KR102246864B1 - Recombinant Microorganism Having Enhanced Menaquinone-7 Producing Ability and Method for Preparing Menaquinone-7 Using the Same - Google Patents

Abstract

The present invention relates to a menaquinone-7 highly productive recombinant microorganism and a method for producing menaquinone-7 using the same, and the recombinant microorganism according to the present invention only has high productivity of menaquinone-7 through reconstruction of the menaquinone synthesis pathway. In addition, it is easy to cultivate high-concentration fermentation with an inexpensive medium component, and thus can be usefully used in economic and commercial production.

Description

Menaquinone-7 Highly Productive Recombinant Microorganism and Method for Producing Menaquinone-7 Using the Same {Recombinant Microorganism Having Enhanced Menaquinone-7 Producing Ability and Method for Preparing Menaquinone-7 Using the Same}

The present invention relates to a menaquinone-7 highly productive recombinant microorganism and a method for producing menaquinone-7 using the same, and in more detail, 1,4-dihydroxy-2-naphthoate , DHNA) biosynthetic pathway and farnesyl pyrophosphate (farnesyl pyrophosphate (FPP) biosynthetic pathway in a microorganism that inherently has, (i) farnesyl pyrophosphate (FPP) to heptaprenyl pyrophosphate (heptaprenyl pyrophosphate, HPP) conversion A gene encoding an enzyme that does And (ii) a recombinant microorganism having the ability to produce menaquinone-7 into which a gene encoding an enzyme that converts dimethylmenaquinol (DMM) to metaquinol-7 (M-7) has been introduced, and using the same It relates to a method for producing menaquinone-7.

Vitamin K is a type of fat-soluble vitamin that has a naphthoquinone ring as a core structure of the head group.It plays an important role in blood coagulation and bone strengthening in the body.If it is deficient, the blood clotting mechanism is impaired or bleeding. It is known to be unable to control and weaken the strength of bones such as osteoporosis and cause calcium deposition in arteries or soft tissues. Among the natural world, it is in the form of vitamin K1 (phylloquinone) in plants, and in the form of vitamin K2 (menaquinone) in microorganisms and animals, and vitamin K2 is known to have the highest physiological activity.

In terms of chemical structure, menaquinone is a type of isoprenoid quinine in which an isoprene tail group is bound to a naphthoquinone head group, and isoprenoid quinone is present as a component of the cell membrane of almost all living organisms. It plays an important role in electron transport, oxidative phosphorylation, and active transport (Fujimoto N. et al ., Chemical Biology, pp 187-208, 2012). Another representative isoprenoid quinone is ubiquinone, known as Coenzyme Q, and is a form in which an isoprene tail group is bound to a benzoquinone head group. These isoprenoid quinones exist in various forms depending on the length of the bound isoprene tail group, in the case of menaquinone, menaquinone-2 (MK-2) to menaquinone-14 (MK-14). ), ubiquinone is known to exist in bacteria from ubiquinone-1 (Q-1) to ubiquinone-11 (Q-11) (Collins MD and Jones D., Microbiol). Rev., 45:316-354, 1981).

In the case of menaquinone, absorption, persistence, and activity in the body may vary depending on the length of the isoprene tail group. Menaquinone-4 (MK-4) and menaquinone are commercially produced for the purpose of controlling bone calcium and preventing osteoporosis. Among 7 (MK-7), menaquinone-7 has a higher absorption rate in the body than menaquinone-4 and has a longer duration, so it is known that its efficacy is high even when ingested in small amounts (WO2014/058330). Currently, menaquinone-7 is produced by a microbial fermentation method and a chemical synthesis method, and in the case of chemical synthesis products, trans and cis forms coexist in the isoprene tail group, whereas in the case of microbial fermentation production. It is produced in an all-trans form without isomers. It is known that the structural difference of these tail groups affects the absorption rate and activity of menaquinone-7 in vivo, and a single trans form produced by microbial fermentation exhibits higher biological activity.

On the other hand, various types of microorganisms are known to produce menaquinone and ubiquinone as electron transport materials in the respiratory chain.Archaebacteria, Gram positive bacteria, and anaerobic Gram negative bacteria Menaquinone is mainly present in, and ubiquinone is mainly present in aerobic gram negative bacteria. In addition, menaquinone and ubiquinone are known to co-exist in gram negative bacteria (Collins MD and Jones D., Microbiol. Rev., 45:316-354, 1981). Menaquinone-producing microorganisms have a pathway for synthesizing DHNA (1,4-dihydroxy-2-naphthoate), a head group in common, and a pathway for synthesizing isoprene tail groups of various lengths (FIG. 1). For example, a microorganism having a pathway for synthesizing HPP (heptaprenyl pyrophosphate) tail group in which seven isoprene units are repeated produces menaquinone-7 (MK-7), and synthesizes an OPP (octaprenyl pyrophosphate) tail group in which eight isoprene units are repeated. Microorganisms with the pathway produce menaquinone-8 (MK-8). In the case of E. coli , the OPP tail group is bound to the DHNA head group and finally converted to menaquinone-8. The detailed metabolic process is as follows.

DHNA is a precursor of chorismate made from the Shikimate pathway, and menF (isochorismate synthase), menD (2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-) constituting men operon. carboxylate synthase), menH (2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase), menC (o-succinylbenzoate synthase), menE (o-succinylbenzoate CoA ligase) , menB (1,4-dihydroxy -2-naphthoyl-CoA synthase) enzymes convert to DHN-CoA (1,4-dihydroxy-2-naphthoyl-CoA), which is converted by menI (1,4-dihydroxy-2-naphthoyl-CoA hydrolase). Converted to DHNA. OPP uses isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) made through glycolysis and 2-C-Methyl-D-erythritol-4-phosphate (MEP) pathways as starting materials, and ispA ((geranyl diphosphate/ Farnesyl diphosphate synthase) is polymerized through GPP (geranyl pyrophosphate) to FPP (farnesyl pyrophosphate) and ispB (octaprenyl-diphosphate synthase) to synthesize OPP. IPP and DMAPP are the biosynthesis of all terpenoid compounds. As a starting precursor, it is synthesized through the MEP pathway or the mevalonate (MVA) pathway. Most eukaryotes including humans and some bacteria have the MVA pathway, and most bacteria including prokaryotes and E. coli have the MEP pathway. The MEP pathway present in E. coli starts with G3P (D-glyceraldehyde-3-phosphate) and pyruvate made through glycolysis, and starts with dxs (1-deoxy-D-xylulose-5-phosphate synthase) and dxr. (deoxyxylulose-5-phosphate reductoisomerase) to make MEP, then ispD (2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase), ispE (4-diphosphocytidyl-2-C-methyl-D-erythritol kinase), ispF (2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase), ispG ((E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase), ispH (4-hydroxy-3-methylbut - 2-en-1-yl diphosphate reductase) makes IPP and DMAPP, which are mutually converted by idi (isopentenyl-diphosphate Delta-isomerase). The synthesized OPP and DHNA are polymerized by menA (1,4-dihydroxy-2-naphthoate polyprenyltransferase) to form DMM-8 (demethylmenaquinol-8), ubiE (demethylmenaquinone methyltransferase) and wrbA/qorB (NAD(P)H). dehydrogenase) is finally converted to menaquinol-8 through M-8.

Among the various microorganisms, a representative strain that produces menaquinone-7 is Bacillus sp., including Bacillus subtilis , and has been the most researched so far, and is currently used for commercial production, In particular, in the case of Bacillus subtilis, it is known that the menaquinone-7 content accounts for 90 to 96% of the total menaquinone production (Korean Patent Registration No. 10-1196338). However, fermentation of microorganisms in Bacillus for commercial production of menaquinone-7 requires high fermentation productivity to comply with the specifications of the final product.To this end, expensive organic nitrogen sources (soytone, yeast extract, etc.) are used as a fermentation medium component. There is a problem in that the economic efficiency of the entire production process is low and the post-fermentation process is difficult, such as using at a high concentration and requiring fermentation culture for a long time, usually 5 days or longer. In addition, in the case of soybean meal, which is used as a complex nutrient component to secure production economy and high productivity, complete sterilization is difficult, so contamination by environmental microorganisms frequently occurs during long-term fermentation and culture. Due to its nature, it is difficult to control the fermentation culture, so that the reproducibility of results is low.

Accordingly, the present inventors have made diligent efforts to develop a method for producing menaquinone-7 at high concentration using microorganisms. As a result, when cultivating a recombinant microorganism into which specific enzyme genes of the menaquinone-7 synthesis metabolic pathway are introduced, inexpensive It was confirmed that menaquinone-7 can be produced at a high concentration even through fermentation culture for a short time in a minimum medium condition, and the present invention was completed.

An object of the present invention is to provide a recombinant microorganism capable of producing menaquinone-7 at a high concentration without adding a complex nutrient component at a high concentration.

Another object of the present invention is to provide a method for producing menaquinone-7 using the recombinant microorganism.

In order to achieve the above object, the present invention is a 1,4-dihydroxy-2-naphthoate (1,4-dihydroxy-2-naphthoate, DHNA) biosynthetic pathway and farnesyl pyrophosphate (farnesyl pyrophosphate, FPP) biosynthetic pathway In microorganisms that have inherently,

(i) a gene encoding an enzyme that converts farnesyl pyrophosphate to heptaprenyl pyrophosphate (HPP);

(ii) a gene encoding 1,4-dihydroxy-2-naphthoate heptaprenyltransferase;

(iii) a gene encoding dimethylmenaquinone methyltransferase; And

(iv) Provides a recombinant microorganism having the ability to produce menaquinone-7 into which a gene encoding NAD(P)H dehydrogenase is introduced.

The present invention also includes the steps of: (a) culturing the recombinant microorganism to produce menaquinone-7; And (b) obtaining the produced menaquinone-7.

The recombinant microorganism according to the present invention not only has high productivity of menaquinone-7 through the reconstruction of the menaquinone synthesis pathway, but also has high concentration fermentation culture with a low-cost medium component, and thus can be usefully used in economic and commercial production.

1 schematically shows an intrinsic pathway and an artificially introduced foreign pathway of a recombinant microorganism required for menaquinone-7 biosynthesis, where a solid line represents an intrinsic pathway, and a solid line represents a pathway introduced from the outside.
2 is a schematic diagram of a recombinant expression plasmid containing genes artificially introduced for menaquinone-7 biosynthesis.
3 shows the results of HPLC analysis of menaquinone-7 produced when menaquinone-7 highly productive recombinant E. coli were flask cultured.
Figure 4 shows the results of fed-batch fermentation of menaquinone-7 highly productive recombinant E. coli (T2S-DH5α).

In the present invention, in a microorganism having a DHNA (1,4-dihydroxy-2-naphthoate) head group synthesis pathway and a farnesyl pyrophosphate (FPP) biosynthetic pathway of menaquinone-7, HPP (heptaprenyl) in which 7 isoprene units are repeated. pyrophosphate) In the case of producing a high-productive recombinant microorganism containing enzyme genes capable of producing an excessive amount of tail group and enzyme genes that convert DHNA and HPP into menaquinone-7, and culturing the recombinant microorganism, mena It was confirmed that quinone-7 can be produced at a high concentration.

Therefore, the present invention, in one aspect, 1,4-dihydroxy-2-naphthoate (1,4-dihydroxy-2-naphthoate, DHNA) biosynthetic pathway and farnesyl pyrophosphate (farnesyl pyrophosphate, FPP) biosynthetic pathway In the internally possessed microorganism, (i) a gene encoding an enzyme that converts farnesyl pyrophosphate (FPP) to heptaprenyl pyrophosphate (HPP); And (ii) dimethylmetaquinol (demethylmenaquinol, DMM) to metaquinol-7 (menaquinol-7, M-7) to a gene encoding an enzyme is introduced to a recombinant microorganism having the ability to produce menaquinone-7 has been introduced. .

In the present invention, the microorganism is an enzyme capable of synthesizing dimethylmetaquinol (DMM) from 1,4-dihydroxy-2-naphtholate (DHNA) and heptaprenyl pyrophosphate (HPP) and metaquinol-7 It may be characterized by an enzyme that converts (menaquinol-7, M-7) to menaquinone-7 (MK-7).

In the present invention, the enzyme that converts farnesyl pyrophosphate (FPP) to heptaprenyl pyrophosphate (HPP) is heptaprenyl diphosphate synthase component I (heptaprenyl diphosphate synthase component I) and heptaprenyl It may be characterized in that it is a diphosphate synthase component II (heptaprenyl diphosphate synthase component II), and the gene encoding the enzyme that converts the farnesyl pyrophosphate (FPP) to heptaprenyl pyrophosphate (HPP) is hepS and It may be characterized in that it is hepT.

In the present invention, the enzyme that converts dimethylmetaquinol (DMM) to metaquinol-7 (M-7) may be characterized in that it is dimethylmenaquinone methyltransferase. .

The recombinant microorganism of the present invention further contains a gene encoding an enzyme capable of synthesizing dimethylmetaquinol (DMM) from 1,4-dihydroxy-2-naphtholate (DHNA) and heptaprenyl pyrophosphate (HPP). It can be characterized by being introduced.

In the present invention, the enzyme capable of synthesizing dimethylmetaquinol (DMM) from 1,4-dihydroxy-2-naphtholate (DHNA) and heptaprenyl pyrophosphate (HPP) is 1,4-dihydro It may be characterized in that it is hydroxy-2-naphthoate heptaprenyltransferase (1,4-dihydroxy-2-naphthoate heptaprenyltransferase), and the 1,4-dihydroxy-2-naphthoate heptaprenyltransfer Raise (1,4-dihydroxy-2-naphthoate heptaprenyltransferase) may be characterized in that the gene encoding menA.

The recombinant microorganism of the present invention is characterized in that a gene encoding an enzyme that converts menaquinol-7 (M-7) to menaquinone-7 (MK-7) is additionally introduced. can do.

In the present invention, the enzyme that converts the metaquinol-7 (menaquinol-7, M-7) to menaquinone-7 (MK-7) is NAD(P)H dehydrogenase (NAD ( P)H dehydrogenase), and the gene encoding the NAD(P)H dehydrogenase may be yhcB.

In the recombinant microorganism of the invention, a gene encoding an enzyme involved in the mevalonate (MVA) synthesis pathway may be additionally introduced, and the enzyme involved in the mevalonate (MVA) synthesis pathway is hydroxymethylglutaryl-CoA. It may be characterized by being selected from the group consisting of reductase, hydroxymethylglutaryl-CoA synthase, mevalonate kinase, phosphomevalonate kinase, and diphosphomevalonate decarboxylase.

In the present invention, the gene encoding the enzyme involved in the mevalonate (MVA) synthesis pathway may be selected from the group consisting of mvaE, mvaK1 , mvaK2 and mvaD.

In the recombinant microorganism of the present invention, a gene encoding an enzyme isopentenyl-diphosphate delta-isomerase, an enzyme that catalyzes the mutual conversion between isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). It may be characterized in that it is additionally introduced, and the gene encoding the group isopentenyl-diphosphate Delta-isomerase enzyme may be characterized in that it is idi.

In one embodiment of the present invention, fed-batch fermentation culture was performed on the recombinant E. coli to confirm the productivity of menaquinone-7 at a level of 132 mg/L in 60 hours of culture.

Accordingly, in another aspect, the present invention comprises the steps of: (a) culturing the recombinant microorganism to produce menaquinone-7; And (b) obtaining the produced menaquinone-7.

Menaquinone-7 Preparation of Recombinant Microorganisms with High Productivity

As shown in Figure 1, the recombinant microorganism having high productivity of menaquinone-7 of the present invention is a DHNA (1,4-dihydroxy-2-naphthoate) head group synthesis pathway and FPP (farnesyl pyrophosphate, FPP) of menaquinone-7. In a microorganism having a biosynthetic pathway, enzyme genes that can over-produce the HPP tail group of 7 repeats of the isoprene unit and enzyme genes that convert DHNA and HPP to menaquinone-7 were introduced. As described above, the HPP tail group is formed through a series of polymerization pathways using IPP and its structural isomer, DMAPP monomer, as a precursor.

Preferably, the recombinant microorganism of the present invention inherently has an FPP synthesis pathway including a DHNA synthesis pathway and an MEP pathway, and four molecules of IPP are sequentially polymerized in one molecule of FPP to synthesize HPP genes, that is, Genes for enzymes that convert hepS (heptaprenyl diphosphate synthase component I), hepT (heptaprenyl diphosphate synthase component II) and DMM to metaquinol-7 (M-7) were introduced.

More preferably, the recombinant microorganism of the present invention inherently has an FPP synthesis pathway including a DHNA synthesis pathway and an MEP pathway, and four molecules of IPP are sequentially polymerized in one molecule of FPP to synthesize HPP genes, In other words, hepS (heptaprenyl diphosphate synthase component I), hepT (heptaprenyl diphosphate synthase component II), HPP and DHNA are polymerized to finally convert to menaquinone-7, namely menA (1,4-dihydroxy-2). -naphthoate heptaprenyltransferase), ubiE (demethylmenaquinone methyltransferase) and yhcB (NAD(P)H dehydrogenase) were introduced.

More preferably, the recombinant microorganism of the present invention includes genes related to the MVA pathway for IPP overproduction , namely mvaE (hydroxymethylglutaryl-CoA reductase), mvaS (hydroxymethylglutaryl-CoA synthase), mvaK1 (mevalonate kinase), along with the introduced foreign genes. , mvaK2 (phosphomevalonate kinase) and mvaD (diphosphomevalonate decarboxylase), and genes (idi ) of enzymes that catalyze the mutual conversion between IPP and DMAPP were additionally introduced.

The microorganisms inherently having the DHNA synthesis pathway and the MEP pathway may be wild-type microorganisms or recombinant microorganisms, and may be archaebacteria to bacteria, preferably Halobacterium genus, Escherichia ), Enterobacter, Klebsiella, Serratia, Proteus, Vibrio, Actinobacillus, Pasteurella ), Flavobacterium, Haemophilus, Thermus, Bacteroides, Capnocytophaga, Desulfovibrio, My Myxococcus genus, Cytopaga genus, Chlorobium genus, Chloropseudomonas genus, Rhodopseudomonas genus, Rhodospirillum genus, Bacillus genus , Clostridium genus, Sporolactobacillus genus, Lactobacillus genus, Listeria genus, Caryophanon genus, Micrococcus genus, Staphylococcus ), Planococcus, Streptococcus, Arthrobacter, Brevibacterium, Cellulomonas, Corynebacterium , Microbacterium, Mycobacterium, Nocardia, Rhodococcus, Actinomy It may be a bacteria of the genus Actinomyces, a genus Proprionibacterium, a genus Streptomyces, and more preferably Escherichia coli , Halobacterium cutirubrum, Halobacterium halobium, Halobacterium saccharovorum, Halobacterium salinarium, Halobacterium volcanii, Halobacterium trapanicum, Enterobacter aerogenes, Enterobacter agglomerans, Enterbacter liquefaciens, Erwinia amylovora, Erwinia carotovora, Kiebsiella aerogenes, Proteus mirabilis, Proteus mirabilis, Proteus vulgaris, Serratia succinos, Protelus vulgaris, Aerobics succins, Viscens, Enterobacter aerogenes, Enterobacter agglomerans, Enterobacter liquefaciens Actinobacillus actinomycetencomitans, Actinobacillus equuli, Actinobacillus lignieresii, Actinobacillus seminis, Flavobacterium arborescens, Flavobacterium breve, Flavobacterium esteraromaticum, Flavobacterium flavescens, Flavobacterium heparinocum, Flavobacterium flavescentum, Flavophilum, Flavophilum, Flavobacterium havor, ilus, Haemophilus parainfluenzae, Haemophilus paragallinarum, Haemophilus aegyptius, Haemophilus influenzae, Haemophilus parahaemolyticus, Haemophilus paraphrophilus, Haemophilus paraphrohaemolyticus, Pasteurella gallinacum, Pasteurella pneumoniae, Pasteurella gallinacum, Pasteurella pneumoniae, Pasteurella pneumoniae, Pasteurella pesteurella, Pasteurella aquatica, Pasteurella neutron Thermus thermophilus, Bacteroides asaccharolyticus, Bacteroides distasonis , Bacteroides eggerthii, Bacteroides fragilis, Bacteroides melaninogenicus, Bacteroides oralis, Bacteroides ruminicola, Bacteroides vulgatus, Capnocytophaga gingivalis, Capnocytophaga ochracea, Desulfovibrio desulfuricans, Desulfovibrio gigas, Desulfovibrio vulgaris, Myxococcus fulvus, Cytophaga aurantiaca, Cytophaga fermentans , Cytophaga hutchinsonii, Chromatium vinosum, Rhodopseudomonas capsulata, Rhodopseudomonas gelatinosa, Rhodopseudomonas viridis, Rhodospirillum fulvum, Rhodospirillum molischianum, Rhodospiril lum rubrum, Caryophanon latum, Caryophanon tenue, Lactobacillus casei, Listeria denitrificans, Micrococcus agilis, Micrococcus halobius, Micrococcus luteus, Micrococcus radiodurans, Planococcus citreus, Staphylococcus aureus, Peptococcus, Staphylococcus aureus, Peptostreptococcus fanus, Streptoccus, Artoccus, Streptoccus fanus, Lactobacillus casei, Strococcus fanus, , Arthrobacter aurescens, Arthrobacter citreus, Arthrobacter crystallopoietes, Arthrobacter globiformis, Arthrobacter oxydans, Arthrobacter polychromogenes, Arthrobacter ramosus, Arthrobacter simplex, Arthrobacter tumescens, Arthrobacter ureafaciens, Brevibacterium fermentans, Breviiumbacter Breviium bacterium lactofermentum, Brevibacterium saccharolyticum, Cellulomonas cartalyticum, Celulomonas fimi, Cellulomonas flavigena, Corynebacterium aquaticum, Corynebacterium insidiosum, Corynebacterium mediolanum, Corynebact erium manihot, Corynebacterium mediolanum, Corynebacterium michiganense, Corynebacterium bovis, Corynebacterium fascians, Corynebacterium flavidum, Corynebacterium glutamicum, Corynebacterium hydrocarboclastus, Corynebacterium renale, Mycobacterium vaccinogenes, Mycobacterium vacscinogenes, Mycobacterium vacsacin, Mycobacterium vaccinogenes, Mycobacterium vacsacinogenes, Mycobacterium vacs, Mycobacterium, Mycobacterium for, , Nocardia rubra, Nocardia erythropolis, Nocardia rugosa, Actinomyces bovis, Actinomyces israelii, Actinomyces viscosus, Propionibacterium acnes, Propionibacterium arabinosum, Streptomyces albus, Streptomyces gardolineri, Streptomyces griseus, Streptomyces malisis, Streptomyces malisis, Streptomyces malisis, etc.

Foreign enzyme gene group required for the synthesis of menaquinone-7

In the recombinant microorganism of the present invention, four molecules of IPP are sequentially polymerized in one molecule of FPP to introduce genes of an enzyme that synthesizes HPP. The genes may be hepS and hepT (Table 1), a gene comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or a gene having 90% or more homology thereto, and the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 A gene encoding a protein having, a gene encoding a protein having an amino acid sequence having 90% or more homology to the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or a protein having an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3; It is a gene that encodes a protein having at least 90% of the same enzyme activity.

gene Enzyme name Derived microorganism Protein sequence/gene sequence hepS heptaprenyl diphosphate synthase component I Bacillus subtilis subsp. natto SEQ ID NO: 1/SEQ ID NO: 2 hepT heptaprenyl diphosphate synthase component II Bacillus subtilis subsp. natto SEQ ID NO: 3/SEQ ID NO: 4

The recombinant microorganism of the present invention is a series of enzyme genes that can be converted to menaquinone-7 by polymerizing HPP and DHNA. The genes may be menA, ubiE, yhcB (Table 2), a gene including the nucleotide sequence of SEQ ID NO: 8, SEQ ID NO: 12, or SEQ ID NO: 14 or a gene having 90% or more homology thereto, SEQ ID NO: 7, sequence A gene encoding a protein having an amino acid sequence of SEQ ID NO: 11 and SEQ ID NO: 13, a gene encoding a protein having an amino acid sequence having 90% or more homology to the amino acid sequence of SEQ ID NO: 7, SEQ ID NO: 11, or SEQ ID NO: 13; or It is a gene encoding a protein having an amino acid sequence of SEQ ID NO: 7, SEQ ID NO: 11, and SEQ ID NO: 13 and a protein having at least 90% identical enzyme activity.

gene Enzyme name Derived microorganism Protein sequence/gene sequence menA 1,4-dihydroxy-2-naphthoate heptaprenyltransferase Bacillus subtilis subsp. natto SEQ ID NO: 7/SEQ ID NO: 8 ubiE demethylmenaquinone methyltransferase Bacillus subtilis subsp. natto SEQ ID NO: 11/SEQ ID NO: 12 yhcB NAD(P)H dehydrogenase Bacillus subtilis subsp. natto SEQ ID NO: 13/SEQ ID NO: 14

In the recombinant microorganism of the present invention, for the overproduction of IPP, a precursor of HPP, genes related to the foreign MVA pathway and genes of enzymes that catalyze the mutual conversion between IPP and DMAPP are additionally introduced.

The gene may be mvaE, mvaS, mvaK1, mvaK2, mvaD, idi (Table 3), and includes the nucleotide sequence of SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, and SEQ ID NO: 34 A gene or a gene having 90% or more homology thereto, a gene encoding a protein having an amino acid sequence of SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, and SEQ ID NO: 33, the SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, a gene encoding a protein having an amino acid sequence having 90% or more homology with the amino acid sequence of SEQ ID NO: 33 or SEQ ID NO: 17, SEQ ID NO: 21, It is a gene encoding a protein having an amino acid sequence of SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, and SEQ ID NO: 33 and a protein having the same enzyme activity of 90% or more.

gene Enzyme name Derived microorganism Protein sequence/gene sequence mvaE hydroxymethylglutaryl-CoA reductase Enterococcus faecalis SEQ ID NO: 17/SEQ ID NO: 18 mvaS hydroxymethylglutaryl-CoA synthase Enterococcus faecalis SEQ ID NO: 21 / SEQ ID NO: 22 mvaK1 mevalonate kinase Streptococcus pneumoniae SEQ ID NO: 25/SEQ ID NO: 26 mvaK2 phosphomevalonate kinase Streptococcus pneumoniae SEQ ID NO: 27/SEQ ID NO: 28 mvaD diphosphomevalonate decarboxylase Streptococcus pneumoniae SEQ ID NO: 29/ SEQ ID NO: 30 idi isopentenyl-diphosphate Delta-isomerase Escherichia coli SEQ ID NO: 33/SEQ ID NO: 34

The introduction of the genes may be in any form in which gene expression is possible, for example, in the form of a plasmid, replacement with a specific gene on a target microorganism genome, or insertion into a specific location.

The term “vector” refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host. The vector can be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are currently the most commonly used form of vectors, in the specification of the present invention “plasmid” and “vector” are sometimes used interchangeably. However, the present invention includes other forms of vectors that have functions equivalent to those known or become known in the art. Typical expression vectors for expression in mammalian cell cultures are based on, for example, pRK5 (EP 307,247), pSV16B (WO 91/08291) and pVL1392 (Pharmingen).

The expression “expression control sequence” means a DNA sequence essential for the expression of a coding sequence operably linked in a particular host organism. Such regulatory sequences include promoters to effect transcription, any operator sequences to regulate such transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences that regulate termination of transcription and translation. For example, regulatory sequences suitable for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells include promoters, polyadenylation signals and enhancers. The factor that most affects the amount of gene expression in the plasmid is the promoter. As a promoter for high expression, an SRα promoter and a cytomegalovirus-derived promoter are preferably used.

In order to express the DNA sequence of the present invention, any of a wide variety of expression control sequences can be used in the vector. Examples of useful expression control sequences include, for example, early and late promoters of SV40 or adenovirus, lac system, trp system, TAC or TRC system, T3 and T7 promoters, major operator and promoter regions of phage lambda, fd Regulatory regions of the coding protein, promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, promoters of the phosphatase, for example Pho5, promoters of the yeast alpha-crossing system and prokaryotic or eukaryotic cells or viruses thereof Other sequences of constructs and inductions known to regulate the expression of the genes of A and several combinations thereof are included. T7 RNA polymerase promoter Φ10 is E. It can be usefully used to express a protein in E. coli.

Nucleic acids are “operably linked” when placed in a functional relationship with another nucleic acid sequence. This can be a gene and regulatory sequence(s) linked in a manner that allows gene expression when the appropriate molecule (eg, a transcriptional activating protein) is bound to the regulatory sequence(s). For example, DNA for a pre-sequence or secretory leader is operably linked to the DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; The promoter or enhancer is operably linked to the coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to the coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to the coding sequence when arranged to facilitate translation. In general, "operably linked" means that the linked DNA sequence is in contact, and, in the case of a secretory leader, is contacted and is present in the reading frame. However, the enhancer does not need to be contacted. The ligation of these sequences is carried out by ligation (linkage) at a convenient restriction enzyme site. If such a site does not exist, a synthetic oligonucleotide adapter or linker according to a conventional method is used.

The term "expression vector" as used herein is a recombinant carrier into which a fragment of a heterologous DNA is inserted, and generally refers to a fragment of double-stranded DNA. Here, heterologous DNA refers to heterologous DNA, which is DNA that is not naturally found in host cells. Once in the host cell, the expression vector can replicate independently of the host chromosomal DNA and several copies of the vector and its inserted (heterologous) DNA can be generated.

As is well known in the art, in order to increase the level of expression of a transfected gene in a host cell, the gene must be operably linked to a transcriptional and translational expression control sequence that exerts a function in the selected expression host. Preferably, the expression control sequence and the corresponding gene are included in one expression vector that includes a bacterial selection marker and a replication origin. When the expression host is a eukaryotic cell, the expression vector must further contain an expression marker useful in the eukaryotic expression host.

A wide variety of expression host/vector combinations can be used to express the DNA sequence of the protein of interest of the present invention. Expression vectors suitable for eukaryotic hosts include expression control sequences derived from, for example, SV40, bovine papillomavirus, anenovirus, adeno-associated virus, cytomegalovirus and retrovirus. Expression vectors that can be used in bacterial hosts include bacterial plasmids obtained from E. coli such as pBluescript, pGEX2T, pUC vector, col E1, pCR1, pBR322, pMB9 and derivatives thereof, and a wider host range such as RP4. Plasmids having λgt10 and λgt11, phage DNA, which can be exemplified by a wide variety of phage lambda derivatives such as NM989, and other DNA phages such as M13 and filamentous single-stranded DNA phage. Expression vectors useful for yeast cells are 2μ plasmids and derivatives thereof. A vector useful for insect cells is pVL 941.

Host cells transformed or transfected with the above-described expression vector constitute another aspect of the present invention. As used herein, the term “transformation” means that DNA is introduced into a host so that the DNA becomes replicable as an extrachromosomal factor or by chromosomal integrity completion. As used herein, the term “transfection” means that the expression vector is accepted by the host cell, whether or not any coding sequence is actually expressed.

The host cell of the invention may be a prokaryotic or eukaryotic cell. In addition, a host having a high DNA introduction efficiency and a high expression efficiency of the introduced DNA is usually used. this. Known eukaryotic and prokaryotic hosts such as coli, Pseudomonas, Bacillus, Streptomyces, fungi, yeast, insect cells such as Spodoptera frugiperda (SF9), animal cells such as CHO and mouse cells, COS 1, COS 7, African green monkey cells such as BSC 1, BSC 40 and BMT 10, and tissue cultured human cells are examples of host cells that can be used. When cloning the cDNA encoding the protein of the present invention, it is preferable to use an animal cell as a host. In the present invention, CHSE-214, FHM, RTG-2 and EPC of fish origin have been exemplified, but of course, the present invention is not limited thereto. In the case of using COS cells, since SV40 large T antigen is expressed in COS cells, the plasmid with the replication initiation point of SV40 is supposed to exist as an episome of multiple copies in the cell. Higher expression can be expected. The introduced DNA sequence may be obtained from the same species as the host cell, may be of a different species than the host cell, or it may be a hybrid DNA sequence comprising any heterologous or homologous DNA.

Of course, it should be understood that not all vectors and expression control sequences function equally in expressing the DNA sequence of the present invention. Likewise, not all hosts function equally for the same expression system. However, those skilled in the art can make an appropriate selection among various vectors, expression control sequences and hosts without departing from the scope of the present invention without undue experimental burden. For example, when choosing a vector, you must consider the host, because the vector must be replicated in it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, should also be considered. In selecting the expression control sequence, several factors must be considered. For example, the relative strength of the sequence, controllability and compatibility with the DNA sequence of the present invention, etc., should be considered in particular with regard to possible secondary structures. The single-celled host is the selected vector, the toxicity of the product encoded by the DNA sequence of the present invention, the secretion characteristics, the ability to accurately fold the protein, culture and fermentation requirements, the product encoded by the DNA sequence of the present invention from the host. It should be selected in consideration of factors such as ease of purification. Within the range of these variables, one skilled in the art can select various vector/expression control sequence/host combinations capable of expressing the DNA sequence of the present invention in fermentation or large-scale animal culture. As a screening method for cloning protein cDNA by expression cloning, a binding method, a panning method, a film emulsion method, or the like can be applied.

Hereinafter, the present invention will be described in more detail through examples. These examples are

It will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples, as only to illustrate the present invention.

Example 1: Preparation of menaquinone-7 highly productive recombinant E. coli

In this example, genes encoding enzymes involved in the menaquinone-7 synthesis pathway and enzymes involved in the MVA pathway for increasing the productivity of the precursor IPP were used in E. coli that inherently have the above-described DHNA synthesis pathway and MEP pathway. The coding genes were introduced in the form of plasmids to produce menaquinone-7 highly efficient biosynthetic recombinant E. coli.

The genes of the menaquinone-7 synthesis pathway and the enzyme genes of the MVA pathway used in this example were in pTrc99A vector (GenBank No. M22744) and pSTV28 vector (Takara Korea, Korea), respectively, taking into account the maintenance stability of the final expression plasmid. It was introduced separately, and because these vectors have different origins, they can coexist within one E. coli.

(1) Preparation of plasmid for expression of enzyme genes related to HPP synthesis and menaquinone-7 conversion

Genes encoding enzymes related to HPP synthesis and menaquinone-7 conversion pathways used in this example are Bacillus subtilis subsp. The natto chromosome was used by PCR amplification as a template, and the primers for gene amplification are shown in Table 4, and the overlapping PCR was performed and introduced into the pTrc99A vector (Pharmacia, Sweden), respectively, and pT-MK7-1 and pT-MK7-2 Was produced (Fig. 2). The hepS, hepT, and ubiE genes are derived from Bacillus subtilis subsp. It existed as an operon on the natto chromosome, and the whole was used after PCR amplification.

gene Primer sequence for gene amplification hepS-ubiE-hepT SEQ ID NO: 5:
CATGGAATTCAAGGAGGTGATATTTATGCAAGACATCTACGGAAC
SEQ ID NO: 6:
TCCTTGGTACCTCCGGATCATTAAAATTTTCTTTTACCGATATAT menA SEQ ID NO: 9:
CGGAGGTACCAAGGAGGAGCTCAAGATGAACCAAACAAATAAGGGTG
SEQ ID NO: 10:
TCTAGAACCTCCTGTACGAGCTCATTATCGGAAATAGCTGATCAATAATC yhcB SEQ ID NO: 15:
AATGAGCTCGTACAGGAGGTTCTAGAATGAAAATTTATGTAGTGTATG
SEQ ID NO: 16:
TGCAGGTCGACTCTAGATTACTGTCCTGCTGTTAGGTTTCC

(2) Preparation of plasmid for expression of enzyme genes of the MVA pathway for IPP overproduction

The genes encoding the enzymes related to the MVA pathway for IPP overproduction used in this example and the enzyme gene idi that catalyzes the mutual conversion between IPP and DMAPP were synthesized in GenScript (NJ, USA), and primers for gene amplification Is shown in Table 5 and was introduced into pSTV28 vector by performing overlapping PCR, respectively, to produce pS- MVA.The mvaK1, mvaK2, and mvaD genes exist as operons on the corresponding strain Streptococcus pneumonia chromosome, and the whole was synthesized and amplified by PCR. Was used (Fig. 2).

gene Primer sequence for gene amplification mvaK1 - mvaD - mvaK2 SEQ ID NO: 31: ACCCGGGGATCCTGCGATAACGGAAAAAACGATAAGGAGGTATTCTATGACAAAAAAAGTTGGTGTCGG
SEQ ID NO: 32:
CAAACCTCCTTAAACTATTACGAGACCTTACGATTTGTCGTCATGTCCTATCC idi SEQ ID NO: 35:
GTCTCGTAATAGTTTAAGGAGGTTTGTTATGCAAACGGAACACGTCATTTTA
SEQ ID NO: 36:
CCTTATACCTGTTTATCAAATCTAGATTATTTAAGCTGGGTAAATGCAGATA mvaE SEQ ID NO: 19:
AATCTAGATTTGATAAACAGGTATAAGGAGGTATTTTATGAAAACAGTAGTTATTATTG
SEQ ID NO: 20:
CATAAAAATACCTCCTTATTATTGTTTTCTTAAATCATTTAAAAT mvaS SEQ ID NO: 23:
CAATAATAAGGAGGTATTTTTATGACAATTGGGATTGATAAAATT
SEQ ID NO: 24:
GCATGCCTGCAGGTCGACTTAGTTTCGATAAGAGCGAACGGTAT

(3) Preparation of transformed recombinant E. coli

The transgene nucleotide sequence of the pT-MK7 and pS-MVA recombinant plasmids prepared above was confirmed through DNA sequencing, and chemical transformation method for E. coli DH5α, an E. coli strain commonly used for the production of isoprenoids. Was introduced to produce recombinant E. coli of the combination shown in Table 6 below.

Recombinant E. coli name Plasmid Transgene C-DH5α pTrc99A, pSTV28 - S-DH5α pS-MVA mvaK1 , mvaD , mvaK2, idi, mvaE, mvaS T1-DH5α pT-MK7-1 hepS, ubiE, hepT T2-DH5α pT-MK7-2 hepS, ubiE, hepT, menA, yhcB T1S-DH5α pT-MK7-1, pS-MVA hepS, ubiE, hepTmvaK1 , mvaD , mvaK2, idi, mvaE, mvaS T2S-DH5α pT-MK7-2, pS-MVA hepS, ubiE, hepT, menA, yhcBmvaK1 , mvaD , mvaK2, idi, mvaE, mvaS

Example 2: Confirmation of menaquinone-7 productivity through flask culture

The recombinant E. coli produced in Example 1 was cultured at the flask level to compare the productivity of menaquinone-7. Each recombinant strain was inoculated into the minimum medium (pH 7.0) of the composition in Table 7 below and cultured for 24 hours at 30°C and 200 rpm, and samples were collected during the culture and OD (optical density) 600 was measured to determine the growth rate of the strain. It was measured. The concentration of menaquinone-7 produced by recombinant E. coli was analyzed based on the USP (US Pharmacopoeia) method, and the process is as follows. The collected sample was completely crushed by sonication, extracted and filtered at 60°C by adding 9-fold volume of ethanol, and analyzed by HPLC (Agilent Infinity series 1260, C18 packing column, C18 column, UV 268nm). (Fig. 3).

ingredient Final concentration Glycerol 30.0 g/L MgSO ₄ 7H ₂ O 1.2 g/L (NH ₄ ) ₂ HPO ₄ 4.0 g/L KH ₂ PO ₄ 13.3 g/L Citric acid 1.7 g/L Yeast extract 5 g/L Trace metal solution* 3 ml/L Trace metal solution (per liter): 2.8g EDTA, 4.33g Zn(CH ₃ COO) ₂ ·2H ₂ O, 5g MnCl ₂ ·4H ₂ O, 1g H ₃ PO ₃ , 33.33g Fe(III)Citrate, 0.5g CuCl ₂ , 0.83 g CoCl ₂ 6H ₂ O, 0.83 g Na ₂ MoO ₄ 2H ₂ O

As a result, all of the recombinant E. coli produced in Example 1 showed similar growth, and in terms of menaquinone-7 production concentration and productivity, T2S-DH5α showed the best performance (Table 8). That is, wild-type E. coli DH5α HPP synthase group ( hepS, hepT ), DHNA and HPP to menaquinone-7 conversion enzyme group ( menA, ubiE, yhcB ), IPP and DMAPP can be mass-produced. Recombinant E. coli to which the MVA pathway enzyme groups ( mvaE, mvaS, mvaK1 , mvaK2, mvaD, idi ) were simultaneously introduced showed a 24 mg/L level of menaquinone-7 productivity in a flask culture for 24 hours.

Recombinant E. coli name Cell concentration
(OD600) Menaquinone-7 production concentration
(mg/L) Menaquinone-7 specific productivity
(mg/L/OD600) C-DH5α 27.8±0.6 Not detected - S-DH5α 28.4±0.7 Not detected - T1-DH5α 26.1±0.6 4.4±0.1 0.17±0.00 T2-DH5α 24.6±0.6 14.2±0.9 0.58±0.04 T1S-DH5α 25.6±0.8 15.1±1.3 0.59±0.03 T2S-DH5α 25.1±0.6 23.8±1.8 0.95±0.05

On the other hand, in order to compare the productivity with Bacillus subtilis natto (ATCC 15245), which is a representative commercially produced strain having menaquinone-7 production capacity, menaquinone was cultured in a flask for 24 hours under the minimum medium condition. -7 was not detected, and complex medium conditions (Tryptic Soy Broth; Tryptone 17g/L, Soytone 3g/L, Glucose 2.5g/L, NaCl 5.0g/L, KH ₂ PO ₄ 2.5g/L, pH 7.3) When incubated in the flask for 24 hours, menaquinone-7 productivity of 3.9mg/L was shown. This is similar to that of the general wild-type Bacillus subtilis showing 4.2 mg/L menaquinone-7 productivity in a 72-hour flask culture in the presence of a high concentration of complex components (Korean Patent Registration No. 10-1884659).

Example 3: Menaquinone-7 productivity confirmation through fed-batch fermentation

The productivity of menaquinone-7 was confirmed by performing fed-batch fermentation culture on the recombinant E. coli T2S-DH5α which showed the best menaquinone-7 productivity in Example 2. The composition of the fermentation medium was the same as in Table 7 above, and cultured under microaerobic conditions (0.5vvm), pH 7.0, and culture temperature of 30°C. The growth rate and the amount of menaquinone-7 production of the strain were measured in the same manner as in Example 2.

As a result, as shown in FIG. 4, the productivity of menaquinone-7 was confirmed at a level of 132 mg/L in the culture for 60 hours.

On the other hand, in the case of Bacillus subtilis natto (ATCC 15245), complex medium conditions (glycerol 50g/L, soybean meal 50g/L, yeast extract 50g/L, KH ₂ PO ₄ 0.6g/L, pH) When cultured for 96 hours at 6.4), only 27.9 mg/L of menaquinone-7 was produced. In addition, in Korean Patent Registration No. 10-1884659, when fermented for 80 hours in an optimal complex medium condition using a wild-type Bacillus subtilis strain, menaquinone-7 at a level of 11.4 mg/L was produced, and ultraviolet rays and sodium azide It has been reported that when the mutant strains mutated to and fermented for 80 hours under the same culture conditions, menaquinone-7 productivity at the level of 107.0mg/L is produced.

As described above, specific parts of the present invention have been described in detail, and for those of ordinary skill in the art, this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. It will be obvious. Therefore, the practical scope of the present invention is defined in accordance with the appended claims and their equivalents.

I would say that it is.

<110> GENOFOCUS CO., LTD. GF Fermentech, Inc. <120> Recombinant Microorganism Having Enhanced Menaquinone-7 Producing Ability and Method for Preparing Menaquinone-7 Using the Same <130> P19-B099 <160> 36 <170> KopatentIn 2.0 <210> 1 <211> 251 <212> PRT <213> Bacillus subtilis subsp. natto <400> 1 Met Gln Asp Ile Tyr Gly Thr Leu Ala Asn Leu Asn Thr Lys Leu Lys 1 5 10 15 Gln Lys Leu Ser His Pro Tyr Leu Ala Lys His Ile Ser Ala Pro Lys 20 25 30 Ile Asp Glu Asp Lys Leu Leu Leu Phe His Ala Leu Phe Glu Glu Ala 35 40 45 Asp Ile Lys Asn Asn Asp Arg Glu Asn Tyr Ile Val Thr Ala Met Leu 50 55 60 Val Gln Ser Ala Leu Asp Thr His Asp Glu Val Thr Thr Ala Arg Val 65 70 75 80 Ile Lys Arg Asp Glu Asn Lys Asn Arg Gln Leu Thr Val Leu Ala Gly 85 90 95 Asp Tyr Phe Ser Gly Leu Tyr Tyr Ser Leu Leu Ser Glu Met Lys Asp 100 105 110 Ile Tyr Met Ile Arg Thr Leu Ala Thr Ala Ile Lys Glu Ile Asn Glu 115 120 125 His Lys Ile Arg Leu Tyr Asp Arg Ser Phe Lys Asp Glu Asn Asp Phe 130 135 140 Phe Glu Ser Val Gly Ile Val Glu Ser Ala Leu Phe His Arg Val Ala 145 150 155 160 Glu His Phe Ser Leu Pro Arg Trp Lys Lys Leu Ser Ser Asp Phe Phe 165 170 175 Val Phe Lys Arg Leu Met Asn Gly Asn Asp Ala Phe Leu Asp Val Ile 180 185 190 Gly Ser Phe Ile Gln Leu Gly Lys Thr Lys Glu Glu Ile Leu Glu Asp 195 200 205 Cys Phe Lys Lys Ala Lys Asn Ser Ile Glu Ser Leu Leu Pro Leu Asn 210 215 220 Ser Pro Ile Gln Asn Ile Leu Ile Asn Arg Leu Lys Thr Ile Ser Gln 225 230 235 240 Asp Gln Thr Tyr His Gln Lys Val Glu Glu Gly 245 250 <210> 2 <211> 753 <212> DNA <213> Bacillus subtilis subsp. natto <400> 2 atgcaagaca tctacggaac tttagccaat ctgaacacga aattaaaaca aaagctgtct 60 catccttatt tagcgaagca tatttctgcg ccgaaaattg atgaggataa gcttcttctt 120 tttcatgctt tatttgaaga agctgacata aaaaacaacg acagagaaaa ttatattgta 180 acagcgatgc ttgtacaaag cgcccttgat acccatgatg aagtgacgac agctagagtc 240 ataaaacgag acgaaaacaa aaaccgccaa ttgactgttc tcgcgggcga ttatttcagc 300 gggctgtact actctttact atctgaaatg aaggatatct acatgattcg gacgcttgct 360 acagccatta aagaaatcaa cgaacataaa attcgtctgt atgaccgttc tttcaaggac 420 gaaaacgatt ttttcgaaag tgtcggcatc gttgaatcag ctttattcca tcgtgtggcg 480 gaacacttca gcctcccgcg ctggaaaaag ctgtcgagtg atttttttgt atttaagcgg 540 cttatgaacg gaaatgatgc atttctggat gtgatcggca gttttataca gctgggaaaa 600 acaaaagaag agatattaga agattgtttt aaaaaagcga aaaacagcat tgagtcactt 660 ctgcctctaa attcacctat tcagaacatt ttaataaacc gtctgaagac aatcagccaa 720 gatcaaacct atcatcagaa agtggaagaa ggg 753 <210> 3 <211> 348 <212> PRT <213> Bacillus subtilis subsp. natto <400> 3 Met Leu Asn Ile Ile Arg Leu Leu Ala Glu Ser Leu Pro Arg Ile Ser 1 5 10 15 Asp Gly Asn Glu Asn Thr Asp Val Trp Val Asn Asp Met Lys Phe Lys 20 25 30 Met Ala Tyr Ser Phe Leu Asn Asp Asp Ile Asp Val Ile Glu Arg Glu 35 40 45 Leu Glu Gln Thr Val Arg Ser Asp Tyr Pro Leu Leu Ser Glu Ala Gly 50 55 60 Leu His Leu Leu Gln Ala Gly Gly Lys Arg Ile Arg Pro Val Phe Val 65 70 75 80 Leu Leu Ser Gly Met Phe Gly Asp Tyr Asp Ile Asn Lys Ile Lys Tyr 85 90 95 Val Ala Val Thr Leu Glu Met Ile His Met Ala Ser Leu Val His Asp 100 105 110 Asp Val Ile Asp Asp Ala Glu Leu Arg Arg Gly Lys Pro Thr Ile Lys 115 120 125 Ala Lys Trp Asp Asn Arg Ile Ala Met Tyr Thr Gly Asp Tyr Met Leu 130 135 140 Ala Gly Ser Leu Glu Met Met Thr Arg Ile Asn Glu Pro Lys Ala His 145 150 155 160 Arg Ile Leu Ser Gln Thr Ile Val Glu Val Cys Leu Gly Glu Ile Glu 165 170 175 Gln Ile Lys Asp Lys Tyr Asn Met Glu Gln Asn Leu Arg Thr Tyr Leu 180 185 190 Arg Arg Ile Lys Arg Lys Thr Ala Leu Leu Ile Ala Val Ser Cys Gln 195 200 205 Leu Gly Ala Ile Ala Ser Gly Ala Asp Glu Lys Ile His Lys Ala Leu 210 215 220 Tyr Trp Phe Gly Tyr Tyr Val Gly Met Ser Tyr Gln Ile Ile Asp Asp 225 230 235 240 Ile Leu Asp Phe Thr Ser Thr Glu Glu Glu Leu Gly Lys Pro Val Gly 245 250 255 Gly Asp Leu Leu Gln Gly Asn Val Thr Leu Pro Val Leu Tyr Ala Leu 260 265 270 Lys Asn Pro Ala Leu Lys Asn Gln Leu Lys Leu Ile Asn Ser Glu Thr 275 280 285 Thr Gln Glu Gln Leu Glu Pro Ile Ile Glu Glu Ile Lys Lys Thr Asp 290 295 300 Ala Ile Glu Ala Ser Met Ala Val Ser Glu Met Tyr Leu Gln Lys Ala 305 310 315 320 Phe Gln Lys Leu Asn Thr Leu Pro Arg Gly Arg Ala Arg Ser Ser Leu 325 330 335 Ala Ala Ile Ala Lys Tyr Ile Gly Lys Arg Lys Phe 340 345 <210> 4 <211> 1044 <212> DNA <213> Bacillus subtilis subsp. natto <400> 4 atgttaaata tcattcgttt actggcggag tcgctgccac gcatatcgga tggaaatgaa 60 aacacagatg tttgggtgaa tgatatgaaa tttaaaatgg cctactcttt tttaaatgac 120 gatattgatg taatcgaaag agaacttgaa caaaccgtac gttccgatta cccgctttta 180 agcgaggcag gtcttcacct gctgcaggcc ggagggaaac gtattcgtcc tgttttcgtg 240 ctgctttctg gcatgtttgg cgattacgat attaataaga ttaaatatgt cgccgtcact 300 ctggaaatga ttcacatggc atctttggtt catgatgatg tcattgatga tgcagagctt 360 cgccgaggaa aaccgacaat caaagcaaag tgggacaatc gtattgcgat gtacacaggc 420 gattatatgc ttgcgggatc tcttgaaatg atgacgagaa ttaacgaacc gaaagcccat 480 aggattttgt cacagacgat cgttgaagtt tgtctagggg aaattgagca gatcaaagac 540 aaatataaca tggaacaaaa tctcagaacg tatctccgcc gtatcaaaag aaaaacagct 600 ctcttgatcg cggtcagctg ccagcttggt gccattgcgt ctggagctga tgagaagatt 660 cataaggcat tgtactggtt tgggtattac gtcggcatgt cttatcagat tattgatgat 720 attcttgatt ttacttcaac tgaagaagag ctgggtaaac ccgttggagg agatttgctt 780 caaggaaacg tcacattgcc agtgctgtat gccctgaaaa atcctgcatt aaaaaaccag 840 cttaaattga ttaacagtga gacaacgcag gagcagcttg aaccaatcat tgaagaaatc 900 aaaaaaacag atgcaattga agcatctatg gcagtaagcg aaatgtatct gcagaaagct 960 tttcagaaat taaacacgct tccacgaggg cgcgcacgct cgtctcttgc agccatcgca 1020 aaatatatcg gtaaaagaaa attt 1044 <210> 5 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 catggaattc aaggaggtga tatttatgca agacatctac ggaac 45 <210> 6 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tccttggtac ctccggatca ttaaaatttt cttttaccga tatat 45 <210> 7 <211> 311 <212> PRT <213> Bacillus subtilis subsp. natto <400> 7 Met Asn Gln Thr Asn Lys Gly Glu Gly Gln Thr Ala Pro Gln Lys Glu 1 5 10 15 Ser Met Gly Gln Ile Leu Trp Gln Leu Thr Arg Pro His Thr Leu Thr 20 25 30 Ala Ser Phe Val Pro Val Leu Leu Gly Thr Val Leu Ala Met Phe Tyr 35 40 45 Val Lys Val Asp Leu Leu Leu Phe Leu Ala Met Leu Phe Ser Cys Leu 50 55 60 Trp Ile Gln Ile Ala Thr Asn Leu Phe Asn Glu Tyr Tyr Asp Phe Lys 65 70 75 80 Arg Gly Leu Asp Thr Ala Glu Ser Val Gly Ile Gly Gly Ala Ile Val 85 90 95 Arg His Gly Met Lys Pro Lys Thr Ile Leu Gln Leu Ala Leu Ala Ser 100 105 110 Tyr Gly Ile Ala Ile Leu Leu Gly Val Tyr Ile Cys Ala Ser Ser Ser 115 120 125 Trp Trp Leu Ala Leu Ile Gly Leu Val Gly Met Ala Ile Gly Tyr Leu 130 135 140 Tyr Thr Gly Gly Pro Leu Pro Ile Ala Tyr Thr Pro Phe Gly Glu Leu 145 150 155 160 Phe Ser Gly Ile Cys Met Gly Ser Val Phe Val Leu Ile Ser Phe Phe 165 170 175 Ile Gln Thr Asp Met Ile Asn Thr Gln Ser Ile Leu Ile Ser Ile Pro 180 185 190 Ile Ala Ile Leu Val Gly Ala Ile Asn Leu Ser Asn Asn Ile Arg Asp 195 200 205 Ile Glu Glu Asp Lys Lys Gly Gly Arg Lys Thr Leu Ala Ile Leu Met 210 215 220 Gly His Lys Gly Ala Val Thr Leu Leu Ala Ala Ser Phe Ala Val Ala 225 230 235 240 Tyr Ile Trp Val Val Gly Leu Val Ile Thr Gly Ala Ala Ser Pro Trp 245 250 255 Leu Phe Val Val Phe Leu Ser Val Pro Lys Pro Val Gln Ala Val Lys 260 265 270 Gly Phe Val Gln Lys Glu Met Pro Met Asn Met Ile Val Ala Met Lys 275 280 285 Ser Thr Ala Gln Thr Asn Thr Phe Phe Gly Phe Leu Leu Ser Ile Gly 290 295 300 Leu Leu Ile Ser Tyr Phe Arg 305 310 <210> 8 <211> 933 <212> DNA <213> Bacillus subtilis subsp. natto <400> 8 atgaaccaaa caaataaggg tgagggtcag acagcgccgc aaaaagaaag catggggcag 60 atcctttggc agttaacccg tcctcatacg ttaaccgcat cgtttgtgcc tgtgctgctc 120 ggaaccgttt tggcgatgtt ttatgtgaag gttgatctgc tgctgttttt ggctatgctg 180 ttttcttgcc tatggattca gatcgcgacg aacttattta atgaatatta tgattttaaa 240 cgcggattag atacagcaga atcagtcgga atcggagggg caattgtacg ccacggaatg 300 aagcctaaaa cgattttgca attagctctg gcatcatacg ggattgccat tttgctcggt 360 gtctatattt gtgcgagcag cagctggtgg cttgcgctga tcggccttgt cggcatggcg 420 atcggctacc tgtatacagg cgggccgctg ccgattgcgt acacgccgtt cggtgaatta 480 ttctcaggca tttgcatggg ttcggtgttt gtgctgattt cgtttttcat tcagacagat 540 atgatcaaca cgcaaagcat tttgatttcc atcccgattg cgattcttgt cggcgcgatt 600 aatttgtcaa acaacattcg cgatattgaa gaggacaaaa aaggcggccg caaaacattg 660 gcgattttga tggggcataa gggagctgtt actctgttag ctgcgtcgtt tgccgtcgct 720 tatatctggg ttgtcggctt ggttattacc ggtgccgcaa gcccatggct gtttgtcgtc 780 tttttgagcg tgcctaagcc ggttcaggca gtgaagggct tcgtccaaaa agaaatgccg 840 atgaatatga ttgtcgcaat gaaatcaaca gcccaaacaa atacattttt cggattcctg 900 ctttcgatcg gattattgat cagctatttc cga 933 <210> 9 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 cggaggtacc aaggaggagc tcaagatgaa ccaaacaaat aagggtg 47 <210> 10 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tctagaacct cctgtacgag ctcattatcg gaaatagctg atcaataatc 50 <210> 11 <211> 233 <212> PRT <213> Bacillus subtilis subsp. natto <400> 11 Met Gln Asp Ser Lys Glu Gln Arg Val His Gly Val Phe Glu Lys Ile 1 5 10 15 Tyr Lys Asn Tyr Asp Gln Met Asn Ser Val Ile Ser Phe Gln Gln His 20 25 30 Lys Lys Trp Arg Asp Lys Thr Met Arg Ile Met Asn Val Lys Glu Gly 35 40 45 Ala Lys Ala Leu Asp Val Cys Cys Gly Thr Ala Asp Trp Thr Ile Ala 50 55 60 Leu Ala Lys Ala Ala Gly Lys Ser Gly Glu Ile Lys Gly Leu Asp Phe 65 70 75 80 Ser Glu Asn Met Leu Ser Val Gly Glu Gln Lys Val Lys Asp Gly Gly 85 90 95 Phe Ser Gln Ile Glu Leu Leu His Gly Asn Ala Met Glu Leu Pro Phe 100 105 110 Asp Asp Asp Thr Phe Asp Tyr Val Thr Ile Gly Phe Gly Leu Arg Asn 115 120 125 Val Pro Asp Tyr Leu Thr Val Leu Lys Glu Met Arg Arg Val Val Lys 130 135 140 Pro Gly Gly Gln Val Val Cys Leu Glu Thr Ser Gln Pro Glu Met Ile 145 150 155 160 Gly Phe Arg Gln Ala Tyr Phe Met Tyr Phe Lys Tyr Ile Met Pro Phe 165 170 175 Phe Gly Lys Leu Phe Ala Lys Ser Tyr Lys Glu Tyr Ser Trp Leu Gln 180 185 190 Glu Ser Ala Arg Asp Phe Pro Gly Met Lys Glu Leu Ala Gly Leu Phe 195 200 205 Glu Glu Ala Gly Leu Lys Asn Val Lys Tyr His Ser Phe Thr Gly Gly 210 215 220 Val Ala Ala Thr His Ile Gly Trp Lys 225 230 <210> 12 <211> 699 <212> DNA <213> Bacillus subtilis subsp. natto <400> 12 atgcaggact caaaagaaca gcgcgtacac ggagtatttg aaaaaatata taaaaactat 60 gaccaaatga actctgtcat cagttttcag cagcataaaa aatggcgcga taaaacgatg 120 cgcatcatga atgtaaaaga aggcgcaaaa gcacttgatg tctgctgcgg aacggctgac 180 tggacgatcg ctcttgcaaa agcggccggc aaaagcggcg agatcaaggg cttggatttc 240 agtgaaaata tgctgagtgt cggcgagcag aaagtaaaag acggcggatt cagccaaatt 300 gaactgctgc acggaaatgc gatggagctt ccttttgatg atgatacatt tgattatgtc 360 accattggct tcgggctccg caatgtccct gattacttga ctgtactgaa agagatgaga 420 cgtgtagtga agccgggcgg gcaggtggta tgtctggaaa cgtcccagcc ggaaatgatc 480 ggattcagac aggcttactt tatgtacttt aagtatatta tgccgttttt cgggaaactg 540 tttgcgaaga gctataaaga atattcttgg cttcaagaat cagccagaga tttccctgga 600 atgaaggaac tggcaggcct gtttgaagag gcgggcctga aaaatgttaa atatcattcg 660 tttactggcg gagtcgctgc cacgcatatc ggatggaaa 699 <210> 13 <211> 176 <212> PRT <213> Bacillus subtilis subsp. natto <400> 13 Met Lys Ile Tyr Val Val Tyr Asp Ser Glu Gly Glu His Thr Lys Val 1 5 10 15 Leu Ala Glu Ala Ile Ala Glu Gly Ala Arg Glu Asn Gly Ala Ala Glu 20 25 30 Val Phe Ile Asp His Val Asp Gln Ala Asp Ile Arg Lys Leu Lys Asp 35 40 45 Met Asp Ala Ile Ile Trp Gly Cys Pro Gly His Phe Gly Thr Ile Ser 50 55 60 Ser Gly Leu Lys Thr Trp Ile Asp Arg Leu Gly Tyr Leu Trp Ala Glu 65 70 75 80 Gly Glu Leu Ile Asn Lys Val Gly Ala Val Phe Cys Thr Thr Ala Thr 85 90 95 Thr His Gly Gly Leu Glu Met Thr Met His Asn Leu Ile Thr Pro Met 100 105 110 Phe His Gln Gly Met Ile Val Val Gly Leu Pro Gly Asn Val Pro Glu 115 120 125 Asn Ala Leu Tyr Gly Ser Tyr Tyr Gly Ala Gly Val Thr Cys Pro Val 130 135 140 Asp Ser Asp Glu Leu Met Ser Glu Glu Gly Ile Gln Leu Gly Arg Ala 145 150 155 160 Leu Gly Arg Arg Val Ser Gln Val Thr Gly Asn Leu Thr Ala Gly Gln 165 170 175 <210> 14 <211> 528 <212> DNA <213> Bacillus subtilis subsp. natto <400> 14 atgaaaattt atgtagtgta tgatagtgaa ggcgaacata ctaaagtgct tgcagaagcg 60 attgctgaag gcgcgagaga aaacggcgcg gctgaagtgt tcatcgacca tgtagatcag 120 gctgatatcc gcaagcttaa agatatggat gcgattattt ggggatgccc agggcatttc 180 ggaacaatca gctccggtct taaaacttgg atcgacagac ttggctactt gtgggctgaa 240 ggcgagctga tcaacaaagt cggtgctgtc ttctgcacaa cggcaacaac acacggcggc 300 ttggaaatga caatgcacaa tttaatcacg ccgatgttcc accaaggcat gattgttgtc 360 ggactgcctg ggaacgtgcc tgaaaacgca ctttatggct cttattacgg agcaggtgtc 420 acttgtccgg tagacagtga tgagttaatg tctgaggaag gtattcagct tggacgcgcg 480 ttgggaagac gtgtcagcca agtcacagga aacctaacag caggacag 528 <210> 15 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 aatgagctcg tacaggaggt tctagaatga aaatttatgt agtgtatg 48 <210> 16 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 tgcaggtcga ctctagatta ctgtcctgct gttaggtttc c 41 <210> 17 <211> 803 <212> PRT <213> Enterococcus faecalis <400> 17 Met Lys Thr Val Val Ile Ile Asp Ala Leu Arg Thr Pro Ile Gly Lys 1 5 10 15 Tyr Lys Gly Ser Leu Ser Gln Val Ser Ala Val Asp Leu Gly Thr His 20 25 30 Val Thr Thr Gln Leu Leu Lys Arg His Ser Thr Ile Ser Glu Glu Ile 35 40 45 Asp Gln Val Ile Phe Gly Asn Val Leu Gln Ala Gly Asn Gly Gln Asn 50 55 60 Pro Ala Arg Gln Ile Ala Ile Asn Ser Gly Leu Ser His Glu Ile Pro 65 70 75 80 Ala Met Thr Val Asn Glu Val Cys Gly Ser Gly Met Lys Ala Val Ile 85 90 95 Leu Ala Lys Gln Leu Ile Gln Leu Gly Glu Ala Glu Val Leu Ile Ala 100 105 110 Gly Gly Ile Glu Asn Met Ser Gln Ala Pro Lys Leu Gln Arg Phe Asn 115 120 125 Tyr Glu Thr Glu Ser Tyr Asp Ala Pro Phe Ser Ser Met Met Tyr Asp 130 135 140 Gly Leu Thr Asp Ala Phe Ser Gly Gln Ala Met Gly Leu Thr Ala Glu 145 150 155 160 Asn Val Ala Glu Lys Tyr His Val Thr Arg Glu Glu Gln Asp Gln Phe 165 170 175 Ser Val His Ser Gln Leu Lys Ala Ala Gln Ala Gln Ala Glu Gly Ile 180 185 190 Phe Ala Asp Glu Ile Ala Pro Leu Glu Val Ser Gly Thr Leu Val Glu 195 200 205 Lys Asp Glu Gly Ile Arg Pro Asn Ser Ser Val Glu Lys Leu Gly Thr 210 215 220 Leu Lys Thr Val Phe Lys Glu Asp Gly Thr Val Thr Ala Gly Asn Ala 225 230 235 240 Ser Thr Ile Asn Asp Gly Ala Ser Ala Leu Ile Ile Ala Ser Gln Glu 245 250 255 Tyr Ala Glu Ala His Gly Leu Pro Tyr Leu Ala Ile Ile Arg Asp Ser 260 265 270 Val Glu Val Gly Ile Asp Pro Ala Tyr Met Gly Ile Ser Pro Ile Lys 275 280 285 Ala Ile Gln Lys Leu Leu Ala Arg Asn Gln Leu Thr Thr Glu Glu Ile 290 295 300 Asp Leu Tyr Glu Ile Asn Glu Ala Phe Ala Ala Thr Ser Ile Val Val 305 310 315 320 Gln Arg Glu Leu Ala Leu Pro Glu Glu Lys Val Asn Ile Tyr Gly Gly 325 330 335 Gly Ile Ser Leu Gly His Ala Ile Gly Ala Thr Gly Ala Arg Leu Leu 340 345 350 Thr Ser Leu Ser Tyr Gln Leu Asn Gln Lys Glu Lys Lys Tyr Gly Val 355 360 365 Ala Ser Leu Cys Ile Gly Gly Gly Leu Gly Leu Ala Met Leu Leu Glu 370 375 380 Arg Pro Gln Gln Lys Lys Asn Ser Arg Phe Tyr Gln Met Ser Pro Glu 385 390 395 400 Glu Arg Leu Ala Ser Leu Leu Asn Glu Gly Gln Ile Ser Ala Asp Thr 405 410 415 Lys Lys Glu Phe Glu Asn Thr Ala Leu Ser Ser Gln Ile Ala Asn His 420 425 430 Met Ile Glu Asn Gln Ile Ser Glu Thr Glu Val Pro Met Gly Val Gly 435 440 445 Leu His Leu Thr Val Asp Glu Thr Asp Tyr Leu Val Pro Met Ala Thr 450 455 460 Glu Glu Pro Ser Val Ile Ala Ala Leu Ser Asn Gly Ala Lys Ile Ala 465 470 475 480 Gln Gly Phe Lys Thr Val Asn Gln Gln Arg Leu Met Arg Gly Gln Ile 485 490 495 Val Phe Tyr Asp Val Ala Asp Pro Glu Ser Leu Ile Asp Lys Leu Gln 500 505 510 Val Arg Glu Ala Glu Ile Phe Gln Gln Ala Glu Leu Ser Tyr Pro Ser 515 520 525 Ile Val Lys Arg Gly Gly Gly Leu Arg Asp Leu Gln Tyr Arg Thr Phe 530 535 540 Asp Glu Ser Phe Val Ser Val Asp Phe Leu Val Asp Val Lys Asp Ala 545 550 555 560 Met Gly Ala Asn Ile Val Asn Ala Met Leu Glu Gly Val Ala Glu Leu 565 570 575 Phe Arg Glu Trp Phe Ala Glu Gln Lys Ile Leu Phe Ser Ile Leu Ser 580 585 590 Asn Tyr Ala Thr Glu Ser Val Val Thr Met Lys Thr Ala Ile Pro Val 595 600 605 Ser Arg Leu Ser Lys Gly Ser Asn Gly Arg Glu Ile Ala Glu Lys Ile 610 615 620 Val Leu Ala Ser Arg Tyr Ala Ser Leu Asp Pro Tyr Arg Ala Val Thr 625 630 635 640 His Asn Lys Gly Ile Met Asn Gly Ile Glu Ala Val Val Leu Ala Thr 645 650 655 Gly Asn Asp Thr Arg Ala Val Ser Ala Ser Cys His Ala Phe Ala Val 660 665 670 Lys Glu Gly Arg Tyr Gln Gly Leu Thr Ser Trp Thr Leu Asp Gly Glu 675 680 685 Gln Leu Ile Gly Glu Ile Ser Val Pro Leu Ala Leu Ala Thr Val Gly 690 695 700 Gly Ala Thr Lys Val Leu Pro Lys Ser Gln Ala Ala Ala Asp Leu Leu 705 710 715 720 Ala Val Thr Asp Ala Lys Glu Leu Ser Arg Val Val Ala Ala Val Gly 725 730 735 Leu Ala Gln Asn Leu Ala Ala Leu Arg Ala Leu Val Ser Glu Gly Ile 740 745 750 Gln Lys Gly His Met Ala Leu Gln Ala Arg Ser Leu Ala Met Thr Val 755 760 765 Gly Ala Thr Gly Lys Glu Val Glu Ala Val Ala Gln Gln Leu Lys Arg 770 775 780 Gln Lys Thr Met Asn Gln Asp Arg Ala Leu Ala Ile Leu Asn Asp Leu 785 790 795 800 Arg Lys Gln <210> 18 <211> 2409 <212> DNA <213> Enterococcus faecalis <400> 18 atgaaaacag tagttattat tgatgcatta cgaacaccaa ttggaaaata taaaggcagc 60 ttaagtcaag taagtgccgt agacttagga acacatgtta caacacaact tttaaaaaga 120 cattccacta tttctgaaga aattgatcaa gtaatctttg gaaatgtttt acaagctgga 180 aatggccaaa atcccgcacg acaaatagca ataaacagcg gtttgtctca tgaaattccc 240 gcaatgacgg ttaatgaggt ctgcggatca ggaatgaagg ccgttatttt ggcgaaacaa 300 ttgattcaat taggagaagc ggaagtttta attgctggtg ggattgagaa tatgtcccaa 360 gcacctaaat tacaacgatt taattacgaa acagaaagct acgatgcgcc tttttctagt 420 atgatgtacg atgggttaac ggatgccttt agtggtcagg caatgggctt aactgctgaa 480 aatgtggccg aaaagtatca tgtaactaga gaagagcaag atcaattttc tgtacattca 540 caattaaaag cagctcaagc acaagcagaa gggatattcg ctgacgaaat agccccatta 600 gaagtgtcag gaacgcttgt ggagaaagat gaagggattc gccctaattc gagcgttgag 660 aagctaggaa cgcttaaaac agtttttaaa gaagacggta ctgtaacagc agggaatgca 720 tcaaccatta atgatggggc ttctgctttg attattgctt cacaagaata tgccgaagca 780 cacggtcttc cttatttagc tattattcga gacagtgtgg aagtcggtat tgatccagcc 840 tatatgggaa tttcgccgat taaagccatt caaaaactgt tagcgcggaa tcaacttact 900 acggaagaaa ttgatctgta tgaaatcaac gaagcatttg cagcaacttc aatcgtggtc 960 caaagagaac tggctttacc agaggaaaag gtcaacattt atggtggcgg tatttcatta 1020 ggtcatgcga ttggtgccac aggtgctcgt ttattaacga gtttaagtta tcaattaaat 1080 caaaaagaaa agaaatatgg cgtggcttct ttatgtatcg gcggtggctt aggactcgct 1140 atgctactag agagacctca gcaaaaaaaa aacagccgat tttatcaaat gagtcctgag 1200 gaacgcctgg cttctcttct taatgaaggc cagatttctg ctgatacaaa aaaagaattt 1260 gaaaatacgg ctttatcttc gcagattgcc aatcatatga ttgaaaatca aatcagtgaa 1320 acagaagtgc cgatgggcgt tggcttacat ttaacagtgg acgaaactga ttatttggta 1380 ccaatggcga cagaagagcc ctcagtgatt gcggctttga gtaatggtgc aaaaatagca 1440 caaggattta aaacagtgaa tcaacaacgc ttaatgcgtg gacaaatcgt tttttacgat 1500 gttgcagatc ccgagtcatt gattgataaa ctacaagtaa gagaagcgga aatttttcaa 1560 caagcagagt taagttatcc atctatcgtt aaacggggcg gcggcttaag agatttgcaa 1620 tatcgtactt ttgatgaatc gtttgtatct gtcgactttt tagtagatgt taaggatgca 1680 atgggggcaa atatcgttaa cgctatgttg gaaggtgtgg ccgagttgtt ccgtgaatgg 1740 tttgcggagc aaaagatttt attcagtatt ttaagtaatt atgccacgga gtcggttgtt 1800 acgatgaaaa cggctattcc agtttcacgt ttaagtaagg ggagcaatgg ccgggaaatt 1860 gctgaaaaaa ttgttttagc ttcacgctat gcttcattag atccttatcg ggcagtcacg 1920 cataacaaag ggatcatgaa tggcattgaa gctgtagttt tagctacagg aaatgataca 1980 cgcgctgtta gcgcttcttg tcatgctttt gcggtgaagg aaggtcgcta ccaaggcttg 2040 actagttgga cgctggatgg cgaacaacta attggtgaaa tttcagttcc gcttgcgtta 2100 gccacggttg gcggtgccac aaaagtcttg cctaaatctc aagcagccgc tgatttgtta 2160 gcagtgacgg atgcaaaaga actaagtcga gtagtagcgg ctgttggttt ggcccaaaat 2220 ttagcggcgt tacgggcctt agtctctgaa ggcattcaaa aaggacacat ggctctacaa 2280 gcacgttctt tagcgatgac ggtcggagct actggtaaag aagttgaggc agtcgctcaa 2340 caattaaaac gtcaaaaaac gatgaaccaa gaccgagcct tggctatttt aaatgattta 2400 agaaaacaa 2409 <210> 19 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 aatctagatt tgataaacag gtataaggag gtattttatg aaaacagtag ttattattg 59 <210> 20 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 cataaaaata cctccttatt attgttttct taaatcattt aaaat 45 <210> 21 <211> 383 <212> PRT <213> Enterococcus faecalis <400> 21 Met Thr Ile Gly Ile Asp Lys Ile Ser Phe Phe Val Pro Pro Tyr Tyr 1 5 10 15 Ile Asp Met Thr Ala Leu Ala Glu Ala Arg Asn Val Asp Pro Gly Lys 20 25 30 Phe His Ile Gly Ile Gly Gln Asp Gln Met Ala Val Asn Pro Ile Ser 35 40 45 Gln Asp Ile Val Thr Phe Ala Ala Asn Ala Ala Glu Ala Ile Leu Thr 50 55 60 Lys Glu Asp Lys Glu Ala Ile Asp Met Val Ile Val Gly Thr Glu Ser 65 70 75 80 Ser Ile Asp Glu Ser Lys Ala Ala Ala Val Val Leu His Arg Leu Met 85 90 95 Gly Ile Gln Pro Phe Ala Arg Ser Phe Glu Ile Lys Glu Ala Cys Tyr 100 105 110 Gly Ala Thr Ala Gly Leu Gln Leu Ala Lys Asn His Val Ala Leu His 115 120 125 Pro Asp Lys Lys Val Leu Val Val Ala Ala Asp Ile Ala Lys Tyr Gly 130 135 140 Leu Asn Ser Gly Gly Glu Pro Thr Gln Gly Ala Gly Ala Val Ala Met 145 150 155 160 Leu Val Ala Ser Glu Pro Arg Ile Leu Ala Leu Lys Glu Asp Asn Val 165 170 175 Met Leu Thr Gln Asp Ile Tyr Asp Phe Trp Arg Pro Thr Gly His Pro 180 185 190 Tyr Pro Met Val Asp Gly Pro Leu Ser Asn Glu Thr Tyr Ile Gln Ser 195 200 205 Phe Ala Gln Val Trp Asp Glu His Lys Lys Arg Thr Gly Leu Asp Phe 210 215 220 Ala Asp Tyr Asp Ala Leu Ala Phe His Ile Pro Tyr Thr Lys Met Gly 225 230 235 240 Lys Lys Ala Leu Leu Ala Lys Ile Ser Asp Gln Thr Glu Ala Glu Gln 245 250 255 Glu Arg Ile Leu Ala Arg Tyr Glu Glu Ser Ile Ile Tyr Ser Arg Arg 260 265 270 Val Gly Asn Leu Tyr Thr Gly Ser Leu Tyr Leu Gly Leu Ile Ser Leu 275 280 285 Leu Glu Asn Ala Thr Thr Leu Thr Ala Gly Asn Gln Ile Gly Leu Phe 290 295 300 Ser Tyr Gly Ser Gly Ala Val Ala Glu Phe Phe Thr Gly Glu Leu Val 305 310 315 320 Ala Gly Tyr Gln Asn His Leu Gln Lys Glu Thr His Leu Ala Leu Leu 325 330 335 Asp Asn Arg Thr Glu Leu Ser Ile Ala Glu Tyr Glu Ala Met Phe Ala 340 345 350 Glu Thr Leu Asp Thr Asp Ile Asp Gln Thr Leu Glu Asp Glu Leu Lys 355 360 365 Tyr Ser Ile Ser Ala Ile Asn Asn Thr Val Arg Ser Tyr Arg Asn 370 375 380 <210> 22 <211> 1149 <212> DNA <213> Enterococcus faecalis <400> 22 atgacaattg ggattgataa aattagtttt tttgtgcccc cttattatat tgatatgacg 60 gcactggctg aagccagaaa tgtagaccct ggaaaatttc atattggtat tgggcaagac 120 caaatggcgg tgaacccaat cagccaagat attgtgacat ttgcagccaa tgccgcagaa 180 gcgatcttga ccaaagaaga taaagaggcc attgatatgg tgattgtcgg gactgagtcc 240 agtatcgatg agtcaaaagc ggccgcagtt gtcttacatc gtttaatggg gattcaacct 300 ttcgctcgct ctttcgaaat caaggaagct tgttacggag caacagcagg cttacagtta 360 gctaagaatc acgtagcctt acatccagat aaaaaagtct tggtcgtagc agcagatatt 420 gcaaaatatg gcttaaattc tggcggtgag cctacacaag gagctggggc ggttgcaatg 480 ttagttgcta gtgaaccgcg cattttggct ttaaaagagg ataatgtgat gctgacgcaa 540 gatatctatg acttttggcg tccaacaggc catccatatc ctatggtcga tggtcctttg 600 tcaaacgaaa cctacatcca atcttttgcc caagtctggg atgaacataa aaaacgaacc 660 ggtcttgatt ttgcagatta tgatgcttta gcgttccata ttccttacac aaaaatgggc 720 aaaaaagcct tattagcaaa aatctccgac caaactgaag cagaacagga acgaatttta 780 gcccgttatg aagaaagcat catctatagt cgtcgcgtag gaaacttgta tacgggttca 840 ctttatctgg gactcatttc ccttttagaa aatgcaacga ctttaaccgc aggcaatcaa 900 attgggttat tcagttatgg ttctggtgct gtcgctgaat ttttcactgg tgaattagta 960 gctggttatc aaaatcattt acaaaaagaa actcatttag cactgctgga taatcggaca 1020 gaactttcta tcgctgaata tgaagccatg tttgcagaaa ctttagacac agacattgat 1080 caaacgttag aagatgaatt aaaatatagt atttctgcta ttaataatac cgttcgctct 1140 tatcgaaac 1149 <210> 23 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 caataataag gaggtatttt tatgacaatt gggattgata aaatt 45 <210> 24 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 gcatgcctgc aggtcgactt agtttcgata agagcgaacg gtat 44 <210> 25 <211> 292 <212> PRT <213> Streptococcus pneumoniae <400> 25 Met Thr Lys Lys Val Gly Val Gly Gln Ala His Ser Lys Ile Ile Leu 1 5 10 15 Ile Gly Glu His Ala Val Val Tyr Gly Tyr Pro Ala Ile Ser Leu Pro 20 25 30 Leu Leu Glu Val Glu Val Thr Cys Lys Val Val Pro Ala Glu Ser Pro 35 40 45 Trp Arg Leu Tyr Glu Glu Asp Thr Leu Ser Met Ala Val Tyr Ala Ser 50 55 60 Leu Glu Tyr Leu Asn Ile Thr Glu Ala Cys Ile Arg Cys Glu Ile Asp 65 70 75 80 Ser Ala Ile Pro Glu Lys Arg Gly Met Gly Ser Ser Ala Ala Ile Ser 85 90 95 Ile Ala Ala Ile Arg Ala Val Phe Asp Tyr Tyr Gln Ala Asp Leu Pro 100 105 110 His Asp Val Leu Glu Ile Leu Val Asn Arg Ala Glu Met Ile Ala His 115 120 125 Met Asn Pro Ser Gly Leu Asp Ala Lys Thr Cys Leu Ser Asp Gln Pro 130 135 140 Ile Arg Phe Ile Lys Asn Val Gly Phe Thr Glu Leu Glu Met Asp Leu 145 150 155 160 Ser Ala Tyr Leu Val Ile Ala Asp Thr Gly Val Tyr Gly His Thr Arg 165 170 175 Glu Ala Ile Gln Val Val Gln Asn Lys Gly Lys Asp Ala Leu Pro Phe 180 185 190 Leu His Ala Leu Gly Glu Leu Thr Gln Gln Ala Glu Val Ala Ile Ser 195 200 205 Gln Lys Asp Ala Glu Gly Leu Gly Gln Ile Leu Ser Gln Ala His Leu 210 215 220 His Leu Lys Glu Ile Gly Val Ser Ser Pro Glu Ala Asp Phe Leu Val 225 230 235 240 Glu Thr Thr Leu Ser His Gly Ala Leu Gly Ala Lys Met Ser Gly Gly 245 250 255 Gly Leu Gly Gly Cys Ile Ile Ala Leu Val Thr Asn Leu Thr His Ala 260 265 270 Gln Glu Leu Ala Glu Arg Leu Glu Glu Lys Gly Ala Val Gln Thr Trp 275 280 285 Ile Glu Ser Leu 290 <210> 26 <211> 876 <212> DNA <213> Streptococcus pneumoniae <400> 26 atgacaaaaa aagttggtgt cggtcaggca catagtaaga taattttaat aggggaacat 60 gcggtcgttt acggttatcc tgccatttcc ctgcctcttt tggaggtgga ggtgacctgt 120 aaggtagttc ctgcagagag tccttggcgc ctttatgagg aggatacctt gtccatggcg 180 gtttatgcct cactggagta tttgaatatc acagaagcct gcattcgttg tgagattgac 240 tcggctatcc ctgagaaacg ggggatgggt tcgtcagcgg ctatcagcat agcggccatt 300 cgtgcagtat ttgactacta tcaggctgat ctgcctcatg atgtactaga aatcttggtc 360 aatcgagctg aaatgattgc ccatatgaat cctagtggtt tggatgctaa gacctgtctt 420 agtgaccaac ctattcgctt tatcaagaac gtaggattta cagaacttga gatggattta 480 tccgcctatt tggtgattgc cgatacgggt gtttatggtc atactcgtga agccatccaa 540 gtggttcaaa ataagggcaa ggatgcccta ccgtttttgc atgccttggg agaattaacc 600 cagcaagcag aagttgcgat ttcacaaaaa gatgctgaag gactgggaca aatcctcagt 660 caagcgcatt tacatttaaa agaaattgga gtcagtagcc ctgaggcaga ctttttggtt 720 gaaacgactc ttagccatgg tgctctgggt gccaagatga gcggtggtgg gctaggaggt 780 tgtatcatag ccttggtaac caatttgaca cacgcacaag aactagcaga aagattagaa 840 gagaaaggag ctgttcagac atggatagag agcctg 876 <210> 27 <211> 335 <212> PRT <213> Streptococcus pneumoniae <400> 27 Met Ile Ala Val Lys Thr Cys Gly Lys Leu Tyr Trp Ala Gly Glu Tyr 1 5 10 15 Ala Ile Leu Glu Pro Gly Gln Leu Ala Leu Ile Lys Asp Ile Pro Ile 20 25 30 Tyr Met Arg Ala Glu Ile Ala Phe Ser Asp Ser Tyr Arg Ile Tyr Ser 35 40 45 Asp Met Phe Asp Phe Ala Val Asp Leu Arg Pro Asn Pro Asp Tyr Ser 50 55 60 Leu Ile Gln Glu Thr Ile Ala Leu Met Gly Asp Phe Leu Ala Val Arg 65 70 75 80 Gly Gln Asn Leu Arg Pro Phe Ser Leu Lys Ile Cys Gly Lys Met Glu 85 90 95 Arg Glu Gly Lys Lys Phe Gly Leu Gly Ser Ser Gly Ser Val Val Val 100 105 110 Leu Val Val Lys Ala Leu Leu Ala Leu Tyr Asn Leu Ser Val Asp Gln 115 120 125 Asn Leu Leu Phe Lys Leu Thr Ser Ala Val Leu Leu Lys Arg Gly Asp 130 135 140 Asn Gly Ser Met Gly Asp Leu Ala Cys Ile Val Ala Glu Asp Leu Val 145 150 155 160 Val Tyr Gln Ser Phe Asp Arg Gln Lys Ala Ala Ala Trp Leu Glu Glu 165 170 175 Glu Asn Leu Ala Thr Val Leu Glu Arg Asp Trp Gly Phe Phe Ile Ser 180 185 190 Gln Val Lys Pro Thr Leu Glu Cys Asp Phe Leu Val Gly Trp Thr Lys 195 200 205 Glu Val Ala Val Ser Ser His Met Val Gln Gln Ile Lys Gln Asn Ile 210 215 220 Asn Gln Asn Phe Leu Ser Ser Ser Lys Glu Thr Val Val Ser Leu Val 225 230 235 240 Glu Ala Leu Glu Gln Gly Lys Ala Glu Lys Val Ile Glu Gln Val Glu 245 250 255 Val Ala Ser Lys Leu Leu Glu Gly Leu Ser Thr Asp Ile Tyr Thr Pro 260 265 270 Leu Leu Arg Gln Leu Lys Glu Ala Ser Gln Asp Leu Gln Ala Val Ala 275 280 285 Lys Ser Ser Gly Ala Gly Gly Gly Asp Cys Gly Ile Ala Leu Ser Phe 290 295 300 Asp Ala Gln Ser Thr Lys Thr Leu Lys Asn Arg Trp Ala Asp Leu Gly 305 310 315 320 Ile Glu Leu Leu Tyr Gln Glu Arg Ile Gly His Asp Asp Lys Ser 325 330 335 <210> 28 <211> 1005 <212> DNA <213> Streptococcus pneumoniae <400> 28 atgattgctg ttaaaacttg cggaaaactc tattgggcag gtgaatatgc tattttagag 60 ccagggcagt tagctttgat aaaggatatt cccatctata tgagggctga gattgctttt 120 tctgacagct accgtatcta ttcagatatg tttgatttcg cagtggactt aaggcctaat 180 cctgactaca gcttgattca agaaacgatt gctttgatgg gagacttcct cgctgttcgc 240 ggtcagaatt taagaccttt ttccctaaaa atctgtggca aaatggaacg agaagggaaa 300 aagtttggtc taggttctag tggcagcgtc gttgtcttgg ttgtcaaggc tttattggct 360 ctctataatc tttcggttga tcagaatctc ttgttcaagc tgactagcgc tgtcttgctc 420 aagcgaggag acaatggttc catgggcgac cttgcctgta ttgtggcaga ggatttggtt 480 gtctaccagt catttgatcg ccagaaggcg gctgcttggt tagaagaaga aaacttggcg 540 acagttctgg agcgtgattg gggatttttt atctcacaag tgaaaccaac tttagaatgt 600 gatttcttag tgggatggac caaggaagtg gctgtatcga gtcacatggt ccagcaaatc 660 aagcaaaata tcaatcaaaa ttttttaagt tcctcaaaag aaacggtggt ttctttggtc 720 gaagccttgg agcaggggaa agccgaaaaa gttatcgagc aagtagaagt agccagcaag 780 cttttagaag gcttgagtac agatatttac acgcctttgc ttagacagtt gaaagaagcc 840 agtcaagatt tgcaggccgt tgccaagagt agtggtgctg gtggtggtga ctgtggcatc 900 gccctgagtt ttgatgcgca atcaaccaaa accttaaaaa atcgttgggc cgatctgggg 960 attgagctct tatatcaaga aaggatagga catgacgaca aatcg 1005 <210> 29 <211> 317 <212> PRT <213> Streptococcus pneumoniae <400> 29 Met Asp Arg Glu Pro Val Thr Val Arg Ser Tyr Ala Asn Ile Ala Ile 1 5 10 15 Ile Lys Tyr Trp Gly Lys Lys Lys Glu Lys Glu Met Val Pro Ala Thr 20 25 30 Ser Ser Ile Ser Leu Thr Leu Glu Asn Met Tyr Thr Glu Thr Thr Leu 35 40 45 Ser Pro Leu Pro Ala Asn Val Thr Ala Asp Glu Phe Tyr Ile Asn Gly 50 55 60 Gln Leu Gln Asn Glu Val Glu His Ala Lys Met Ser Lys Ile Ile Asp 65 70 75 80 Arg Tyr Arg Pro Ala Gly Glu Gly Phe Val Arg Ile Asp Thr Gln Asn 85 90 95 Asn Met Pro Thr Ala Ala Gly Leu Ser Ser Ser Ser Ser Gly Leu Ser 100 105 110 Ala Leu Val Lys Ala Cys Asn Ala Tyr Phe Lys Leu Gly Leu Asp Arg 115 120 125 Ser Gln Leu Ala Gln Glu Ala Lys Phe Ala Ser Gly Ser Ser Ser Arg 130 135 140 Ser Phe Tyr Gly Pro Leu Gly Ala Trp Asp Lys Asp Ser Gly Glu Ile 145 150 155 160 Tyr Pro Val Glu Thr Asp Leu Lys Leu Ala Met Ile Met Leu Val Leu 165 170 175 Glu Asp Lys Lys Lys Pro Ile Ser Ser Arg Asp Gly Met Lys Leu Cys 180 185 190 Val Glu Thr Ser Thr Thr Phe Asp Asp Trp Val Arg Gln Ser Glu Lys 195 200 205 Asp Tyr Gln Asp Met Leu Ile Tyr Leu Lys Glu Asn Asp Phe Ala Lys 210 215 220 Ile Gly Glu Leu Thr Glu Lys Asn Ala Leu Ala Met His Ala Thr Thr 225 230 235 240 Lys Thr Ala Ser Pro Ala Phe Ser Tyr Leu Thr Asp Ala Ser Tyr Glu 245 250 255 Ala Met Asp Phe Val Arg Gln Leu Arg Glu Lys Gly Glu Ala Cys Tyr 260 265 270 Phe Thr Met Asp Ala Gly Pro Asn Val Lys Val Phe Cys Gln Glu Lys 275 280 285 Asp Leu Glu His Leu Ser Glu Ile Phe Gly His Arg Tyr Arg Leu Ile 290 295 300 Val Ser Lys Thr Lys Asp Leu Ser Gln Asp Asp Cys Cys 305 310 315 <210> 30 <211> 951 <212> DNA <213> Streptococcus pneumoniae <400> 30 atggatagag agcctgtaac agtacgttcc tacgcaaata ttgctattat caaatattgg 60 ggaaagaaaa aagaaaaaga gatggtgcct gctactagca gtatttctct aactttggaa 120 aatatgtata cagagacgac cttgtcgcct ttaccagcca atgtaacagc tgacgaattt 180 tacatcaatg gtcagctaca aaatgaggtc gagcatgcca agatgagtaa gattattgac 240 cgttatcgtc cagctggtga gggctttgtc cgtatcgata ctcaaaacaa tatgcctacg 300 gcagcgggtc tgtcctcaag ttctagtggt ttgtccgccc tggtcaaggc ttgtaatgct 360 tatttcaagc ttggattgga tagaagtcag ttggcacagg aagccaaatt tgcctcaggt 420 tcttcttctc ggagttttta tggaccacta ggagcctggg ataaggatag tggagaaatt 480 taccctgtag agacagactt gaaactagct atgattatgt tggtgctaga ggacaagaaa 540 aaaccaatct ctagccgtga cgggatgaaa ctttgtgtgg aaacctcgac gacttttgac 600 gactgggttc gtcagtctga gaaggactat caggatatgc tgatttatct caaggaaaat 660 gattttgcca agattggaga attaacggag aaaaatgccc tggctatgca tgctacgaca 720 aagactgcta gtccagcctt ttcttatctg acggatgcct cttatgaggc tatggacttt 780 gttcgccagc ttcgtgagaa aggagaggcc tgctacttta ccatggatgc tggtcccaat 840 gttaaggtct tctgtcagga gaaagacttg gagcatttat cagaaatttt cggtcatcgt 900 tatcgcttga ttgtgtcaaa aacaaaggat ttgagtcaag atgattgctg t 951 <210> 31 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 acccggggat cctgcgataa cggaaaaaac gataaggagg tattctatga caaaaaaagt 60 tggtgtcgg 69 <210> 32 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 caaacctcct taaactatta cgagacctta cgatttgtcg tcatgtccta tcc 53 <210> 33 <211> 182 <212> PRT <213> Escherichia coli <400> 33 Met Gln Thr Glu His Val Ile Leu Leu Asn Ala Gln Gly Val Pro Thr 1 5 10 15 Gly Thr Leu Glu Lys Tyr Ala Ala His Thr Ala Asp Thr Arg Leu His 20 25 30 Leu Ala Phe Ser Ser Trp Leu Phe Asn Ala Lys Gly Gln Leu Leu Val 35 40 45 Thr Arg Arg Ala Leu Ser Lys Lys Ala Trp Pro Gly Val Trp Thr Asn 50 55 60 Ser Val Cys Gly His Pro Gln Leu Gly Glu Ser Asn Glu Asp Ala Val 65 70 75 80 Ile Arg Arg Cys Arg Tyr Glu Leu Gly Val Glu Ile Thr Pro Pro Glu 85 90 95 Ser Ile Tyr Pro Asp Phe Arg Tyr Arg Ala Thr Asp Pro Ser Gly Ile 100 105 110 Val Glu Asn Glu Val Cys Pro Val Phe Ala Ala Arg Thr Thr Ser Ala 115 120 125 Leu Gln Ile Asn Asp Asp Glu Val Met Asp Tyr Gln Trp Cys Asp Leu 130 135 140 Ala Asp Val Leu His Gly Ile Asp Ala Thr Pro Trp Ala Phe Ser Pro 145 150 155 160 Trp Met Val Met Gln Ala Thr Asn Arg Glu Ala Arg Lys Arg Leu Ser 165 170 175 Ala Phe Thr Gln Leu Lys 180 <210> 34 <211> 546 <212> DNA <213> Escherichia coli <400> 34 atgcaaacgg aacacgtcat tttattgaat gcacagggag ttcccacggg tacgctggaa 60 aagtatgccg cacacacggc agacacccgc ttacatctcg cgttctccag ttggctgttt 120 aatgccaaag gacaattatt agttacccgc cgcgcactga gcaaaaaagc atggcctggc 180 gtgtggacta actcggtttg tgggcaccca caactgggag aaagcaacga agacgcagtg 240 atccgccgtt gccgttatga gcttggcgtg gaaattacgc ctcctgaatc tatctatcct 300 gactttcgct accgcgccac cgatccgagt ggcattgtgg aaaatgaagt gtgtccggta 360 tttgccgcac gcaccactag tgcgttacag atcaatgatg atgaagtgat ggattatcaa 420 tggtgtgatt tagcagatgt attacacggt attgatgcca cgccgtgggc gttcagtccg 480 tggatggtga tgcaggcgac aaatcgcgaa gccagaaaac gattatctgc atttacccag 540 cttaaa 546 <210> 35 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 gtctcgtaat agtttaagga ggtttgttat gcaaacggaa cacgtcattt ta 52 <210> 36 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 ccttatacct gtttatcaaa tctagattat ttaagctggg taaatgcaga ta 52

Claims (17)

1,4-dihydroxy-2-naphthoate (DHNA) biosynthetic pathway and farnesyl pyrophosphate (FPP) biosynthetic pathway, 1,4-dihydroxy-2 -An enzyme capable of synthesizing demethylmenaquinol-8 (DMM-8) from naphtholate (DHNA) and octaprenyl pyrophosphate (OPP) and metaquinol-8 (Menaquinol-8, M In E. coli, which has an enzyme that converts -8) to menaquinone-8 (MK-8), and does not have the ability to produce menaquinone-7,
(i) hepS and hepT , which are genes encoding enzymes that convert farnesyl pyrophosphate (FPP) into heptaprenyl pyrophosphate (HPP);
(ii) 1, an enzyme capable of synthesizing dimethylmetaquinol-7 (DMM-7) from 1,4-dihydroxy-2-naphtholate (DHNA) and heptaprenyl pyrophosphate (HPP) MenA, a gene encoding a ,4-dihydroxy-2-naphthoate heptaprenyltransferase;
(iii) of dimethyl meta-quinol -7 (DMM-7) a meta-quinol -7 (menaquinol-7, M- 7) gene coding for the enzyme conversion to ubiE;
(iv) yhcB , a gene encoding an enzyme that converts metaquinol-7 (M-7) to menaquinone-7 (MK-7);
(v) mvaE, mvaK1 , mvaK2 and mvaD , which are genes encoding enzymes involved in the mevalonate (MVA) synthesis pathway; And
(vi) Isopentenyl-diphosphate delta-isomerase (isopentenyl-diphosphate Delta-isomerase) is a recombinant microorganism having idi, which is a gene encoding an enzyme, has been introduced and has the ability to produce menaquinone-7.
delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete Menaquinone-7 production method comprising the following steps:
(a) culturing the recombinant microorganism of claim 1 to produce menaquinone-7; And
(b) obtaining the produced menaquinone-7.

Images