KR102276305B1 - A novel ribitol dehydrogenase and D-ribulose preparation method using the same - Google Patents

Abstract

The present invention relates to a novel ribitol dehydrogenase and a D-ribulose preparing method using the same, and more specifically, to: a novel ribitol dehydrogenase derived from a Sphingomonas sp. MD2 strain; polynucleotide encoding the novel ribitol dehydrogenase; an expression vector including the polynucleotide; a transformant including the expression vector; a ribitol dehydrogenase preparing method including a step of culturing the transformant; a D-ribulose preparing method using the ribitol dehydrogenase; and a composition for preparing D-ribulose including the ribitol dehydrogenase and the like. The ribitol dehydrogenase according to the present invention exhibits enzymatic activity even at a low temperature such that D-ribulose can be prepared by reacting the ribitol dehydrogenase with D-ribitol at a low temperature. In addition, D-ribulose can be prepared through an eco-friendly process by using the ribitol dehydrogenase according to the present invention without going through a separate chemical process.

Description

Novel ribitol dehydrogenase and D-ribulose preparation method using same {A novel ribitol dehydrogenase and D-ribulose preparation method using the same}

The present invention relates to a novel ribitol dehydrogenase and a method for preparing D-ribulose using the same. More specifically, the present invention provides a novel ribitol dehydrogenase, a polynucleotide encoding the same, an expression vector including the polynucleotide, a transformant including the expression vector, and ribitol comprising the step of culturing the transformant It relates to a method for producing toll dehydrogenase, a method for producing D-ribulose using the ribitol dehydrogenase, and the like, and a composition for producing D-ribulose comprising the ribitol dehydrogenase and the like.

In general, monosaccharides are classified into aldose having a polyhydroxylaldehyde structure, ketose having a polyhydroxyl ketone structure, and sugar alcohols obtained by reducing them. In addition, according to the number of carbons, it is divided into triose, tetrose, pentose, hexose, and the like. For example, a sugar belonging to aldohexose, which is an aldose of a hexose, includes allose, altrose, glucose, mannose, idose, galactose, and the like, and belongs to ketohexose, which is a ketose of a hexose. Sugars include psicose, fructose, tagatose, and the like.

On the other hand, D-ribulose (Formula: C ₅ H ₁₀ O ₅ ) is a monosaccharide carbohydrate composed of five carbons, and has a ketone (C=O) group. D-ribulose is an intermediate product of the pentose phosphate pathway in humans, and in plants, it _{reacts with CO 2 in} the form of D-ribulose-1,5-bisphosphate to initiate photosynthesis. In addition, D-ribulose plays an important role in the production of many physiologically active substances, and is attracting more attention as it is known to be highly useful as a drug substance used in the synthesis of branched pentose sugars. Accordingly, there is a demand for such rare saccharides, and establishment of a stable production method for these saccharides is required.

The main method for preparing D-ribulose is a chemical synthesis method, but there are problems such as low yield, complex reaction, and by-product generation. As a biological synthesis method, there is a method for producing D-ribulose using ribitol dehydrogenase , and ribitol dehydrogenase derived from microorganisms such as Enterobacter has been reported (Japanese Patent Laid-Open No. 1996- 056659).

Under this background, the present inventors have completed the present invention by discovering ribitol dehydrogenase having enzymatic activity at low temperature as a result of intensive research efforts to develop a method for producing ribulose using a biocatalyst.

Republic of Korea Patent Publication No. 10-2009-0083939 Japanese Patent Laid-Open No. 1996-056659

It is an object of the present invention to provide a ribitol dehydrogenase comprising the amino acid sequence of SEQ ID NO: 1 derived from Sphingomonas sp.

Another object of the present invention is to provide a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 encoding the ribitol dehydrogenase.

Another object of the present invention is to provide an expression vector comprising the polynucleotide.

Another object of the present invention is to provide a transformant comprising the expression vector.

Another object of the present invention is to provide a method for producing ribitol dehydrogenase comprising the step of culturing the transformant.

Another object of the present invention is to provide a method for preparing D-ribulose by contacting D-ribitol with the ribitol dehydrogenase or the transformant.

Another object of the present invention is the ribitol dehydrogenase or the transformant; and D-ribitol to provide a composition for preparing D-ribulose.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.

As an aspect for achieving the above object, the present invention provides a ribitol dehydrogenase comprising the amino acid sequence of SEQ ID NO: 1 derived from a Sphingomonas strain.

The term "ribitol" in the present invention is a crystalline pentose alcohol (C ₅ H ₁₂ O ₅ ), also called adonitol.

As used herein, the term "dehydrogenase" is an enzyme that catalyzes a chemical reaction that removes hydrogen from organic molecules.

The "Sphingomonas strain" of the present invention is a lichen symbiotic bacterium that inhabits the polar (Arctic), specifically Sphingomonas sp. PAMC 26621, but is not limited thereto.

The ribitol dehydrogenase according to the present invention is not only the amino acid sequence of SEQ ID NO: 1, but also 80% or more, for example, 90% or more, in another embodiment, 95% or more, in another embodiment, 98% or more or 99% or more of the sequence. As an amino acid sequence showing homology, any protein showing the activity of ribitol dehydrogenase may be included without limitation.

As used herein, the term "homology" with reference to a sequence refers to the degree of correspondence with a given amino acid sequence or base sequence, and may be expressed as a percentage. In the present specification, a homologous sequence having the same or similar activity to a given amino acid sequence or base sequence is expressed as "% homology". For example, using standard software that calculates parameters such as score, identity and similarity, specifically BLAST 2.0, or by Southern hybridization experiments under defined stringent conditions. It can be confirmed by comparing the, and defined suitable hybridization conditions are within the technical scope (Sambrook et al., 1989, Infra), can be determined by a method well known to those skilled in the art.

In addition, as long as it can be efficiently expressed in E. coli than a protein derived from a conventional Sphingomonas strain, various amino acid sequences are added to the N-terminus or C-terminus of the amino acid sequence of SEQ ID NO: 1 peptides. In addition, it may further include a targeting sequence, a tag, a labeled residue, a half-life or an amino acid sequence designed for a specific purpose to increase the stability of the peptide.

In addition, if it can be expressed more efficiently in E. coli than a protein derived from a conventional Sphingomonas strain, a mutant protein in which some amino acids of the amino acid sequence of SEQ ID NO: 1 are mutated by methods such as addition, substitution, deletion, etc. in the present invention It may be included in the category of ribitol dehydrogenase provided.

The ribitol dehydrogenase according to the present invention may be a natural ribitol dehydrogenase obtained by culturing a Sphingomonas strain, or a recombinant ribitol dehydrogenase obtained by culturing a transformant.

The ribitol dehydrogenase according to the present invention is Sphingomonas sp. After culturing the PAMC 26621 strain in a minimal medium containing ribitol, it can be obtained using isolation and purification methods known in the art. The known separation and purification methods include crushing, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (eg ammonium sulfate precipitation), chromatography (eg cation exchange, Anion exchange, affinity, hydrophobicity and size exclusion) may be used alone or in combination, but is not limited thereto. Specifically, the ribitol dehydrogenase according to the present invention can be separated and purified using ammonium sulfate precipitation, DEAE chromatography, SP column chromatography, and Mono Q column chromatography (pH 6.0 and pH 8.).

The ribitol dehydrogenase according to the present invention is prepared by a chemical peptide synthesis method known in the art, or the gene encoding the ribitol dehydrogenase is amplified by PCR (polymerase chain reaction) or synthesized by a known method and then expressed It can be prepared by cloning into a vector and expressing it.

The ribitol dehydrogenase according to the present invention belongs to the medium-chain dehydrogenase/reductase (MDR) group, and is the first ribitol dehydrogenase belonging to this group.

The molecular weight of the ribitol dehydrogenase according to the present invention is about 39 kDa, and when it exists as a trimer, the molecular weight is about 117 kDa.

The ribitol dehydrogenase according to the present invention does not require metal ions for catalysis, and can catalyze at a temperature of 4°C to 60°C.

The catalytic efficiency of the ribitol dehydrogenase according to the present invention (catalytic efficiency, k _cat /K _m ) is 3.5 mM ^-1 s ^-1 , which shows excellent efficiency, so that the enzymatic reaction can be performed even with a small amount.

As another aspect for achieving the above object, the present invention provides a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 encoding the ribitol dehydrogenase.

The polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is Sphingomonas sp. It may be isolated from PAMC 2662.

In the present invention, the nucleotide sequence constituting the polynucleotide is a nucleotide sequence capable of encoding the amino acid sequence of SEQ ID NO: 1 or the N-terminus or C-terminus of the amino acid sequence of SEQ ID NO: 1 that can be added to various The nucleotide sequence encoding the amino acid sequence may be added to the 5'-end or the 3'-end of the nucleotide sequence capable of encoding the amino acid sequence of SEQ ID NO: 1. Specifically, the nucleotide sequence of SEQ ID NO: 2 that can encode the amino acid sequence of SEQ ID NO: 1 or a nucleotide sequence encoding various amino acid sequences that can be added to the N-terminus or C-terminus of the amino acid sequence of SEQ ID NO: 1 This may be a form added to the 5'-end or 3'-end of the nucleotide sequence of SEQ ID NO: 2.

In addition, as long as it can encode a protein that can be expressed more efficiently in E. coli than a protein derived from a conventional Sphingomonas strain, a polynucleotide comprising a nucleotide sequence showing homology to the nucleotide sequence is also provided in the present invention. It may be included in the category of polynucleotides, specifically, it may be a polynucleotide comprising a nucleotide sequence showing 80% or more homology, and more specifically, a polynucleotide comprising a nucleotide sequence showing 90% or more homology. and, most specifically, it may be a polynucleotide comprising a nucleotide sequence exhibiting 95% or more homology.

Meanwhile, in the polynucleotide, one or more bases may be mutated by substitution, deletion, insertion, or a combination thereof. When the nucleotide sequence is prepared by chemical synthesis, a synthesis method well known in the art, for example, the method described in the literature (Engels and Uhlmann, Angew Chem Int Ed Engl., 37:73-127, 1988) can be used. , triester, phosphite, phosphoramidite and H-phosphate methods, PCR and other autoprimer methods, oligonucleotide synthesis methods on a solid support, and the like.

As another aspect for achieving the above object, the present invention provides an expression vector comprising the polynucleotide.

As used herein, the term "expression vector" refers to a gene construct including a gene insert to enable expression of a target protein in an appropriate host cell, and essential regulatory elements operably linked to express the gene insert.

As used herein, the term "vector" refers to any medium for cloning and/or transfer of a base into an organism, such as a host cell. A vector may be a replicator capable of binding other DNA fragments to bring about replication of the bound fragment. Herein, the term "replication unit" refers to any genetic unit (eg, plasmid, phage, cosmid, chromosome, virus) that functions as a self-unit of DNA replication in vivo, that is, is capable of replication by its own regulation. say The term "vector" of the present invention may include viral and non-viral mediators for introducing a base into an organism, such as a host cell, in vitro, ex vivo or in vivo, and may include mini-spherical DNA, Sleeping Beauty. transposons such as Izsvak et al. J. MoI. Biol. 302:93-102 (2000)), or artificial chromosomes. Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state. Specifically, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and as plasmid vectors, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, pET-based and the like can be used. The vector usable in the present invention is not particularly limited, and a known recombinant vector may be used, and specifically pET28b may be used.

The expression vector includes expression control elements such as a start codon, a stop codon, a promoter, and an operator. The start codon and stop codon are generally considered to be part of a nucleotide sequence encoding a polypeptide, and when the gene construct is administered, the individual It must exhibit an action in the sequence and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible.

As used herein, the term "operably linked" refers to a state in which a nucleic acid expression control sequence and a nucleic acid sequence encoding a desired protein or RNA are functionally linked to perform a general function. . For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the coding sequence. The operative linkage with the expression vector can be prepared using a genetic recombination technique well known in the art, and site-specific DNA cleavage and ligation can use enzymes generally known in the art.

In the present invention, the expression vector introduces a polynucleotide encoding a novel ribitol dehydrogenase provided in the present invention into E. coli, and transforms the E. coli into a transformant capable of producing ribitol dehydrogenase. can do.

To this end, the expression vector may include a signal region for the release of the protein in order to promote the separation of the protein from the cell culture medium. A specific initiation signal may also be required for efficient translation of the inserted nucleic acid sequence. These signals include the ATG initiation codon and adjacent sequences. In some cases, an exogenous translational control signal, which may include an ATG initiation codon, must be provided. These exogenous translational control signals and initiation codons can be from a variety of natural and synthetic sources. Expression efficiency can be increased by introduction of appropriate transcriptional or translational enhancing factors.

As another aspect for achieving the above object, the present invention provides a transformant comprising the expression vector.

The transformant according to the present invention is produced by introducing the expression vector into a host cell to transform it, and by expressing the polynucleotide contained in the expression vector, it can be used to produce the ribitol dehydrogenase of the present invention.

The host cell into which the expression vector can be introduced is not particularly limited thereto, as long as it can express the polynucleotide to produce the ribitol dehydrogenase, but bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium; yeast cells such as Saccharomyces cerevisiae, Schizoscaromyces pombe, and Pichia pastoris; insect cells such as Drosophila and Spodoptera Sf9 cells; animal cells such as CHO, COS, NSO, 293, and Bow melanoma cells; Or it may be a plant cell, specifically, may be E. coli.

In addition, the transformation can be performed by various methods, as long as it can produce the ribitol dehydrogenase of the present invention, which exhibits the effect of improving various cellular activities to a high level, but is not particularly limited thereto, but CaCl ₂ Hanahan method, heat shock method, electroporation method, calcium phosphate precipitation method, protoplasmic fusion method, silicon carbide method with increased efficiency by using a reducing substance called dimethyl sulfoxide (DMSO) in precipitation method, CaCl _{2 precipitation method} Agitation using fibers, agrobacterium mediated transformation, transformation using PEG, dextran sulfate, lipofectamine and drying/inhibition mediated transformation may be used.

As another aspect for achieving the above object, the present invention provides a method for producing ribitol dehydrogenase comprising the step of culturing the transformant.

As used herein, the term "cultivation" refers to a method of growing microorganisms in an appropriately artificially controlled environmental condition. In the present invention, the method for culturing the transformant can be performed using a method widely known in the art. Specifically, the culture is not particularly limited as long as it can be produced by expressing the ribitol dehydrogenase of the present invention.

The medium used for culture can satisfy the requirements of a specific strain in an appropriate manner while controlling temperature, pH, etc. under aerobic conditions in a conventional medium containing an appropriate carbon source, nitrogen source, amino acid, vitamin, and the like.

In addition, precursors suitable for the culture medium may be used. The above-mentioned raw materials may be added in a batch, fed-batch or continuous manner by an appropriate method to the culture during the culturing process, but is not particularly limited thereto. Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acid compounds such as phosphoric acid or sulfuric acid can be used in an appropriate manner to adjust the pH of the culture.

Specifically, the ribitol dehydrogenase of the present invention cultivates the transformant, expresses and accumulates ribitol dehydrogenase, a gene product, in a culture (cultured cells or culture supernatant), and the ribitol dehydrogenase from the culture can be prepared by recovery through separation and purification.

A method of recovering the expressed ribitol dehydrogenase may be performed using a method well known in the art. Specifically, the recovery method is not particularly limited as long as the ribitol dehydrogenase of the present invention can be recovered, but specifically crushing, centrifugation, filtration, extraction, spraying, drying, expansion, precipitation, crystallization, electrophoresis , fractional dissolution (eg, ammonium sulfate precipitation), chromatography (eg, cation exchange, anion exchange, affinity, hydrophobicity, size exclusion), etc. can be used alone or in combination.

Confirming that the recovered material is a ribitol dehydrogenase according to the present invention can be performed by a conventional method known in the art, specifically SDS-polyacrylamide gel electrophoresis (SDS-PAGE), western blotting, etc. However, the present invention is not limited thereto.

As another aspect for achieving the above object, the present invention provides a step of converting D-ribitol into D-ribulose by contacting D-ribitol with the ribitol dehydrogenase or the transformant. -Provides a method for preparing ribulose.

Specifically, the contacting may be performed under pH 6.0 to pH 11.0 conditions, at 4° C. to 40° C. temperature conditions, and/or for 0.5 hours to 48 hours. More specifically, the contacting may be performed under conditions of pH 7.0 to pH 10.0, pH 7.0 to pH 9.0, or pH 8.0. In addition, the contacting may be performed at a temperature of 4°C to 30°C, 4°C to 20°C, or 4°C to 15°C.

The method for preparing D-ribulose according to the present invention may further include isolating and/or purifying the prepared D-ribulose. The separation and/or purification may be performed using a method commonly used in the technical field of the present application. Non-limiting examples include crushing, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (eg ammonium sulfate precipitation), chromatography (eg cation exchange, anion exchange, affinity, hydrophobicity and size exclusion) may be used alone or in combination.

As another aspect for achieving the above object, the present invention provides (i) the ribitol dehydrogenase of claim 1 or the transformant of claim 4; and (ii) D-ribitol. It provides a composition for preparing D-ribulose.

The composition may convert D-ribitol to D-ribulose by the action of the ribitol dehydrogenase or the ribitol dehydrogenase expressed in the transformant. In addition, by providing the composition in the form of a kit, it is possible to prepare D-ribulose in the kit.

The composition for preparing D-ribulose according to the present invention may further include any suitable excipients commonly used in the composition for preparing D-ribulose. Such excipients may be, for example, but not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, and the like.

Since the ribitol dehydrogenase according to the present invention has enzymatic activity even at low temperatures, it is possible to produce D-ribulose by reacting ribitol dehydrogenase with D-ribitol at a low temperature. In addition, by using the ribitol dehydrogenase according to the present invention, it becomes possible to manufacture D-ribulose in an environmentally friendly process without going through a separate chemical process. In addition, due to the excellent catalytic efficiency of ribitol dehydrogenase, the reaction can be performed in a small amount, and D-ribulose can be prepared at a fast reaction rate.

1a is a picture of SDS gel for each purification step of SpRDH. M: Size marker, 1: Ammonium sulfate (30-60%) precipitation, 2: DEAE chromatography, 3: SP column chromatography, 4 & 5: Mono Q column chromatography (pH 6.0), 6: Mono Q column chromatography graphic (pH 8.0).
1b is a graph of the results of gel-filtration chromatography (Superdex-200 column) of purified SpRDH. The standard proteins used for molecular weight determination were: Catalase (232 kDa), glutathione reductase (100 kDa), bovine serum albumin (66 kDa), ovalbumin (44 kDa).
1c is a Native-PAGE photograph of purified SpRDH. Proteins used for molecular weight comparison are as follows. 1: glutathione reductase, 2: bovine serum albumin, 3: SpRDH.
2 is a graph showing the activity of SpRDH according to the substrate.
Figure 3a is a graph showing the enzyme activity according to the reaction temperature in the enzyme reaction of SpRDH.
Figure 3b is a graph showing the enzyme activity according to the reaction pH in the enzyme reaction of SpRDH.
3c is for confirming the thermal stability of SpRDH, and is a graph showing the degree of residual enzyme activity after reaction time at each temperature.
4 is a graph showing HPLC results of products of an enzymatic reaction using SpRDH and control substances (NAD ⁺ , NADH, D-ribose, D-ribulose, and D-ribitol).
Figure 5a is an SDS gel picture for each purification step of recombinant SpRDH. M: Size marker, 1: Cell lysate, 2: Wash, 3: Fraction eluted from His trap, 4: Fraction eluted from Q-Sepharose column.
Figure 5b is a gel-filtration chromatography (Superdex-200 column) result graph of recombinant SpRDH. The standard proteins used for molecular weight determination were: Catalase (232 kDa), glutathione reductase (100 kDa), bovine serum albumin (66 kDa), ovalbumin (44 kDa).
5c is a Native-PAGE photograph of recombinant SpRDH. Proteins used for molecular weight comparison are as follows. 1: BSA, 2: native SpRDH, 3: recombinant SpRDH.
6 is a graph showing the activity of recombinant SpRDH according to the substrate.
7a is a graph showing the enzyme activity according to the reaction temperature in the enzymatic reaction of recombinant SpRDH.
Figure 7b is a graph showing the enzyme activity according to the reaction pH in the enzyme reaction of recombinant SpRDH.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited thereto.

Sphinomonas sp. used in the present invention. PAMC 26621 strain was provided from Polar and Alpine Microbial Collection of Korea Polar Research Institute (Incheon, Korea) and pET28b (+) vector was purchased from Novagen (Madison, Wisconsin, USA) and used, ArcticExpress Escherichia coli (DE3) was purchased from Agilent Technologies (Santa Clara, CA, USA).

Example 1: Obtaining ribitol dehydrogenase (SpRDH)

Example 1-1: Sphingomonas ( Sphinomonas sp. PAMC 26621) strain culture

Sphinomonas sp. grown on Reasoner's 2A plates. One colony of PAMC 26621 was inoculated into Reasoner's 2A broth and cultured at 15°C for two days (OD ₆₀₀ = 0.8-1.0). Then, 1% of the culture medium was added to 100 mL of minimal medium (10.5 g/LK ₂ HPO ₄ , 5 g/L KH ₂ PO ₄ , 1 g/L (NH ₄ ) ₂ SO ₄ , 0.5 g/L sodium citrate, 2 mM MgSO ₄ , 15 μM vitamin B ₁ and 1% ribitol), and then cultured with shaking at 15° C. for 24 hours at 225 rpm.

Example 1-2: Ribitol Dehydrogenase (SpRDH) Isolation and Purification

Using ammonium sulfate precipitation and four column chromatography steps, Sphinomonas sp. SpRDH was purified from PAMC 26621.

Sphinomonas sp. After incubation of PAMC 26621 in minimal medium containing 1% (w/v) ribitol at 15 °C, cells were harvested by centrifugation at 10,000 x g for 20 min and buffer A (50 mM Tris-HCl, pH 8.0; 50 mM KC). Proteins were extracted through sonication, and cell lysates were obtained by centrifugation at 20,000 x g for 30 minutes. The cell lysate was precipitated with ammonium sulfate and then centrifuged at 20,000 x g for 30 minutes to collect fractions containing 30-60% saturated ammonium sulfate.

This pellet was resuspended and desalted in Buffer A at a flow rate of 2 mL/min using a HiTrap desalting 26/10 column applied to a HiPrep DEAE EF 16/10 column equilibrated with Buffer A. The protein was then eluted using a KCl-segmented gradient (50-200 mM KCl with two column volumes (CV), 200-500 mM with 15 CV and 500-1000 mM KCl with 3 CV). ). The active fractions were pooled and desalted in buffer B (50 mM sodium acetate, pH 5.0, 50 mM NaCl) on a desalting column, and then loaded onto a HiPrep SP FF 16/10 column equilibrated with buffer B. Proteins were eluted in buffer B by a linear gradient of 50-1000 mM NaCl at a flow rate of 2 mL/min. The active fractions were pooled and immediately desalted in buffer C (20 mM L-Histidine, pH 6.0, 50 mM KCl) using a desalting column. This sample was applied to a Mono Q HR 5/5 column (1 mL) equilibrated with Buffer C, followed by Buffer C (50-200 mM: 5 CV; 200-400 mM: 20 CV; 400-1000 mM: 5 CV). ), the protein was eluted by a segmented gradient of KCl at a flow rate of 0.5 mL/min. The active fractions were pooled and desalted in buffer A with a 5 mL-Amicon Ultra centrifugal filter (10 kDa), followed by purification using a Mono Q column with buffer A. Protein was eluted under the same conditions as described above for the first Mono Q column purification, except that buffer A (pH 8.0) was used as an elution buffer. All steps of the purification process were carried out at 4°C.

Experimental Example 1: Characteristics experiment of ribitol dehydrogenase (SpRDH)

The physicochemical properties of the ribitol dehydrogenase obtained in Example 1 were investigated.

Experimental Example 1-1: Confirmation of molecular weight of ribitol dehydrogenase (SpRDH)

The molecular weight of SpRDH purified by the method of Example 1-2 was confirmed by two methods.

First, the purified SpRDH was analyzed by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) together with the chromatography step performed on the AKTA Explorer system (GE Healthcare).

As a result, as shown in lane 6 of FIG. 1a, the molecular weight of SpRDH was confirmed to be about 39 kDa in SDS-PAGE.

Next, the molecular weight of native SpRDH was measured by gel filtration chromatography and native-PAGE using a Superdex 200 column.

As a result, as shown in FIGS. 1b and 1c, the molecular weight of native SpRDH was about 117 kDa, and it was confirmed that a trimer was formed.

Experimental Example 1-2: Confirmation of substrate specificity of ribitol dehydrogenase (SpRDH)

In order to confirm the enzymatic activity of SpRDH according to the present invention, substrate specificity was investigated.

Specifically, SpRDH activity was confirmed by measuring the absorbance of NADH formation at 60° C. and 340 nm using a Shimadzu UV-1800 spectrophotometer. The reaction mixture (500 μL) contains 1 mM NAD+, 40 mM substrate, and an appropriate amount of SpRDH in 100 mM potassium phosphate at pH 8.0, D-ribitol, D-xylitol, D-mannitol, erythritol as substrates. , myo-inositol, D- gallititol and glycerol were used to measure the enzyme activity.

As a result, as shown in FIG. 2, when the enzymatic activity (2800 U/mg) of SpRDH for D-ribitol was taken as 100%, D-xylitol compared to D-ribitol had 66% enzymatic activity, and erythritol was It was confirmed that the enzyme activity was 4%, and the activity to erythritol was almost nonexistent. When mannitol, sorbitol, inositol, galactitol or glycerol was used as a substrate, the enzymatic activity of SpRDH was not observed.

Experimental Example 1-3: Confirmation of optimum temperature, optimum pH, and thermal stability of ribitol dehydrogenase (SpRDH)

(1) Optimum temperature of SpRDH according to the present invention

Using the method for measuring enzyme activity described in Experimental Example 1-2, the apparent optimal temperature was determined by measuring the enzyme activity at 10°C to 80°C.

As a result, as shown in Figure 3a, SpRDH exhibited the maximum enzyme activity at 60 ℃.

(2) Investigation of optimal pH of SpRDH according to the present invention

According to the method for measuring enzyme activity described in Experimental Example 1-2, enzyme activity according to various pHs was measured at 60° C., which is the optimum temperature of SpRDH. The substrate was 40 mM D-ribitol, and 1 mM NAD+ was used as the coenzyme. Buffers of 100 mM potassium phosphate (pH 6.0-8.0), 100 mM potassium phosphate-NaOH (pH 8.5-11.0), and 50 mM Tris.HCl (pH 8.0-11.0) were used.

As a result, as shown in FIG. 3b , SpRDH exhibited the maximum enzyme activity at pH 8.0 in the phosphate buffer condition.

(3) Investigation of thermal stability of SpRDH according to the present invention

In order to investigate the thermal stability of SpRDH, the residual activity level of SpRDH was measured according to the method for measuring enzyme activity described in Experimental Example 1-2. After SpRDH was left at various temperatures (4°C, 25°C, 40°C, 50°C, and 60°C), enzyme activity was measured for 4 hours at 30-minute intervals under optimal conditions (60°C, pH 8.0).

As a result, as shown in FIG. 3c , SpRDH maintained enzyme activity of 70% or more for 4 hours in a temperature range of 4 to 50° C., but the enzyme activity of SpRDH disappeared within 30 minutes at a temperature of 60° C.

Experimental Example 1-4: Confirmation of product according to enzymatic reaction of ribitol dehydrogenase (SpRDH)

The reaction products catalyzed by SpRDH were identified using high performance liquid chromatography (HPLC).

Specifically, 1 mL of the reaction mixture (100 mM potassium phosphate containing 5 mM NAD+, 100 mM ribitol and 0.06 μM SpRDH enzyme) was reacted at 40° C. for 2 hours. Then, 20 μL of the reaction mixture or authentic compound (10 mg/ml NAD+, NADH, ribitol, lyulose and ribose) was added to a Waters Alliance HPLC system on a Sugar-Pak I column (Ø 6.5 X 300 mm). For each loading, peaks were detected by a refractive index detector.

As a result, as shown in FIG. 4, the HPLC chromatogram of the reactant showed peaks at the same position as the peaks of NADH and ribulose. SpRDH is a ribitol dehydrogenase that converts ribitol and NAD+ to ribulose and NADH, respectively. It was confirmed that

Experimental Example 1-5: Measurement of kinetics of ribitol dehydrogenase (SpRDH)

The kinetic parameter of SpRDH was determined by measuring the initial rate of SpRDH at various fixed concentrations of ribitol in the range of 10 to 160 mM when the NAD+ concentration was varied in the range of 0.05 to 1 mM at 25 °C, and vice versa. measured. Data were analyzed using the SigmaPlot Enzyme Kinetic Module of SigmaPlot 14.0 (Systat Software Inc., San Jose, USA), and all experiments were performed three times.

As a result, the results shown in Table 1 below were obtained, and it was confirmed that SpRDH converts ribitol to ribulose with a relatively high catalytic efficiency ( k _cat / K _m =3.5 mM ^-1 s ^-1 ).

Kinetic parameters of SpRDH according to the present invention K _{m ,} ribitol (mM) K _{m ,} NAD ⁺ (mM) k _{cat ,} ribitol
(s ^-1 ) k _cat / K _{m ,} ribitol
(mM ^-1 s ^-1 ) 8.5 0.3 29 3.5

Experimental Example 1-6: Confirmation of activity change of ribitol dehydrogenase (SpRDH) according to enzyme action inhibitor

In order to confirm whether metal ions are involved in the catalysis of SpRDH according to the present invention, the change in activity of SpRDH according to the enzyme action inhibitor was investigated.

Specifically, 1 mM or 5 mM of an inhibitor (N-Ethylmaleimide, NEM; Phenylmethylsulfonyl fluoride, PMSF; Ethylenediaminetetraacetic acid, EDTA) was added to the SpRDH reaction mixture, followed by the enzyme activity measurement method described in Experimental Example 1-2. Toll dehydrogenase activity was measured.

As a result, as shown in Table 2 below, the SpRDH activity was reduced to 32% and 4.3% in 1 mM and 5 mM of NEM, respectively. A decrease in enzymatic activity by NEM means that there is an amino acid cystine residue at the enzyme active site. In addition, when PMSF was used, SpRDH activity was reduced to 81% in 5 mM PMSF, but there was no change in SpRDH activity in 1 mM PMSF. However, when EDTA was used, no decrease in the activity of SpRDH was observed at both 1 mM and 5 mM. Since there is no effect of reducing the activity of SpRDH enzyme by EDTA, this result means that metal ions are not involved in the catalysis of SpRDH.

Effect of enzyme inhibitors on SpRDH activity Inhibitor Relative activity (%) 1 mM 5 mM None 100±1 100±1 N-Ethylmaleimide (NEM) 31.6±0.1 4.3±0.4 Phenylmethylsulfonyl fluoride (PMSF) 99±1.4 81.1±0.2 Ethylenediaminetetraacetic acid (EDTA) 100±0.8 99±0.5

Experimental Example 1-7: Confirmation of metal ion detection in ribitol dehydrogenase (SpRDH)

For the analysis of the elements present in the sample, the metal ions of the purified SpRDH sample were investigated by requesting the Seoul Center of the Korea Basic Science Institute (KBSI).

As a result, a small amount (3 μg/L) of Mg was detected, and metal ions including Zn were not detected. This result means that metal ions are not involved in the enzymatic action of SpRDH, as in the results of EDTA treatment of Experimental Example 1-6.

Elements Concentration (μg/L) Mg 3.0 Mn < 1.0 Fe < 1.0 Co < 1.0 Ni < 1.0 Cu < 1.0 Zn < 1.0

Example 2: Preparation of Recombinant Ribitol Dehydrogenase (SpRDH)

Example 2-1: ribitol dehydrogenase (SpRDH) gene cloning and transformant preparation

Sphingomonas sp. After amplifying the rdh gene having the nucleotide sequence of SEQ ID NO: 2 encoding SpRDH from the genome of PAMC 26621, it was cloned into the pET28b expression vector. After confirming the pET28b-rdh construct by DNA sequence analysis, it was transformed into Arctic Express E. coli (DE3).

Primer 1: TA CCATGG ATGCGGTCGTCTGCCACG ( Nco I site underlined)

Primer 2: AT CTCGAG TGTCGACGGGCTCAGCACGA ( Xho I site underlined)

Example 2-2: Recombinant Ribitol Dehydrogenase (SpRDH) Expression and Purification

Recombinant SpRDH was expressed in Arctic Express E. coli. E. coli was cultured in Luria-Bertani (LB) broth containing kanamycin (50 μg/ml) at 30° C. to a _{cell density of OD 600 = 0.6-0.8.} Then, the cells were placed at 12° C. for 15 minutes, followed by IPTG induction at a final concentration of 1 mM, and incubated at 12° C. for an additional 24 hours. Cells were harvested by centrifugation at 10,000×g, 4°C for 20 minutes. The pellet was resuspended in 50 mM Tris.HCl, pH 8.0, 5 mM imidazole, followed by sonication. Cell lysates were centrifuged at 15,000×g, 4° C. for 30 minutes, and the supernatant was collected.

Anion-exchange chromatography using a 1-mL HisTrap column with 100 mM and 500 mM imidazole step gradients in buffer A, followed by anion-exchange chromatography using a 5-mL Q-Sepharose FF column with a 50-1000 mM KCl linear gradient in buffer A. was used on the AKTA Explorer System (GE Healthcare) to purify the recombinant SpRDH. Recombinant SpRDH (SpRDH) was expressed as a soluble protein with a 6×His-tag fused to the C-terminus in Arctic Express E. coli (DE3) cells.

All purification steps were performed at 4°C, and the pure recombinant SpRDH was frozen in liquid nitrogen and stored at -80°C for further experiments.

Experimental Example 2: Characteristics experiment of recombinant ribitol dehydrogenase (rSpRDH)

The physicochemical properties of the recombinant ribitol dehydrogenase (rSpRDH) obtained in Example 2 were investigated.

Experimental Example 2-1: Confirmation of molecular weight of recombinant ribitol dehydrogenase (rSpRDH)

The molecular weight of the recombinant SpRDH purified by the method of Example 2-2 was confirmed by the method described in Experimental Example 1-1.

As a result, as shown in lane 4 of FIG. 5A , the molecular weight of recombinant SpRDH was confirmed to be about 39 kDa in SDS-PAGE, the same as that of native SpRDH.

In addition, as shown in FIGS. 5B and 5C , it was confirmed that the molecular weight of the native recombinant SpRDH was about 117 kDa by gel filtration chromatography and native-PAGE, and a trimer was formed.

Experimental Example 2-2: Confirmation of substrate specificity of recombinant ribitol dehydrogenase (rSpRDH)

To confirm the enzymatic activity of the recombinant SpRDH according to the present invention, the substrate specificity of rSpRDH was investigated by the method described in Experimental Example 1-2.

As a result, as shown in FIG. 6 , it was confirmed that recombinant SpRDH, like native SpRDH, has substrate specificity for D-ribitol and hardly exhibits erythritol activity. When mannitol, sorbitol, inositol, galactitol or glycerol was used as a substrate, the enzymatic activity of rSpRDH was not shown.

Experimental Example 2-3: Confirmation of optimum temperature and optimum pH of recombinant ribitol dehydrogenase (rSpRDH)

The optimum temperature and optimum pH of the recombinant SpRDH according to the present invention were confirmed by the method described in Experimental Example 1-3.

As a result, as shown in Figures 7a and 7b, the recombinant SpRDH also exhibited the maximum enzyme activity at 60 ℃ and pH 8.0.

<110> Industry Academic Cooperation Foundation, Daegu University <120> A novel ribitol dehydrogenase and D-ribulose preparation method using the same <130> KPA01456 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 352 <212> PRT <213> Sphinomonas sp. <400> 1 Met Thr Ala Val Val Cys His Gly Pro Lys Asp Tyr Arg Val Glu Glu 1 5 10 15 Ile Ala His Pro Thr Ala Gly Ala Leu Glu Phe Val Ile Arg Val Thr 20 25 30 Ala Cys Gly Ile Cys Ala Ser Asp Cys Lys Cys Trp Ser Gly Ala Lys 35 40 45 Met Phe Trp Gly Asp Asp Pro Trp Val Lys Ala Pro Val Val Pro Gly 50 55 60 His Glu Phe Phe Gly Val Val Asp Glu Leu Gly Glu Gly Ala Gly Glu 65 70 75 80 His Phe Gly Val Ala Val Gly Asp Arg Val Ile Ala Glu Gln Ile Val 85 90 95 Pro Cys Glu Arg Cys Arg Tyr Cys Arg Ser Gly Gln Tyr Trp Met Cys 100 105 110 Glu Val His Asn Ile Phe Gly Phe Gln Arg Leu Val Ala Asp Gly Gly 115 120 125 Met Ala Gln Phe Met Arg Leu Pro Arg Thr Ser Arg Val His Leu Ile 130 135 140 Pro Ala Glu Ile Pro Asp Asp Asp Ala Val Ile Ile Glu Pro Leu Ala 145 150 155 160 Cys Ala Leu His Thr Val Arg Arg Gly Thr Ile Gly Phe Glu Asp Val 165 170 175 Val Val Ile Ala Gly Ala Gly Pro Ile Gly Leu Met Met Val Gln Ala 180 185 190 Ala Arg Leu Gln Thr Pro Arg Lys Leu Val Val Ile Asp Met Val Pro 195 200 205 Glu Arg Leu Ala Leu Ala Thr Thr Phe Gly Ala Asp Val Val Ile Asn 210 215 220 Pro Ala Thr Asp Asp Ala Leu Ala Ile Val His Gly Leu Thr Asp Gly 225 230 235 240 Tyr Gly Cys Asp Val Tyr Ile Glu Ala Thr Gly Ser Pro Ala Gly Val 245 250 255 Val Gln Gly Leu Asn Leu Ile Arg Arg Leu Gly Arg Phe Val Glu Phe 260 265 270 Ser Val Phe Gly Ser Asp Thr Thr Val Asp Trp Ser Ile Ile Gly Asp 275 280 285 Arg Lys Glu Leu Asp Val Arg Gly Ala His Leu Gly Pro Tyr Cys Tyr 290 295 300 Pro Ile Ala Ile Asp Leu Leu Ser Arg Gly Leu Ile Thr Ser Asn Gly 305 310 315 320 Ile Val Thr His Arg Phe Pro Leu Ile Gln Trp Ala Glu Ala Ile Ala 325 330 335 Val Ala Asp Ser Leu Glu Ser Ile Lys Val Val Leu Ser Pro Ser Thr 340 345 350 <210> 2 <211> 1059 <212> DNA <213> Sphinomonas sp. <400> 2 atgacggcgg tcgtctgcca cggcccgaag gattaccgcg tcgaagagat cgcccatccc 60 acggcgggcg cgcttgagtt cgtcatccgc gtgacggcct gcggcatctg cgcgagcgac 120 tgcaaatgct ggtcgggggc gaagatgttc tggggagacg atccctgggt gaaggcgcca 180 gtcgtacccg gccacgagtt cttcggcgtg gtggacgagc tcggcgaagg tgccggcgaa 240 cacttcggcg tcgccgtcgg cgaccgagtg atcgccgagc agatcgtgcc gtgcgaacgc 300 tgccgctact gccgctccgg ccaatattgg atgtgcgagg tccacaacat cttcggcttc 360 caacgcctgg tggccgacgg tgggatggcg cagttcatgc gcctgccgcg aacgtcgcgc 420 gtgcacctca tcccggccga aattccggac gacgacgcgg tgatcatcga gccgctcgcc 480 tgcgcgctcc acaccgtccg gcgcggaacg atcggcttcg aggacgtcgt cgtgatcgcc 540 ggcgcgggac cgatcggcct gatgatggtg caggcggcaa ggctccagac cccgcgcaag 600 ctggtggtta tcgacatggt cccagaacgg ctggcgctcg cgaccacgtt cggcgccgac 660 gtcgtcatca accccgcgac ggacgacgca ctcgcgatcg tgcacgggct gacggacggt 720 tacggctgcg acgtctacat agaggcgacc ggatcgcctg ccggcgtcgt gcagggacta 780 aacctcatcc gccgcctcgg ccggttcgtg gagttctccg tgttcgggag cgacaccacg 840 gtcgattggt cgatcatcgg ggaccggaag gagctcgacg tccgcggcgc gcatttgggc 900 ccctactgct atccgatcgc gatcgacctg ctctcacgcg gcctgatcac gtccaacggc 960 atcgtcacgc acaggtttcc tctgatccaa tgggcggaag ccatcgcggt cgccgactcc 1020 ctggagtcga tcaaggtcgt gctgagcccg tcgacatga 1059

Claims (9)

Ribitol dehydrogenase consisting of the amino acid sequence of SEQ ID NO: 1 derived from the Sphingomonas sp. strain; or contacting the Sphingomonas strain or transformant expressing the ribitol dehydrogenase with D-ribitol, thereby converting the D-ribitol into D-ribulose. The method of claim 1, wherein the method is carried out at a temperature of 4°C to 40°C. The method of claim 1, wherein the method further comprises isolating or purifying D-ribulose. (i) ribitol dehydrogenase consisting of the amino acid sequence of SEQ ID NO: 1 derived from the Sphingomonas sp. strain; Or a Sphingomonas strain or transformant expressing the ribitol dehydrogenase; And (ii) a composition for preparing D-ribulose comprising D-ribitol. delete delete delete delete delete

Images