Unknown <220> <223> excinuclease ABC subunit A nucleotide sequence <400> 4 ttggctgatc gcctcgtagt gcgcggagcg cgtgaacaca acctaaaagg cgtggatatt 60 gatctgccac gcgactcgat ggtggtgttc accggcctgt caggttccgg taaatcatca 120 ctggcctttg acaccatctt tgcggaaggc cagcgccgtt acgtggagtc gttgtccagt 180 tacgcccgca tgttcttggg gcagatggac aagccggacg tggatttgat tgatggatta 240 tccccagcgg tctccattga ccaaaagtcc accaaccgca accctcggtc caccgtcggt 300 accatcacgg aagtctatga ctacctgcgt cttctgtatg cccgcgctgg taccgcacac 360 tgcccagtgt gtgatgcccg cgtggagcgt caaaccccgc agcagatggt ggaccagatc 420 cttggcatgg aggagggact gaagttccaa atccttgcgc ctgtggtgcg tacccgtaaa 480 ggtgagttcg ttgatctttt cgcagatctt gcatcccaag gttattcccg cgtgcgggtt 540 gatggggaag tgcaccagct ctcggatcct ccaaagctag aaaagcagat caagcacgat 600 attgatgttg tggttgaccg tctgcaggta aaagccagcc aaaagcagcg cctgacagac 660 tctatggaaa ccgcacttcg cctggccgat ggcgtggctg tgctggagtt cgttggcctg 720 gaggaagatg atccgaatag gcttcgtcga ttctctgaaa agatgagctg ccctaacggt 780 cacgcgttga cggttgatga gctggagcct cgtgcttttt ccttcaactc tccttatggc 840 gcgtgtcctg cctgtgatgg cttgggtgtg cgcaccgaag ttgatattga tctgatcatc 900 ccagatccag atgcacctgc aactaaagcg gttcagccct ggaactccag cccaaaccac 960 tcttactttg aaaagctcat tgaaggcctg gcgaaagccc tcggatttga tccggaaact 1020 ccgtacagtg agctcaccgc agctcaaaag aaggctctgg tctatggatc gaaggaagaa 1080 gtaagcgttc gatacaagaa ccgctacgga cgcgtgcgtt cttggactgc gccttttgaa 1140 ggtgtcatgg gctactttga tcgcaagttg gagcagactg attccgaaac ccaaaaagac 1200 cgactgttgg gctacacccg tgaagtgccc tgcccaacct gtaaaggcgc acgcctcaag 1260 ccggaaatct tggccgtacg cctagactcc ggaagccatg gagcgttgtc cattgctgga 1320 ctaaccgcgc tgtcggtgca tgaagcattc gagtttttgg ataacctcac actgggcaag 1380 cgcgaggaaa tgatcgcggg agctgtgctg agggaaattc acgcccgcct gaaattcttg 1440 cttgacgtgg gcctttccta cctcaccctt gatcgcgccg caggcaccct gtctggtggt 1500 gaagcgcagc gtatccgcct ggctactcaa attggttccg gtctggctgg tgtgctctac 1560 gtcttggatg agccatccat tggtctgcac caacgtgaca accagcgctt aatcactacc 1620 cttgagcatc tccgagatat cggaaacaca ctcattgttg tggaacacga tgaagacacc 1680 atcaggcgcg cagattggct cgtggatatt ggtcctcgag ctggtgaatt tggtggtgaa 1740 gtggtctacc aaggtgagcc gaagggcatt ttggactgcg aagaatccct cacaggtgct 1800 tacttgtctg gtcgtcgaac cctgggtgtt cctgatactc gccgtgagat cgacaaagag 1860 cgacagctca aggtggttgg tgctagggaa aacaacctgc ggggcatcga tgtgaaaatc 1920 ccactgggtg tgctgtgctg catcactggt gtgtcgggat ctggtaaatc cacgctggtc 1980 aatcagattt tggccaaggt tctggccaac aaactcaacc gcgcacgcca agtgcctggt 2040 cgcgcaaagc gggtggaagg cctcgagcac ttggataagt tggtccaggt ggatcagtcg 2100 ccaattggtc gtactccacg ttcaaaccca gcgacgtaca cgggtgtgtt tgataaagtc 2160 cgtaaccttt ttgccgagac cactgaagcg aaggtccgcg gttacaagcc tggccgcttc 2220 tccttcaata ttaagggtgg acgctgcgaa gcatgtcagg gcgatggcac gctgaagatc 2280 gaaatgaact tcctgcccga cgtgtatgtt ccgtgtgaag tctgtgatgg tcagcgctac 2340 aaccgcgaga ccctcgaggt gaagtacaag ggcaaaaaca tcgctgaagt attgggcatg 2400 ccgatctctg aggctgcgga cttctttgag cccatcacct caattcaccg atacctagca 2460 acgctggttg atgtcggcct tggctatgtc cgtttgggcc aggcagcaac aaccttgtct 2520 ggtggtgaag cccagcgtgt gaaacttgcc gctgagctgc agaagcgttc caacggtcgc 2580 accgtttaca tcctcgatga gccaactact ggtttgcact ttgaagatat tcgcaaactc 2640 atgatggtga tccaaggcct ggtggacaag ggtaactccg tgatcatcat cgagcacaac 2700 ctcgacgtga tcaaggctgc cgactggatc gtggacatgg gtccagaagg cggaagcggc 2760 ggtggaactg tggtcgctga aggaacccca gagcaagttg ctgaagttgc gggttcctac 2820 accggccaat tccttaaaga gttgttgtag 2850 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer 1F <400> 5 tcgagctcgg tacccagtgc cctgcccaac ctgta 35 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer 2R <400> 6 ccaaattcat cagctcgagg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer 3F <400> 7 cctcgagctg atgaatttgg 20 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer 4R <400> 8 ctctagagga tccccaggag aagcggccag gcttg 35 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer 5F <400> 9 agtgccctgc ccaacctgta 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer 6R <400> 10 aggagaagcg gccaggcttg 20 <210> 11 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer odhA_up_F <400> 11 tgaattcgag ctcggtaccc ttgaacggaa ttgggtgg 38 <210> 12 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer odhA_up_R <400> 12 cccaggtggc atcggtacct tcacccagcg ccacgcag 38 <210> 13 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer odhA_down_F <400> 13 cgctgggtga aggtaccgat gccacctggg ttggtcaag 39 <210> 14 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer odhA_down_R <400> 14 gtcgactcta gaggatcccc ggacaaggaa tggagaga 38 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer odhA_del_F <400> 15 cttaccgttg ttgccctt 18 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer odhA_del_R <400> 16 ctccttcacc cacatcatt 19 <210> 17 <211> 1205 <212> PRT <213> Unknown <220> <223> OdhA amino acid sequence <400> 17 Met Phe Gln Gln Phe Gln Lys Asp Pro Lys Ser Val Asp Lys Glu Trp 1 5 10 15 Arg Glu Leu Phe Glu Ala Gln Gly Gly Pro Asn Ala Thr Pro Ala Thr 20 25 30 Thr Glu Ala Gln Pro Ser Ala Pro Lys Glu Ser Ala Lys Pro Ala Pro 35 40 45 Lys Ala Ala Pro Ala Ala Lys Ala Ala Pro Arg Val Glu Thr Lys Pro 50 55 60 Ala Ala Lys Thr Ala Pro Lys Ala Lys Glu Ser Ser Val Pro Gln Gln 65 70 75 80 Pro Lys Leu Pro Glu Pro Gly Gln Thr Pro Ile Arg Gly Ile Phe Lys 85 90 95 Ser Ile Ala Lys Asn Met Asp Ile Ser Leu Glu Ile Pro Thr Ala Thr 100 105 110 Ser Val Arg Asp Met Pro Ala Arg Leu Met Phe Glu Asn Arg Ala Met 115 120 125 Val Asn Asp Gln Leu Lys Arg Thr Arg Gly Gly Lys Ile Ser Phe Thr 130 135 140 His Ile Ile Gly Tyr Ala Met Val Lys Ala Val Met Ala His Pro Asp 145 150 155 160 Met Asn Asn Ser Tyr Asp Val Ile Asp Gly Lys Pro Thr Leu Ile Val 165 170 175 Pro Glu His Ile Asn Leu Gly Leu Ala Ile Asp Leu Pro Gln Lys Asp 180 185 190 Gly Ser Arg Ala Leu Val Val Ala Ala Ile Lys Glu Thr Glu Lys Met 195 200 205 Asn Phe Ser Glu Phe Leu Ala Ala Tyr Glu Asp Ile Val Thr Arg Ser 210 215 220 Arg Lys Gly Lys Leu Thr Met Asp Asp Tyr Gln Gly Val Thr Val Ser 225 230 235 240 Leu Thr Asn Pro Gly Gly Ile Gly Thr Arg His Ser Val Pro Arg Leu 245 250 255 Thr Lys Gly Gln Gly Thr Ile Ile Gly Val Gly Ser Met Asp Tyr Pro 260 265 270 Ala Glu Phe Gln Gly Ala Ser Glu Asp Arg Leu Ala Glu Leu Gly Val 275 280 285 Gly Lys Leu Val Thr Ile Thr Ser Thr Tyr Asp His Arg Val Ile Gln 290 295 300 Gly Ala Val Ser Gly Glu Phe Leu Arg Thr Met Ser Arg Leu Leu Thr 305 310 315 320 Asp Asp Ser Phe Trp Asp Glu Ile Phe Asp Ala Met Asn Val Pro Tyr 325 330 335 Thr Pro Met Arg Trp Ala Gln Asp Val Pro Asn Thr Gly Val Asp Lys 340 345 350 Asn Thr Arg Val Met Gln Leu Ile Glu Ala Tyr Arg Ser Arg Gly His 355 360 365 Leu Ile Ala Asp Thr Asn Pro Leu Ser Trp Val Gln Pro Gly Met Pro 370 375 380 Val Pro Asp His Arg Asp Leu Asp Ile Glu Thr His Ser Leu Thr Ile 385 390 395 400 Trp Asp Leu Asp Arg Thr Phe Ser Val Gly Gly Phe Gly Gly Lys Glu 405 410 415 Thr Met Thr Leu Arg Glu Val Leu Ser Arg Leu Arg Ala Ala Tyr Thr 420 425 430 Leu Lys Val Gly Ser Glu Tyr Thr His Ile Leu Asp Arg Asp Glu Arg 435 440 445 Thr Trp Leu Gln Asp Arg Leu Glu Ala Gly Met Pro Lys Pro Thr Gln 450 455 460 Ala Glu Gln Lys Tyr Ile Leu Gln Lys Leu Asn Ala Ala Glu Ala Phe 465 470 475 480 Glu Asn Phe Leu Gln Thr Lys Tyr Val Gly Gln Lys Arg Phe Ser Leu 485 490 495 Glu Gly Ala Glu Ala Leu Ile Pro Leu Met Asp Ser Ala Ile Asp Thr 500 505 510 Ala Ala Gly Gln Gly Leu Asp Glu Val Val Ile Gly Met Pro His Arg 515 520 525 Gly Arg Leu Asn Val Leu Phe Asn Ile Val Gly Lys Pro Leu Ala Ser 530 535 540 Ile Phe Asn Glu Phe Glu Gly Gln Met Glu Gln Gly Gln Ile Gly Gly 545 550 555 560 Ser Gly Asp Val Lys Tyr His Leu Gly Ser Glu Gly Gln His Leu Gln 565 570 575 Met Phe Gly Asp Gly Glu Ile Lys Val Ser Leu Thr Ala Asn Pro Ser 580 585 590 His Leu Glu Ala Val Asn Pro Val Met Glu Gly Ile Val Arg Ala Lys 595 600 605 Gln Asp Tyr Leu Asp Lys Gly Val Asp Gly Lys Thr Val Val Pro Leu 610 615 620 Leu Leu His Gly Asp Ala Ala Phe Ala Gly Leu Gly Ile Val Pro Glu 625 630 635 640 Thr Ile Asn Leu Ala Lys Leu Arg Gly Tyr Asp Val Gly Gly Thr Ile 645 650 655 His Ile Val Val Asn Asn Gln Ile Gly Phe Thr Thr Thr Pro Asp Ser 660 665 670 Ser Arg Ser Met His Tyr Ala Thr Asp Tyr Ala Lys Ala Phe Gly Cys 675 680 685 Pro Val Phe His Val Asn Gly Asp Asp Pro Glu Ala Val Val Trp Val 690 695 700 Gly Gln Leu Ala Thr Glu Tyr Arg Arg Arg Phe Gly Lys Asp Val Phe 705 710 715 720 Ile Asp Leu Val Cys Tyr Arg Leu Arg Gly His Asn Glu Ala Asp Asp 725 730 735 Pro Ser Met Thr Gln Pro Lys Met Tyr Glu Leu Ile Thr Gly Arg Glu 740 745 750 Thr Val Arg Ala Gln Tyr Thr Glu Asp Leu Leu Gly Arg Gly Asp Leu 755 760 765 Ser Asn Glu Asp Ala Glu Ala Val Val Arg Asp Phe His Asp Gln Met 770 775 780 Glu Ser Val Phe Asn Glu Val Lys Glu Gly Gly Lys Lys Gln Ala Glu 785 790 795 800 Ala Gln Thr Gly Ile Thr Gly Ser Gln Lys Leu Pro His Gly Leu Glu 805 810 815 Thr Asn Ile Ser Arg Glu Glu Leu Leu Glu Leu Gly Gln Ala Phe Ala 820 825 830 Asn Thr Pro Glu Gly Phe Asn Tyr His Pro Arg Val Ala Pro Val Ala 835 840 845 Lys Lys Arg Val Ser Ser Val Thr Glu Gly Gly Ile Asp Trp Ala Trp 850 855 860 Gly Glu Leu Leu Ala Phe Gly Ser Leu Ala Asn Ser Gly Arg Leu Val 865 870 875 880 Arg Leu Ala Gly Glu Asp Ser Arg Arg Gly Thr Phe Thr Gln Arg His 885 890 895 Ala Val Ala Ile Asp Pro Ala Thr Ala Glu Glu Phe Asn Pro Leu His 900 905 910 Glu Leu Ala Gln Ser Lys Gly Asn Asn Gly Lys Phe Leu Val Tyr Asn 915 920 925 Ser Ala Leu Thr Glu Tyr Ala Gly Met Gly Phe Glu Tyr Gly Tyr Ser 930 935 940 Val Gly Asn Glu Asp Ser Val Val Ala Trp Glu Ala Gln Phe Gly Asp 945 950 955 960 Phe Ala Asn Gly Ala Gln Thr Ile Ile Asp Glu Tyr Val Ser Ser Gly 965 970 975 Glu Ala Lys Trp Gly Gln Thr Ser Lys Leu Ile Leu Leu Leu Pro His 980 985 990 Gly Tyr Glu Gly Gln Gly Pro Asp His Ser Ser Ala Arg Ile Glu Arg 995 1000 1005 Phe Leu Gln Leu Cys Ala Glu Gly Ser Met Thr Val Ala Gln Pro Ser 1010 1015 1020 Thr Pro Ala Asn His Phe His Leu Leu Arg Arg His Ala Leu Ser Asp 1025 1030 1035 1040 Leu Lys Arg Pro Leu Val Ile Phe Thr Pro Lys Ser Met Leu Arg Asn 1045 1050 1055 Lys Ala Ala Ala Ser Ala Pro Glu Asp Phe Thr Glu Val Thr Lys Phe 1060 1065 1070 Gln Ser Val Ile Asp Asp Pro Asn Val Ala Asp Ala Ala Lys Val Lys 1075 1080 1085 Lys Val Met Leu Val Ser Gly Lys Leu Tyr Tyr Glu Leu Ala Lys Arg 1090 1095 1100 Lys Glu Lys Asp Gly Arg Asp Asp Ile Ala Ile Val Arg Ile Glu Met 1105 1110 1115 1120 Leu His Pro Ile Pro Phe Asn Arg Ile Ser Glu Ala Leu Ala Gly Tyr 1125 1130 1135 Pro Asn Ala Glu Glu Val Leu Phe Val Gln Asp Glu Pro Ala Asn Gln 1140 1145 1150 Gly Pro Trp Pro Phe Tyr Gln Glu His Leu Pro Glu Leu Ile Pro Asn 1155 1160 1165 Met Pro Lys Met Arg Arg Val Ser Arg Arg Ala Gln Ser Ser Thr Ala 1170 1175 1180 Thr Gly Val Ala Lys Val His Gln Leu Glu Glu Lys Gln Leu Ile Asp 1185 1190 1195 1200 Glu Ala Phe Glu Ala 1205 <210> 18 <211> 3618 <212> DNA <213> Unknown <220> <223> OdhA nucleotide sequence <400> 18 atgttccagc agttccagaa ggaccccaag tccgtggaca aggaatggag agaactcttt 60 gaggcgcagg ggggaccaaa tgctaccccc gctacaacag aagcacagcc ttcagcgccc 120 aaggagtctg cgaaaccagc accaaaggct gcccctgcag ccaaggcagc accgcgcgta 180 gaaaccaagc cggccgccaa gaccgcccct aaggccaagg agtcctcagt gccacagcaa 240 cctaagcttc cggagccagg acaaacccca atcaggggta ttttcaagtc catcgcgaag 300 aacatggata tctccctgga aatcccaacc gcaacctcgg ttcgcgatat gccagctcgc 360 ctcatgttcg aaaaccgcgc gatggtcaac gatcagctca agcgcacccg cggtggcaag 420 atctccttca cccacatcat tggctacgcc atggtgaagg cagtcatggc tcacccggac 480 atgaacaact cctacgacgt catcgacggc aagccaaccc tgatcgtgcc tgagcacatc 540 aacctgggcc ttgccatcga ccttcctcag aaggacggct cccgcgcact tgtcgtagca 600 gccatcaagg aaaccgagaa gatgaacttc tccgagttcc tcgcagcata cgaagacatc 660 gtgacacgct cccgcaaggg caagctcacc atggatgact accagggcgt taccgtttcc 720 ttgaccaacc caggtggcat cggtacccgc cactctgtcc cacgtctgac caagggccag 780 ggcaccatca tcggtgtcgg ttccatggat tacccagcag agttccaggg cgcttccgaa 840 gaccgccttg cagagctcgg cgttggcaag cttgtcacca tcacctccac ctacgatcac 900 cgcgtgatcc agggtgctgt gtccggtgaa ttcctgcgta ccatgtctcg cctgctcacc 960 gatgattcct tctgggatga gatcttcgac gcaatgaacg ttccttacac cccaatgcgt 1020 tgggcacagg acgttccaaa caccggtgtt gataagaaca cccgcgtcat gcagctcatt 1080 gaggcatacc gctcccgtgg acacctcatc gctgacacca acccactttc atgggttcag 1140 cctggcatgc cagttccaga ccaccgcgac ctcgacatcg agacccacag cctgaccatc 1200 tgggatctgg accgtacctt cagcgtcggt ggcttcggcg gcaaggagac catgaccctg 1260 cgcgaggtac tgtcccgcct gcgcgctgcc tacaccttga aggtcggctc cgaatacacc 1320 cacatcctgg accgcgacga gcgcacctgg ctgcaggacc gcctcgaagc cggaatgcca 1380 aagccaaccc aggcagagca gaagtacatc ctgcagaagc tgaacgccgc agaggctttc 1440 gagaacttcc tgcagaccaa gtacgtcggc cagaagcgct tctccctcga aggtgcagaa 1500 gctctcatcc cactgatgga ctccgccatc gacaccgccg caggccaggg cctcgacgaa 1560 gttgtcatcg gtatgccaca ccgtggtcgc ctcaacgtgc tgttcaacat cgtgggcaag 1620 ccactggcat ccatcttcaa cgagtttgaa ggccaaatgg agcagggcca gatcggtggc 1680 tccggtgacg tgaagtacca cctcggttcc gaaggccagc acctgcagat gttcggcgac 1740 ggcgagatca aggtctccct gactgctaac ccgtcccacc tggaagctgt taacccagtg 1800 atggaaggta tcgtccgcgc aaagcaggac tacctggaca agggcgtaga cggcaagact 1860 gttgtgccac tgctgctcca cggtgacgct gcattcgcag gcctgggcat cgtgccagaa 1920 accatcaacc tggctaagct gcgtggctac gacgtcggag gcaccatcca catcgtggtg 1980 aacaaccaga tcggcttcac caccacccca gactccagcc gctccatgca ctacgcaacc 2040 gactacgcca aggcattcgg ctgcccagtc ttccacgtca atggtgatga cccagaggca 2100 gttgtctggg ttggccagct ggcaaccgag taccgtcgtc gcttcggcaa ggacgtcttc 2160 atcgacctcg tttgctaccg cctccgcggc cacaacgaag ctgatgatcc ttccatgacc 2220 cagccaaaga tgtatgagct catcaccggc cgcgagaccg ttcgtgctca gtacaccgaa 2280 gacctgctcg gacgtggaga cctctccaac gaagatgcag aagcagtcgt ccgcgacttc 2340 cacgaccaga tggaatctgt gttcaacgaa gtcaaggaag gcggcaagaa gcaggctgag 2400 gcacagaccg gcatcaccgg ctcccagaag cttccacacg gccttgagac caacatctcc 2460 cgtgaagagc tcctggaact gggacaggct ttcgccaaca ccccagaagg cttcaactac 2520 cacccacgtg tggctccagt tgctaagaag cgcgtctcct ctgtcaccga aggtggcatc 2580 gactgggcat ggggcgagct cctcgccttc ggttccctgg ctaactccgg ccgcttggtt 2640 cgccttgcag gtgaagattc ccgccgcggt accttcaccc agcgccacgc agttgccatc 2700 gacccagcga ccgctgaaga gttcaaccca ctccacgagc ttgcacagtc caagggcaac 2760 aacggtaagt tcctggtcta caactccgca ctgaccgagt acgcaggcat gggcttcgag 2820 tacggctact ccgtaggaaa cgaagactcc gtcgttgcat gggaagcaca gttcggcgac 2880 ttcgccaacg gcgctcagac catcatcgat gagtacgtct cctcaggcga agctaagtgg 2940 ggccagacct ccaagctgat ccttctgctg cctcacggct acgaaggcca gggcccagac 3000 cactcttccg cacgtatcga gcgcttcctg cagctgtgcg ctgagggttc catgactgtt 3060 gctcagccat ccaccccagc aaaccacttc cacctgctgc gtcgtcacgc tctgtccgac 3120 ctgaagcgtc cactggttat cttcaccccg aagtccatgc tgcgtaacaa ggctgctgcc 3180 tccgcaccag aagacttcac tgaggtcacc aagttccaat ccgtgatcga cgatccaaac 3240 gttgcagatg cagccaaggt gaagaaggtc atgctggtct ccggcaagct gtactacgaa 3300 ttggcaaagc gcaaggagaa ggacggacgc gacgacatcg cgatcgttcg tatcgaaatg 3360 ctccacccaa ttccgttcaa ccgcatctcc gaggctcttg ccggctaccc taacgctgag 3420 gaagtcctct tcgttcagga tgagccagca aaccagggcc catggccgtt ctaccaggag 3480 cacctcccag agctgatccc gaacatgcca aagatgcgcc gcgtttcccg ccgcgctcag 3540 tcctccaccg caactggtgt tgctaaggtg caccagctgg aggagaagca gcttatcgac 3600 gaggctttcg aggcttaa 3618 <210> 19 <211> 5803 <212> DNA <213> Artificial Sequence <220> <223> pDCM2 nucleotide sequence <400> 19 gttcgcttgc tgtccataaa accgcccagt ctagctatcg ccatgtaagc ccactgcaag 60 ctacctgctt tctctttgcg cttgcgtttt cccttgtcca gatagcccag tagctgacat 120 tcatccgggg tcagcaccgt ttctgcggac tggctttcta cgtgttccgc ttcctttagc 180 agcccttgcg ccctgagtgc ttgcggcagc gtgaagctag cttttatcgc cattcgccat 240 tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc 300 tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt 360 cacgacgttg taaaacgacg gccagtgaat tcgagctcgg tacccgggga tcctctagag 420 tcgacctgca ggcatgcaag cttggcgtaa tcatggtcat agctgtttcc tgtgtgaaat 480 tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg taaagcctgg 540 ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc cgctttccag 600 tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt 660 ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg 720 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg 780 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 840 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 900 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 960 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 1020 tttctccctt cgggaagcgt ggcgctttct caatgctcac gctgtaggta tctcagttcg 1080 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 1140 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 1200 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 1260 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct 1320 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc 1380 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 1440 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 1500 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttgggg 1560 tgggcgaaga actccagcat gagatccccg cgctggagga tcatccagcc ctgatagaaa 1620 cagaagccac tggagcacct caaaaacacc atcatacact aaatcagtaa gttggcagca 1680 tcacccgacg cactttgcgc cgaataaata cctgtgacgg aagatcactt cgcagaataa 1740 ataaatcctg gtgtccctgt tgataccggg aagccctggg ccaacttttg gcgaaaatga 1800 gacgttgatc ggcacgtaag aggttccaac tttcaccata atgaaataag atcactaccg 1860 ggcgtatttt ttgagttatc gagattttca ggagctgata gaaacagaag ccactggagc 1920 acctcaaaaa caccatcata cactaaatca gtaagttggc agcatcaccc gacgcacttt 1980 gcgccgaata aatacctgtg acggaagatc acttcgcaga ataaataaat cctggtgtcc 2040 ctgttgatac cgggaagccc tgggccaact tttggcgaaa atgagacgtt gatcggcacg 2100 taagaggttc caactttcac cataatgaaa taagatcact accgggcgta ttttttgagt 2160 tatcgagatt ttcaggagct ctttggcatc gtctctcgcc tgtcccctca gttcagtaat 2220 ttcctgcatt tgcctgtttc cagtcggtag atattccaca aaacagcagg gaagcagcgc 2280 ttttccgctg cataaccctg cttcggggtc attatagcga ttttttcggt atatccatcc 2340 tttttcgcac gatatacagg attttgccaa agggttcgtg tagactttcc ttggtgtatc 2400 caacggcgtc agccgggcag gataggtgaa gtaggcccac ccgcgagcgg gtgttccttc 2460 ttcactgtcc cttattcgca cctggcggtg ctcaacggga atcctgctct gcgaggctgg 2520 ccggctaccg ccggcgtaac agatgagggc aagcggatgg ctgatgaaac caagccaacc 2580 aggaagggca gcccacctat caaggtgtac tgccttccag acgaacgaag agcgattgag 2640 gaaaaggcgg cggcggccgg catgagcctg tcggcctacc tgctggccgt cggccagggc 2700 tacaaaatca cgggcgtcgt ggactatgag cacgtccgcg agggcgtccc ggaaaacgat 2760 tccgaagccc aacctttcat agaaggcggc ggtggaatcg aaatctcgtg atggcaggtt 2820 gggcgtcgct tggtcggtca tttcgaaaaa ggttaggaat acggttagcc atttgcctgc 2880 ttttatatag ttcantatgg gattcacctt tatgttgata agaaataaaa gaaaatgcca 2940 ataggatatc ggcattttct tttgcgtttt tatttgttaa ctgttaattg tccttgttca 3000 aggatgctgt ctttgacaac agatgttttc ttgcctttga tgttcagcag gaagctcggc 3060 gcaaacgttg attgtttgtc tgcgtagaat cctctgtttg tcatatagct tgtaatcacg 3120 acattgtttc ctttcgcttg aggtacagcg aagtgtgagt aagtaaaggt tacatcgtta 3180 ggcggatcaa gatccatttt taacacaagg ccagttttgt tcagcggctt gtatgggcca 3240 gttaaagaat tagaaacata accaagcatg taaatatcgt tagacgtaat gccgtcaatc 3300 gtcatttttg atccgcggga gtcagtgaac aggtaccatt tgccgttcat tttaaagacg 3360 ttcgcgcgtt caatttcatc tgttactgtg tagatgcaa tcagcggttt catcactttt 3420 ttcagtgtgt aatcatcgtt tagctcaatc ataccgagag cgccgtttgc taactcagcc 3480 gtgcgttttt tatcgctttg cagaagtttt tgactttctt gacggaagaa tgatgtgctt 3540 ttgccatagt atgctttgtt aaataaagat tcttcgcctt ggtagccatc ttcagttcca 3600 gtgtttgctt caaatactaa gtatttgtgg cctttatctt ctacgtagtg aggatctctc 3660 agcgtatggt tgtcgcctga gctgtagttg ccttcatcga tgaactgctg tacattttga 3720 tacgtttttc cgtcaccgtc aaagattgat ttataatcct ctacaccgtt gatgttcaaa 3780 gagctgtctg atgctgatac gttaacttgt gcagttgtca gtgtttgttt gccgtaatgt 3840 ttaccggaga aatcagtgta gaataaacgg atttttccgt cagatgtaaa tgtggctgaa 3900 cctgaccatt cttgtgtttg gtcttttagg atagaatcat ttgcatcgaa tttgtcgctg 3960 tctttaaaga cgcggccagc gtttttccag ctgtcaatag aagtttcgcc gactttttga 4020 tagaacatgt aaatcgatgt gtcatccgca tttttaggat ctccggctaa tgcaaagacg 4080 atgtggtagc cgtgatagtt tgcgacagtg ccgtcagcgt tttgtaatgg ccagctgtcc 4140 caaacgtcca ggccttttgc agaagagata tttttaattg tggacgaatc aaattcagaa 4200 acttgatatt tttcattttt ttgctgttca gggatttgca gcatatcatg gcgtgtaata 4260 tgggaaatgc cgtatgtttc cttatatggc ttttggttcg tttctttcgc aaacgcttga 4320 gttgcgcctc ctgccagcag tgcggtagta aaggttaata ctgttgcttg ttttgcaaac 4380 tttttgatgt tcatcgttca tgtctccttt tttatgtact gtgttagcgg tctgcttctt 4440 ccagccctcc tgtttgaaga tggcaagtta gttacgcaca ataaaaaaag acctaaaata 4500 tgtaaggggt gacgccaaag tatacacttt gccctttaca cattttaggt cttgcctgct 4560 ttatcagtaa caaacccgcg cgatttactt ttcgacctca ttctattaga ctctcgtttg 4620 gattgcaact ggtctatttt cctcttttgt ttgatagaaa atcataaaag gatttgcaga 4680 ctacgggcct aaagaactaa aaaatctatc tgtttctttt cattctctgt attttttata 4740 gtttctgttg catgggcata aagttgcctt tttaatcaca attcagaaaa tatcataata 4800 tctcatttca ctaaataata gtgaacggca ggtatatgtg atgggttaaa aaggatcacc 4860 ccagagtccc gctcagaaga actcgtcaag aaggcgatag aaggcgatgc gctgcgaatc 4920 gggagcggcg ataccgtaaa gcacgaggaa gcggtcagcc cattcgccgc caagctcttc 4980 agcaatatca cgggtagcca acgctatgtc ctgatagcgg tccgccacac ccagccggcc 5040 acagtcgatg aatccagaaa agcggccatt ttccaccatg atattcggca agcaggcatc 5100 gccatgggtc acgacgagat cctcgccgtc gggcatccgc gccttgagcc tggcgaacag 5160 ttcggctggc gcgagcccct gatgctcttc gtccagatca tcctgatcga caagaccggc 5220 ttccatccga gtacgtgctc gctcgatgcg atgtttcgct tggtggtcga atgggcaggt 5280 agccggatca agcgtatgca gccgccgcat tgcatcagcc atgatggata ctttctcggc 5340 aggagcaagg tgagatgaca ggagatcctg ccccggcact tcgcccaata gcagccagtc 5400 ccttcccgct tcagtgacaa cgtcgagaca gctgcgcaag gaacgcccgt cgtggccagc 5460 cacgatagcc gcgctgcctc gtcttggagt tcattcaggg caccggacag gtcggtcttg 5520 acaaaaagaa ccgggcgccc ctgcgctgac agccggaaca cggcggcatc agagcagccg 5580 attgtctgtt gtgcccagtc atagccgaat agcctctcca cccaagcggc cggagaacct 5640 gcgtgcaatc catcttgttc aatcatgcga aacgatcctc atcctgtctc ttgatcagat 5700 cttgatcccc tgcgccatca gatccttggc ggcaagaaag ccatccagtt tactttgcag 5760 ggcttcccaa ccttaccaga gggcgcccca gctggcaatt ccg 5803

Claims (5)

An exinuclease ABC subunit A variant comprising the amino acid sequence set forth in SEQ ID NO: 1, wherein glycine, an amino acid corresponding to position 575 of SEQ ID NO: 3, is substituted with aspartic acid.
A polynucleotide encoding the variant of claim 1 .
The variant of claim 1 or comprising a polynucleotide encoding the variant, Corynebacterium glutamicum strain.
According to claim 3, wherein the strain is L- glutamic acid production capacity is increased compared to Corynebacterium glutamicum comprising the polypeptide of SEQ ID NO: 3 or a polynucleotide encoding it, the strain.
A method for producing L- glutamic acid, comprising the step of culturing in a medium a Corynebacterium glutamicum strain having L-glutamic acid-producing ability comprising the variant of claim 1 or a polynucleotide encoding the variant.

Images