KR102255066B1 - Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising 3’-methoxyflavone as Active Ingredient - Google Patents

Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising 3’-methoxyflavone as Active Ingredient Download PDF

Info

Publication number
KR102255066B1
KR102255066B1 KR1020200019414A KR20200019414A KR102255066B1 KR 102255066 B1 KR102255066 B1 KR 102255066B1 KR 1020200019414 A KR1020200019414 A KR 1020200019414A KR 20200019414 A KR20200019414 A KR 20200019414A KR 102255066 B1 KR102255066 B1 KR 102255066B1
Authority
KR
South Korea
Prior art keywords
disease
stem cells
astrocytes
composition
methoxyflavone
Prior art date
Application number
KR1020200019414A
Other languages
Korean (ko)
Inventor
김현정
이지우
Original Assignee
중앙대학교 산학협력단
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 중앙대학교 산학협력단, 서울대학교산학협력단 filed Critical 중앙대학교 산학협력단
Priority to KR1020200019414A priority Critical patent/KR102255066B1/en
Application granted granted Critical
Publication of KR102255066B1 publication Critical patent/KR102255066B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0622—Glial cells, e.g. astrocytes, oligodendrocytes; Schwann cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M21/00—Bioreactors or fermenters specially adapted for specific uses
    • C12M21/08—Bioreactors or fermenters specially adapted for specific uses for producing artificial tissue or for ex-vivo cultivation of tissue
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/03—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from non-embryonic pluripotent stem cells

Abstract

The present invention relates to a composition for inducing differentiation of stem cells into astrocytes containing 3'-methoxyflavone as an active ingredient. When the composition of the present invention is used, it is possible to induce differentiation into the astrocytes without using a conventional stem cell differentiation promoter, and moreover, it is expected that the differentiated astrocytes can be used to effectively treat neurodegenerative diseases.

Description

3’-메톡시플라본을 유효성분으로 포함하는 줄기세포의 성상세포로의 분화 유도용 조성물{Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising 3’-methoxyflavone as Active Ingredient}Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising 3'-methoxyflavone as Active Ingredient}

본 발명은 3’-메톡시플라본을 유효성분으로 포함하는 줄기세포의 성상세포로의 분화 유도용 조성물 등에 관한 것이다.The present invention relates to a composition for inducing differentiation of stem cells into astrocytes comprising 3'-methoxyflavone as an active ingredient.

신경퇴행성 질환(Neurodegenerative disorders)이란 나이가 들어감에 따라 발생하는 퇴행성 질환 중에서 뇌(brain) 또는 척수(Spinal cord)에서 발생하는 질환을 말하며, 현재까지 알려지지 않은 원인 또는 유전적 결함이나 환경적 요인에 의해 뇌와 척수의 특정 뇌세포군의 점진적 구조의 손실 및 기능의 손실에 의해 나타나는 질환을 말한다. 퇴행성 신경계 질환으로 인해 야기된 신경세포 사멸 또는 손상은 뇌신경계의 정보전달에 가장 중요한 뇌신경세포와 뇌신경세포 사이의 정보를 전달하는 시냅스의 형성이나 기능상의 문제, 뇌신경의 전기적 활동성의 이상적 증가나 감소를 야기하는 것으로 알려져 있다. 뇌와 척수의 신경세포들은 위치에 따라 매우 다양한 기능을 하고 있어 특정 부위의 신경세포 손상에 의해 특징적인 기능장애를 유발하며, 또 이러한 기능장애가 어떤 형태로 진행되는가에 따라 매우 다양한 임상 양상을 보인다. 이러한 퇴행성 신경계 질환에는 루게릭병으로 알려진 근 위축성 측삭 경화증(Amyotrophic lateral sclerosis: ALS), 파킨슨씨병(Parkinson’s disease: PD), 알츠하이머병(Alzheimer’s disease: AD) 및 헌팅턴병(Huntington’s disease: HD), 다발성 경화증(Multiple sclerosis: MS) 등이 있다.Neurodegenerative disorders refer to diseases that occur in the brain or spinal cord among degenerative diseases that occur with age, and are due to unknown causes or genetic defects or environmental factors. It refers to a disease caused by the gradual loss of structure and function of specific brain cell groups in the brain and spinal cord. Neuronal cell death or damage caused by degenerative neurological disorders can lead to the formation of synapses, functional problems, and ideal increase or decrease in the electrical activity of the cranial nerves, which transfer information between the cranial nerve cells and the cranial nerve cells, which are most important for the transmission of information in the cranial nervous system. It is known to cause. Neurons of the brain and spinal cord perform a wide variety of functions depending on their location, causing a characteristic dysfunction by damage to the nerve cells in a specific area, and also shows a wide variety of clinical manifestations depending on how such a dysfunction progresses. These neurodegenerative diseases include amyotrophic lateral sclerosis (ALS), Parkinson's disease (PD), Alzheimer's disease (AD) and Huntington's disease (HD), also known as Lou Gehrig's disease, and multiple sclerosis. Multiple sclerosis: MS).

한편, 현재까지 알츠하이머병에 관한 연구를 위해 주로 전뇌에 많이 존재하는 신경세포로 분화시킨 후, 병인에 관한 연구를 진행하고 있다. 전뇌 신경세포로의 분화는 특별한 외부 물질의 첨가 없이 진행되는 신경세포 분화 방법에 의해 이루어지며, 최근에 ‘dual-SMAD inhibition’을 통한 monolayer culture 방법, embryoid body 형성을 통한 방법, cerebral organoid 형성을 통한 방법 등이 개발되고 있으며, ‘glutamatergic neuron’ 과 ‘GABAergic neuron’ 모두 알츠하이머 병인 발굴에 관한 연구에 많이 이용되고 있다. 최근에 발표된 논문에 따르면, 환자유래 유도만능줄기세포를 ‘GABAergic neuron’으로 분화시킨 경우 아밀로이드베타에 의한 세포사멸에 좀 더 저항성이 있는 것으로 확인되었다. 즉, 특정 신경세포로의 분화에 따라 다양한 표현형이 나타날 수 있다는 것을 보여준 경우이다. On the other hand, to date, for research on Alzheimer's disease, after differentiating into neurons mainly present in the forebrain, studies on the etiology are being conducted. Differentiation into forebrain neurons is achieved by a neuronal differentiation method that proceeds without the addition of special foreign substances, and recently, a monolayer culture method through'dual-SMAD inhibition', a method through embryoid body formation, and a cerebral organoid formation. Methods and the like are being developed, and both'glutamatergic neuron' and'GABAergic neuron' are widely used in research on the discovery of the pathogenesis of Alzheimer's. According to a recently published paper, it was confirmed that when the patient-derived induced pluripotent stem cells were differentiated into “GABAergic neurons”, they were more resistant to apoptosis by amyloid beta. In other words, it was shown that various phenotypes can appear according to differentiation into specific neurons.

신경세포와 더불어 성상세포 또한 알츠하이머 병인에 매우 중요한 역할을 하는 것으로 보고되고 있다. 성상세포는 시냅스 형성 및 성숙에서 결정적인 역할을 함으로써 신경 퇴행성 질환을 치료할 수 있다고 보고되어 왔다. 일반적으로, 성상세포는 신경세포와 동일한 전구세포로부터 분화가 진행되며, 두 가지 세포가 혼합되어있는 세포군에서 성상세포 특이 발현 인자를 이용한 세포 분획 및 정제가 가능하다. In addition to nerve cells, astrocytes are also reported to play a very important role in the pathogenesis of Alzheimer's. It has been reported that astrocytes can treat neurodegenerative diseases by playing a critical role in synapse formation and maturation. In general, astrocytes undergo differentiation from the same progenitor cells as neurons, and cell fractionation and purification using astrocyte-specific expression factors are possible in a cell group in which two cells are mixed.

한편, 3’-메톡시플라본(3’-methoxyflavone, PubChem CID: 619834)이 신경 줄기세포를 성상세포로 유도하는데 효과적인지는 알려진 바 없다.Meanwhile, it is not known whether 3'-methoxyflavone (PubChem CID: 619834) is effective in inducing neural stem cells into astrocytes.

Yin L, Hu Q (2014). "CYP17 inhibitors-abiraterone, C17,20-lyase inhibitors and multi-targeting agents". Nat Rev Urol. 11 (1): 32-42.Yin L, Hu Q (2014). "CYP17 inhibitors-abiraterone, C17,20-lyase inhibitors and multi-targeting agents". Nat Rev Urol. 11 (1): 32-42.

본 발명자들은 줄기세포를 성상세포로 유도하는 방법을 찾고자 예의 노력한 결과, 본 발명의 3’-메톡시플라본이 신경줄기세포를 성상세포로 유도하기 위해 처리될 수 있음을 확인함으로써, 본 발명을 완성하였다.The present inventors have made great efforts to find a method for inducing stem cells into astrocytes, and as a result of confirming that the 3'-methoxyflavone of the present invention can be processed to induce neural stem cells into astrocytes, the present invention has been completed. .

이에, 본 발명의 목적은 3’-메톡시플라본(3’-methoxyflavone)을 유효성분으로 포함하는 줄기세포의 성상세포로의 분화 유도용 조성물을 제공하는 것이다.Accordingly, an object of the present invention is to provide a composition for inducing differentiation of stem cells into astrocytes comprising 3'-methoxyflavone as an active ingredient.

본 발명의 다른 목적은 3’-메톡시플라본을 유효성분으로 포함하는, 신경퇴행성 질환 예방 또는 치료용 약학적 조성물 등을 제공하는 것이다.Another object of the present invention is to provide a pharmaceutical composition for preventing or treating neurodegenerative diseases, including 3'-methoxyflavone as an active ingredient.

그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems that are not mentioned will be clearly understood by those skilled in the art from the following description.

상기 목적을 달성하기 위하여, 본 발명은 3’-메톡시플라본(3’-methoxyflavone)을 유효성분으로 포함하는 줄기세포의 성상세포로의 분화 유도용 조성물을 제공한다.In order to achieve the above object, the present invention provides a composition for inducing differentiation of stem cells into astrocytes comprising 3'-methoxyflavone as an active ingredient.

또한, 본 발명은 상기 조성물을 줄기세포와 함께 배양하는 단계를 포함하는, 줄기세포를 성상세포로 분화시키는 방법을 제공한다.In addition, the present invention provides a method for differentiating stem cells into astrocytes, comprising the step of culturing the composition with stem cells.

또한, 본 발명은 3’-메톡시플라본을 유효성분으로 포함하는, 줄기세포의 성상세포로의 분화 유도용 키트를 제공한다.In addition, the present invention provides a kit for inducing differentiation of stem cells into astrocytes, comprising 3'-methoxyflavone as an active ingredient.

또한, 본 발명은 3’-메톡시플라본을 유효성분으로 포함하는, 신경퇴행성 질환 예방 또는 치료용 약학적 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for preventing or treating neurodegenerative diseases, comprising 3'-methoxyflavone as an active ingredient.

또한, 본 발명은 상기 방법에 의해 제조된 성상세포를 포함하는 신경퇴행성 질환 치료용 세포치료제를 제공한다.In addition, the present invention provides a cell therapy for the treatment of neurodegenerative diseases comprising astrocytes prepared by the above method.

본 발명의 일 구현예로, 상기 줄기세포는 배아 줄기세포, 성체 줄기세포, 배아생식 줄기세포 및 배아종양 줄기세포로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.In one embodiment of the present invention, the stem cells may be at least one selected from the group consisting of embryonic stem cells, adult stem cells, embryonic stem cells, and embryonic tumor stem cells, but is not limited thereto.

본 발명의 다른 구현예로, 상기 조성물은 시약 조성물일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the composition may be a reagent composition, but is not limited thereto.

본 발명의 또 다른 구현예로, 상기 3’-메톡시플라본은 0.1 내지 100 μM의 농도로 포함되는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the 3'-methoxyflavone may be included in a concentration of 0.1 to 100 μM, but is not limited thereto.

본 발명의 또 다른 구현예로, 상기 성상세포는 GFAP(Glial fibrillary acidic protein)를 발현하는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the astrocytes may express GFAP (Glial fibrillary acidic protein), but are not limited thereto.

본 발명의 또 다른 구현예로, 상기 신경퇴행성 질환은 알츠하이머병, 근육위축 측삭 경화증, 부신백질형성 장애증, 알렉산더병, 알퍼병, 혈관확장성 운동실조증, 배튼병, 소해면양 뇌증 (BSE), 카나반병, 피질기저 퇴화, 크로이츠펠트-야콥병, 루이체들을 가진 치매, 치명적 가족성 불면증, 전두 측두엽 퇴화, 헌팅턴병, 케네디병, 크랩병, 라임병, 마카도-요세프병, 다발성 경화증, 다발성 전신 위축증, 신경 유극적혈구증, 니만-피크병, 파킨슨병, 피크병, 일차 측삭 경화증, 진행성 핵상 마비, 레프섬병, 샌드호프병, 확산성 미엘린분해 경화증, 척수소뇌성 실조증, 척수의 아급성 조합된 퇴화, 척수 매독, 테이-삭스병, 독성 뇌증, 전파가능한 해면양 뇌증, 및 불안정 헤지호그 증후군으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the neurodegenerative disease is Alzheimer's disease, muscular atrophy lateral sclerosis, adrenal leukoplastic disorder, Alexander's disease, Alper's disease, vasodilatory ataxia, Baton's disease, bovine spongiform encephalopathy (BSE), Canaban disease, cortical degeneration, Creutzfeldt-Jakob disease, dementia with Lewy bodies, fatal familial insomnia, frontal temporal lobe degeneration, Huntington's disease, Kennedy's disease, Crab's disease, Lyme disease, Macado-Josef disease, multiple sclerosis, multiple systemic atrophy , Neurotrophic erythropoiesis, Niemann-Peak disease, Parkinson's disease, Peak's disease, primary lateral sclerosis, progressive nuclear paralysis, Levsum disease, Sandhof's disease, diffuse myelinlytic sclerosis, spinal cerebellar ataxia, subacute combined degeneration of the spinal cord , Spinal syphilis, Tay-Sachs disease, toxic encephalopathy, transmissible spongiform encephalopathy, and unstable Hedgehog syndrome, but may be one or more selected from the group consisting of, but is not limited thereto.

또한, 본 발명은 3’-메톡시플라본을 유효성분으로 포함하는 조성물을 개체에 투여하는 단계를 포함하는 신경퇴행성 질환의 치료 방법을 제공한다.In addition, the present invention provides a method for treating neurodegenerative diseases comprising administering to an individual a composition containing 3'-methoxyflavone as an active ingredient.

또한, 본 발명은 3’-메톡시플라본을 유효성분으로 포함하는 조성물의 신경퇴행성 질환 치료 용도를 제공한다.In addition, the present invention provides a use of a composition comprising 3'-methoxyflavone as an active ingredient for the treatment of neurodegenerative diseases.

또한, 본 발명은 3’-메톡시플라본의 신경퇴행성 질환에 이용되는 약제를 생산하기 위한 용도를 제공한다.In addition, the present invention provides a use of 3'-methoxyflavone for producing a medicament used in neurodegenerative diseases.

또한, 본 발명은 상기 세포치료제를 개체에 투여하는 단계를 포함하는 신경퇴행성 질환의 치료 방법을 제공한다.In addition, the present invention provides a method of treating a neurodegenerative disease comprising administering the cell therapy agent to an individual.

또한, 본 발명은 상기 세포치료제의 신경퇴행성 질환 치료 용도를 제공한다.In addition, the present invention provides the use of the cell therapy agent to treat neurodegenerative diseases.

본 발명자들은 3’-메톡시플라본을 이용하여 줄기세포를 성상세포로 유도하는 기법을 보여줌으로써, 기존의 줄기세포 분화 촉진제를 사용하지 않고 성상세포로 분화를 유도할 수 있을 뿐만 아니라, 분화된 성상세포를 이용하여 신경퇴행성 질환을 효과적으로 치료할 수 있을 것으로 기대된다.The present inventors show a technique for inducing stem cells into astrocytes using 3'-methoxyflavone, so that it is possible to induce differentiation into astrocytes without using an existing stem cell differentiation promoter, as well as differentiated astrocytes. It is expected that cells can be used to effectively treat neurodegenerative diseases.

도 1은 플라본, 화합물 1 (2'- 아미노플라본), 및 화합물 2 (3'- 메톡시플라본)의 화학 구조식을 각각 나타낸 것이다.
도 2는 신경줄기세포를 EGF 및 FGF2 없이 4일 동안 0.1 % DMSO, 또는 20 μM 플라본, 화합물 1 (2'- 아미노플라본), 또는 화합물 2 (3'- 메톡시플라본)로 처리 한 후, TuJ1 (녹색) 또는 항-GFAP (적색)로 면역염색한 결과를 나타낸 것이다. 핵은 DAPI (청색)로 염색되었다. 스케일 바 = 50 μm.
도 3은 플라본, 화합물 1 (2'- 아미노플라본), 또는 화합물 2 (3'- 메톡시플라본)을 처리한 경우, 총 DAPI-양성 세포 중 TuJ1-양성 세포 및 GFAP-양성 세포의 비율을 평균 ± SEM (n = 6)으로 정량화한 결과를 나타낸 것이다.
도 4는 플라본, 화합물 1 (2'- 아미노플라본), 또는 화합물 2 (3'- 메톡시플라본) 각각을 처리하고 3일 후, 세포로부터 총 RNA를 정량적 RT-PCR을 이용하여 상대적인 βIII 튜불린 및 GFAP 존재비를 측정한 결과를 나타낸 것이다. 값은 평균 ± SEM (n = 3)으로 표시하였다. * P <0.05, ** P <0.01 (Student’s t-test).
도 5는 4일(좌측 도면) 또는 1 시간(우측 도면) 동안 플라본, 화합물 1 (2'- 아미노플라본), 또는 화합물 2 (3'- 메톡시플라본) 각각을 포함하는 배지에서 배양된 신경줄기세포로부터 수득한 세포 용해물에 대하여 웨스턴 블롯 분석을 수행한 결과를 나타낸 것이다.1 shows the chemical structural formulas of flavone, compound 1 (2'-aminoflavone), and compound 2 (3'-methoxyflavone), respectively.
FIG. 2 shows neural stem cells treated with 0.1% DMSO, or 20 μM flavone, compound 1 (2'-aminoflavone), or compound 2 (3'-methoxyflavone) for 4 days without EGF and FGF2, and then TuJ1 ( It shows the result of immunostaining with green) or anti-GFAP (red). Nuclei were stained with DAPI (blue). Scale bar = 50 μm.
3 is an average of the proportion of TuJ1-positive cells and GFAP-positive cells among total DAPI-positive cells when flavone, compound 1 (2′-aminoflavone), or compound 2 (3′-methoxyflavone) was treated. It shows the result of quantification by ± SEM (n = 6).
Figure 4 is a flavone, compound 1 (2'- aminoflavone), or compound 2 (3'- methoxyflavone) 3 days after treatment, respectively, total RNA from cells using quantitative RT-PCR relative βIII tubulin And it shows the result of measuring the abundance of GFAP. Values are expressed as mean±SEM (n=3). * P <0.05, ** P <0.01 (Student's t-test).
5 is a neural stem cell cultured in a medium containing each of flavone, compound 1 (2'- aminoflavone), or compound 2 (3'- methoxyflavone) for 4 days (left view) or 1 hour (right view). It shows the results of performing Western blot analysis on the cell lysate obtained from.

본원 명세서에서 사용되는 용어, 기술 등은 특별한 한정이 없는 한, 본 발명이 속하는 기술 분야에서 일반적으로 사용되는 의미로 사용된다. 또한, 본 명세서에 언급된 문헌들은 모두 본 발명을 설명하기 위한 문헌으로 본 명세서에 포함된다.The terms, technology, and the like used in the present specification are used with meanings generally used in the technical field to which the present invention belongs unless there is a specific limitation. In addition, all of the documents mentioned in the present specification are included in the present specification as documents for explaining the present invention.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명에서, “3’-메톡시플라본”은 2-(3-메톡시페닐)크로-4-몬)(2-(3-methoxyphenyl)chromen-4-one)으로도 명명되며, 하기 화학식 1로 표시될 수 있으나, 이에 제한되는 것은 아니다.In the present invention, "3'-methoxyflavone" is also named as 2-(3-methoxyphenyl)chromen-4-one) (2-(3-methoxyphenyl)chromen-4-one), the following formula 1 May be expressed as, but is not limited thereto.

[화학식 1][Formula 1]

Figure 112020016894060-pat00001
Figure 112020016894060-pat00001

이때, 상기 3’-메톡시플라본은 본 발명의 조성물에 0.1 내지 100 uM, 1 내지 90 uM, 1 내지 80 uM, 1 내지 70 uM, 1 내지 60 uM, 1 내지 55 uM, 1 내지 50 uM, 1 내지 45 uM, 1 내지 40 uM, 1 내지 35 uM, 1 내지 30 uM, 1 내지 25 uM, 3 내지 25 uM, 4 내지 23 uM, 5 내지 20 uM, 5 내지 25 uM, 10 내지 25 uM, 10 내지 30 uM, 10 내지 40 uM, 10 내지 50 uM, 10 내지 60 uM, 15 내지 50 uM, 15 내지 40 uM, 15 내지 30 uM, 또는 15 내지 25 uM의 농도로 포함될 수 있으나, 이에 제한되는 것은 아니다.At this time, the 3'-methoxyflavone is 0.1 to 100 uM, 1 to 90 uM, 1 to 80 uM, 1 to 70 uM, 1 to 60 uM, 1 to 55 uM, 1 to 50 uM, in the composition of the present invention, 1 to 45 uM, 1 to 40 uM, 1 to 35 uM, 1 to 30 uM, 1 to 25 uM, 3 to 25 uM, 4 to 23 uM, 5 to 20 uM, 5 to 25 uM, 10 to 25 uM, 10 to 30 uM, 10 to 40 uM, 10 to 50 uM, 10 to 60 uM, 15 to 50 uM, 15 to 40 uM, 15 to 30 uM, or 15 to 25 uM, but limited thereto It is not.

본 발명에서, “줄기세포”란 미분화 상태이면서, 무한정 증식 및 성상세포로의 분화기능을 갖는 세포라면 특별히 제한되지는 않는다. 구체적으로 줄기세포로는 배아줄기세포, 성체 줄기세포, 배아생식 줄기세포, 배아종양 줄기세포 등을 들 수 있으나, 이에 한정되지는 않는다.In the present invention, the term "stem cell" is not particularly limited as long as it is a cell that is in an undifferentiated state and has a function of indefinitely proliferating and differentiating into astrocytes. Specifically, the stem cells include, but are not limited to, embryonic stem cells, adult stem cells, embryonic stem cells, and embryonic tumor stem cells.

본 발명에서, 상기 줄기세포는 신경 줄기세포일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the stem cells may be neural stem cells, but are not limited thereto.

본 발명에서, “성상세포”란 신경세포 마커인 βⅢ-tubulin 발현 수준은 감소하고, GFAP 발현 수준은 증가하는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the expression level of βIII-tubulin, which is a neuronal cell marker, may be decreased and the GFAP expression level may be increased, but is not limited thereto.

또한, 본 발명은 상기 조성물을 줄기세포와 함께 배양하는 단계를 포함하는, 줄기세포를 성상세포로 분화시키는 방법을 제공한다.In addition, the present invention provides a method for differentiating stem cells into astrocytes, comprising the step of culturing the composition with stem cells.

본 발명에서, “배양”은 고농도 글루코스가 포함된 DMEM(Dulbecco's modified Eagle's medium, Hyclone)과 같은 세포 배양용 배지에서 수행될 수 있으며, 배양배지에는 피루브산 나트륨(sodium pyruvate), 글루타민(glutamine) 등이 추가로 첨가될 수 있다. 배양기간은 3 내지 10일이 바람직하다.In the present invention, "culture" may be performed in a cell culture medium such as DMEM (Dulbecco's modified Eagle's medium, Hyclone) containing high concentration of glucose, and the culture medium includes sodium pyruvate, glutamine, etc. It can be added further. The culture period is preferably 3 to 10 days.

본 발명에 사용된 용어 ‘배지’는 당, 아미노산, 각종 영양물질, 혈청, 성장인자, 무기질 등의 세포의 성장 및 증식 등에 필수적인 요소를 포함하는 시험관 내(in vitro)에서 성상세포 등의 세포의 분화 및 증식을 위한 혼합물을 말하며, 특히, 본 발명의 배지는 성상세포의 분화 및 증식을 위한 배지이다. 상기 ‘배양’은 성상세포의 분화 및 증식을 포함하는 의미이다.The term'medium' used in the present invention contains essential elements such as sugars, amino acids, various nutrients, serum, growth factors, minerals, etc. of cells such as astrocytes in vitro. It refers to a mixture for differentiation and proliferation, and in particular, the medium of the present invention is a medium for differentiation and proliferation of astrocytes. The'culture' is meant to include differentiation and proliferation of astrocytes.

본 발명의 용어 “배지”는 당업계에 알려진 기본 배지를 제한 없이 사용할 수 있다. 기본 배지는 인위적으로 합성하여 제조할 수 있으며, 상업적으로 제조된 배지는 예를 들면, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, α-MEM (α-Minimal Essential Medium), G-MEM(Glasgow's Minimal Essential Medium) 및 Iscove's Modified Dulbecco's Medium 등이 있으나, 이에 제한되지 않는다. The term "medium" of the present invention may use a basic medium known in the art without limitation. The basic medium can be artificially synthesized, and the commercially prepared medium is, for example, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10 , F-12, α-MEM (α-Minimal Essential Medium), G-MEM (Glasgow's Minimal Essential Medium), Iscove's Modified Dulbecco's Medium, and the like, but are not limited thereto.

또한 본 발명의 배양 배지는 영양혼합물 (Nutrient Mixture)을 추가로 포함할 수 있다. 상기 영양 혼합물은 세포 배양에 일반적으로 사용되는 각종 아미노산, 비타민, 무기염 등을 포함하는 혼합물로서, 상기 아미노산, 비타민, 무기염 등을 혼합하여 제조하거나 상업적으로 제조된 영양 혼합물을 사용할 수 있다. 상업적으로 제조된 영양혼합물은 예를 들면, B27, N2, F-12, M199, MCDB110, MCDB202, MCDB302 등이 있으나, 이에 제한되지 않는다.In addition, the culture medium of the present invention may further include a nutrient mixture. The nutrient mixture is a mixture containing various amino acids, vitamins, inorganic salts, etc. that are generally used in cell culture, and may be prepared by mixing the amino acids, vitamins, inorganic salts, and the like, or a nutrient mixture prepared commercially may be used. Commercially prepared nutrient mixtures include, for example, B27, N2, F-12, M199, MCDB110, MCDB202, MCDB302, etc., but are not limited thereto.

또한, 본 발명의 분화 유도 배지는 성장인자를 포함하지 않는 것일 수 있다. 상기 성장인자는 예를 들어 EGF 또는 FGF2일 수 있으나, 이에 제한되는 것은 아니다.In addition, the differentiation inducing medium of the present invention may not contain a growth factor. The growth factor may be, for example, EGF or FGF2, but is not limited thereto.

상기 줄기세포를 배양하는 배양액은 당해 분야에서 성상세포 분화에 통상적으로 사용되는 배지 배양액를 모두 포함한다. 배양에 사용되는 배양액은 일반적으로 탄소원, 질소원 및 미량원소 성분을 포함한다. The culture medium for culturing the stem cells includes all medium culture solutions commonly used for differentiation of astrocytes in the art. The culture medium used for cultivation generally contains a carbon source, a nitrogen source, and a trace element component.

보다 상세하게는 a) 개체로부터 분리된 배아줄기세포를 증식배지에 배양하여 배아체(embryonic body) 세포로 분화시키는 단계; 및 In more detail, a) culturing the embryonic stem cells isolated from the individual in a proliferation medium to differentiate into embryonic body cells; And

b) 상기 분화된 배아체 세포를 3’-메톡시플라본이 유효성분으로 포함된 조성물이 포함된 분화배지에 배양하여 성상세포로 분화시키는 단계;를 포함하는 줄기세포를 성상세포로 분화시키는 방법일 수 있다.b) culturing the differentiated embryonic cells in a differentiation medium containing a composition containing 3'-methoxyflavone as an active ingredient to differentiate into astrocytes; I can.

보다 상세하게는, 줄기세포를 3’-메톡시플라본이 유효성분으로 포함된 조성물이 포함된 분화 배지에 배양하여 성상세포로 분화시키는 단계;를 포함하는 줄기세포를 성상세포로 분화시키는 방법일 수 있다.More specifically, the step of culturing stem cells in a differentiation medium containing a composition containing 3'-methoxyflavone as an active ingredient to differentiate into astrocytes; it may be a method of differentiating stem cells into astrocytes, including have.

상기 줄기세포로는 배아줄기세포, 성체 줄기세포, 배아생식 줄기세포, 배아종양 줄기세포 등을 들 수 있으나, 이에 한정되지는 않는다.Examples of the stem cells include, but are not limited to, embryonic stem cells, adult stem cells, embryonic stem cells, and embryonic tumor stem cells.

상기 단계 a)의 개체는 예를 들어 동물, 포유류, 인간을 제외한 포유류 또는 설치류일 수 있으나, 이에 제한되는 것은 아니다.The individual in step a) may be, for example, an animal, a mammal, a mammal other than a human, or a rodent, but is not limited thereto.

상기 단계 a)의 증식배지는 항생제, B27, EGF(Epidermal growth factor) 및 FGF2(Fibroblast growth factor 2)로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.The growth medium of step a) may include one or more selected from the group consisting of antibiotics, B27, EGF (Epidermal growth factor), and FGF2 (Fibroblast growth factor 2), but is not limited thereto.

상기 단계 a)의 증식배지는 항생제 0.1 내지 5 %(v/v); B27 0.5 내지 5 %(v/v); 및 EGF 및 FGF2 10 내지 30 ng/mL 로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.The growth medium of step a) is antibiotic 0.1 to 5% (v/v); B27 0.5-5% (v/v); And EGF and FGF2 from 10 to 30 ng/mL, but may include at least one selected from the group consisting of, but is not limited thereto.

상기 단계 b)의 분화배지는 항생제, 및 B27로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.The differentiation medium of step b) may include antibiotics and at least one selected from the group consisting of B27, but is not limited thereto.

상기 단계 b)의 분화배지는 항생제 0.1 내지 5 %(v/v); 및 B27 0.5 내지 5 %(v/v)로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.The differentiation medium of step b) is an antibiotic of 0.1 to 5% (v/v); And B27 may include at least one selected from the group consisting of 0.5 to 5% (v/v), but is not limited thereto.

상기 단계 b)의 분화배지는 단계 a)의 배지에서 성장인자 EGF 및 FGF2가 회수된 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다.The differentiation medium of step b) may be characterized in that the growth factors EGF and FGF2 are recovered from the medium of step a), but are not limited thereto.

또한, 본 발명은 3’-메톡시플라본을 유효성분으로 포함하는, 줄기세포의 성상세포로의 분화 유도용 키트를 제공한다.In addition, the present invention provides a kit for inducing differentiation of stem cells into astrocytes, comprising 3'-methoxyflavone as an active ingredient.

상기 키트는 상기한 것에 한정되는 것은 아니며, 다른 시약이나 기구를 포함할 수 있다. 예를 들면, 대상 세포를 배양하기 위한 배양 플레이트나 백악모세포로의 분화 상태를 평가 가능한 시약(예를 들면, 알리자린 레드 등)을 포함할 수 있고, 배양하는 대상이 되는 줄기세포를 구비하고 있을 수도 있다.The kit is not limited to the above, and may include other reagents or devices. For example, it may contain a culture plate for culturing a target cell or a reagent capable of evaluating the state of differentiation into a cretaceous cell (for example, alizarin red, etc.), and the stem cells to be cultured may be provided. have.

본 발명에 따른 키트의 제공형태는 분화 유도 배지용 첨가제, 또는 3’-메톡시플라본, 또는 영양혼합물, 성장인자, 또는 기초 배지와 그 외의 시약 모두를 적절한 용량 및/또는 형태로 함유한 하나의 용기일 수 있거나, 각각 다른 용기에 의해 제공할 수 있다.The provided form of the kit according to the present invention is one containing an additive for differentiation induction medium, or 3'-methoxyflavone, or a nutrient mixture, a growth factor, or both a basal medium and other reagents in an appropriate dose and/or form. It may be a container, or each may be provided by a different container.

본 발명에 따른 키트는 상술한 본 발명에 따른 방법을 실시하기 위한 순서 등을 기재한 설명서를 포함할 수 있다.The kit according to the present invention may include a description describing the procedure for carrying out the method according to the present invention described above.

또한, 본 발명은 3’-메톡시플라본 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환 예방 또는 치료용 약학적 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for preventing or treating neurodegenerative diseases comprising 3′-methoxyflavone or a pharmacologically acceptable salt thereof as an active ingredient.

본 발명에 따른 3’-메톡시플라본은 그 자체 또는 약학적으로 허용 가능한 염의 형태로 사용될 수 있다. The 3'-methoxyflavone according to the present invention may be used by itself or in the form of a pharmaceutically acceptable salt.

본 발명에서 용어, "약학적으로 허용 가능한 염"이란 약학적으로 허용되는 무기산, 유기산, 또는 염기로부터 유도된 염을 포함한다. In the present invention, the term "pharmaceutically acceptable salt" includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases.

적합한 산의 예로는 염산, 브롬산, 황산, 질산, 과염소산, 프로피온산, 말레인산, 주석산, 글루콘산, 트리플루오로아세트산, 푸마르산, 말레산, 인산, 글리콜산, 락트산, 살리실산, 숙신산, 톨루엔-p-설폰산, 타르타르산, 아세트산, 시트르산, 메탄설폰산, 포름산, 벤조산, 말론산, 나프탈렌-2-설폰산, 벤젠설폰산, 브롬화수소산, 요오드화수소산, 아질산, 안식향산, 구연산, 젖산 등을 들 수 있다. 산부가염은 통상의 방법, 예를 들면 화합물을 과량의 산 수용액에 용해시키고, 이 염을 메탄올, 에탄올, 아세톤 또는 아세토니트릴과 같은 수혼화성 유기 용매를 사용하여 침전시켜서 제조할 수 있다. 또한, 동몰량의 화합물 및 물 중의 산 또는 알코올을 가열하고 이어서 상기 혼합물을 증발시켜서 건조시키거나, 또는 석출된 염을 흡인 여과시켜 제조할 수 있다.Examples of suitable acids are hydrochloric acid, bromic acid, sulfuric acid, nitric acid, perchloric acid, propionic acid, maleic acid, tartaric acid, gluconic acid, trifluoroacetic acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p- Sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid, benzoic acid, malonic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, hydrobromic acid, hydroiodic acid, nitrous acid, benzoic acid, citric acid, lactic acid, and the like. The acid addition salt can be prepared by a conventional method, for example, dissolving a compound in an excess acid aqueous solution, and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. Further, it can be prepared by heating an equimolar amount of the compound and an acid or alcohol in water and then evaporating the mixture to dryness, or by suction filtration of the precipitated salt.

적합한 염기로부터 유도된 염은 나트륨, 칼륨 등의 알칼리 금속, 마그네슘 등의 알칼리 토금속, 및 암모늄 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 알칼리 금속 또는 알칼리 토금속염은, 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리토 금속 수산화물 용액 중에 용해하고, 비용해 화합물염을 여과한 후 여액을 증발, 건조시켜 얻을 수 있다. 이 때, 금속염으로서는 특히 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하며, 또한 이에 대응하는 은염은 알칼리 금속 또는 알칼리토 금속염을 적당한 은염(예, 질산은)과 반응시켜 얻을 수 있다.Salts derived from suitable bases may include alkali metals such as sodium and potassium, alkaline earth metals such as magnesium, and ammonium, but are not limited thereto. The alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate. In this case, as the metal salt, it is particularly pharmaceutically suitable to prepare sodium, potassium or calcium salt, and the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).

본 발명에서 사용되는 용어 "신경퇴행성 질환"의 종류는 특별히 제한되지 아니한다. 상기 신경퇴행성 질환의 비제한적인 예로 알츠하이머병, 근육위축 측삭 경화증, 부신백질형성 장애증, 알렉산더병, 알퍼병, 혈관확장성 운동실조증, 배튼병, 소해면양 뇌증 (BSE), 카나반병, 피질기저 퇴화, 크로이츠펠트-야콥병, 루이체들을 가진 치매, 치명적 가족성 불면증, 전두 측두엽 퇴화, 헌팅턴병, 케네디병, 크랩병, 라임병, 마카도-요세프병, 다발성 경화증, 다발성 전신 위축증, 신경 유극적혈구증, 니만-피크병, 파킨슨병, 피크병, 일차 측삭 경화증, 진행성 핵상 마비, 레프섬병, 샌드호프병, 확산성 미엘린분해 경화증, 척수소뇌성 실조증, 척수의 아급성 조합된 퇴화, 척수 매독, 테이-삭스병, 독성 뇌증, 전파가능한 해면양 뇌증, 및 불안정 헤지호그 증후군으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나 이에 제한되는 것은 아니다.The type of the term "neurodegenerative disease" used in the present invention is not particularly limited. Non-limiting examples of the neurodegenerative diseases are Alzheimer's disease, muscular atrophy lateral sclerosis, adrenal leukoplastic disorder, Alexander's disease, Alper's disease, dilated ataxia, Batten's disease, bovine spongiform encephalopathy (BSE), canaban disease, cortical basal disease. Degeneration, Creutzfeldt-Jakob disease, dementia with Lewy bodies, fatal familial insomnia, frontal temporal lobe degeneration, Huntington's disease, Kennedy's disease, Crab's disease, Lyme disease, Macado-Joseph disease, multiple sclerosis, multiple systemic atrophy, neurotrophic cellosis , Niemann-Peak's disease, Parkinson's disease, Peak's disease, primary lateral sclerosis, progressive supranuclear palsy, Levsum's disease, Sandhof's disease, diffuse myelinlytic sclerosis, spinal cerebellar ataxia, subacute combined degeneration of the spinal cord, spinal cord syphilis, Tay -It may be one or more selected from the group consisting of Sachs disease, toxic encephalopathy, transmissible spongiform encephalopathy, and unstable Hedgehog syndrome, but is not limited thereto.

본 발명의 조성물 내의 상기 화합물의 함량은 질환의 증상, 증상의 진행 정도, 환자의 상태 등에 따라서 적절히 조절 가능하며, 예컨대, 전체 조성물 중량을 기준으로 0.0001 내지 99.9중량%, 0.001 내지 80중량% 또는 0.01 내지 50중량%일 수 있으나, 이에 한정되는 것은 아니다. 상기 함량비는 용매를 제거한 건조량을 기준으로 한 값이다.The content of the compound in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9% by weight, 0.001 to 80% by weight or 0.01 based on the total weight of the composition. To 50% by weight, but is not limited thereto. The content ratio is a value based on the dry amount from which the solvent has been removed.

본 발명에 따른 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 부형제는 예를 들어, 희석제, 결합제, 붕해제, 활택제, 흡착제, 보습제, 필름-코팅 물질, 및 제어방출첨가제로 이루어진 군으로부터 선택된 하나 이상일 수 있다. The pharmaceutical composition according to the present invention may further include suitable carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions. The excipient may be, for example, one or more selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a moisturizing agent, a film-coating material, and a controlled release additive.

본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 서방형 과립제, 장용과립제, 액제, 점안제, 엘실릭제, 유제, 현탁액제, 주정제, 트로키제, 방향수제, 리모나아데제, 정제, 서방형정제, 장용정제, 설하정, 경질캅셀제, 연질캅셀제, 서방캅셀제, 장용캅셀제, 환제, 틴크제, 연조엑스제, 건조엑스제, 유동엑스제, 주사제, 캡슐제, 관류액, 경고제, 로션제, 파스타제, 분무제, 흡입제, 패취제, 멸균주사용액, 또는 에어로졸 등의 외용제 등의 형태로 제형화하여 사용될 수 있으며, 상기 외용제는 예를들어 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 등의 제형을 가질 수 있다. The pharmaceutical composition according to the present invention is a powder, granule, sustained-release granule, enteric granule, liquid, eye drop, L-silic agent, emulsion, suspension, alcohol, troche, fragrance, limonadese according to a conventional method, respectively. , Tablets, sustained-release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusate, It can be formulated and used in the form of a warning agent, lotion, pasta, spray, inhalant, patch, sterile injectable solution, or external preparation such as aerosol, and the external preparation is, for example, cream, gel, patch, spray, ointment. , A warning agent, a lotion agent, a liniment agent, a pasta agent, or a cataplasma agent.

본 발명에 따른 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. Carriers, excipients, and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium. Phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used.

본 발명에 따른 정제, 산제, 과립제, 캡슐제, 환제, 트로키제의 첨가제로 옥수수전분, 감자전분, 밀전분, 유당, 백당, 포도당, 과당, 디-만니톨, 침강탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 미결정셀룰로오스, 덱스트린, 알긴산나트륨, 메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 카올린, 요소, 콜로이드성실리카겔, 히드록시프로필스타치, 히드록시프로필메칠셀룰로오스, 1928, 2208, 2906, 2910, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤 등 부형제; 젤라틴, 아라비아고무, 에탄올, 한천가루, 초산프탈산셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스칼슘, 포도당, 정제수, 카제인나트륨, 글리세린, 스테아린산, 카르복시메칠셀룰로오스나트륨, 메칠셀룰로오스나트륨, 메칠셀룰로오스, 미결정셀룰로오스, 덱스트린, 히드록시셀룰로오스, 히드록시프로필스타치, 히드록시메칠셀룰로오스, 정제쉘락, 전분호, 히드록시프로필셀룰로오스, 히드록시프로필메칠셀룰로오스, 폴리비닐알코올, 폴리비닐피롤리돈 등의 결합제가 사용될 수 있으며, 히드록시프로필메칠셀룰로오스, 옥수수전분, 한천가루, 메칠셀룰로오스, 벤토나이트, 히드록시프로필스타치, 카르복시메칠셀룰로오스나트륨, 알긴산나트륨, 카르복시메칠셀룰로오스칼슘, 구연산칼슘, 라우릴황산나트륨, 무수규산, 1-히드록시프로필셀룰로오스, 덱스트란, 이온교환수지, 초산폴리비닐, 포름알데히드처리 카제인 및 젤라틴, 알긴산, 아밀로오스, 구아르고무(Guar gum), 중조, 폴리비닐피롤리돈, 인산칼슘, 겔화전분, 아라비아고무, 아밀로펙틴, 펙틴, 폴리인산나트륨, 에칠셀룰로오스, 백당, 규산마그네슘알루미늄, 디-소르비톨액, 경질무수규산 등 붕해제; 스테아린산칼슘, 스테아린산마그네슘, 스테아린산, 수소화식물유(Hydrogenated vegetable oil), 탈크, 석송자, 카올린, 바셀린, 스테아린산나트륨, 카카오지, 살리실산나트륨, 살리실산마그네슘, 폴리에칠렌글리콜 4000, 폴리에칠렌글리콜 6000, 유동파라핀, 수소첨가대두유(Lubri wax), 스테아린산알루미늄, 스테아린산아연, 라우릴황산나트륨, 산화마그네슘, 마크로골(Macrogol), 합성규산알루미늄, 무수규산, 고급지방산, 고급알코올, 실리콘유, 파라핀유, 폴리에칠렌글리콜지방산에테르, 전분, 염화나트륨, 초산나트륨, 올레인산나트륨, dl-로이신, 경질무수규산 등의 활택제;가 사용될 수 있다.As additives for tablets, powders, granules, capsules, pills, and troches according to the present invention, corn starch, potato starch, wheat starch, lactose, white sugar, glucose, fructose, di-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, phosphoric acid Calcium monohydrogen, calcium sulfate, sodium chloride, sodium hydrogen carbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methylcellulose, sodium carboxymethylcellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropyl methyl Excipients such as cellulose, 1928, 2208, 2906, 2910, propylene glycol, casein, calcium lactate, and primogel; Gelatin, Arabic rubber, ethanol, agar powder, phthalate phthalate, carboxymethylcellulose, carboxymethylcellulose calcium, glucose, purified water, casein sodium, glycerin, stearic acid, sodium carboxymethylcellulose, sodium methylcellulose, methylcellulose, microcrystalline cellulose, dextrin , Hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, refined shellac, starch, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl alcohol, polyvinylpyrrolidone, and other binders may be used, Hydroxypropyl methylcellulose, corn starch, agar powder, methylcellulose, bentonite, hydroxypropyl starch, sodium carboxymethylcellulose, sodium alginate, calcium carboxymethylcellulose, calcium citrate, sodium lauryl sulfate, silicic anhydride, 1-hydroxy Propyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde-treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, arabic rubber, Disintegrants such as amylopectin, pectin, sodium polyphosphate, ethyl cellulose, sucrose, magnesium aluminum silicate, di-sorbitol liquid, and light anhydrous silicic acid; Calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lychee, kaolin, petrolatum, sodium stearate, cacao butter, sodium salicylate, magnesium salicylate, polyethylene glycol 4000, polyethylen glycol 6000, liquid soybean oil, hydrogenated soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, silicic anhydride, higher fatty acid, higher alcohol, silicone oil, paraffin oil, polyethylen glycol fatty acid ether, starch, Lubricants such as sodium chloride, sodium acetate, sodium oleate, dl-leucine, and light anhydrous silicic acid; may be used.

본 발명에 따른 액제의 첨가제로는 물, 묽은 염산, 묽은 황산, 구연산나트륨, 모노스테아린산슈크로스류, 폴리옥시에칠렌소르비톨지방산에스텔류(트윈에스텔), 폴리옥시에칠렌모노알킬에텔류, 라놀린에텔류, 라놀린에스텔류, 초산, 염산, 암모니아수, 탄산암모늄, 수산화칼륨, 수산화나트륨, 프롤아민, 폴리비닐피롤리돈, 에칠셀룰로오스, 카르복시메칠셀룰로오스나트륨 등이 사용될 수 있다.The additives of the liquid preparation according to the present invention include water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylensorbitol fatty acid esters (twin esters), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethylcellulose, sodium carboxymethylcellulose, and the like may be used.

본 발명에 따른 시럽제에는 백당의 용액, 다른 당류 혹은 감미제 등이 사용될 수 있으며, 필요에 따라 방향제, 착색제, 보존제, 안정제, 현탁화제, 유화제, 점조제 등이 사용될 수 있다.The syrup according to the present invention may include a solution of white sugar, other sugars or sweeteners, and if necessary, a fragrance, a colorant, a preservative, a stabilizer, a suspending agent, an emulsifier, a viscous agent, and the like may be used.

본 발명에 따른 유제에는 정제수가 사용될 수 있으며, 필요에 따라 유화제, 보존제, 안정제, 방향제 등이 사용될 수 있다.Purified water may be used for the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. may be used as needed.

본 발명에 따른 현탁제에는 아카시아, 트라가칸타, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 미결정셀룰로오스, 알긴산나트륨, 히드록시프로필메칠셀룰로오스, 1828, 2906, 2910 등 현탁화제가 사용될 수 있으며, 필요에 따라 계면활성제, 보존제, 안정제, 착색제, 방향제가 사용될 수 있다.Suspension agents such as acacia, tragacanta, methylcellulose, carboxymethylcellulose, carboxymethylcellulose sodium, microcrystalline cellulose, sodium alginate, hydroxypropyl methylcellulose, 1828, 2906, 2910, etc. may be used as the suspending agent according to the present invention, Surfactants, preservatives, stabilizers, colorants, and fragrances may be used as needed.

본 발명에 따른 주사제에는 주사용 증류수, 0.9%염화나트륨주사액, 링겔주사액, 덱스트로스주사액, 덱스트로스+염화나트륨주사액, 피이지(PEG), 락테이티드 링겔주사액, 에탄올, 프로필렌글리콜, 비휘발성유-참기름, 면실유, 낙화생유, 콩기름, 옥수수기름, 올레인산에칠, 미리스트산 이소프로필, 안식향산벤젠과 같은 용제; 안식향산나트륨, 살리실산나트륨, 초산나트륨, 요소, 우레탄, 모노에칠아세트아마이드, 부타졸리딘, 프로필렌글리콜, 트윈류, 니정틴산아미드, 헥사민, 디메칠아세트아마이드와 같은 용해보조제; 약산 및 그 염(초산과 초산나트륨), 약염기 및 그 염(암모니아 및 초산암모니움), 유기화합물, 단백질, 알부민, 펩 톤, 검류와 같은 완충제; 염화나트륨과 같은 등장화제; 중아황산나트륨(NaHSO3)이산화탄소가스, 메타중아황산나트륨(Na2S2O3), 아황산나트륨(Na2SO3), 질소가스(N2), 에칠렌디아민테트라초산과 같은 안정제; 소디움비설파이드 0.1%, 소디움포름알데히드 설폭실레이트, 치오우레아, 에칠렌디아민테트라초산디나트륨, 아세톤소디움비설파이트와 같은 황산화제; 벤질알코올, 클로로부탄올, 염산프로카인, 포도당, 글루콘산칼슘과 같은 무통화제; 시엠시나트륨, 알긴산나트륨, 트윈 80, 모노스테아린산알루미늄과 같은 현탁화제를 포함할 수 있다.Injectables according to the present invention include distilled water for injection, 0.9% sodium chloride injection, ring gel injection, dextrose injection, dextrose + sodium chloride injection, PEG, lactated ring gel injection, ethanol, propylene glycol, non-volatile oil-sesame oil Solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleic acid, isopropyl myristic acid, and benzene benzoate; Solubility aids such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, tweens, nijeongtinamide, hexamine, and dimethylacetamide; Buffering agents such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, and gums; Isotonic agents such as sodium chloride; Stabilizers such as sodium bisulfite (NaHSO 3 ) carbon dioxide gas, sodium metabisulfite (Na 2 S 2 O 3 ), sodium sulfite (Na 2 SO 3 ), nitrogen gas (N 2 ), and ethylenediamine tetraacetic acid; Sulfating agents such as sodium bisulfide 0.1%, sodium formaldehyde sulfoxylate, thiourea, ethylendiamine tetraacetate disodium, and acetone sodium bisulfite; Painless agents such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; Suspending agents such as sodium siemsi, sodium alginate, Tween 80, and aluminum monostearate may be included.

본 발명에 따른 좌제에는 카카오지, 라놀린, 위텝솔, 폴리에틸렌글리콜, 글리세로젤라틴, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 스테아린산과 올레인산의 혼합물, 수바날(Subanal), 면실유, 낙화생유, 야자유, 카카오버터+콜레스테롤, 레시틴, 라네트왁스, 모노스테아린산글리세롤, 트윈 또는 스판, 임하우젠(Imhausen), 모놀렌(모노스테아린산프로필렌글리콜), 글리세린, 아뎁스솔리두스(Adeps solidus), 부티룸 태고-G(Buytyrum Tego-G), 세베스파마 16 (Cebes Pharma 16), 헥사라이드베이스 95, 코토마(Cotomar), 히드록코테 SP, S-70-XXA, S-70-XX75(S-70-XX95), 히드록코테(Hydrokote) 25, 히드록코테 711, 이드로포스탈 (Idropostal), 마사에스트라리움(Massa estrarium, A, AS, B, C, D, E, I, T), 마사-MF, 마수폴, 마수폴-15, 네오수포스탈-엔, 파라마운드-B, 수포시로(OSI, OSIX, A, B, C, D, H, L), 좌제기제 IV 타입 (AB, B, A, BC, BBG, E, BGF, C, D, 299), 수포스탈 (N, Es), 웨코비 (W, R, S, M ,Fs), 테제스터 트리글리세라이드 기제 (TG-95, MA, 57)와 같은 기제가 사용될 수 있다.Suppositories according to the present invention include cacao butter, lanolin, witepsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cacao butter+ Cholesterol, lecithin, ranetwax, glycerol monostearate, tween or span, Imhausen, monolen (propylene glycol monostearate), glycerin, Adeps solidus, Butyrum Taego-G (Buytyrum Tego) -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hydro Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Masupol, Masupol-15, Neosupostal-ene, Paramound-B, Sufoshiro (OSI, OSIX, A, B, C, D, H, L), suppository type IV (AB, B, A, BC, BBG, E, BGF, C, D, 299), supostal (N, Es), Wekobi (W, R, S, M, Fs), tester triglyceride base (TG-95, MA, 57) and The same mechanism can be used.

경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient in the extract, such as starch, calcium carbonate, and sucrose. ) Or lactose (lactose), gelatin, etc. are mixed to prepare. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, syrups, etc.In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweetening agents, fragrances, and preservatives may be included. have. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used.

본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물의 투여량은 유효성분을 기준으로 1일 0.1 mg/kg 내지 100 mg/kg, 1 mg/kg 내지 50 mg/kg 또는 1 mg/kg 내지 10 mg/kg으로 할 수 있으나, 이에 제한되는 것은 아니다.　투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수 있다.The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "a pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, drug activity, Sensitivity to drugs, time of administration, route of administration and rate of excretion, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field can be determined. The dosage of the composition of the present invention may be 0.1 mg/kg to 100 mg/kg, 1 mg/kg to 50 mg/kg, or 1 mg/kg to 10 mg/kg per day, based on the active ingredient. It is not limited. Administration may be administered once a day or may be divided several times.

본 발명에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 본 발명이 속하는 기술분야에 통상의 기술자에 의해 용이하게 결정될 수 있다.The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple. It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all the above factors, and this can be easily determined by a person skilled in the art to which the present invention pertains.

본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구 복용, 피하 주사, 복강 투여, 정맥 주사, 근육 주사, 척수 주위 공간(경막내) 주사, 설하 투여, 볼점막 투여, 직장 내 삽입, 질 내 삽입, 안구 투여, 귀 투여, 비강 투여, 흡입, 입 또는 코를 통한 분무, 피부 투여, 경피 투여 등에 따라 투여될 수 있다.The pharmaceutical composition of the present invention can be administered to a subject by various routes. All modes of administration can be expected, for example oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, peri-spinal space (intrathecal) injection, sublingual administration, buccal mucosa administration, rectal injection, vaginal injection. It may be administered according to intramuscular insertion, ocular administration, ear administration, nasal administration, inhalation, spray through the mouth or nose, skin administration, transdermal administration, and the like.

본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별, 체중 및 질환의 중등도 등의 여러 관련 인자와 함께 활성성분인 약물의 종류에 따라 결정된다.The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient, along with various related factors such as the disease to be treated, the route of administration, the age, sex, weight, and severity of the disease of the patient.

본 발명에서 “개체”란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말, 및 소 등의 포유류를 의미한다.In the present invention, “individual” means a subject in need of treatment of a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, cows, etc. Means mammals.

본 발명에서 “투여”란 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.In the present invention, "administering" means providing a given composition of the present invention to a subject by any suitable method.

본 발명에서 “예방”이란 목적하는 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미하고, “치료”란 본 발명에 따른 약학적 조성물의 투여에 의해 목적하는 질환과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, “개선”이란 본 발명에 따른 조성물의 투여에 의해 목적하는 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다. In the present invention, "prevention" refers to any action that suppresses or delays the onset of the target disease, and "treatment" refers to the target disease and the resulting metabolic abnormalities are improved by administration of the pharmaceutical composition according to the present invention. It means all actions that are advantageously altered, and "improvement" means any action of reducing the degree of a parameter related to a desired disease, for example, symptoms by administration of the composition according to the present invention.

나아가, 본 발명의 약학적 조성물은 신경퇴행성 질환의 예방 또는 치료 효과를 가지는 공지의 화합물과 병행하여 투여할 수 있다.Furthermore, the pharmaceutical composition of the present invention can be administered in combination with a known compound having a preventive or therapeutic effect on neurodegenerative diseases.

본 발명에서는 3’-메톡시플라본을 이용하여 줄기세포를 성상세포로 분화유도하였다. 분화유도된 성상세포는 환자를 위한 세포치료제로 활용 가능성이 매우 높다.In the present invention, 3'-methoxyflavone was used to induce differentiation of stem cells into astrocytes. Differentiation-induced astrocytes are highly likely to be used as cell therapy for patients.

따라서, 본 발명은 상기 방법에 의해 제조된 성상세포를 포함하는 신경퇴행성 질환 치료용 세포치료제에 관한 것이다.Accordingly, the present invention relates to a cell therapy agent for treating neurodegenerative diseases comprising astrocytes prepared by the above method.

본 발명의 용어 "세포치료제 (cellular therapeutic agent)"란, 인간으로부터 분리, 배양 및 특수한 조작을 통해 제조된 세포 및 조직으로 치료, 진단 및 예방의 목적으로 사용되는 의약품 (미국 FDA 규정)으로서, 세포 혹은 조직의 기능을 복원시키기 위하여 살아있는 자가, 동종, 또는 이종세포를 체외에서 증식 선별하거나 다른 방법으로 세포의 생물학적 특성을 변화시키는 등의 일련의 행위를 통하여 이러한 세포가 질병의 치료, 진단 및 예방의 목적으로 사용되는 의약품을 의미한다.The term "cellular therapeutic agent" of the present invention refers to a drug used for treatment, diagnosis, and prevention of cells and tissues manufactured through isolation, culture and special manipulation from humans (US FDA regulations). Or, in order to restore the function of the tissue, these cells can be used for the treatment, diagnosis, and prevention of diseases through a series of actions such as proliferating and selecting live autologous, allogeneic, or xenogeneic cells in vitro, or by changing the biological characteristics of the cells in other ways. It means a drug used for the purpose.

본 발명의 세포치료제 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 비경구 투여, 예를 들어, 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피내 투여될 수 있으나, 이에 제한되지는 않는다.The administration route of the cell therapy composition of the present invention may be administered through any general route as long as it can reach the target tissue. Parenteral administration, for example, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, or intradermal administration, but is not limited thereto.

상기 조성물은 세포 치료에 일반적으로 사용되는 약제학적 담체와 함께 적합한 형태로 제형화될 수 있다. '약학적으로 허용되는'이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증 등과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 말한다. 약학적으로 허용되는 담체로는 예를 들면, 물, 적합한 오일, 식염수, 수성 글루코스 및 글리콜 등과 같은 비경구 투여용 담체 등이 있으며 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸- 또는 프로필-파라벤 및 클로로부탄올이 있다. 그 밖의 약학적으로 허용되는 담체로는 다음의 문헌에 기재되어 있는 것을 참고로 할 수 있다 (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).The composition may be formulated in a suitable form with a pharmaceutical carrier generally used for cell therapy. "Pharmacologically acceptable" refers to a composition that is physiologically acceptable and does not usually cause allergic reactions such as gastrointestinal disorders, dizziness, or similar reactions when administered to humans. Pharmaceutically acceptable carriers include, for example, carriers for parenteral administration such as water, suitable oils, saline, aqueous glucose and glycol, and the like, and may further include stabilizers and preservatives. Suitable stabilizers are antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives are benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Other pharmaceutically acceptable carriers may be referred to as those described in the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

또한, 상기 조성물은 세포치료제가 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수도 있다.In addition, the composition may be administered by any device capable of moving a cell therapy agent to a target cell.

본 발명의 세포치료제 조성물은 질환의 치료를 위하여 치료학적으로 유효한 양의 세포치료제를 포함할 수 있다. '치료학적으로 유효한 양 (therapeutically effective amount)'은 연구자, 수의사, 의사 또는 기타 임상에 의해 생각되는 조직계, 동물 또는 인간에서 생물학적 또는 의학적 반응을 유도하는 유효 성분 또는 약학적 조성물의 양을 의미하는 것으로, 이는 치료되는 질환 또는 장애의 증상의 완화를 유도하는 양을 포함한다.The cell therapy composition of the present invention may contain a therapeutically effective amount of a cell therapy agent for the treatment of a disease. The term'therapeutically effective amount' refers to the amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal, or human thought by a researcher, veterinarian, doctor or other clinician. , Which includes an amount that induces relief of symptoms of the disease or disorder being treated.

본 발명의 조성물에 포함되는 세포치료제는 원하는 효과에 따라 변화될 것임은 당업자에게 자명하다. 그러므로 최적의 세포치료제 함량은 당업자에 의해 쉽게 결정될 수 있으며, 질환의 종류, 질환의 중증도, 조성물에 함유된 다른 성분의 함량, 제형의 종류, 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 포함하는 것이 중요하다. 예컨대, 본 발명의 줄기세포의 1일 투여량은 1.0×104 내지 1.0×1011 세포/kg 체중, 바람직하게는 1.0×105 내지 1.0×109 세포/kg 체중을 1회 또는 수회로 나누어 투여할 수 있다. 그러나, 유효성분의 실제 투여량은 치료하고자 하는 질환, 질환의 중증도, 투여경로, 환자의 체중, 연령 및 성별 등의 여러 관련 인자에 비추어 결정되어야하는 것으로 이해되어야 하며, 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.It is obvious to those skilled in the art that the cell therapy agent included in the composition of the present invention will vary depending on the desired effect. Therefore, the optimal cell therapy content can be easily determined by a person skilled in the art, and the type of disease, severity of the disease, the content of other ingredients in the composition, the type of formulation, and the age, weight, general health status, sex and diet of the patient. , Administration time, administration route and secretion rate of the composition, treatment period, it may be adjusted according to various factors including drugs used simultaneously. It is important to include an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all of the above factors. For example, the daily dose of the stem cells of the present invention is 1.0×10 4 to 1.0×10 11 cells/kg body weight, preferably 1.0×10 5 to 1.0×10 9 cells/kg body weight, divided once or several times. Can be administered. However, it should be understood that the actual dosage of the active ingredient should be determined in light of various related factors such as the disease to be treated, the severity of the disease, the route of administration, the weight, age, and sex of the patient. It is not intended to limit the scope of the present invention to any aspect.

본 발명은 포유동물에게 치료학적으로 유효한 양의 본 발명의 상기 세포치료제 조성물을 투여하는 것을 포함하는 치료방법을 제공한다. 여기에서 사용된 용어 포유동물은 치료, 관찰 또는 실험의 대상인 포유동물을 말하며, 바람직하게는 인간을 말한다.The present invention provides a treatment method comprising administering to a mammal a therapeutically effective amount of the cell therapy composition of the present invention. The term mammal as used herein refers to a mammal that is an object of treatment, observation or experiment, and preferably refers to a human.

이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, a preferred embodiment is presented to aid the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[[ 실시예Example ]]

실시예Example 1. 실험 방법 1. Experimental method

실시예Example 1-1. 세포 배양 및 화합물 처리 1-1. Cell culture and compound treatment

모든 동물 실험은 실험실 동물의 관리 및 사용을 위한 국립 보건 연구소 (National Institutes of Health) 가이드 라인을 준수했으며 중앙대학교 동물 관리위원회의 승인을 받았다 (허가 번호 : 13-0049, 2014-00032).All animal experiments comply with the guidelines of the National Institutes of Health for the care and use of laboratory animals and have been approved by the Animal Care Committee of Chung-Ang University (license number: 13-0049, 2014-00032).

구체적으로, 동물을 CO2에 짧게 노출시켜 마취시키고 경추 탈골로 희생시켰다. 신경줄기세포(NSC)는 배아 14 일차에 스프라그-돌리 래트 배아(Sprague-Dawley rat embryos, Orient Bio, Seongnam, Republic of Korea)의 피질로부터 단리하고, 1 %(v/v) 항생제 항진균제(antibiotic antimycotic), 2 %(v/v) B27(Thermo Fisher Scientific) 및 20 ng / mL EGF(Merck Millipore) 및 FGF2(Merck Millipore)가 보충된 DMEM / F12(Thermo Fisher Scientific, Waltham, MA, USA)에서 6 일 동안 신경구로 확장시켰다.Specifically, animals were anesthetized by brief exposure to CO 2 and sacrificed by cervical dislocation. Neural stem cells (NSC) were isolated from the cortex of Sprague-Dawley rat embryos (Orient Bio, Seongnam, Republic of Korea) on the 14th day of embryo, and 1% (v/v) antibiotic antimycotic agent (antibiotic antimycotic). ), in DMEM/F12 (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 2% (v/v) B27 (Thermo Fisher Scientific) and 20 ng/mL EGF (Merck Millipore) and FGF2 (Merck Millipore) 6 Expanded to the neurosphere for days.

이어서, 아큐타제(accutase, Merck Millipore)로 해리하고, 28000 / cm2의 밀도로 0.01 % 폴리-D-리신- 및 10 μg/mL 라미닌- 코팅된 플레이트 상에 분주하였다.Then, it was dissociated with accutase (Merck Millipore), and was dispensed onto 0.01% poly-D-lysine- and 10 μg/mL laminin-coated plates at a density of 28000 / cm 2.

증식 1일 후, 성장 인자(EGF 및 FGF2)가 없는 조건의 배양액에서 0.1 % 디메틸설폭사이드(DMSO) (Sigma-Aldrich), 플라본, 2’-아미노플라본 또는 3’-메톡시플라본(3’-methoxyflavone) 각각을 20 μM 로 처리하여 분화를 유도 하였다. 각 화합물은 DMSO (최종 배양 농도, 0.1 %)에 용해시켰다. After 1 day of proliferation, 0.1% dimethylsulfoxide (DMSO) (Sigma-Aldrich), flavone, 2'-aminoflavone or 3'-methoxyflavone (3'-) in a culture medium without growth factors (EGF and FGF2). methoxyflavone) each was treated with 20 μM to induce differentiation. Each compound was dissolved in DMSO (final culture concentration, 0.1%).

실시예 1-2. 면역세포화학 분석(immunocytochemistry analysis)Example 1-2. Immunocytochemistry analysis

실시예 1-1에서 분화 유도된 세포를 4% 파라포름알데히드 (대한민국, 성남시, Biosesang)로 고정하고, 5% 정상 염소 혈청 (Merck Millipore) 및 0.2 % Triton X-100 (VWR International, Radnor, PA, USA)을 함유하는 인산염 완충 식염수(PBS)로 차단한 후, 1차 항체와 함께 배양하였다 : 항-GFAP (토끼 IgG, 1 : 500; Z0334, Agilent Technologies, Santa Clara, CA, USA) Cells induced differentiation in Example 1-1 were fixed with 4% paraformaldehyde (Biosesang, Seongnam, Korea), 5% normal goat serum (Merck Millipore) and 0.2% Triton X-100 (VWR International, Radnor, PA). , USA) after blocking with phosphate buffered saline (PBS) and incubated with the primary antibody: anti-GFAP (rabbit IgG, 1:500; Z0334, Agilent Technologies, Santa Clara, CA, USA)

이어서, 상기 세포를 Alexa Fluor 488 (염소 항-마우스 IgG, 1 : 1000; A11001, Thermo Fisher Scientific), Alexa Fluor 546 (염소 항-마우스 IgG2b, 1 : 1; A21143, Thermo Fisher Scientific), Cy3 (염소 항 토끼 IgG, 1 : 1000; 111-165-144, Jackson ImmunoResearch, West Grove, PA, USA) 또는 Alexa Fluor 488 (염소 항-마우스 IgG2a, 1 : 1000; A21131, Thermo Fisher Scientific)이 접합된 2차 항체와 함께 배양하였다. 핵은 4', 6-디아미디노-2-페닐인돌 (DAPI) (1:10000; D9542, Sigma-Aldrich)로 염색되었다. 형광 이미지는 역형광 현미경 (DMIL; Leica, Wetzlar, Germany)으로 관찰되었다. 실험은 3 개 또는 6 개의 생물학적으로 독립적인 실험을 사용하여 3 회 또는 6회로 수행하였다.Then, the cells were transferred to Alexa Fluor 488 (goat anti-mouse IgG, 1: 1000; A11001, Thermo Fisher Scientific), Alexa Fluor 546 (goat anti-mouse IgG2b, 1: 1; A21143, Thermo Fisher Scientific), Cy3 (goat Anti-rabbit IgG, 1: 1000; 111-165-144, Jackson ImmunoResearch, West Grove, PA, USA) or Alexa Fluor 488 (goat anti-mouse IgG2a, 1: 1000; A21131, Thermo Fisher Scientific) conjugated secondary Incubated with antibody. The nuclei were stained with 4', 6-diamidino-2-phenylindole (DAPI) (1:10000; D9542, Sigma-Aldrich). Fluorescence images were observed with an inverted fluorescence microscope (DMIL; Leica, Wetzlar, Germany). Experiments were performed 3 or 6 times using 3 or 6 biologically independent experiments.

실시예 1-3. 웨스턴 블롯 분석(Western blot analysis)Example 1-3. Western blot analysis

실시예 1-1에서 분화 유도된 세포를 NP-40 완충액에 용해시킨 뒤, 동일한 양의 단백질(5-10 μg/lane)을 8-10 % 소듐도데실설페이트-폴리아크릴아미드겔 전기영동 겔에서 분해하고 폴리비닐리덴 디플루오라이드 막(Merck Millipore)으로 옮겼다. 이후 막을 블로킹시키고, 1차 항체(항-TuJ1(1:2000; T5076, Sigma-Aldrich), 항-GFAP(1:500; G9269, Sigma-Aldrich), 또는 GAPDH(1:1000, sc-32233, Santa Cruz, Dallas, TX, USA))를 처리한 후, 양고추냉이 퍼옥시다제가 접합된 2차 항체(항-마우스 IgG(1:5 000; ADI-SAB-100-J, Enzo Biochem, Farmingdale, NY, USA) 또는 항-토끼 IgG(1:5 000; ADI-SAB-300-J, Enzo Biochem))를 처리한 뒤, 웨스턴 블로팅 루미놀 시약(Santa Cruz)을 사용하여 시각화하였다. 막 상의 효소 활성은 CP-BU New X-ray 필름(Agfa, Mortsel, Belgium)에 기록된 화학 발광에 의해 표시되었다. 밴드 강도는 ImageJ 소프트웨어 (National Institutes of Health, Bethesda, MD, USA)를 사용하여 측정되었다. 실험은 3 개의 생물학적으로 독립된 실험을 통해 3 회 수행하였다.After dissolving the differentiation-induced cells in Example 1-1 in NP-40 buffer, the same amount of protein (5-10 μg/lane) was added to 8-10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel. It was digested and transferred to a polyvinylidene difluoride membrane (Merck Millipore). The membrane was then blocked, and the primary antibody (anti-TuJ1 (1:2000; T5076, Sigma-Aldrich), anti-GFAP (1:500; G9269, Sigma-Aldrich), or GAPDH (1:1000, sc-32233, Santa Cruz, Dallas, TX, USA)), and then horseradish peroxidase conjugated secondary antibody (anti-mouse IgG (1:5 000; ADI-SAB-100-J, Enzo Biochem, Farmingdale)). , NY, USA) or anti-rabbit IgG (1:5 000; ADI-SAB-300-J, Enzo Biochem)) and then visualized using Western blotting luminol reagent (Santa Cruz). Enzymatic activity on the membrane was indicated by chemiluminescence recorded on a CP-BU New X-ray film (Agfa, Mortsel, Belgium). Band intensity was measured using ImageJ software (National Institutes of Health, Bethesda, MD, USA). The experiment was carried out three times through three biologically independent experiments.

실시예 1-4. RT-PCRExample 1-4. RT-PCR

TRIzol 시약 (Thermo Fisher Scientific)을 사용하여 실시예 1-1에서 분화 유도된 세포로부터 총 RNA를 추출하고 QuantiTect 역전사 키트 (Qiagen, Hilden, Germany)를 사용하여 역전사시켰다. 특이적 프라이머 (Cosmo Genetech, Seoul, Korea)와 함께 iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA)를 사용하여 특이적 mRNA 수준을 RT- PCR로 정량화하였다 : βIII tubulin, AGCCCTCTACGACATCTGCT (forward, 서열번호 1) 및 ATTGAGCTGACCAGGGAATC (reverse, 서열번호 2); gfap, AGCGGCTCTGAGAGAGATTC (forward, 서열번호 3) 및 AGCAACGTCTGTGAGGTCTG (reverse, 서열번호 4); mek1, TGCCCAGTGGAGTATTCAGT (forward, 서열번호 5) 및 AAGTCTACCTCCTCGGCATC (reverse, 서열번호 6); mek2, CCTCCAACATTCTGGTGAAC (forward, 서열번호 7) 및 AGCGTGTCCCTACAAATGAG (reverse, 서열번호 8); 또는 glyceraldehyde 3-phosphate dehydrogenase (GADPH), AGTTCAACGGCACAGTCAAG (forward, 서열번호 9) 및 GTGGTGAAGACGCCAGTAGA (reverse, 서열번호 10). Total RNA was extracted from the cells induced to differentiate in Example 1-1 using TRIzol reagent (Thermo Fisher Scientific) and reverse transcribed using QuantiTect reverse transcription kit (Qiagen, Hilden, Germany). Specific mRNA levels were quantified by RT-PCR using iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) with specific primers (Cosmo Genetech, Seoul, Korea): βIII tubulin, AGCCCTCTACGACATCTGCT (forward, SEQ ID NO: 1) and ATTGAGCTGACCAGGGAATC (reverse, SEQ ID NO: 2); gfap, AGCGGCTCTGAGAGAGATTC (forward, SEQ ID NO: 3) and AGCAACGTCTGTGAGGTCTG (reverse, SEQ ID NO: 4); mek1, TGCCCAGTGGAGTATTCAGT (forward, SEQ ID NO: 5) and AAGTCTACCTCCTCGGCATC (reverse, SEQ ID NO: 6); mek2, CCTCCAACATTCTGGTGAAC (forward, SEQ ID NO: 7) and AGCGTGTCCCTACAAATGAG (reverse, SEQ ID NO: 8); Or glyceraldehyde 3-phosphate dehydrogenase (GADPH), AGTTCAACGGCACAGTCAAG (forward, SEQ ID NO: 9) and GTGGTGAAGACGCCAGTAGA (reverse, SEQ ID NO: 10).

반응 프로그램은 다음과 같다 : 3 분 동안 95 ℃에서 초기 활성화 단계, 95 ℃에서 10 초 동안 40 사이클의 변성 단계, 58 ℃에서 15 초 동안 어닐링 단계 및 72 ℃에서 20 초 동안 연장 단계. The reaction program is as follows: an initial activation step at 95° C. for 3 minutes, a denaturation step of 40 cycles at 95° C. for 10 seconds, an annealing step at 58° C. for 15 seconds, and an extension step at 72° C. for 20 seconds.

Bio-Rad CFX Manager 3.1을 사용하여 데이터를 얻었으며, 하우스 키핑 유전자 GAPDH를 내부 대조군으로 사용하였다.Data were obtained using Bio-Rad CFX Manager 3.1, and housekeeping gene GAPDH was used as an internal control.

DMSO로 처리된 NSC와 각각의 화합물로 처리된 NSC 사이의 유전자 발현의 비율은 하기 식을 사용하여 계산되었다 : 비율 = 2ΔCt DMSO - ΔCt Compound (Ct, 역치 사이클) 여기서, ΔCt DMSO = Ct 표적 유전자-DMSO 처리된 NSC로부터의 Ct GAPDH; 및 ΔCt Compound = Ct 표적 유전자-화합물 처리된 NSC로부터의 Ct GAPDH. 실험은 3 개의 생물학적 독립 실험을 사용하여 3 회 수행하였다.The ratio of gene expression between NSC treated with DMSO and NSC treated with each compound was calculated using the following formula: ratio = 2 ΔCt DMSO - ΔCt Compound (Ct, threshold cycle) where ΔCt DMSO = Ct target gene-Ct GAPDH from DMSO treated NSC; And ΔCt Compound = Ct GAPDH from Ct target gene-compound treated NSC. The experiment was performed 3 times using 3 biological independent experiments.

실시예 1-5. 통계적 분석Example 1-5. Statistical analysis

모든 실험은 생물학적으로 독립적인 샘플에서 세 번 이상 수행되었다. 데이터는 평균 ± 표준 평균 오차 (SEM)로 표현하였으며, 결과의 통계적 유의성 (P 값)은 Microsoft Excel 2010 (버전 14.0.7212.5000, Microsoft Corporation, WA, USA, USA)을 사용하여 Student’s t-테스트에 의해 계산되었다 (* P <0.05, ** P <0.01).All experiments were performed at least three times on biologically independent samples. Data were expressed as mean ± standard mean error (SEM), and the statistical significance (P value) of the results was determined by Student's t-test using Microsoft Excel 2010 (version 14.0.7212.5000, Microsoft Corporation, WA, USA, USA). Was calculated (*P<0.05, **P<0.01).

실시예 2. 실험결과Example 2. Experimental results

실시예 2-1. 면역세포화학 분석을 통한 성상세포 분화 유도 확인Example 2-1. Confirmation of induction of astrocyte differentiation through immunocytochemical analysis

GFAP(Glial fibrillary acidic protein)는 성상교세포의 중간미세섬유단백으로 성상세포 분화 표지자로 이용되고 있다. 이에, 성상세포 분화 마커인 GFAP 및 신경 분화 마커인 TuJ1(βIII tubulin)의 발현을 확인하였다.GFAP (Glial fibrillary acidic protein) is an intermediate microfibrous protein of astrocytes and is used as a marker for differentiation of astrocytes. Thus, the expression of GFAP, a marker for astrocyte differentiation, and TuJ1 (βIII tubulin), a marker for neuronal differentiation were confirmed.

도 2에 나타난 바와 같이, DMSO, 플라본, 및 화합물 1을 처리한 신경줄기세포와 비교하여, 화합물 2(3’-메톡시플라본)을 처리한 결과 신경 분화 마커인 TuJ1(βIII tubulin)의 발현은 감소하면서, 성상세포의 분화 마커인 GFAP의 발현이 증가함을 확인하였다.As shown in Figure 2, compared to the neural stem cells treated with DMSO, flavone, and Compound 1, the expression of TuJ1 (βIII tubulin), a neuronal differentiation marker, decreased as a result of treatment with Compound 2 (3'-methoxyflavone). While, it was confirmed that the expression of GFAP, a marker for differentiation of astrocytes, was increased.

또한, 도 3에 나타난 바와 같이, 플라본, 또는 화합물 1 (2'- 아미노플라본)을 처리한 경우와 비교하여, 화합물 2 (3'- 메톡시플라본)을 처리한 경우, TuJ1-양성 세포 비율은 감소하고, GFAP-양성 세포의 비율은 유의하게 증가함을 확인하였다.In addition, as shown in FIG. 3, compared to the case where flavone or compound 1 (2'-aminoflavone) was treated, when compound 2 (3'-methoxyflavone) was treated, the TuJ1-positive cell ratio was Decreased, and the proportion of GFAP-positive cells increased significantly.

실시예 2-2. RT-PCR을 통한 성상세포 특이적 마커 발현 확인Example 2-2. Confirmation of astrocyte-specific marker expression through RT-PCR

도 4에 나타난 바와 같이, 플라본, 또는 화합물 1 (2'- 아미노플라본)을 처리한 경우와 비교하여, 화합물 2 (3'- 메톡시플라본)를 처리한 경우, 상대적인 βIII 튜불린 존재비는 유의하게 감소하고, GFAP 존재비는 유의하게 증가함을 확인하였다.As shown in Figure 4, compared to the case of flavone or compound 1 (2'-aminoflavone) treatment, when compound 2 (3'-methoxyflavone) was treated, the relative abundance of βIII tubulin was significantly It was confirmed that it decreased, and the abundance of GFAP increased significantly.

실시예 2-3. 웨스턴 블롯을 통한 성상세포 특이적 마커 발현 확인Example 2-3. Confirmation of astrocyte-specific marker expression through Western blot

도 5에 나타난 바와 같이, 플라본, 또는 화합물 1 (2'- 아미노플라본)을 처리한 경우와 비교하여, 화합물 2 (3'- 메톡시플라본)를 처리한 경우, 세포 용해물의 TuJ1 발현은 감소하지만, GFAP의 발현은 증가함을 확인하였으며, ERK1/2의 인산화에는 영향이 없음을 확인하였다.As shown in Figure 5, compared to the case of treatment with flavone or Compound 1 (2'-aminoflavone), when treated with Compound 2 (3'-methoxyflavone), the expression of TuJ1 in cell lysates decreased. However, it was confirmed that the expression of GFAP was increased, and it was confirmed that there was no effect on phosphorylation of ERK1/2.

상기 결과들로부터, 3’-메톡시플라본이 신경줄기세포를 성상세포로 분화시킬 수 있음을 확인하였는 바, 성상세포 유도용 조성물로 유용하게 사용할 수 있을 것으로 기대된다.From the above results, it was confirmed that 3'-methoxyflavone can differentiate neural stem cells into astrocytes, and it is expected to be useful as a composition for inducing astrocytes.

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.The above description of the present invention is for illustrative purposes only, and those of ordinary skill in the art to which the present invention pertains will be able to understand that other specific forms can be easily modified without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative and non-limiting in all respects.

<110> Chung-Ang University Industry-Academy Cooperation Foundation SNU R & DB FOUNDATION <120> Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising 3-methoxyflavone as Active Ingredient <130> MP19-266 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta III-tubulin forward primer <400> 1 agccctctac gacatctgct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta III-tubulin reverse primer <400> 2 attgagctga ccagggaatc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gfap forward primer <400> 3 agcggctctg agagagattc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gfap reverse primer <400> 4 agcaacgtct gtgaggtctg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mek1 forward primer <400> 5 tgcccagtgg agtattcagt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mek1 reverse primer <400> 6 aagtctacct cctcggcatc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mek2 forward primer <400> 7 cctccaacat tctggtgaac 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mek2 reverse primer <400> 8 agcgtgtccc tacaaatgag 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GADPH forward primer <400> 9 agttcaacgg cacagtcaag 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GADPH reverse primer <400> 10 gtggtgaaga cgccagtaga 20 <110> Chung-Ang University Industry-Academy Cooperation Foundation SNU R & DB FOUNDATION <120> Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising 3-methoxyflavone as Active Ingredient <130> MP19-266 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta III-tubulin forward primer <400> 1 agccctctac gacatctgct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta III-tubulin reverse primer <400> 2 attgagctga ccagggaatc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gfap forward primer <400> 3 agcggctctg agagagattc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gfap reverse primer <400> 4 agcaacgtct gtgaggtctg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mek1 forward primer <400> 5 tgcccagtgg agtattcagt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mek1 reverse primer <400> 6 aagtctacct cctcggcatc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mek2 forward primer <400> 7 cctccaacat tctggtgaac 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mek2 reverse primer <400> 8 agcgtgtccc tacaaatgag 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GADPH forward primer <400> 9 agttcaacgg cacagtcaag 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GADPH reverse primer <400> 10 gtggtgaaga cgccagtaga 20

Claims (11)

3’-메톡시플라본을 유효성분으로 포함하는 줄기세포의 성상세포로의 분화 유도용 조성물.
A composition for inducing differentiation of stem cells into astrocytes comprising 3'-methoxyflavone as an active ingredient.
 제1항에 있어서,
상기 조성물은 시약 조성물인 것을 특징으로 하는, 조성물.
The method of claim 1,
The composition is characterized in that the reagent composition, composition.
 제1항에 있어서,
상기 줄기세포는 배아 줄기세포, 성체 줄기세포, 배아생식 줄기세포 및 배아종양 줄기세포로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 조성물.
The method of claim 1,
The stem cell is characterized in that at least one selected from the group consisting of embryonic stem cells, adult stem cells, embryonic stem cells, and embryonic tumor stem cells.
 제1항에 있어서,
상기 3’-메톡시플라본은 0.1 내지 100 μM의 농도로 포함되는 것을 특징으로 하는, 조성물.
The method of claim 1,
The 3'-methoxyflavone is characterized in that contained in a concentration of 0.1 to 100 μM, composition.
 제1항에 따른 조성물을 줄기세포와 함께 생체 외에서 배양하는 단계를 포함하는, 줄기세포를 성상세포로 생체 외에서 분화시키는 방법.
A method for differentiating stem cells into astrocytes in vitro, comprising the step of culturing the composition according to claim 1 together with stem cells in vitro.
 제5항에 있어서, 상기 성상세포는 GFAP(Glial fibrillary acidic protein)를 발현하는 것을 특징으로 하는, 방법.
The method of claim 5, wherein the astrocytes express GFAP (Glial fibrillary acidic protein).
 3’-메톡시플라본을 유효성분으로 포함하는, 줄기세포의 성상세포로의 분화 유도용 키트.
A kit for inducing differentiation of stem cells into astrocytes, comprising 3'-methoxyflavone as an active ingredient.
 3’-메톡시플라본을 유효성분으로 포함하는, 신경퇴행성 질환 예방 또는 치료용 약학적 조성물.
A pharmaceutical composition for preventing or treating neurodegenerative diseases, comprising 3'-methoxyflavone as an active ingredient.
 제8항에 있어서,
상기 신경퇴행성 질환은 알츠하이머병, 근육위축 측삭 경화증, 부신백질형성 장애증, 알렉산더병, 알퍼병, 혈관확장성 운동실조증, 배튼병, 소해면양 뇌증 (BSE), 카나반병, 피질기저 퇴화, 크로이츠펠트-야콥병, 루이체들을 가진 치매, 치명적 가족성 불면증, 전두 측두엽 퇴화, 헌팅턴병, 케네디병, 크랩병, 라임병, 마카도-요세프병, 다발성 경화증, 다발성 전신 위축증, 신경 유극적혈구증, 니만-피크병, 파킨슨병, 피크병, 일차 측삭 경화증, 진행성 핵상 마비, 레프섬병, 샌드호프병, 확산성 미엘린분해 경화증, 척수소뇌성 실조증, 척수의 아급성 조합된 퇴화, 척수 매독, 테이-삭스병, 독성 뇌증, 전파가능한 해면양 뇌증, 및 불안정 헤지호그 증후군으로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 약학적 조성물.
The method of claim 8,
The neurodegenerative diseases are Alzheimer's disease, muscular atrophy lateral sclerosis, adrenal leukoplastic disorder, Alexander's disease, Alper's disease, vasodilatory ataxia, Baton's disease, bovine spongiform encephalopathy (BSE), Canaban disease, cortical base degeneration, Creutzfeldt. -Jakob's disease, dementia with Lewy bodies, fatal familial insomnia, frontal temporal lobe degeneration, Huntington's disease, Kennedy's disease, Crab's disease, Lyme disease, Macado-Josef disease, multiple sclerosis, multiple systemic atrophy, neurotrophic cytosis, Niemann-Peak Disease, Parkinson's disease, Peak's disease, primary lateral sclerosis, progressive nuclear paralysis, Levsum's disease, Sandhof's disease, diffuse myelinlytic sclerosis, spinal cerebellar ataxia, subacute combined degeneration of the spinal cord, spinal cord syphilis, Tay-Sachs disease, Toxic encephalopathy, transmissible spongiform encephalopathy, and unstable Hedgehog syndrome, characterized in that at least one selected from the group consisting of.
 삭제delete 삭제delete
KR1020200019414A 2020-02-18 2020-02-18 Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising 3’-methoxyflavone as Active Ingredient KR102255066B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020200019414A KR102255066B1 (en) 2020-02-18 2020-02-18 Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising 3’-methoxyflavone as Active Ingredient

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200019414A KR102255066B1 (en) 2020-02-18 2020-02-18 Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising 3’-methoxyflavone as Active Ingredient

Publications (1)

Publication Number Publication Date
KR102255066B1 true KR102255066B1 (en) 2021-05-24

Family

ID=76152703

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200019414A KR102255066B1 (en) 2020-02-18 2020-02-18 Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising 3’-methoxyflavone as Active Ingredient

Country Status (1)

Country Link
KR (1) KR102255066B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114181902A (en) * 2021-11-05 2022-03-15 山东大学 Simple and rapid astrocyte differentiation method

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100797909B1 (en) * 2006-09-07 2008-01-24 연세대학교 산학협력단 Composition for inducing differentiation of multi-potent neural stem cells and method for inducing differentiation using the same
US20100028931A1 (en) * 2008-04-15 2010-02-04 President And Fellows Of Harvard College Neurodegenerative diseases and methods of modeling
WO2014104409A1 (en) * 2012-12-28 2014-07-03 Kyoto University Method for inducing astrocytes
KR20140103132A (en) * 2011-12-13 2014-08-25 플린더스 유니버시티 오브 사우스 오스트레일리아 Method of producing multipotent stem cells
KR20170081783A (en) * 2016-01-04 2017-07-13 중앙대학교 산학협력단 Novel benzothiazole derivatives for differentiation of neural stem cells and use thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100797909B1 (en) * 2006-09-07 2008-01-24 연세대학교 산학협력단 Composition for inducing differentiation of multi-potent neural stem cells and method for inducing differentiation using the same
US20100028931A1 (en) * 2008-04-15 2010-02-04 President And Fellows Of Harvard College Neurodegenerative diseases and methods of modeling
KR20140103132A (en) * 2011-12-13 2014-08-25 플린더스 유니버시티 오브 사우스 오스트레일리아 Method of producing multipotent stem cells
WO2014104409A1 (en) * 2012-12-28 2014-07-03 Kyoto University Method for inducing astrocytes
KR20170081783A (en) * 2016-01-04 2017-07-13 중앙대학교 산학협력단 Novel benzothiazole derivatives for differentiation of neural stem cells and use thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Yin L, Hu Q (2014). "CYP17 inhibitors-abiraterone, C17,20-lyase inhibitors and multi-targeting agents". Nat Rev Urol. 11 (1): 32-42.

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114181902A (en) * 2021-11-05 2022-03-15 山东大学 Simple and rapid astrocyte differentiation method
CN114181902B (en) * 2021-11-05 2023-10-24 山东大学 Simple, convenient and rapid astrocyte differentiation method

Similar Documents

Publication Publication Date Title
US7470798B2 (en) 7,8-bicycloalkyl-chroman derivatives
KR102448455B1 (en) Compositions of Selenoorganic Compounds and Methods of Use Thereof
Yan et al. Osthole promotes endogenous neural stem cell proliferation and improved neurological function through Notch signaling pathway in mice acute mechanical brain injury
KR102255066B1 (en) Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising 3’-methoxyflavone as Active Ingredient
Huang et al. Hericium erinaceus mycelium and its small bioactive compounds promote oligodendrocyte maturation with an increase in myelin basic protein
KR20200004208A (en) Pharmaceutical composition for preventing or treating the dementia comprising human neural crest derived stem cells and screening method thereof
US20100004244A1 (en) Use of cb2 receptor agonists for promoting neurogenesis
KR20230148138A (en) Pharmaceutical composition for preventing or treating Cranial nerve diseases
US20220119765A1 (en) Differentiation method of neural stem cells manufactured by direct cell conversion into astrocytes
Petrovic et al. Prodromal local sleep disorders in a rat model of Parkinson’s disease cholinopathy, hemiparkinsonism and hemiparkinsonism with cholinopathy
TWI659017B (en) Use of indolyl and indolinyl hydroxamates for treating neurodegenerative disorders or cognitive deficits
WO2022181920A1 (en) Pharmaceutical composition for treatment of neuroinflammation, comprising eleutheroside b as active ingredient
US20230364153A1 (en) Method for direct reprogramming from somatic cells into pancreatic beta cells by using microrna, and differentiation composition
EP3628315A1 (en) Combination of acetylcholinesterase inhibitor and 5-ht4 receptor agonist as neuroprotective agent in the treatment of neurodegenerative diseases
US20080153886A1 (en) Use Of Heterocyclic Compounds As Neurogenic Agents
KR102551880B1 (en) Composition for promoting the formation of neurosphere comprising Corticotropin-releasing hormone as an active ingredient
KR20100036052A (en) Composition for the treatment and/or prevention of parkinson&#39;s disease and neurological brain disease by using other compounds from laurus nobilis leaves extracts
KR20210066150A (en) Composition for Inducing Differentiation of Stem Cells into Astrocytes Comprising Galeteron as Active Ingredient
TWI837513B (en) Use of gastrodin for prevention or treatment of amyotrophic lateral sclerosis
RU2814327C1 (en) Use of sulphate salts of n-(3-(4-(3-(diisobutylamino)propyl)piperazin-1-yl)propyl)-1n-benzo[d]imidazol-2-amine and their solvates for treatment of motor neuron diseases and neuromuscular diseases
WO2021194256A1 (en) Pharmaceutical composition for preventing or treating retinitis pigmentosa, comprising mesenchymal stem cells derived from human embryonic stem cells
WO2017069376A1 (en) Composition for treating inflammatory diseases, containing ikkε inhibitor
US11963969B2 (en) Method for prevention or treatment of amyotrophic lateral sclerosis by administering gastrodin
KR20170089809A (en) composition for inducing differentiation of multi-potent neural stem cell into dopaminergic meurons and method for inducing differentiation using the same
KR101833412B1 (en) composition for inducing differentiation of multi-potent neural stem cell into dopaminergic meurons and method for inducing differentiation using the same

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant