KR102265785B1 - Novel antigenic proteins and their use to detect wheat-dependent exercise-induced anaphylaxis - Google Patents

Abstract

The present invention relates to an antigenic protein comprising the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, wherein the antigenic protein induces wheat-dependent exercise-induced hypersensitivity, which can be used to diagnose wheat-dependent exercise-induced hypersensitivity. can
Specifically, the antigen protein was identified as a reactive protein through two-dimensional immunoblot analysis using opri wheat protein with a partial deletion of omega-5 gliadin and serum from a WDEIA patient, and also the omega-, a central antigen of WEDIA, 5 It was confirmed that it also reacts with a monoclonal antibody against gliadin. As a result of analyzing the antigenic protein by mass spectrometry, it was confirmed that it corresponds to a novel omega-5 gliadin gene encoded on chromosome 1D.
Therefore, it was confirmed that the antigen protein also reacts with the serum of WDEIA patients or the monoclonal antibody against omega-5 gliadin, the central antigen of WEDIA, using the antigen protein that induces wheat-dependent exercise-induced hypersensitivity. Wheat-dependent exercise-induced hypersensitivity can be diagnosed.

Description

Novel antigenic proteins and their use to detect wheat-dependent exercise-induced anaphylaxis

The present invention relates to novel antigenic proteins causing wheat-dependent exercise-induced hypersensitivity and uses thereof.

Gluten proteins are a complex group of 70-100 abundant proteins that give wheat flour its inherent viscoelastic properties. At the same time, some of these proteins are involved in human health problems including food allergies and celiac disease. Among gluten proteins, omega gliadins are particularly immunogenic. The protein accounts for 5-10% of the total wheat flour protein, although it varies depending on the variety and plant growth conditions. The omega gliadin is composed of an abnormally high ratio of glutamine and proline (about 68-73%) repeated sequences and is generally deficient in cysteine. The proteins are divided into two groups, referred to as omega-5 and omega-1,2 gliadins, which differ in N-terminal sequence and repeat motif. Omega-5 gliadins usually start with SRL and contain multiple copies of the repetitive motifs FPQQQ and QQIPQQQ, while omega-1,2 gliadins start with ARE, ARQ or KEL and contain the repetitive motif PQQPFP . The omega-5 gliadin is encoded in the Gli-1 locus (locus) on the short arm of chromosome 1B in hexaploid wheat and induces wheat-dependent exercise, which is a serious food allergy when exercise after consuming wheat. It is a major sensitive allergen in hypersensitivity (WDEIA). The omega-1,2 gliadins are encoded on chromosomes 1A and 1D and contain immunodominant T-cell stimulatory epitopes involved in celiac disease. The omega gliadin shows the greatest change among gluten proteins when applied as fertilizer or reacting to high temperatures in the course of grain development, which may affect the immunogenic potential of wheat flour.

Because of this, research on omega gliadins has been challenging. In particular, omega-5 gliadins are difficult to identify by tandem mass spectrometry (MS/MS) because they contain a limited number of proteolytic cleavage sites. Moreover, the complete protein sequence for omega-5 gliadin has not been elucidated in the database despite the significant allelic diversity of these proteins between breeds. Indeed, until recently, only BAE20328 (omega-5 gliadin) out of more than 100 omega gliadin protein sequences of NCBI was identified by mass spectrometry to have a molecular weight in the range of 48.9-51.5 kDa. The other four proteins, AJG03093, AJG03080, AJG03079 and CAR82267, are missing a portion of the repeat region and are predicted to have molecular weights ranging from 36 to 42 kDa, but many other omega-5 gliadin proteins of NCBI are of the central repeat region. A significant part is missing. The lack of full length protein sequences makes highly repetitive gene duplication difficult. Recently, the genomic sequence of the region harboring the prolamin gene was collected from Chinese Spring, a reference wheat, and two additional full-length omega-5 gliadin protein sequences omega-B3 (AWK59777) corresponding to 47.7 and 51.5 kDa, respectively. and omega-B6 (AWK59773) were added to the NCBI.

The IgE binding epitope for WDEIA was identified using an array of overlapping peptides based on the full-length sequence of BAE20328. The peptides QQFPQQQ, QQIPQQQ, QQSPQQQ and QQSPEQQ were found to be predominant epitope with amino acids at positions 1, 4, 5, 6 and 7 important for IgE binding. Interestingly, BAE20328 contains 23 QQFPQQQs and 4 QQIPQQQs, some of which overlap and contribute to the immunogenicity of the protein.

Recently, a number of strategies have been attempted to reduce the level of omega-5 gliadins in wheat to reduce the immunogenic potential of wheat. One approach is to select genotypes with reduced levels of these proteins. To this end, an attempt was made to examine wheat proteins in a collection of cultivars expressing 13 different omega-5 gliadin alleles for reactivity with IgE in WEDIA patients. Only one cultivar containing wheat/rye translocations showed a low level of reactivity. However, these translocation lines (translocation lines) have deteriorated baking properties by replacing the secaline gene, which is a disease resistance gene of rye, with omega-5 gliadin. Another trial identified a spontaneous mutation in a crossover line between the spelt variety and the Polish breeding line, which was due to an inactive omega-5 gliadin gene at the Gli-B1 locus. After crossing the line with another line containing an inactive gene at the Gli-A1 and Gli-D1 loci, ELISA was used to confirm that the immunoreactivity decreased by about 30%. In a biotechnology approach using RNA interference, transgenic wheat with reduced IgE reactivity to serum from WDEIA patients was used to reduce the levels of omega-5 gliadins without adversely affecting the end-use functional properties of the wheat flour. There was the manufacture of plants.

Recently, the wheat mutant O-free (DH20), which lacks LMW-GS encoded by the B genome, has been isolated from two Korean wheat varieties, hard white wheat ‘Geumgang’ and soft red wheat. ) was developed by screening for glutenin from a double haploid population derived from crossovers between 'olgru'. When evaluated in the field over a two-year period, Opry showed superior agricultural characteristics and slightly higher yields than the seed cultivar. In addition, the protein content, SDS sedimentation volume and mixing tolerance of opry flour were similar to those of Geumgang, Korea's best bread wheat variety with good milling quality and medium dough strength.

Republic of Korea Patent Publication No. 10-2011-0026953

An object of the present invention is to provide an antigenic protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2.

Another object of the present invention is to provide a composition for diagnosing wheat-dependent exercise-induced hypersensitivity comprising the antigen protein.

Another object of the present invention is to provide a composition for detecting omega-5 gliadin comprising the antigen protein.

Another object of the present invention is to provide a kit comprising the composition for diagnosing wheat-dependent exercise-induced hypersensitivity.

The present inventors performed wheat flour analysis of Opry, a mutant line, by tandem mass spectrometry and two-dimensional gel electrophoresis (2-DE). As a result, it was confirmed that at least 5.8 Mb of chromosome 1B was deleted in the mutant line, and the omega-5 gliadin encoded by the Gli-B1 locus and some gamma gliadins were absent. In addition, through two-dimensional immunoblot analysis of wheat flour protein using serum from WDEIA patients, it was confirmed that the IgE reactivity was reduced in the mutant compared to the parental line due to the absence of major omega-5 gliadins. However, the two minor proteins showed strong reactivity to WDEIA patient sera in both parental and mutant lines, and it was confirmed that they also reacted with monoclonal antibodies against omega-5 gliadin, a central antigen of WEDIA. As a result of analysis of two small reactive proteins by mass spectrometry, it was confirmed that they correspond to the omega-5 gliadin gene encoded on chromosome 1D. Therefore, it was confirmed that the antigenic protein also reacts with the serum of WDEIA patients or the monoclonal antibody against omega-5 gliadin, the central antigen of WEDIA, as the antigenic protein induces wheat-dependent exercise-induced hypersensitivity, By detecting this, it was confirmed that wheat-dependent exercise-induced hypersensitivity could be diagnosed, thereby completing the present invention.

As one aspect for achieving the above object, the present invention provides an antigenic protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2.

In the present invention, the antigen protein also reacts with the serum of a WDEIA patient or a monoclonal antibody against omega-5 gliadin, the central antigen of WEDIA, and consists of an amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2.

The antigenic protein was identified as a minor spot by 2-D immunoblot analysis, and is a novel antigenic protein present in the Opry mutant line and belongs to the omega-5 gliadin gene.

The antigenic protein is characterized in that it induces wheat-dependent exercise-induced hypersensitivity. The "wheat-dependent exercise-induced anaphylaxis (WEDIA)" occurs when physical exercise is performed after consuming wheat-containing food, and is known to occur mainly in adults.

The main epitope that binds to the serum immunoglobulin E (IgE) of WDEIA patients is known as omega-5 gliadin.

In the present invention, the protein is not limited to the protein consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 described in the accompanying sequence list, and may be a functional equivalent to the antigen protein having the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 . The "functional equivalent" means at least 60%, preferably 70%, more preferably 80% or more of the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 as a result of the addition, substitution or deletion of amino acids. As having homology, it refers to a protein that exhibits substantially the same activity as the antigen protein of the present invention.

The functional equivalents include, for example, amino acid sequence variants in which some of the amino acids of SEQ ID NO: 1 or SEQ ID NO: 2 are substituted, deleted, or added. Substitutions of amino acids are preferably conservative substitutions. Examples of conservative substitutions for naturally occurring amino acids are; Aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn) ) and sulfur-containing amino acids (Cys, Met). Deletion of amino acids is preferably located in a portion not directly involved in the activity of the antigen protein of the present invention. In addition, the scope of the functional equivalent includes protein derivatives in which a part of the chemical structure of the protein is modified while maintaining the basic skeleton of the antigenic protein and its physiological activity. For example, fusion proteins made by fusion with other proteins such as GFP (Green Fluorescent Protein) while maintaining physiological activity and structural changes to change the stability, storage, volatility or solubility of the protein of the present invention are included in this. .

The novel omega-5 gliadin antigen protein corresponding to the minor spot present in the off-line includes QQFPQQQ and QQIPQQQ, which are known as IgE-binding epitopes for WDEIA, and the antigen protein is QQFPQQQ or QQIPQQQ peptide antigen It is characterized in that it contains a crystal group.

The amino acid represented by SEQ ID NO: 1 may be encoded by the nucleotide sequence represented by SEQ ID NO: 3, and the amino acid represented by SEQ ID NO: 2 may be encoded by the nucleotide sequence represented by SEQ ID NO: 4.

In another aspect, the present invention provides a composition for diagnosing wheat-dependent exercise-induced hypersensitivity comprising the antigen protein.

In the present invention, the description of the antigen protein, wheat-dependent exercise-induced hypersensitivity is the same as described above.

Wheat-dependent exercise-induced hypersensitivity can be diagnosed through an antigen-antibody reaction with the antigen protein of the isolated biological sample by using the antibody against the antigenic protein.

By reacting the antibody against the antigenic protein with a biological sample and detecting the formation of an antigen-antibody complex, the antigenic protein can be detected, thereby providing information on whether wheat-dependent exercise-induced hypersensitivity.

As used herein, the term "biological sample" includes tissues, cells, whole blood, serum, plasma, tissue autopsy samples (brain, skin, lymph nodes, spinal cord, etc.), cell culture supernatants, ruptured eukaryotic cells and bacterial expression systems. However, the present invention is not limited thereto. The presence of the antigenic protein is confirmed by reacting these biological samples with the antibody against the antigenic protein in a manipulated or unmanipulated state, and when the expression of the antigenic protein is detected, the diagnosis of wheat-dependent exercise-induced hypersensitivity is possible. .

As used herein, the term “antigen-antibody complex” refers to a combination of an antigen protein in a sample and an antibody that recognizes it, and the formation of the antigen-antibody complex is performed by a colormetric method or an electrochemical method. , fluorimetric method, luminometry, particle counting method, visual assessment and scintillation counting method. It can be detected by any method selected from the group consisting of. However, it is not necessarily limited to these, and various applications and applications are possible.

In the present invention, various markers can be used to detect the antigen-antibody complex. Specific examples may be selected from the group consisting of enzymes, fluorescent substances, ligands, luminescent substances, microparticles, and radioactive isotopes, but are not necessarily limited thereto.

Enzymes used as detection markers include acetylcholinesterase, alkaline phosphatase, β-D-galactosidase, horseradish peroxidase, β-latamase, and the like, and the fluorescent substance is fluorescein. Phosphorus, Eu3+, Eu3+ chelate or cryptate, etc., and the ligand includes a biotin derivative, and the luminescent material includes acridinium ester, isoluminol derivative, and the like, and the microparticle includes colloidal gold, colored Latex and the like, and radioactive isotopes include 57Co, 3H, 125I, 125I-Bonton Hunter reagent and the like.

In addition, antigen-antibody complexes can be detected using enzyme immunosorbent assay (ELISA). The enzyme immunosorbent assay (ELISA) includes a direct ELISA using a labeled antibody recognizing an antigen attached to a solid support, and an indirect ELISA using a labeled secondary antibody recognizing a capture antibody in a complex of an antibody recognizing an antigen attached to a solid support. , a direct sandwich ELISA using another labeled antibody that recognizes an antigen in a complex of an antibody attached to a solid support and another antibody that recognizes an antigen in a complex of an antibody attached to a solid support and another antibody that recognizes an antigen in a complex Various ELISA methods are included, such as indirect sandwich ELISA using a labeled secondary antibody that recognizes the antibody. The antibody may have a detection label, and when it does not have a detection label, these antibodies can be captured and confirmed by treating another antibody having a detection label.

In another aspect, the present invention provides a composition for detecting omega-5 gliadin comprising the antigen protein.

In the present invention, the description of the antigen protein, wheat-dependent exercise-induced hypersensitivity is the same as described above.

The antigenic protein belongs to omega-5 gliadin, a major antigen of wheat-dependent exercise-induced hypersensitivity, and showed strong reactivity to WDEIA patient serum. As it was confirmed that also reacts, it is possible to detect omega-5 gliadin, which induces wheat-dependent exercise-induced hypersensitivity by using the antigenic protein.

In the case of the detection, as described above, detection is possible by the method of detecting the antigen-antibody complex.

In another aspect, the present invention provides a kit comprising a composition for diagnosing wheat-dependent exercise-induced hypersensitivity comprising the antigen protein.

In the present invention, the description of the antigen protein, wheat-dependent exercise-induced hypersensitivity is the same as described above.

The kit of the present invention comprises one or more other component compositions, solutions or devices suitable for diagnostic, detection and analysis methods.

The kit of the present invention may be a kit characterized in that it includes essential elements necessary for performing an enzyme immunoassay (ELISA). The ELISA kit includes an antibody specific for an antigenic protein, and an agent for measuring the protein level. The ELISA kit may include a reagent capable of detecting an antibody that has formed an "antigen-antibody complex", for example, a labeled secondary antibody, chromopores, an enzyme (eg, conjugated to an antibody) and a substrate thereof. have. In addition, an antibody specific for the quantitative control protein may be included.

The present invention relates to an antigenic protein comprising the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, wherein the antigenic protein induces wheat-dependent exercise-induced hypersensitivity, which can be used to diagnose wheat-dependent exercise-induced hypersensitivity. can

Specifically, the antigenic protein was identified as a reactive protein through two-dimensional immunoblot analysis using opri wheat protein with a partial deletion of omega-5 gliadin and serum from a WDEIA patient, and also the omega-, a central antigen of WEDIA, 5 It was confirmed that it also reacts with a monoclonal antibody against gliadin. As a result of analyzing the antigenic protein by mass spectrometry, it was confirmed that it corresponds to a novel omega-5 gliadin gene encoded on chromosome 1D.

Therefore, it was confirmed that the antigen protein also reacts with the serum of WDEIA patients or the monoclonal antibody against omega-5 gliadin, the central antigen of WEDIA, using the antigen protein that induces wheat-dependent exercise-induced hypersensitivity. Wheat-dependent exercise-induced hypersensitivity can be diagnosed.

Figure 1 shows the total wheat flour proteins of the parental lines Geumgang (a,d) and Olgroo (b,e) and the mutant line Opry (c,f). Protein spots in the black boxes of panels (a, b and c) were confirmed by MS/MS. Proteins circled in red, blue, yellow, purple, green and black in panels (d, e and f) are omega-5 gliadin, s-form LMW-GS, i-form LMW-GS, m-form, respectively. LMW-GS, gamma gliadin and triticin are shown. Dotted circles indicate that the protein is identified in at least one of the parental lines and not in the mutant line. MS/MS data are summarized in Table 1.
Figure 2 shows Glu-B3 locus (locus) (a), omega-5 gliadin (b), repeat splicing primers 19S-1.3-2 (c) and 143E located at the end of the 5.8 Mb region of chromosome 1B of Chinese Spring. The results of PCR analysis using primers specific for LMW-GS encoded in -1-600(d) are shown. In each panel, genomic DNAs from the nullisomic tetrasomic lines N1BT1A (4) and N1BT1D (5), Chinese Spring (6) from Kumgang (1), Olgroo (2), Opry (3), Chinese Spring were amplified. The size of the molecular weight marker in kb is indicated by lane M in each panel. Primer sequences are shown in Table 2.
Figure 3 shows the reactivity of the WDEIA patient serum and the whole wheat protein of the parental varieties Geumgang (a,d), Olgroo (b,e) or mutant Opry (c,f). Serum was obtained from J Agric Food Chem. 2015;63:9323-32. were those of patient #4(ac) and patient #5(df). Protein spots identified as omega-5 gliadins in the parental line are indicated by ovals in panels (a, b and d, e). Arrows in panels (c and f) indicate protein spots where reactivity was confirmed in both the mutant and parental lines.
Figure 4 shows the reactivity of the monoclonal antibody prepared against the N-terminal sequence of omega-5 gliadin to whole wheat protein from (a) Kumgang, (b) Olgru or (c) Opry. Protein spot positions identified as omega-5 gliadins present in the parental line are indicated by ovals in panels (a, b). In panel (c), arrows on mutant lines indicate unidentified protein spots that are reactive in both mutant and parental lines.
Figure 5 shows the genome sequence of the omega gliadin gene in chromosomes 1A (a), 1B (b) and 1D (c) of Chinese Spring. The positions of the ancestral genes found on the three chromosomes are indicated by black dots. Genes with repetitive motif features of omega-5 and omega-1,2 gliadin are indicated by red and blue ellipses, respectively. The predicted N-terminal sequence of the encoded protein is shown above each group of genes. Genes encoding full-length omega gliadins are indicated by solid ovals, pseudogenes by open ovals, and truncated genes by hatched ovals. When expressed, the truncated gene encodes a protein that lacks a portion of the COOH terminus. The truncated gene on chromosome 1A is located outside the 5.3 Mb region.
6 shows a sequence comparison of omega-5 gliadins encoded by the B and D genomes of Chinese Spring with full-length omega-5 gliadins BAE20328. N- and C-terminal sequences are indicated by black and blue boxes, respectively. Within each protein sequence, the dominant epitopes of WDEIA QQFPQQQ and QQIPQQQ are indicated in red and blue, respectively. The line above the protein sequence highlights the peptides unique to omega-D4 identified by MS/MS in Opry's protein spot reacting with serum from WDEIA patients. The red line highlights the peptides identified in the more basic protein, while the blue line highlights the peptides identified in the more acidic protein.
7 shows a PCR analysis result using a primer specific to the omega-D4 gene from Chinese Spring. Geumgang(1), Olgroo(2), Opry(3), Chinese Spring (4) and Chinese Spring nullisomic tetrasomic lines N1AT1B(5), N1AT1D(6), N1BT1A(7), N1BT1D(8), N1DT1A( 9) and N1DT1B (10) genomic DNA was amplified. The size of the molecular weight marker in kb is indicated by lane M.
8 shows the base sequence and amino acid sequence of two minor spots.

Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings so that those of ordinary skill in the art to which the present invention pertains can easily carry out the present invention. However, the present invention may be embodied in many different forms and is not limited to the embodiments described herein.

Example 1: Plant material

Geumgang (Triticum aestivum L.), the best hard wheat variety in Korea used for both baking and noodle production, and Olgru, a soft wheat variety used for noodle making, were used as parent lines to produce the mutant line Opry haploid population. Kumgang contains the Glu-A3c, Glu-B3h and Glu-D3a alleles, and Olgrou contains the Glu-A3d, Glu-B3d and Glu-D3a alleles. A reference cultivar Chinese Spring containing Glu-A3a, Glu-B3a and Glu-D3a alleles and a nullisomic tetrasomic line from Chinese Spring provided by the National BioResource Project-Wheat (Kyoto, Japan) were used as controls for PCR analysis. The plant material was obtained by growing in the field.

Example 2: Protein extraction, 2-DE analysis and mass spectrometry

Whole wheat proteins from Kumgang, Olgru and Opry were extracted with SDS buffer (2% SDS, 10% glycerol, 50 mM DTT, 40 mM Tris-Cl, pH 6.8), quantified and analyzed by 2-DE. Individual protein spots were excised from Coomassie-stained gels and transferred to 96-well plates for digestion with thermolysin, chymotrypsin or trypsin using DigestPro (Intavis, Koeln, Germany). Plates containing peptides were placed in an autosampler of a nanoflow HPLC connected to an Orbitrap Elite mass spectrometer (Thermo Scientific, San Jose, CA). MS/MS spectra were obtained from a database containing Triticeae protein sequences downloaded from NCBI on November 1, 2016, cultivar-specific sequences from Butte 86 ( Triticum aestivum ), and January 30, 2015 A database of common contaminants downloaded on the same day was searched. Two search engines, Mascot and X!Tandem, were used for analysis and the results were edited in Scaffold version 4.7.5 (Proteome Software, Inc., Portland, OR).

The updated database was used for identification of minor IgE responsive proteins in Opry. The database includes Triticeae protein sequences downloaded from NCBI on February 7, 2018, cultivar-specific gluten protein sequences from Butte 86 ( Triticum aestivum ), gliadins and LMW- from Chinese Spring cultivars. Sequences of GS, and a database of common contaminants downloaded on 30 January 2015 are included.

Example 3: PCR analysis

Genomic DNA was isolated from Geumgang and Olgroo parental lines, Opry mutant lines, Chinese Spring and Chinese Spring nullisomic tetrasomic lines using the DNeasy Plant mini kit (Qiagen, Hilden, Germany) according to the protocol provided by the manufacturer. PCR was performed using Extaq polymerase (Takara Bio Inc., Kyoto, Japan). PCR primers and amplification conditions are shown in Table 2. A known primer specific for the LMW-GS GluB3-4 gene found in Geumgang, Olgrou, and Chinese Spring was used. Forward and reverse primers for omega-5 gliadin are based on the sequence of AB181300 and amplify a 1212 bp fragment. The design of repeat junction primers followed a known method. These primers were based on the previously reported assembled sequence of the 6.5Mb region of chromosome 1B from Chinese Spring, NCBI accession number MG560141. Repeat splicing primer 19S-1.3-2 amplifies the 418 bp region. The forward primer corresponds to the sequence between positions 700,904 to 700,923 of NCBI Accession Number MG560141, and the reverse primer corresponds to the sequence between 701,298 to 710,321. Repeat splicing primers 143E-1-600 amplify the 482 bp region. The forward primer corresponds to the sequence between 6,512,265 and 6,512,288 of NCBI Accession Number MG560141, and the reverse primer corresponds to the sequence between 6,512,722 and 6,512,746.

The omega-D4 primer was designed to amplify the omega-D4 gene of the Chinese Spring variety. The forward primer corresponds to the sequence 58 to 78 bp downstream from the initiation codon and the reverse primer corresponds to the sequence 1074 to 1094 downstream from the initiation codon. The forward and reverse primers have 3 and 7 base mismatches with AB181300, a gene sequence encoding omega-5 gliadin BAE20328.

Example 4: Immunoblot Analysis

For immunoblot analysis of parental and mutant lines, 7.5 μg of total SDS-extracted protein was separated by 2-DE and transferred to a nitrocellulose membrane. Immunoblot analysis was performed using sera from WDEIA patients (approval no. 2008-A01565-50) with informed patient consent and approval from the Ethics Committee of Ile de France III and the Health Products Safety Agency (AFSSAPS). IgE-binding protein was visualized using peroxidase-labeled rabbit anti-human IgE (9160-05 SouthernBiotech) and chemiluminescent substrate (WesternBright Quantum, Advansta K-120420D20) diluted 1:500,000 according to the manufacturer's instructions. . In addition, membranes were reacted with monoclonal antibody against peptide SRLLSPRGKELG (mono ONT 18A5) diluted 1/80, peroxidase-labeled goat anti-mouse IgG(H, L)-HRP conjugate diluted 1:50,000. It was visualized using a gate (170-6516 Biorad).

Example 5: Novel Antigen Protein Sequencing in Opry

The nucleotide sequence SEQ ID NO: 3 and SEQ ID NO: 4 were analyzed by extracting the genomic DNA of Opry. The nucleotide sequence was analyzed using exome capture array and PacBio long-read sequencing system.

Experimental Example 1: 2-DE analysis of total wheat protein

Through analysis of the total wheat flour protein of the parent line Kumgang, Olgrou, and the mutant line Opry by two-dimensional gel electrophoresis (2-DE), it was found that a number of gluten proteins of about 34 to 55 kDa were missing in the mutant. was confirmed (FIG. 1, Table 1). As previously described, they contain many LMW-GS encoded by the Glu-B3 locus. As shown in Fig. 1d, spots 7-11 were identified as s-type LMW-GS ACA63869 and ACA63865 by MS/MS, and as shown in Fig. 1e, spot 8-10 was s-type by MS/MS, as shown in Fig. 1e. LMW-GS ACA63864 and ACA63868 were identified, but these spots were absent in the mutant line Opry (Fig. 1f). These proteins have the N-terminal sequence SHIPGLERP and differ only in a few amino acids.

In addition, Opry lacks the m-form LMW-GS encoded by the Glu-B3 locus. LMW-GS ACA63871 was confirmed in spot 17 of Geumgang (FIG. 1d), and LMW-GS ACP27643 was confirmed in spot 16 in Allgrou (FIG. 1e). These two proteins start with the N-terminal sequence METSHIP and differ only by 5 amino acids.

It was confirmed that the Opry mutant contained the i-type LMW-GS AAS10189 (spot 1 in FIG. 1f) contributed by the Geumgang parent (spot 6 in FIG. 1d), confirming the presence of the Glu-A3c allele in the mutant line. did. In addition, AAS10189 was identified in spot 2 of Opry and was a minor component of spot 7 in Geumgang (Fig. 1d).

All three lines start with the N-terminal sequence METSRV contributed by the Glu-D3a allele [Geumgang's spot 16 (Fig. 1d), Olgrou's spot 15 (Fig. 1e) and Opry's spot 5 (Fig. 1f)]. contains the same m-form LMW-GS ABC84361. These spots serve as a reference between the gels.

Most notably, omega-5 gliadin was lacking in the mutant line Opry. In Geumgang, spot 1-5 was identified as omega-5 gliadin CAR82267 or BAE20328 (Fig. 1d, Table 1), whereas spot 1-6 in Olgroo was CAR82267, BAE20328, or some sequence of AIU64835 or AII26682. (Fig. 1e, Table 1). All of the proteins in these regions of the 2-D gel were lacking in Opry (Fig. 1f).

In addition, several gamma gliadins were lacking in Opry, including spots 13 and 14 in Geumgang (FIG. 1d) and spots 13 and 14 in Olgrou (FIG. 1e). The two spots in Geumgang were identified as Gamma Gliadin Bu-5 from the American variety Butte 86, and the two spots in Olgrou were identified as AGO17716, and the two proteins differed only by 8 amino acids. Spot 15 of Geumgang and spot 4 of Opry identified as gamma gliadin AGJ50340, along with spot 12 of Geumgang and spot 12 and spot 3 of Opry identified as triticin are reference spots in the gel to be.

Experimental Example 2: PCR analysis of parental and mutant lines

As a result of PCR analysis, it was confirmed that many genes were deleted in Opry (FIG. 2). Through PCR using primers specific for the Glu-B3-4 LMW-GS gene, a fragment of about 1600 bp was obtained from the genomic DNA of Geumgang, Olgrou and wheat Chinese Spring used as a reference, but the mutant line Opry and Chinese Spring It was not obtained in the nullisomic tetrasomic lines N1BT1A and N1BT1D (Fig. 2a). Similarly, using primers specific for the omega-5 gliadin gene, an approximately 1200 bp fragment was obtained from Kumgang, Olgrou, and Chinese Spring (Table 2), but from Opry or Chinese Spring's nullisomic tetrasomic lines, N1BT1A and N1BT1D, not obtained (Fig. 2b). Through these results, it was confirmed that Opry lacks the omega-5 gliadin gene and the Glu-B3-4 LMW-GS gene located on chromosome 1B.

To determine the degree of deficiency in Opry, repeat splicing based on the recently published genomic sequence of the 6.5 Mb region of chromosome 1B from Chinese Spring containing LMW-GS, omega-5 gliadin and gamma gliadin genes. (repeat junction) primers were selected (Table 2). These primers amplified fragments of the expected size from the parental lines, Geumgang and Olgrou, as well as Chinese Spring, but failed to amplify Opry or N1BT1A and N1BT1D, which are nullisomic tetrasomic lines of Chinese Spring. This means that at least a 5.8 Mb region of chromosome 1B was missing in Opry.

Experimental Example 3: Immunogenic potential of parental and mutant lines

Since omega-5 gliadin is a major sensitizing protein in severe food allergy WDEIA, 2-D immunoblot analysis was performed using the sera of patients identified with WDEIA to evaluate the immunogenic potential of Opry. Patient sera were previously characterized by ELISA and 2D immunoblot analysis using individual gluten protein fractions. In both parental lines, the protein identified as omega-5 gliadin showed the greatest reactivity with IgE (Fig. 3a, b, d, e). In addition, there was some reactivity with some proteins in the LMW-GS and alpha gliadin regions of the 2D gel, as well as two protein spots with a slightly lower molecular weight than omega-5 gliadin, but the reactivity with IgE in Opry was remarkable. was significantly reduced (Fig. 3c,f). The omega-5 gliadin region was not reactive with IgE. However, two protein spots just below the omega-5 gliadin region indicated by arrows in FIG. 3 showed reactivity with the serum of two WDEIA patients. This spot corresponds to a very small protein of the Coomassie-stained gel (Fig. 1).

As a result of immunoblot, it also reacted with a monoclonal antibody prepared against the N-terminal sequence of omega-5 gliadin ( FIG. 4 ). As expected, the antibody strongly reacted with proteins identified as omega-5 gliadin (spot 1-5 in FIG. 1d) and olgru (spot 1-6 in FIG. 1e) in Geumgang. In addition, two spots were found in response to the omega-5 gliadin antibody in the mutant line Opry (Fig. 4c). Through this result, it was found that the two spots of Opry also correspond to omega-5 gliadins. A small reactivity with a basic protein of about 35 kDa was observed in all lines ( FIG. 4 ), but it was difficult to align with a specific spot on the Coomassie-stained gel.

Experimental Example 4: Arrangement of Omega Gliadin Genes in Varieties Chinese Spring

To investigate the origin of the minor reactive protein in Opry, the sequence of the omega gliadin gene in the reference wheat Chinese Spring was investigated in detail.

Of the 19 omega gliadin genes of Chinese Spring, 4 are located on chromosome 1A, 8 are located on 1B, and 7 are located on 1D (Fig. 5). The repetitive motif of 7 genes is characteristic of omega-1,2 gliadin (blue), whereas the repetitive motif of 12 genes is characteristic of omega-5 gliadin (red). A cluster of eight omega-5 gliadin genes is located within the 162 kb region of chromosome 1B, with two ancestral genes common to all three genomes. Six of these are pseudogenes with various mutations that introduce frameshifts and/or early stop codons into the coding region. Interspersed between the pseudogenes are omega-B3 and omega-B6, which encode complete omega-5 gliadins. Interestingly, four different omega-5 gliadin genes are located in the 51 kb region between the heterologous ancestral genes of chromosome 1D (Fig. 5). Three of these are distinct pseudogenes, and one omega-D4 contains a single base deletion 50bp upstream from the stop codon. C-terminally denatured omega-D4 would encode a protein of 44.4 kDa.

The amino acid sequence of the omega-5 gliadin protein encoded by chromosome 1B (omega-B3 and omega-B6) of Chinese Spring was compared with the amino acid sequence of omega-D4 ( FIG. 6 ). BAE20328, the only other full-length omega-5 gliadin sequence from NCBI, was also included in the analysis. Omega-B3 differs from BAE20328 by 2 amino acid substitutions and 28 amino acid deletions, whereas omega-B6 has 6 amino acid substitutions and 5 amino acid insertions. In comparison, the sequence of omega-D4 is significantly different from BAE20328. The N-terminal sequence of BAE20328, a protein encoded on the B chromosome, is SRL, whereas the N-terminal sequence of omega-D4 is TRQ. Also, the last 16 amino acids at the C-terminus of omega-B3, omega-B6 and BAE20328 are identical, but 9 of the last 16 amino acids are altered in omega-D4 and lack the last 6 amino acids. Despite the smaller omega-D4, the protein contains 6-8 predominant WDEIA epitopes over BAE20328 or Chinese Spring B-encoded omega-5 gliadin (Table 3). There are 27 QQFPQQQ and 6 QQIPQQQ repeat motifs in omega-D4. In particular, more than 90% of these epitopes overlap with other epitopes. Indeed, there are two regions of the protein in which two epitopes overlap, three regions in which four epitopes overlap, one region in which five epitopes overlap and one region in which nine epitopes overlap. In comparison, only 52-56% of epitope overlaps in B-encoded omega-5 gliadin and the overlap region is shorter. BAE20328 and omega-B3 each have two regions with two overlapping epitopes, two regions with three epitopes, and one region with four epitopes, whereas omega-B6 has two regions of overlap. There are four regions in which the determinants overlap, one region in which three epitopes overlap, and one region in which four epitopes overlap (Fig. 6, Table 3).

Experimental Example 5 Identification of small immunogenic proteins in Opry

Two minor unidentified proteins reacted with WDEIA serum in Opry were excised from 2-D gels, digested with chymotrypsin, thermolysin or trypsin, and analyzed by MS/MS. For the analysis of spectral data, the gluten protein gene sequence of Chinese Spring was added to the database for information. A unique peptide for omega-D4 was identified in the spot corresponding to both reactive proteins ( FIG. 6 ). This means that these proteins are encoded by the chromosome 1D genome.

Through PCR analysis of genomic DNA using primers specific for the Chinese Spring omega-D4 gene, the presence of omega-D4 was verified in both the parental line and the mutant opri (Table 2 and Fig. 7). Through the amplification of the aneuploid (aneuploid) line of Chinese Spring, the position of omega-D4 in the 1D chromosome was further confirmed. 986 from the start codon, via direct sequencing of the PCR product in Opry using OD4-F1, OD4-R1 and three internal primers (OD4-F3, CAATTCCCCGAACAACAATTC; OD4-F4, AACAGCAATTCCCTCAACAGC; OD4-F5, CAACAACACCAGTTACCG) It was confirmed that a single sequence different from omega-D4 was generated by the transition from A to C in bp. This sequence encoded a protein with a pI of 6.84. It is not known whether Opry expresses another omega-5 gliadin gene, which is an acid protein.

Experimental Example 6. Sequencing of small immunogenic proteins in Opry

The amino acid sequence and base sequence of the minor protein spot of the mutant line Opry identified in FIGS. 3 and 4 were analyzed previously. As a result, it was confirmed that the minor spot identified in FIGS. 3 and 4 has the amino acid sequence of SEQ ID NO: 1 and the base sequence of SEQ ID NO: 3. In addition, it was confirmed to have the amino acid sequence of SEQ ID NO: 2 and the amino acid sequence of SEQ ID NO: 4.

As a result of sequencing, the minor spots are novel omega-5 gliadins, newly discovered in the Opry mutant line, and were confirmed to contain repeat motifs QQFPQQQ and QQIPQQQ, known as IgE-binding epitopes for WDEIA.

Although the preferred embodiment of the present invention has been described in detail above, the scope of the present invention is not limited thereto, and various modifications and improvements by those skilled in the art using the basic concept of the present invention as defined in the following claims are also provided. is within the scope of the

<110> Republic of Korea <120> Novel antigenic proteins and their use to detect wheat-dependent exercise-induced anaphylaxis <130> DP2019125 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 387 <212> PRT <213> Unknown <220> <223> O-free <400> 1 Met Lys Thr Phe Ile Ile Phe Val Leu Leu Ala Met Val Met Ser Ile 1 5 10 15 Ala Ser Ala Thr Arg Gln Leu Ser Pro Arg Gly Lys Glu Leu Gln Thr 20 25 30 Pro Gln Glu Gln Phe Pro Gln Gln Gln Phe Pro Gln Pro Gln Gln Ile 35 40 45 Leu Gln Gln Gln Phe Pro Gln Arg Gln Gln Ile Pro Gln Gln Pro Gln 50 55 60 Gln Phe Pro Gln Gln Gln Phe Pro Gln Gln Gln Ile Pro Gln Gln Gln 65 70 75 80 Ile Pro Gln Gln Gln Phe Pro Gln Pro Gln Gln Ile Pro Gln Gln Gln 85 90 95 Phe Pro Gln Gln Gln Gln Ile Pro Gln Gln Gln Phe Pro Gln Gln Gln 100 105 110 Gln Ile Pro Gln Gln Pro Gln Gln Phe Pro Gln Gln Gln Gln Phe Pro 115 120 125 Gln Gln Gln Gln Ile Pro Gln Gln Pro Gln Gln Phe Pro Gln Gln Gln 130 135 140 Gln Phe Pro Gln Gln Gln Gln Phe Pro Gln Gln Gln Phe Pro Gln Gln 145 150 155 160 Gln Phe Pro Glu Gln Gln Phe Ser Gln Gln Gln Ser Pro Gln Pro Gln 165 170 175 Gln Ile Pro Gln Gln Gln Leu Leu Gln Gln Gln Gln Ile Pro Gln Gln 180 185 190 Glu Phe Pro Gln Gln Gln Gln Phe Pro Gln Gln Gln Phe Pro Gln Gln 195 200 205 Gln Phe Pro Gln Gln Gln Phe Pro Gln Gln Gln Gln Ile Pro Gln Gln 210 215 220 Gln Pro Gln Gln His Pro Gln Gln Gln Gln Gln Phe Pro Gln Gln Gln 225 230 235 240 Gln Ile Pro Gln Gln Lys Tyr Pro Gln Gln Gln Gln Phe Pro Gln Gln 245 250 255 Gln Phe Pro Gln Gln Gln Gln Phe Pro Gln Gln His Gln Leu Pro Gln 260 265 270 Gln Gln Phe Pro Gln Gln Gln Gln Ile Ser Glu Gln Gln Gln Gln Phe 275 280 285 Pro Gln Gln Gln Gln Phe Pro Gln Gln Gln Phe Pro Gln Gln Gln Phe 290 295 300 Pro Gln Gln Gln Gln Phe Pro Gln Gln Gln Gln Phe Pro Gln Gln Gln 305 310 315 320 Gln Phe Pro Gln Gln Gln Gln Phe Pro Gln Gln Gln Gln Phe Pro Gln 325 330 335 Gln Gln Phe Pro Gln Gln Pro Gln Gln Gln Phe Pro Lys Gln Gln Phe 340 345 350 Pro Ile Pro Tyr Pro Pro Gln Gln Gln Ser Gln Glu Ala Ser Pro Tyr 355 360 365 Gln Gln Tyr His Asn Asn Asn Tyr Leu Gly Ala Thr Leu *** Val Ser 370 375 380 Val Ala Asp 385 <210> 2 <211> 388 <212> PRT <213> Unknown <220> <223> O-free <400> 2 Met Lys Thr Phe Ile Ile Phe Val Leu Leu Ala Met Val Met Ser Ile 1 5 10 15 Ala Ser Ala Thr Arg Gln Leu Ser Pro Arg Gly Lys Glu Leu Gln Thr 20 25 30 Pro Gln Glu Gln Phe Pro Gln Gln Gln Phe Pro Gln Pro Gln Gln Ile 35 40 45 Leu Gln Gln Gln Phe Pro Gln Gln Gln Gln Ile Pro Gln Gln Pro Gln 50 55 60 Gln Phe Pro Gln Gln Gln Ile Pro Gln Gln Gln Ile Pro Gln Gln Gln 65 70 75 80 Phe Pro Gln Pro Gln Gln Ile Pro Gln Gln Gln Phe Pro Gln Gln Gln 85 90 95 Pro Ile Pro Gln Gln Pro Gln Gln Phe Pro Gln Gln Gln Gln Ile Pro 100 105 110 Gln Gln Pro Gln Gln Phe Pro Gln Gln Gln Gln Phe Pro Gln Gln Gln 115 120 125 Gln Phe Pro Gln Gln Gln Phe Pro Gln Gln Gln Phe Pro Glu Gln Gln 130 135 140 Phe Ser Gln Gln Gln Ser Pro Gln Pro Gln Gln Ile Pro Gln Gln Gln 145 150 155 160 Leu Leu Gln Gln Gln Gln Ile Pro Gln Gln Gln Leu Leu Gln Gln Gln 165 170 175 Gln Ile Pro Gln Gln Glu Phe Pro Gln Gln Gln Gln Phe Pro Gln Gln 180 185 190 Gln Phe Pro Gln Gln Gln Phe Pro Gln Gln Gln Gln Ile Pro Gln Gln 195 200 205 Gln Pro Gln Gln Leu Pro Gln Gln Gln Gln Gln Phe Pro Gln Gln Gln 210 215 220 Gln Phe Pro Gln Gln Gln Tyr Pro Gln Gln Gln Gln Phe Pro Gln Gln 225 230 235 240 Gln Phe Pro Gln Gln Gln Gln Phe Pro Gln Gln His Gln Leu Pro Gln 245 250 255 Gln Gln Phe Pro Gln Gln Gln Phe Pro Gln Gln Gln Gln Ile Ser Glu 260 265 270 Gln Pro Gln Gln Phe Pro Gln Gln Gln Gln Phe Pro Gln Gln Gln Gln 275 280 285 Ile Pro Gln Gln Gln Phe Pro Gln Gln Gln Phe Pro Gln Gln Gln Gln 290 295 300 Phe Pro Gln Gln Gln Gln Phe Pro Gln Gln Gln Gln Phe Pro His Pro 305 310 315 320 Gln Gln Phe Pro Gln Gln Gln Gln Phe Pro Gln Gln Gln Gln Phe Pro 325 330 335 Gln Gln Gln Phe Pro Gln Gln Pro Gln Gln Gln Phe Pro Gln Gln Gln 340 345 350 Phe Pro Ile Pro Tyr Pro Pro Gln Gln Gln Ser Gln Glu Ala Ser Pro 355 360 365 Tyr Gln Gln Tyr His Asn Asn Thr Tyr Leu Gly Thr Thr Leu *** Val 370 375 380 Ser Val Ala Asp 385 <210> 3 <211> 1163 <212> DNA <213> Unknown <220> <223> O-free <400> 3 atgaagacct tcatcatatt tgtcctcctt gctatggtga tgagcatcgc cagtgccact 60 aggcaactaa gccctagagg caaggagttg caaacaccac aagaacaatt cccccaacag 120 caattccctc aaccacaaca aatcctccaa caacaattcc cccaacgaca acaaatcccc 180 cagcaaccgc aacaattccc ccaacagcaa ttcccgcaac agcaaatccc acaacagcaa 240 atcccgcaac aacaattccc ccaaccacaa caaatccccc aacaacaatt cccccaacaa 300 caacaaatcc cccaacaaca attcccccaa caacaacaaa tcccccagca accacaacaa 360 ttcccccaac aacagcaatt cccccaacaa caacaaatcc cccagcaacc acaacaattt 420 ccccaacaac agcaattccc ccaacaacaa caattccccc aacagcaatt cccgcaacaa 480 caattccccg aacaacaatt ctcacaacaa caatcccccc aaccacaaca aatcccccaa 540 caacaattac tccaacaaca acaaatcccc cagcaagaat tcccccaaca acagcaattc 600 ccgcaacaac aattccccca acagcaattc cctcaacagc aattcccaca acaacaacaa 660 atcccccagc aacaaccaca acaacatccc caacaacaac aacaatttcc ccaacaacaa 720 caaatccccc aacaaaaata cccccaacaa caacaattcc cccaacagca attcccccaa 780 caacaacaat ttccccaaca acaccagtta ccgcaacaac aattccccca acaacaacaa 840 atctccgagc aacaacaaca attcccccaa caacaacaat tcccccaaca gcaattcccg 900 caacaacaat ttccccaaca acaacaattc ccacaacaac aacagttccc ccaacaacaa 960 caattccccc aacaacaaca gttcccccaa caacaacaat tcccgcaaca acaattcccc 1020 cagcaaccac aacaacaatt cccaaaacaa caatttccca taccataccc accccaacaa 1080 caatcgcaag aagcttcccc ataccaacaa taccacaaca acaactatct gggagcgaca 1140 ttataagtat cagtggccga tga 1163 <210> 4 <211> 1166 <212> DNA <213> Unknown <220> <223> O-free <400> 4 atgaagacct tcatcatatt tgtcctcctt gctatggtga tgagcatcgc cagtgccact 60 aggcaactaa gccctagagg caaggagttg caaacaccac aagaacaatt cccccaacag 120 caattccctc aaccacaaca aatcctccaa caacaattcc cccaacaaca acaaatcccc 180 cagcaaccgc aacaattccc ccaacagcaa atcccacaac agcaaatccc gcaacaacaa 240 ttcccccaac cacaacaaat cccccaacaa caattccccc aacaacaacc aatcccccag 300 caaccacagc aattccccca acaacaacaa atcccccagc aaccacaaca attcccccaa 360 caacagcaat tcccccaaca acaacaattc ccccaacagc aattcccgca acaacaattc 420 cccgaacaac aattctcaca acaacaatcc ccccaaccac aacaaatccc ccaacaacaa 480 ttactccaac aacaacaaat cccccaacaa caattactcc aacaacaaca aatcccccag 540 caagaattcc cccaacaaca gcaattcccg caacaacaat tcccccaaca gcaattccca 600 caacaacaac aaatccccca gcaacaacca caacaacttc cccaacaaca acaacaattt 660 ccccaacaac aacaattccc ccaacaacaa tacccccaac aacaacaatt cccccaacag 720 caattccccc aacaacaaca atttccccaa caacaccagt taccgcaaca acaattcccc 780 caacaacaat tccctcaaca acaacaaatc tccgagcaac cacaacaatt cccccaacaa 840 caacaattcc cccaacaaca acaaatcccc caacagcaat tcccgcaaca acaatttccc 900 caacaacaac aattcccaca acaacaacag ttcccccaac aacaacaatt cccccatcca 960 caacaattcc cccaacaaca acagttcccc caacaacaac aattccccca acaacaattc 1020 ccccagcaac cacaacaaca attcccccaa caacaatttc ccataccata cccaccccaa 1080 caacaatcac aagaagcttc cccataccaa caataccaca acaacaccta tctgggaacg 1140 acgttataag tatcagtggc cgatga 1166

Claims (8)

An antigenic protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2. The antigenic protein of claim 1, wherein the antigenic protein induces wheat-dependent exercise-induced hypersensitivity. The antigenic protein of claim 1, wherein the amino acid represented by SEQ ID NO: 1 is encoded by the nucleotide sequence represented by SEQ ID NO: 3. The antigenic protein of claim 1, wherein the amino acid represented by SEQ ID NO: 2 is encoded by the nucleotide sequence represented by SEQ ID NO: 4. The antigenic protein of claim 1, wherein the antigenic protein comprises an epitope of QQFPQQQ or QQIPQQQ peptide. A composition for diagnosing wheat-dependent exercise-induced hypersensitivity comprising the antigen protein of claim 1. A composition for detecting omega-5 gliadin comprising the antigen protein of claim 1. A kit comprising the composition of claim 6 or 7.

Images