KR102261338B1 - InDel molecular marker for discriminating genotype of restorer-of-fertility genes involved in cytoplasmic male sterility of pear and uses thereof - Google Patents

Abstract

The present invention relates to an InDel molecular marker for discriminating the genotype of a gene related to male sterility recovery in cytoplasmic genes of Pyrus pyrifolia, and uses thereof. The InDel molecular marker of the present invention can quickly and accurately predict the presence or absence of pollen in Pyrus pyrifolia by using genomic DNA from young leaves regardless of the flowering period, thereby reducing the cost and time required for breeding of Pyrus pyrifolia.

Description

InDel molecular marker for discriminating genotype of restorer-of-fertility genes involved in cytoplasmic male sterility of pear and uses thereof

The present invention relates to an InDel molecular marker for determining the genotype of an embryo cytoplasmic gene male fertility recovery-related gene and its use.

Pear is the fruit of the pear tree ( Pyrus spp), and together with apples, 80 million tons of pears are produced annually in the pear subfamily, the third largest after bananas and tangerines worldwide, and the second largest in the Rosaceae with 252 million tons of annual production. Production is high (FAO 2013). Pear trees, like most other fruit trees, have a disadvantage in that the breeding cycle is long due to the characteristics of juvenile that takes a long time from sowing to fruiting and self-incompatibility where self-pollination is impossible. . Therefore, there is a growing demand for the development of useful trait-associated molecular markers to improve breeding efficiency.

The study of cytoplasmic male sterility was reported in 1976 in embryos, and the phenotype appears mainly as the presence or absence of pollen. Cytoplasmic male infertility is caused by a mutated mitochondrial gene and mitochondrial DNA exists in the cytoplasm and is inherited from the maternal line, so the mitochondria with the infertility gene are conserved and inherited in the next generation. In commercial orchards, depending on the cultivar, pollinizers should be planted or artificial pollination should be performed in consideration of the S (male infertility cytoplasm) genotype.

GBS (Genotyping by sequencing) was developed and distributed in 2011 as an application technology of NGS (Next generation sequencing), an automated technology that reads DNA genetic information. GBS refers to a series of analysis processes that develop single nucleotide polymorphisms (SNPs) for multiple individuals and enable genotyping as the basis of the NGS technology analysis platform. If the nucleotide sequence information of a single entity was read in the existing NGS, GBS treats a number of target entities with restriction enzymes and attaches barcodes and adapters to a large number at a relatively low cost through an analysis library production method characterized by attaching barcodes and adapters. It is possible to obtain a large amount of fragment sequencing data and genotype data for individuals of GBS technology is suitable for the search for SNPs, and the discovered SNPs are used for genetic studies of various animal and plant species, such as genome-wide association studies between multiple individuals, association mapping, and quantitative trait mapping (QTL mapping). is becoming With the development of plant genome analysis technologies such as NGS and GBS, it has become possible to search for genetic mutations related to target traits, and research is underway to utilize them for marker-assisted selection (MAS) in breeding programs. In particular, the creation of genetic maps for quantitative and qualitative traits based on genetic maps provides insight into the genetic background of agricultural traits and further facilitates the development of trait-related molecular markers for molecular marker selection.

Molecular markers are a method of detecting polymorphisms using Polymorphism chain reaction technology. They are basically simple and fast and are not affected by various environmental factors such as the cultivation environment, plant development stage, and the subjectivity of the researcher. does not The InDel marker is used to search for a nucleotide sequence inserted or deleted from the genomic DNA nucleotide sequence of a specific species or closely related entity as a molecular marker. If PCR primers are designed to include InDel structures among various DNA mutation structures existing in the genome and then PCR and electrophoresis are performed, individuals can be distinguished according to individual InDel polymorphisms.

Meanwhile, Korea Patent No. 1783347 discloses 'CAPS marker for determining the presence or absence of pollen in pears and their use' based on SNP, and Korean Patent No. 1778877 discloses 'Distinguishing between golden pear and mini pear varieties based on InDel polymorphism'. A molecular marker for 'is disclosed, but the InDel molecular marker and its use for determining the genotype of the cytoplasmic gene of the present invention and the gene related to male sterility recovery are not described.

The present invention was derived by the above request, and the present inventors analyzed the nucleotide sequences of a pear cultivar with pollen (mini pear) and a pear cultivar without pollen (golden pear), then chromosomes 4 and 5 of the reference genome Comparing the fertility restoration gene Rf1 and Rf2 nucleotide sequences present in fertility and the nucleotide sequence corresponding to the same position as the Rf1 and Rf2 genes of the reference genome in the golden pear and mini embryo genomes, the genomes of golden pear and mini embryo developed a (CBp04id01 and CBp05id01) InDel molecular markers based on the sequence within the insertion or deletion polymorphism, in the development of the PCR was performed using the InDel molecular markers combining genotype of Rf1 and Rf2 over the size of the amplification product golden times And the present invention was completed by confirming that the presence or absence of pollen in the interspecies F _{1 group of mini-bae can be effectively predicted.}

In order to solve the above problems, the present invention provides an oligonucleotide primer set of SEQ ID NOs: 1 and 2; and oligonucleotide primer sets of SEQ ID NOs: 3 and 4; provides a primer set for predicting the presence or absence of pollen of a pear tree (Pyrus spp.), including.

In addition, the present invention is the primer set; And it provides a kit for predicting the presence or absence of pollen of a pear tree comprising a reagent for performing an amplification reaction.

In addition, the present invention comprises the steps of isolating genomic DNA from a pear tree sample; amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set; and analyzing the genotype through the product of the amplification step; provides a method for predicting the presence or absence of pollen of a pear tree.

The InDel molecular marker of the present invention can quickly and accurately determine the presence or absence of pollen in pears using the genomic DNA of young leaves (young leaves) regardless of the flowering period. It is thought that the cost and time required for embryo breeding can be reduced by identifying and excluding the parent with the root causative gene that can cause the absence of pollen in the mating plan for pollinizer breeding.

1 is a photograph confirming the presence or absence of pollen for golden pears, mini pears, and F _{1 objects of golden pears and mini pears.}
2 is a diagram showing the location of a single nucleotide polymorphism (SNP; marked in red), which is highly related to the presence or absence of pollen, on the genome association map of _{golden pear and mini pear F 1 .}

In order to achieve the object of the present invention, the present invention provides an oligonucleotide primer set of SEQ ID NOs: 1 and 2; and oligonucleotide primer sets of SEQ ID NOs: 3 and 4; provides a primer set for predicting the presence or absence of pollen of a pear tree (Pyrus spp.), including.

The primer set according to the present invention has a SNP position that is closely related to the presence of pollen in the genome sequence of the pear tree reference genome (Chinese pear Dangchansuli, http://peargenome.njau.edu.cn/default.asp?d=4&m=3). subject to based respectively present fertility restoration gene in the reference genome chromosomes 4 and 5 in (restorer gene) Rf (restorer of fertility) 1 and the nucleotide sequence of Rf2, pear cultivar "golden times with no pollen (Whangkeumbae; Scientific name , Pyrus purofolia ; Parentage, Niitaka×Nijisseiki) and pollen cultivar 'Minibae; Scientific name , (P. pyrifolia × P. ussuriensis )× P. pyrifolia ; Parentage, Danbae×Kosui) ' It is a primer set prepared based on a polymorphism inserted or deleted in the genome sequence of golden pear and mini pear by comparing the nucleotide sequences corresponding to the same position as the Rf1 and Rf2 genes of the reference genome in the genome.

The term 'fertility recovery gene' refers to a gene that restores the infertility characteristics of a male infertile parent.

The term 'male infertility' is a phenomenon in which infertility occurs due to abnormalities in male organs such as pollen, anther, and stamen. Male infertility strains used for most breeding are male infertility strains due to genetic causes. Male infertility due to genetic causes can be largely divided into cytoplasmic genic male sterility (CGMS), genic male sterility (GMS) and cytoplasmic male sterility (CMS), Among these, cytoplasmic gene male sterility and cytoplasmic male sterility both mean loss of self-fertilization ability by generating abnormal pollen due to mitochondrial abnormalities in the cytoplasm, but can be distinguished depending on the presence or absence of a fertility recovery gene. Cytoplasmic gene male fertility is a 100% male fertility line when crossed with a male fertile line that has a fertility restoring gene (Rf ) in the form of a homozygote, and a male fertility line that does not have a fertility restoring gene is crossed 100% male sterility can come out.

In the primer set of the present invention, the primer set of SEQ ID NOs: 1 and 2 (CPp04id01) is the Rf1 gene nucleotide sequence in chromosome 4 where SNPs highly related to the presence or absence of pollen in the reference genome (Chinese cultivar 'Dangshansuli') exist. By comparing the 11,292,864~11,292,987 bp (157 bp) region of the nucleotide sequence corresponding to the same position as the Rf1 gene region of the reference genome in the golden-pear and mini-fold genomes, some bases are deleted from the genome sequence of the golden-pear or mini-fold. It is built on the basis of a given area; The primer set of SEQ ID NOS: 3 and 4 (CPp05id01), see dielectric (Chinese pear 'Dangshansuli') within the SNP high pollen presence relevant presence chromosome 5 that within Rf2 27,068,476 of the gene sequence ~ 27,068,617 bp (142 bp) By comparing the region and the nucleotide sequence corresponding to the same position as the Rf2 gene region of the reference genome in the golden pear and mini pear genomes, it was produced based on the region in which some bases were inserted in the genomic sequence of the golden pear and mini embryo, The genotype of Rf1 , a fertility recovery gene, can be determined according to the size of the product amplified by the primer sets of SEQ ID NOs: 1 and 2, and fertility recovery according to the size of the product amplified by the primer sets of SEQ ID NOs: 3 and 4 Since the genotype of the gene Rf2 can be determined, when two primer sets are used at the same time, it is possible to discriminate male infertility of the embryo's cytoplasmic gene, thereby more efficiently predicting the presence of pollen in the embryo.

That is, the primer sets of SEQ ID NOs: 1 and 2; and the primer sets of SEQ ID NOs: 3 and 4 can determine the genotypes of the fertility recovery genes Rf1 and Rf2, respectively, depending on the size of the amplification product. It is possible to discriminate the cytoplasmic male infertility of the embryo, so it is possible to more efficiently predict the presence of pollen in the embryo.

According to the sequence length of each primer, the primers are SEQ ID NOs: 1 and 2; and oligonucleotides consisting of fragments of 16 or more, 17 or more, 18 or more, 19 or more, 20 or more consecutive nucleotides in the sequence of SEQ ID NOs: 3 and 4. For example, the primer of SEQ ID NO: 1 (20 oligonucleotides) may include an oligonucleotide consisting of a fragment of 18 or more, 19 or more consecutive nucleotides in the sequence of SEQ ID NO: 1. In addition, the primers are SEQ ID NOs: 1 and 2; And SEQ ID NOs: 3 and 4; may also include a sequence of addition, deletion or substitution of the nucleotide sequence.

In the primer set of the present invention, the nucleotide sequences shown in SEQ ID NOs: 1 and 3 represent forward primers, and the nucleotide sequences shown in SEQ ID NOs: 2 and 4 represent reverse primers.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

As used herein, the oligonucleotide used as a primer may also contain a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid or An intercalating agent may be included.

The present invention also provides the primer set of the present invention; And it provides a kit for predicting the presence or absence of pollen of a pear tree comprising a reagent for performing an amplification reaction.

In the kit of the present invention, the primer set is the same as described above, and the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, a buffer, and the like. In addition, the kit of the present invention may further include a user's guide describing optimal conditions for performing the reaction. A handbook is a printout explaining how to use the kit, eg, how to prepare a PCR buffer, and suggested reaction conditions. Instructions include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information published or provided through electronic media such as the Internet.

The present invention also

isolating genomic DNA from a pear tree sample;

amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer sets of SEQ ID NOs: 1 and 2 and the primer sets of SEQ ID NOs: 3 and 4; and

It provides a method for predicting the presence or absence of pollen of a pear tree, including; analyzing the genotype through the product of the amplification step.

The method of the present invention comprises isolating genomic DNA from a sample of a pear plant. The method for isolating the genomic DNA may use a method known in the art, for example, the CTAB method may be used, or a Wizard prep kit (Promega) may be used. The target sequence may be amplified by performing an amplification reaction using the isolated genomic DNA as a template and using the oligonucleotide primer set according to an embodiment of the present invention as a primer. Methods for amplifying a target nucleic acid include a polymerase chain reaction (PCR), a ligase chain reaction, a nucleic acid sequence-based amplification, and a transcription-based amplification system. amplification system), strand displacement amplification or amplification via Qβ replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling material may be a material emitting fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer during amplification of the target sequence, the target sequence may be labeled with a detectable fluorescent labeling material. ^{In addition, when a radioactive isotope such as 32} P or ³⁵ S is added to a PCR reaction solution for labeling using a radioactive material, the amplification product is synthesized and radioactivity is incorporated into the amplification product, so that the amplification product can be radioactively labeled. The oligonucleotide primer sets used to amplify the target sequence are as described above.

In one embodiment of the present invention, the primer set of the present invention can be used for predicting the presence or absence of pollen in a pear tree, and by analyzing the genotype of the product of the amplification step, it is possible to predict pear varieties with and without pollen. .

In the method according to an embodiment of the present invention, the pear tree sample may be an interspecies F ₁ group of golden pears and mini pears, but is not limited thereto.

Specifically, when PCR is performed using the primer set (CPp04id01) of SEQ ID NOs: 1 and 2 of the present invention, golden pear has a homozygotic genotype with the reference genome, thereby 157/157 bp (genotype rf1 / rf1). ; hereinafter referred to as aa) size of the amplification product, and the minibage has a reference genome and a heterozygotic genotype, so the same nucleotide sequence as the reference genome and 157/133 bp (genotype rf1) are deleted. /Rf1 ; hereinafter referred to as Aa) represents an amplification product of the size, so depending on the size of the amplification product, the fertility recovery allele Rf1 and / or the non-fertility recovery allele rf1 in _{the F 1 population of golden pears and mini pears.} By specifically discriminating F ₁ individuals, it is possible to accurately predict pear varieties with and without pollen (see Table 5).

Further, when performing the PCR using a primer set (CPp05id01) of SEQ ID NO: 3 and 4 of the present invention, gold boat and ship mini reference by having a dielectric with a heterozygous genotype (genotype heterozygotic) 126/140 bp (genotype Rf2 /rf2 ; Hereinafter, it represents an amplification product of the size (hereinafter referred to as hk), depending on the size of the amplification product, with the fertility recovery allele Rf2 and / or the non-fertility recovery allele rf2 in _{the F 1 population of golden pear and mini pear} By specifically discriminating F ₁ individuals, it is possible to accurately predict pear varieties with and without pollen (see Table 5).

Accordingly, in the present invention, the primer sets of SEQ ID NOs: 1 and 2; And when PCR is performed using the primer sets of SEQ ID NOs: 3 and 4 at the same time, if the size of the product amplified by the primer sets of SEQ ID NOs: 1 and 2 is 157/157 bp, aa ( rf1 ·rf1 ), 157/ If it is 133 bp, it can be determined as the genotype of Aa ( Rf1 · rf1 ); If the size of the product amplified by the primer sets of SEQ ID NOs: 3 and 4 is 126/126 bp, hh ( Rf2· Rf2 ), 126/140 bp, hk ( Rf2 ·rf2 ), and 140/140 bp, kk ( rf2·rf2 ) ), when combining the Rf1 and Rf2 genotypes according to the size of the amplification product, Aa/hh ( Rf1 · rf1 / Rf2 · Rf2 ), Aa/hk ( Rf1 · rf1 / Rf2 · rf2 ), Aa/ of kk( Rf1 rf1 / rf2 rf2 ), aa/hh ( rf1 rf1 / Rf2 Rf2 ), aa/hk ( rf1 rf1 / Rf2 rf2 ) and aa/kk( rf1 rf1 / rf2 rf2 ) The genotype can be confirmed, and the genotypes of Aa/hh and Aa/hk, which contain both fertility recovery genes (dominant) Rf1 and Rf2 , can be predicted from a pollen pear tree, and Aa/kk with one Rf1 or one Rf2 gene. And the genotypes of aa/hh and aa/kk, which contain both the aa/hk genotype and the nonfertility recovery genes (recessive) rf1 and rf2, can be predicted from pollen-free pear trees.

Oligonucleotide primer sets of SEQ ID NOs: 1 and 2 according to an embodiment of the present invention; And by using all of the oligonucleotide primer sets of SEQ ID NOs: 3 and 4, it is possible to predict the presence or absence of pollen in _{the interspecies F 1 population of golden pear and mini pear varieties with higher probability (Table 7).}

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

Example 1. Crossbreeding F of Golden Pear and Mini Pear _One Extraction of genomic DNA from individuals

_{The leaves were collected from F 1} crossbreeding of golden pears and mini pears (Naju Pear Research Institute, National Institute of Horticultural and Herbal Science), washed with distilled water, packaged individually and stored at -80°C, followed by CTAB (cetyl trimethyl ammonium bromide) method. was used to isolate genomic DNA. The isolated genomic DNA was quantified at 24 ng/μl.

Example 2. Single nucleotide polymorphism (SNP) analysis using GBS analysis

For nucleotide sequence analysis and genotyping, a library was prepared for performing GBS (Genotyping by sequencing) on the DNA _{of F 1} 177 individuals of golden pears, mini pears with pollen, and golden pears and mini pears without pollen, and Illumina The nucleotide sequence of the library was deciphered according to the standard protocol of the Hiseq2000 sequencer. The generated fragment sequences (reads) were then used for bioinformatic analysis, and for bioinformation analysis, Chinese pear 'Dangshansuli'(http://peargenome.njau.edu.cn/default.asp?d=4&m=3) was The whole genome sequence was used as a reference genome. For the development of SNPs for gene mapping, fragment sequences of each golden pear and mini pear were mapped to the genomic sequence of a reference genome, and the genomic sequences of golden pear and mini pear genomes were compared to select SNPs based on the following criteria. : (1) Biallelic SNP, (2) missing values for full-sib family by SNP (rate in which SNP genotype was not confirmed in nucleotide sequencing using GBS technology among parents and children) within 10%.

Example 3. Analysis of the presence or absence of pollen of pear trees

All plant materials used for the analysis of the presence or absence of pollen on pear trees were seedlings of _{golden pears and mini pears F 1 planted at the Naju Pear Research Institute of the National Institute of Horticultural and Herbal Science.} This study was conducted by referring to the Manual of Genetic Resource Characterization of the National Institute of Horticultural and Herbal Science, Rural Development Administration. Specifically, for golden pears, mini pears, and F ₁ 177 individuals, collect 5 to 10 flowers just before flowering, remove all petals, dry them in a Petri dish at 25° C. for 24 hours, and collect pollen-covered individuals. As 1, an individual whose pollen did not come out was recorded as 0 (FIG. 1).

In addition, the number of genes involved in the presence or absence of pollen was estimated through the phenotypic separation ratio of the full-sib family for golden pear and mini pear F _{1 177 individuals.} The presence/absence of pollen in the golden pear and mini-pear F ₁ ^{177 observed from 2016 to 2018 is 70:107, and the probability range that the test statistic χ 2} = 0.57 belongs to the expected separation ratio of 3:5 is p>0.05. The separation ratio of golden pears and mini pears was determined to be 3:5.

As a result of estimating the genotypes of the golden embryo and the mini-cultivation parent to explain the separation ratio, it was predicted that two fertility recovery-related genes ( Rf1 , Rf2 ) would be involved (Table 1). F ₁ The genotype of the parents (golden pear, mini pear) that can explain the presence of pollen: 70: 107 (≒ 3:5) in the typical hawk line of 177 individuals is golden pear ( rf1 · rf1 / Rf2 · rf2 ), It was determined as a mini-bae ( Rf1 ·rf1 / Rf2 ·rf2 ) (Table 2).

Example 4. Golden Pear and Mini Pear F _One Genetic map creation of collective hawk families

_{Genetic mapping of F 1} 177 individuals of golden pears and mini pears was performed using the JoinMap 5 program (when association group was established, LOD=15.0), and the genetic map distance was calculated in cM (Kosambi centiMorgans). And, based on the created genetic map, analysis of the association between phenotype and genotype was performed using the MapQTL 6.0 program. As a result, 29 SNPs showing a close correlation to the presence or absence of pollen were found in association groups 4 (16) and 5 (13). dog) was searched ( FIG. 2 ), and information on 29 SNPs is shown in Table 3 below.

Example 5. Development of InDel marker for pollen presence/absence selection based on NGS resequencing data

A library for performing NGS was prepared for genomic DNA of golden pears and mini pears, and the nucleotide sequence of the library was deciphered according to the standard protocol of the Illumina Hiseq2000 sequencer. The generated fragment sequences (reads) were then used for bioinformatics analysis, and for bioinformation analysis, Chinese pear 'Dangshansuli' (http://peargenome.njau.edu.cn/default.asp?d=4&m=3) was The whole genome sequence was used as a reference genome.

Based on the SNP position (Table 3) that is closely related to the presence or absence of pollen, the 11,292,864~11,292,987 bp (157 bp) region of the fertility recovery gene Rf1 gene sequence present on chromosome 4 of the reference genome, and the Rf1 of the reference genome By comparing the nucleotide sequences of the golden pear and mini embryo genomes corresponding to the same position as the gene region, it was found that the golden pear has a homozygotic genotype having the same nucleotide sequence as the reference genome, and the mini embryo has the same nucleotide sequence as the reference genome. After confirming that it has a heterozygotic genotype having the same nucleotide sequence as the genome and a nucleotide sequence with a deletion of 24 bp nucleotides, the InDel marker 'CBp04id01' based on the region in which some nucleotides are deleted from the genome sequence of the mini embryo produced. _{Therefore, when PCR is performed using the CBp04id01 on F 1} individuals of golden pear and mini pear, an amplification product having a size of 157/157 bp or 133/157 bp may be generated.

In addition, a reference present in the genome chromosome 5 of the fertility restoration gene Rf2 27,068,476 ~ 27,068,617 bp (142 bp ) region of the gene sequence and the golden times for the same position and Rf2 gene region of the reference genome and the mini-fold dielectric By comparing the nucleotide sequences, it was confirmed that the golden pear and mini embryo have a heterozygous genotype having the same nucleotide sequence as the reference genome and a nucleotide sequence inserted with a 14 bp base, and then some bases in the genomic sequence of the golden pear and mini embryo An InDel marker 'CBp05id01' was prepared based on the region where was inserted. _{Therefore, when PCR is performed using the CBp05id01 to target F 1} individuals of golden pear and mini pear, an amplification product having a size of 126/126 bp, 140/140 bp, or 126/140 bp may be generated.

Primer set information of the present invention Marker name Primer sequence (5'→3') (SEQ ID NO:) Tm
(℃) Amplicon
size(bp) Forward Reverse CBp04id01 AAGCCCCCTATAACACAGGA (1) AATGGCATGCTCTTTGGGTG (2) 60 133/157 CBp05id01 GGAGCCGATTGATTTTCCTC (3) CAATCCTCTCATCCCGCTAA (4) 60 126/140

Example 6. Prediction of pollen presence through electrophoretic polymorphic patterns of InDel markers

Using the InDel marker of the present invention, PCR is performed on 93 of golden pear, mini pear, and golden pear and mini-pear F ₁ 177 individuals according to the size of the amplified cytoplasmic gene Genes involved in male sterility recovery By determining the genotype, the presence or absence of pollen in _{the F 1 group of golden pears and mini pears was predicted.} Genotypes that gold boat described above in Example 3 is rf1 · rf1 / Rf2 · rf2 and the genotype of the mini ship Rf1 · rf1 / Rf2 · Because rf2, gold times and genotype of the F ₁ population by interspecific crosses the mini-fold (1) Rf1 rf1 / Rf2 Rf2 , (2) Rf1 rf1 / Rf2 rf2 , (3) Rf1 rf1 / rf2 rf2 , (4) rf1 rf1 / Rf2 Rf2 , (5) rf1 . rf1 / Rf2·rf2 and (6) rf1·rf1 / rf2·rf2 .

Intended for gold times CBp04id01 (Rf1 or rf1 genotypes determined) and CBp05id01 (Rf2 or rf2 genotypes determined), the PCR and capillary electrophoresis is a result CBp04id01 157/157 bp, it performed using CBp05id01 is amplification of 126/140 bp size In the case of mini-bay, CBp04id01 was 133/157 bp and CBp05id01 was 126/140 bp in size. Through these results, 157/157 bp in the size of the product amplified by the CBp04id01 marker can be represented as a homozygous genotype (named aa) and 133/157 bp as a heterozygous genotype (named Aa); In the size of the product amplified by the CBp05id01 marker, 126/140 bp can be represented as a heterozygous genotype (named hk), and 126/126 bp and 140/140 bp can be represented as a homozygous genotype (named hh and kk, respectively). was found (Table 5).

In addition, _{as a result of PCR and capillary electrophoresis using CBp04id01 and CBp05id01 on F 1} 14-059 individuals, CBp04id01 was 157/157 bp (aa), and CBp05id01 was 126/140 bp (hk) in size. It was predicted that no pollen was generated and the actual phenotype was the same, and in _{the case of F 1} 14-061 individuals, CBp04id01 was 133/157 bp (Aa) and CBp05id01 was 126/140 bp (hk) in size. By confirming that it was generated and predicted to have pollen, and the actual phenotype was also the same, it was found that the presence of pollen can be predicted only when both Rf1 (A) and Rf2 (h) genes are present.

As shown in Table 7, the dominant gene related to fertility recovery produces products of 133 bp and 126 bp in that _{other F 1} individuals must have both the Rf1 (A) genotype and the Rf2 (h) genotype to be predicted as a pollen pear tree. genes ( Rf1 and Rf2 , respectively). Therefore, the genotypes of Aa/hh and Aa/hk, which contain both the fertility recovery genes (dominant) Rf1 and Rf2 , are pollen pear trees, and are not identical to the Aa/kk and aa/hk genotypes, which contain one Rf1 or one Rf2 gene. The genotypes of aa/hh and aa/kk, which contain both fertility recovery genes (recessive) rf1 and rf2 , can be predicted from pollen-free pear trees (Table 6).

As a result of comparing the predicted phenotype of the presence of pollen confirmed through CBp04id01 and CBp05id01 with the actual phenotype of the remaining F _{1 individuals in this way, 75 of the total F 1} 93 individuals except for one whose genotype was not confirmed were obtained. It was confirmed that the predicted phenotype and the actual phenotype were consistent with each other, and it was found that the accuracy of determining the presence or absence of pollen of the primer set of the present invention was about 81.5% (Table 7).

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> InDel molecular marker for discriminating genotype of restorer-of-fertility genes involved in cytoplasmic male sterility of pear and uses thereof <130> PN20060 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 aagcccccta taacacagga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 aatggcatgc tctttgggtg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ggagccgatt gattttcctc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 caatcctctc atcccgctaa 20

Claims (5)

oligonucleotide primer sets of SEQ ID NOs: 1 and 2; and oligonucleotide primer sets of SEQ ID NOs: 3 and 4; a primer set composition for predicting the presence or absence of pollen in the _{F 1 interspecies crossbreeding of golden pear varieties and mini pear varieties.} The primer set composition of claim 1; And a kit for predicting the presence or absence of pollen in _{the interspecies F 1} population of golden pear varieties and mini pear varieties, including reagents for performing an amplification reaction. The kit according to claim 2, wherein the reagents for performing the amplification reaction include DNA polymerase, dNTPs and a buffer. Isolating genomic DNA from _{the interspecies F 1} population sample of golden pear varieties and mini pear varieties;
amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set composition of claim 1; and
Analyzing the genotype through the product of the amplification step; method for predicting the presence or absence of pollen in _{the interspecies F 1 population of golden pear varieties and mini pear varieties.} delete

Images