KR102263396B1 - Pharmaceutical Composition comprising Isoliquiritigenin Derivatives for Preventing or Treating of Bone Related Diseases - Google Patents

Abstract

The present invention relates to isoliquiritigenin derivatives and their uses, and the isoriquiritigenin derivatives can be used alone or in combination, inhibiting the differentiation of macrophages into osteoclasts without significant cytotoxicity, and inhibiting the differentiation of osteoclasts into osteoclasts. Since it inhibits the activity of osteoblasts and has the effect of inhibiting apoptosis of osteoblasts, it can be usefully used for the prevention or treatment of bone diseases.

Description

Pharmaceutical composition comprising Isoliquiritigenin Derivatives for Preventing or Treating of Bone Related Diseases, comprising isoliquiritigenin derivatives

The present invention relates to isoliquiritgenin derivatives and their use for the prevention or treatment of bone diseases.

The normal bone remodeling process consists of a balance between bone formation and bone resorption, and this bone formation and bone resorption is largely accomplished by the interaction of three cells, chondrocytes, osteoblasts, and osteoclasts. . Among them, osteoclasts are cells derived from hematopoietic stem cells and are responsible for resorption of aged bone, and osteoblasts are cells derived from bone marrow stromal cells in the bone marrow and play a major role in bone formation. Bone formation is maintained by continuously regulating the balance between bone resorption by osteoclasts and bone formation by osteoblasts. However, excessive activity of osteoclasts or decreased activity of osteoblasts causes imbalance in the remodeling process of bone formation, and may cause bone disease by breaking the balance between osteoclasts and osteoblasts in vivo.

Osteoporosis, a typical example of bone disease, is a disease in which bone mass is reduced due to the disruption of the balance between bone formation and bone resorption, and the risk of fracture continues to increase due to the degeneration of the microstructure of bone tissue. This is a reduced state, and it occurs when the balance of bone remodeling is disrupted and osteoclast action is increased than osteoblastic action. The gap between the bone microstructures becomes wider and the microstructure becomes thinner, increasing the risk of easily fractured bones even with a small impact. Osteoporosis after menopause occurs gradually in men and women over 70 years of age.

Substances currently used for the treatment of osteoporosis include estrogen, androgenic anagolic ateroid, calcium preparations, phosphates, fluoride preparations, ipriflavone, vitamin D3, and the like. Estrogen suppresses apoptosis of osteoblasts to increase cell survival, and promotes apoptosis of osteoclasts to decrease cell survival, which is an effective method for the treatment of menopause symptoms and maintenance of bone density. There are side effects that cause In addition, drugs that inhibit bone destruction by inhibiting osteoclast activity or increase the activity of bone regeneration unit through proliferation of osteoblasts include calcitonin, parathyroid hormone, and bisphosphonate preparations. However, existing osteoporosis drugs cause many side effects when administered for a long period of time. Therefore, there is a demand for the development of new osteoporosis therapeutics in addition to existing therapeutics.

Accordingly, the present inventors have made efforts to discover new substances that can effectively treat bone diseases, and as a result, it has been confirmed that isoliquiritgenin compounds have excellent preventive and therapeutic effects for bone diseases and completed the present invention.

1. Int J Biochem Cell Biol., vol. 44, 1139-1152 (2012)

It is an object of the present invention to provide a pharmaceutical composition for preventing or treating bone disease, and a food composition for preventing or improving bone disease, comprising an isoliquiritijenin derivative as an active ingredient.

In order to achieve the above object, one aspect of the present invention is a compound or mixture selected from the group consisting of a compound represented by the following formula (1), a compound represented by the following formula (2), a pharmaceutically acceptable salt thereof, or a mixture thereof. It provides a pharmaceutical composition for the prevention or treatment of bone diseases comprising as an active ingredient.

[Formula 1]

[Formula 2]

In the present invention, the compound represented by Formula 1 may be referred to as (2E)-1-(2,4-Dihydroxyphenyl)-3-(4-fluorophenyl)-2-propen-1-one, and represented by Formula 2 The indicated compound may be referred to as 2',3,4,4',5-pentahydroxychaclone or robtein. These two compounds are derivatives of isoliquiritigenin (ILG) represented by the following Chemical Formula 3, and isoliquiritigenin is known to have an osteoclast differentiation inhibitory effect (Non-Patent Document 1), but the Chemical Formula 1 or Inhibition of osteoclast differentiation and activity, and osteoblast protective effect of the compound represented by Formula 2 are not known.

[Formula 3]

As a result of the present inventors' efforts to discover substances having a therapeutic effect on bone-related diseases, for example, osteoporosis, derivatives of isoliquiritgenin inhibit the differentiation of macrophages into osteoclasts, and inhibit the activity of osteoclasts. It was confirmed that it inhibits and protects osteoblasts from apoptosis. In addition, the derivatives of the isoriquiritigenin of the present invention are more effective than the isoriquiritigenin ( FIGS. 2 to 6 ).

In one embodiment of the present invention, the pharmaceutical composition may include both the compound represented by Formula 1 and the compound represented by Formula 2, and a salt of the compound represented by Formula 1 and the compound represented by Formula 2, or It may include a salt of the compound represented by Formula 1 and the compound represented by Formula 2.

In one embodiment of the present invention, when the pharmaceutical composition includes both the compound represented by Formula 1 and the compound represented by Formula 2, the pharmaceutical composition is represented by Formula 2 per 1 part by weight of the compound represented by Formula 1 The compound may be included in an amount of 0.05 to 10 parts by weight, for example, 0.2 to 5 parts by weight of the compound represented by Formula 2 per 1 part by weight of the compound of Formula 1 may be included.

The present inventors confirmed that when the compound represented by Formula 1 and the compound represented by Formula 2 were treated together, the osteoclast differentiation and activity inhibitory effect and the osteoblast protective effect were significantly increased than when each compound was treated alone. The compound may be included in the pharmaceutical composition together ( FIGS. 4 to 6 ).

In one embodiment of the present invention, the pharmaceutical composition is an osteoclast differentiation marker selected from the group consisting of cathepsin K, DC STAMP (dendritic cell specific transmembrane protein), and tartrate-resistant acid phosphate (TRAP). expression can be inhibited.

Specifically, macrophages were pretreated with ILG, a compound of Formula 1 (derivative 1 of Example) or a compound of Formula 2 (derivative 2 of Example), and treated with receptor activator of NK-κB ligand (RANKL), an osteoclast differentiation inducer After that, it was confirmed. As a result, it was confirmed that the expression level of the differentiation markers was significantly reduced, and it was confirmed that the derivatives of isoriquiritgenin of the present invention can inhibit the differentiation of macrophages into osteoclasts.

In addition, the pharmaceutical composition can protect osteoblasts from apoptosis caused by oxidative stress. Osteoblasts are cells that make bone (bone) by synthesizing and secreting bone matrix. If the balance between osteoclasts and osteoblasts is disrupted and the activity of osteoclasts increases, bone-related diseases may occur.

The present inventors pretreated osteoblasts with ILG, a compound of Formula 1 (derivative 1 in Example), a compound of Formula 2 (derivative 2 in Example), or a compound of Formula 1+2, and subjected to oxidative stress, a major cause of osteoporosis. , it was confirmed that osteoblasts were protected from apoptosis caused by oxidative stress (FIG. 6).

In the present invention, the bone disease may be selected from the group consisting of osteoporosis, periodontal disease, osteomalacia, osteopenia, bone defect, bone atrophy, osteonecrosis, fracture, osteolysis, osteoarthritis, and osteodystrophy, preferably osteoporosis. have.

As used herein, the term "osteoporosis" refers to a state in which the mineral (especially calcium) and matrix constituting the bone decrease, so that the microstructure of the bone tissue deteriorates, and as a result, the risk of fracture is continuously increased. When osteoclast activity is increased more than osteoblastic activity, it occurs because the balance of bone remodeling is disturbed, and the causes include calcium malabsorption, vitamin D deficiency, drug side effects, lack of exercise, excessive drinking, menopause, and depression. In particular, in the case of women, it is known that when estrogen secretion decreases after menopause, active oxygen accumulates in the cells, triggering bone loss.

Types of osteoporosis include primary osteoporosis, such as postmenopausal osteoporosis and senile osteoporosis, and secondary osteoporosis caused by diseases affecting bone formation and reduction, drugs, alcohol, and smoking.

The pharmaceutical composition of the present invention may further include suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceuticals. Carriers, excipients and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

When formulating the pharmaceutical composition of the present invention, it is prepared using a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, and a surfactant usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the composition of the present invention, for example, starch, calcium carbonate, sucrose (sucrose) or lactose (lactose), gelatin, etc. are mixed and prepared. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances, preservatives, etc. may be included. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

The composition of the present invention may be administered orally or parenterally, and oral administration is preferred. The preferred dosage of the composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the drug form, the route and duration of administration, but may be appropriately selected by those skilled in the art. Administration may be administered once a day or may be administered in several divided doses, and the dosage is not intended to limit the scope of the present invention in any way.

Another aspect of the present invention is bone comprising a compound or mixture selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, a pharmaceutically acceptable salt thereof, or a mixture thereof as an active ingredient. It provides a food composition for preventing or improving diseases.

Since the food composition uses the same ingredients as the pharmaceutical composition for the prevention or treatment of bone diseases, overlapping content between the two is omitted to avoid excessive description of the specification.

In the present invention, the food composition may be provided in the form of powder, granule, tablet, capsule, syrup, beverage or pill, and is used with other foods or food additives in addition to the compound represented by Formula 1 or Formula 2 as an active ingredient, It can be used suitably according to a conventional method. The mixing amount of the active ingredient may be suitably determined according to the intended use thereof, for example, prophylactic, health or therapeutic treatment.

The effective dose of the active ingredient contained in the food composition may be used according to the effective dose of the pharmaceutical composition, but in the case of long-term intake for health and hygiene purposes or health control, it may be less than the above range, It is certain that the active ingredient can be used in an amount beyond the above range because there is no problem in terms of safety.

The food composition includes ingredients commonly added during food production, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents. Examples of the above-mentioned carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose, oligosaccharides and the like; and polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents, natural flavoring agents and synthetic flavoring agents can be used. For example, when the food composition of the present invention is prepared as a drink, citric acid, high fructose, sugar, glucose, acetic acid, malic acid, fruit juice, etc. may be additionally included in addition to the active ingredient of the present invention.

Another aspect of the present invention provides a composition for inhibiting osteoclast differentiation in vitro using the compound represented by Formula 1 or 2.

In one embodiment of the present invention, since the compound represented by Formula 1 or 2 effectively inhibited the differentiation of macrophages into osteoclasts induced by RANKL treatment, the compounds may be used for inhibiting osteoclast differentiation.

The isoquiritijenin derivatives according to the present invention may be used alone or in combination, and inhibit the differentiation of macrophages into osteoclasts without significant cytotoxicity, inhibit the activity of osteoclasts, and inhibit the apoptosis of osteoblasts. It can be usefully used for the prevention or treatment of bone diseases because of its effect.

1 is a result of measuring cell viability (A) and cytotoxicity (B) after treating macrophages with an osteoclast differentiation inducer (RANKL), isoliquiritgenin (ILG), derivative 1 or derivative 2;
2 is a micrograph (A) and a graph (B) showing the degree of differentiation into osteoclasts after macrophages are treated with an osteoclast differentiation inducer (RANKL), isoliquiritgenin (ILG), derivative 1 or derivative 2; it shows the result.
Figure 3 is after the treatment of macrophages with osteoclast differentiation inducer (RANKL), isoliquiritgenin (ILG), derivative 1 or derivative 2, osteoclast differentiation and activation marker DC STAMP (dendritic cell specific transmembrane protein) and car This is the result of confirming the mRNA level of cathepsin K.
4 is a result confirming the degree of differentiation into osteoclasts after macrophages are treated with an osteoclast differentiation inducer (RANKL), isoliquiritgenin (ILG), derivative 1, derivative 2, or derivative 1+2.
5 is a graph showing the degree of differentiation of bone mimic matrix by osteoclasts after macrophages are treated with osteoclast differentiation inducer (RANKL), isoliquiritgenin (ILG), derivative 1, derivative 2, or derivative 1+2 ( A) and micrographs (B) show the results.
6 is a result of confirming the cell viability after treating osteoblasts with an oxidative stress inducer (H2O2), isoliquiritgenin (ILG), derivative 1 or derivative 2.

Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are for illustrative purposes of one or more embodiments, and the scope of the present invention is not limited to these examples.

Isoliquiritigenin (hereinafter, referred to as ILG) is known to have an osteoclast differentiation inhibitory effect. Accordingly, (2E)-1-(2,4-Dihydroxyphenyl)-3-(4-fluorophenyl)-2-propen-1-one (hereinafter, referred to as derivative 1) and robtein 2 among ILG derivatives The effects of ',3,4,4',5-pentahydroxychalcone (hereinafter referred to as derivative 2) were confirmed in Examples 1 to 5 below.

Example 1: Confirmation of cytotoxicity of derivatives 1 and 2

In order to confirm the toxicity of Derivatives 1 and 2, an experiment was conducted as follows.

First, in order to confirm cell viability, the activity of dehydrogenase present in the cytoplasm was measured. In a 96-well plate, 5x10 ³ cells were seeded in each well and cultured for 24 hours, and RANKL (receptor activator of NK-κB ligand), an osteoclast differentiation inducer, 40 ng/ml, and ILG, derivative 1, derivative 2 was treated for each concentration and then further cultured for 48 hours. Thereafter, EZ-cytox reagent (DOGEN, Korea) was added to each well and left at 37° C. for 2 hours, and then absorbance was measured at 450 nm with a microplate reader (Thermo Fisher Scientific, MA, USA).

In addition, in order to confirm the level of cytotoxicity, the level of lactate dehydrogenase (LDH) released from the cells into the culture medium was measured with an LDH Cytotoxicity detection kit (TAKARABIO, Japan). Specifically, the culture medium remaining in the cell viability confirmation experiment was transferred to a new 96-well plate, and a reaction mixture containing tetrazolium salt was added to each well and reacted at room temperature for 10 to 30 minutes. Then, 1N HCl was added to stop the further reaction, and the absorbance was measured at 490 to 492 nm with a microplate reader to calculate cytotoxicity.

As a result, no significant changes in cell viability and cytotoxicity were found in all of the experimental groups until 48 hours of cell culture, and when 10 uM of Derivative 1 or Derivative 2 was treated, cell viability was slightly decreased compared to the control group, but statistical significance was not It was found that there is no (Fig. 1).

Example 2: Inhibition of differentiation and activation of osteoclasts

2-1. Inhibition of osteoclast differentiation

In a 48-well plate, RAW264.7 cells, a mouse macrophage cell line, were aliquoted into each well by 3x10 ³ , and ILG, derivative 1 and derivative 2 were pretreated with 0.1, 1, 5 or 10 μM concentrations, respectively. After 1 hour, RANKL (receptor activator of NK-κB ligand), an osteoclast differentiation inducer, was treated at a concentration of 40 ng/ml. Thereafter, the culture medium was replaced every 2 days for a total of 5 days, and when differentiation into osteoclasts was confirmed under a microscope, the cell medium was discarded and washed with PBS. The differentiated cells were fixed with a fixing solution at room temperature for 5 minutes and washed several times with distilled water. A substrate solution of sodium tartrate and acid phosphatase was mixed, and the prepared mixture was added to each well to stain TRAP (tartrate-resistant acid phosphate), an osteoclast differentiation marker. Staining was carried out at 37° C. for 15 to 45 minutes after covering the plate to prevent drying. Thereafter, the dye was discarded and the reaction was stopped by washing with distilled water three times. After observing under a microscope, the number of stained cells was counted by taking pictures. Since osteoclasts are characterized by having multiple nuclei, TRAP ⁺ osteoclasts having three or more nuclei in one cell were counted as effective cells.

As a result, the ILG-treated group showed an inhibitory effect on osteoclast differentiation from a concentration of 5 μM, and the derivative 1 and derivative 2 treatment groups also showed an inhibitory effect on osteoclast differentiation from a concentration of 5 μM. It was excellent (Fig. 2).

2-2. Effect of inhibiting the expression of osteoclast differentiation markers

In a 6-well plate, 3x10 ⁴ cells were seeded into each well, and ILG, Derivative 1 and Derivative 2 were each pretreated at a concentration of 5 uM or 10 uM for 1 hour. Then, each well was treated with RANKL at a concentration of 40 ng/ml, and the cells were recovered with trizol after culturing for a total of 4 days while changing the medium every 2 days. mRNA was isolated from the recovered cells by the trizol-chloroform method, and quantified by nano-drop. Thereafter, cDNA was synthesized using a cDNA synthesis kit (oligo dT primer) with 500 ng of the isolated mRNA, and RT-PCR was performed using the synthesized cDNA as a template. A total of 35 cycles of RT-PCR annealing were performed at 56° C. for 30 seconds and elongation at 72° C. for 1 minute. The primer sequences used for RT-PCR were as follows:

DC-STAMP F (SEQ ID NO: 1): TTGAACCGAGCTGCATTCCT;

DC-STAMP R (SEQ ID NO: 2): GCACTACCTTGGCCTTACCT;

cathepsin K F (SEQ ID NO: 3): GCAGATGTTTGTGTTGGTCTCT; and

Cathepsin K R (SEQ ID NO: 4): TGGTGGAAAGGTGTGACAGG.

As a result, it was confirmed that the mRNA levels of DC STAMP (dendritic cell specific transmembrane protein) and cathepsin K, which are osteoclast differentiation and activation markers, decreased in all of the ILG-treated group, the derivative 1 treatment group and the derivative 2 treatment group. In the case of 10 uM treatment of Derivative 2, the mRNA reduction effect was the best (FIG. 3).

Example 3: Effect of Combination Treatment of Derivative 1 and Derivative 2

The experiment was carried out in the same manner as in Example 2-1, but the effect of inhibiting differentiation into osteoclasts was confirmed by adding an experimental group treated with Derivative 1 and Derivative 2 together. Treatment concentrations of Derivative 1 and Derivative 2 were set to 1+1, 1+5 and 5+1 uM, respectively.

As a result, the ILG treatment group (5 uM), the derivative 1 treatment group (5 uM), and the derivative 2 treatment group (5 uM) all inhibited the differentiation of RAW264.7 cells into osteoclasts. It was found that the 2 treatment group (1+5 uM, 5+1 uM treatment) significantly increased (FIG. 4).

Example 4: Confirmation of activity of differentiated osteoclasts

To confirm the activity of RAW264.7 cells differentiated into osteoclasts by RANKL treatment, a bone resorption assay kit (CSR-BRA-48KIT, COSMOBIO) was used. Specifically, RAW264.7 cells were aliquoted on a Petri dish coated with a bone imitation mattress containing a calcium-phosphate layer, and ILG, Derivative 1, Derivative 2, and Derivative 1+2 were pretreated for 1 hour. Thereafter, RANKL at a concentration of 40 ng/ml was treated at 2-day intervals for a total of 6 days, and after 6 days, 5% sodium hypochlorite was treated for 5 minutes to remove osteoclasts attached to the culture dish. The culture dish was further washed with water and dried, and after taking a picture of each well, the pit area formed by osteoclasts decomposing the bone imitation matrix was measured as image J. The degradation area is proportional to the activity of osteoclasts.

As a result of the measurement, when RANKL and each compound were treated simultaneously, the ILG-treated group showed a significant decrease in the decomposition area from a concentration of 5 uM, and at the same concentration, the Derivative 1 and Derivative 2 treatment groups showed better decomposition area reduction. The effect of reducing the decomposition area was the most excellent in the 10 uM concentration of Derivative 2 treatment group, and the derivative 1+2 treatment group (1+5 uM, 5+1 uM treatment group) showed a similar effect to the 5 uM derivative 2 treatment group. was seen (FIG. 5).

Example 5: Osteoblast protective effect

Saos2 (human bone osteosarcoma) cells, a type of osteoblast, were ^{aliquoted in each well of 5x10 3} cells in a 96-well plate and cultured for 24 hours, treated with ILG, derivative 1, and derivative 2 at each concentration for 6 hours incubated (pre-treatment). _{Then, each well was treated with 100 uM of H 2} O ₂ , an osteoporosis-inducing substance, and cultured for 2 hours, EZ-cytox reagent (DOGEN) was added to each well and left at 37° C. for 2 hours. After 2 hours, absorbance was measured at 450 nm with a microplate reader (Thermo Fisher Scientific, MA, USA).

As a result of the measurement, it was found that _{the viability of Saos2 cells was reduced by 40% by the H 2} O ₂ treatment, but the cell viability was significantly increased when the derivative 2 was treated at a concentration of 5 or 10 uM ( FIG. 6 ). This result means that the compound of derivative 2 can protect osteoblasts from apoptosis caused by oxidative stress.

<110> CATHOLIC KWANDONG UNIVERSITY <120> Pharmaceutical Composition comprising Isoliquiritigenin Derivatives for Preventing or Treating of Bone Related Diseases <130> P19U17C0976 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP Forward primer <400> 1 ttgaaccgag ctgcattcct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP reverse primer <400> 2 gcactacctt ggccttacct 20 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> cathepsin K Forward primer <400> 3 gcagatgttt gtgttggtct ct 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> cathepsin K reverse primer <400> 4 tggtggaaag gtgtgacagg 20

Claims (9)

A compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof, and
As a pharmaceutical composition for the prevention or treatment of bone diseases comprising a compound represented by the following formula (2) or a pharmaceutically acceptable salt thereof as an active ingredient,
The bone disease is osteoporosis, periodontal disease, osteomalacia, osteopenia, bone defect, bone atrophy, osteonecrosis, fracture, osteolysis, osteoarthritis (osteoarthritis) and osteogenic insufficiency (osteogenesis imperfecta) selected from the group consisting of, a pharmaceutical composition for the prevention or treatment of bone diseases.
[Formula 1]

[Formula 2]

delete According to claim 1, wherein the pharmaceutical composition comprises 0.05 to 10 parts by weight of the compound represented by Formula 2 per 1 part by weight of the compound represented by Formula 1, The pharmaceutical composition for preventing or treating bone disease.
delete According to claim 1, wherein the pharmaceutical composition is cathepsin K (cathepsin K), DC STAMP (dendritic cell specific transmembrane protein) and TRAP (tartrate-resistant acid phosphate) expression of osteoclast differentiation markers selected from the group consisting of A pharmaceutical composition for the prevention or treatment of bone disease, which inhibits.
The pharmaceutical composition for preventing or treating bone disease according to claim 1, wherein the pharmaceutical composition protects osteoblasts from apoptosis caused by oxidative stress.
A compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof, and
As a food composition for the prevention or improvement of bone disease comprising a compound represented by the following formula (2) or a pharmaceutically acceptable salt thereof as an active ingredient,
The bone disease is selected from the group consisting of osteoporosis, periodontal disease, osteomalacia, osteopenia, bone defect, bone atrophy, osteonecrosis, fracture, osteolysis, osteoarthritis and osteodystrophy, a food composition for preventing or improving bone disease.
[Formula 1]

[Formula 2]

delete delete

Images