KR102234586B1 - Method for production of siderophore using mushrooms - Google Patents

Abstract

The present invention is to solve the problem that siderophore biosynthesis is interrupted when iron ions are present in the medium of Agaricus bisporus. Transformants in which HapX genes, a transcription factor related to siderophore biosynthesis to stop expression by iron ions, are controlled by an expression promoter are produced. As a result, Agaricus bisporus transformant T2 strain has the improved production capacity of siderophore more than 10 times, regardless of the presence or absence of iron ions, compared to wild-type Agaricus bisporus.

Description

How to produce siderophore from mushrooms {Method for production of siderophore using mushrooms}

The present invention relates to a method for producing siderophores from mushrooms.

Iron ions (Fe ³⁺ ) are essential micronutrients involved in various redox reactions by binding to proteins or organic low molecular weight substances in living organisms. In the natural environment, iron exists under conditions that are difficult for living organisms to absorb. As one of the effective methods of absorbing iron, microorganisms secrete siderophores to the outside of the cell, adsorb iron ions, and then absorb iron into the cells. Take a strategy to ensure that. Sideropoa is a low-molecular organic material that binds to metal ions through coordination bonds, and is structurally divided into carboxylates, hydroxamayes, and catecholates (Aznar and Dellagi ( 2015) J. Exp. Bot. 66, 3001-2010).

On the other hand, sideropoa has been applied in various fields for its adsorption function of iron ions. In the case of pathogenic microorganisms, the ability to use iron ions affects the pathogenicity , and desferol, a sideropoa produced by Pseudomonas spp ., has been developed as a pharmaceutical and is used to weaken the pathogenicity of pathogenic microorganisms (Visca et al. The Dual Personality of Iron Chelators: Growth Inhibitors or Promoters?Antimicrob Agents Chemother.2013;57:2432-2433). In addition, when antibiotic resistance is indicated by interfering with the absorption of antibiotics, attempts have been made to control antibiotic-resistant microorganisms by treating antibiotics in the form of sideropoa conjugates to promote antibiotic absorption. In addition, since siderophores have the ability to bind heavy metals other than iron ions, attempts have been made to use them to remove heavy metals from contaminated water (Saha et al. Microbial siderophores and their potential applications: a review. Environ Sci Pollut Res Int. 2016;23:3984-3999).

According to recent research results, it has been reported that ferrichrome, a sideropoa produced by the lactobacillus casei , effectively prevents colon cancer in a mouse model system (Konishi et al. Probiotic-derived ferrichrome inhibits colon cancer progression via JNK-mediated. apoptosis.Nature communications 2016;7:12365). This means that sideropoa is a substance that plays an important role in which lactic acid bacteria have been shown to have an effect on colon cancer. Sideropoa has various structures depending on the type of microorganism, and chemical synthesis is very difficult in the case of some major sideropores due to structural complexity.

In fungi, sideropoa is mainly composed of hydroxamate sideropoa, ferrichrome and fusarinine, which are biosynthesized through the activity of nonribosomal peptide synthetase assembly (NRPS). do. According to the biosynthetic pathway modeled on Aspergillus fumigatus, hydroxamates sideropoa are biosynthesized using L-ornithine, a non-proteinaceous amino acid, as a precursor. L-ornithine is converted to N5-hydroxyornithine by the ornithine-N5-monooxygenase encoded by the SidA gene, and N5-hydroxyornithine is N5-acylated by the activities of the N-acyltransferase enzymes SidF and SidL, respectively, and these are SidD and SidC NRPS. Through activity, fusarinine C and ferrichrome are biosynthesized, respectively. Among the mushrooms, the presence of hydroxamate sideropoa such as ferrichrome and fusarinine was found in the mushrooms, as in Aspergillus and other aspergillus (Eng-Wilmot et al. 1992).

Through the above literature studies, it was found that the Sid gene and transcription factors are involved in the biosynthesis of sideropoa in Ascythemia, but there are no related studies in the basidiomycete edible mushroom.

Accordingly, the present invention discovered genes involved in the biosynthesis of sideropoa in Basidiomycetes in order to produce a high concentration of sideropoa in the edible mushroom mushroom, and the genes that determine sideropoa biosynthesis were determined, through which It was revealed that AbHapX, a homologous gene of the HapX gene, is a crucial regulator of sideropore biosynthesis. On the other hand, the mushroom AbHapX was expressed only under iron-deficient conditions, so the presence of iron ions in the medium inhibited HapX expression. Therefore, for the production of sideropoa through cultivation of mushroom bacteria, a minimal medium deficient in iron ions must be used. On the other hand, when the minimal medium is used, the growth of mushroom fungi is extremely inhibited, making it difficult to achieve the high-concentration production of the targeted sideropoa.

In order to solve this problem, in the present invention, through the constant expression of the HapX gene, excessive production of sideropoa was attempted through a transformant in which sideropoa is overproduced even in the presence of iron ions. The present invention was completed by producing a mushroom transformant that mass-produces lofoa.

An object of the present invention is to provide a mushroom transformant that mass-produces sideropoa even under conventional complex nutrient medium conditions, and provides a method for mass-producing sideropoa through this.

In order to solve the above problems, the present invention provides a recombinant vector having enhanced siderophore production capacity including a glyceraldehyde phosphate dehydrogenase (GPD) promoter and an AbHapX gene operably linked to the promoter.

In one embodiment of the present invention, the "GPD promoter" may be represented by SEQ ID NO: 3, and the "AbHapX gene" may be represented by SEQ ID NO: 4.

In addition, the present invention is a'GPD (glyceraldehyde phosphate dehydrogenase) promoter and a siderophore (siderophore)-producing ability enhanced recombinant vector containing the AbHapX gene operably linked to the promoter' transduced siderophore production capacity is enhanced. Strains are provided.

In one embodiment of the present invention, the "vector-transduced siderophore-producing strain" may be characterized in that it is an Agrobacterium tumefaciens AGL-1 (Agrobacterium tumefaciens AGL-1) strain.

In addition, the present invention provides a novel Agaricus bisporus (Agaricus bisporus) strain with accession number KCTC18789P, enhanced siderophore production ability.

In one embodiment of the present invention, the "Agaricus bisporus strain" may be characterized by an increased ^{iron ion (Fe 3+) binding ability.}

In an embodiment of the present invention, the "Agaricus bisporus strain" may be characterized in that 6000 mAU to 6500 mAU of sideropoa is produced regardless of the presence or absence ^{of iron ions (Fe 3+ ).}

In addition, the present invention is a'siderophore-producing ability-enhanced recombinant vector including a GPD (glyceraldehyde phosphate dehydrogenase) promoter and AbHapX gene operably linked to the promoter'transduced'siderophore-producing ability is enhanced. Agrobacterium tumefaciens AGL-1 (Agrobacterium tumefaciens AGL-1) strain'introduced sideropoa-producing ability is enhanced to provide a mushroom mushroom.

In addition, the present invention provides a composition for producing siderophores comprising a'GPD (glyceraldehyde phosphate dehydrogenase) promoter and a siderophore-producing ability enhanced recombinant vector comprising the AbHapX gene operably linked to the promoter' do.

In addition, the present invention comprises a new Agaricus bisporus strain, the lysate of the strain, the culture supernatant of the strain, a fruiting body of the strain, or a mixture thereof, with accession number KCTC18789P, enhanced siderophore production capability. It provides a composition for producing sideropoa.

In addition, the present invention provides a method for producing sideropoa in mushrooms comprising the step of overexpressing the AbHapX gene.

In one embodiment of the present invention, the "mushroom" may be characterized in that it is a mushroom.

In one embodiment of the present invention, the "step of overexpressing the AbHapX gene" is a recombination with enhanced siderophore production capability including a'GPD (glyceraldehyde phosphate dehydrogenase) promoter and AbHapX gene operably linked to the promoter. Vector' or'a strain with enhanced siderophore-producing ability transduced with a recombinant vector having enhanced siderophore-producing ability including a GPD (glyceraldehyde phosphate dehydrogenase) promoter and AbHapX gene operably linked to the promoter' It can be characterized by using.

In the present invention, in order to solve the problem that siderophore biosynthesis is stopped when iron ions are present in the culture medium of mushrooms, the HapX gene, a transcription factor related to sideropoa biosynthesis, whose expression is stopped by iron ions, is in a constant expression promoter. A transformant that was controlled by was produced. Through this, it was confirmed that the mutant mushroom transformant strain produced more than 10 times the siderophore, regardless of the presence or absence of iron ions, compared to the wild type mushroom mushroom.

1 is a diagram confirming the existence of the bZip transcription factor domain and the yeast Hap4 binding protein binding domain of HapX in the AbHapX protein sequence of the present invention.
Figure 2 is a diagram confirming the classification of HapX protein of fungi that AbHapX of the present invention is grouped into the same group as HapX of Basidiomyces (the location of AbHapX in mushrooms is indicated by an arrow).
Figure 3 is a diagram showing a vector map of the mushroom recombinant vector pBGgHg2-hapX of the present invention.
Figure 4 is a diagram showing the manufacturing process of the mushroom transformant of the present invention.
Figure 5 is a diagram showing the analysis of the DNA markers of the mutant mushroom transformant of the present invention.
6 is a diagram showing the RT-PCR results of the mushroom transformant of the present invention.
7 is a diagram showing the analysis of the expression levels of AbHapX and AbSidD genes compared to b-tubulin of the mushroom transformant of the present invention.
Figure 8 is a diagram confirming the stability of the mushroom transformant of the present invention.
9 is a diagram showing the analysis of sideropoa produced by the mushroom transformant of the present invention by HPLC.
FIG. 10 is a diagram illustrating the ability to bind sideropoa iron ions using the mutton mushroom transformant of the present invention using Chrome azurol S (CAS).

An object of the present invention is to provide a recombinant vector having enhanced siderophore production capability, including a glyceraldehyde phosphate dehydrogenase (GPD) promoter and an AbHapX gene operably linked to the promoter.

In one embodiment of the present invention, the GPD promoter may be represented by SEQ ID NO: 3, and the AbHapX gene may be represented by SEQ ID NO: 4, but is not limited thereto.

In addition, the present invention provides a strain having enhanced siderophore-producing ability transduced with a recombinant vector having enhanced siderophore production capability including a glyceraldehyde phosphate dehydrogenase (GPD) promoter and an AbHapX gene operably linked to the promoter. It aims to provide.

In one embodiment of the present invention, the vector-transduced siderophore-producing strain is enhanced may be characterized in that Agrobacterium tumefaciens AGL-1 (Agrobacterium tumefaciens AGL-1) strain, but limited thereto. It does not become.

In addition, it is an object of the present invention to provide a novel Agaricus bisporus strain with accession number KCTC18789P, enhanced sideropoa production ability.

In one embodiment of the present invention, the Agaricus bisporus strain may ^{be characterized by an increased iron ion} (Fe 3+) binding capacity, but is not limited thereto.

In an embodiment of the present invention, the Agaricus bisporus strain may be characterized in that 6000 mAU to 6500 mAU of sideropoa is produced regardless of the presence or absence ^{of iron ions (Fe 3+ ), but limited thereto.} It does not become.

In addition, the present invention is a glyceraldehyde phosphate dehydrogenase (GPD) promoter and a recombinant vector with enhanced siderophore production capability including the AbHapX gene operably linked to the promoter. It is an object of the present invention to provide a mushroom mushroom with enhanced siderophore-producing ability into which the Agrobacterium tumefaciens AGL-1 strain is introduced.

In addition, the present invention provides a composition for producing siderophores comprising a recombinant vector having enhanced siderophore production capability including a GPD (glyceraldehyde phosphate dehydrogenase) promoter and an AbHapX gene operably linked to the promoter. The purpose.

In addition, the present invention comprises a new Agaricus bisporus strain, the lysate of the strain, the culture supernatant of the strain, a fruiting body of the strain, or a mixture thereof, with accession number KCTC18789P, enhanced siderophore production capability. It is an object of the present invention to provide a composition for producing sideropoa.

Finally, an object of the present invention is to provide a method for producing sideropoa in mushrooms comprising the step of overexpressing the AbHapX gene.

In one embodiment of the present invention, the mushroom may be characterized in that it is a mushroom mushroom, but is not limited thereto.

In one embodiment of the present invention, the step of overexpressing the AbHapX gene comprises a glyceraldehyde phosphate dehydrogenase (GPD) promoter and an AbHapX gene operably linked to the promoter. It is characterized by using a strain having enhanced siderophore-producing ability transduced with a recombinant vector having enhanced siderophore production capability including a glyceraldehyde phosphate dehydrogenase (GPD) promoter and AbHapX gene operably linked to the promoter. However, it is not limited thereto.

Hereinafter, the present invention will be described in detail as an embodiment of the present invention with reference to the accompanying drawings. However, the following implementation examples are presented as examples of the present invention, and if it is determined that a detailed description of a technique or configuration well known to those skilled in the art may unnecessarily obscure the subject matter of the present invention, the detailed description may be omitted. However, the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of equality interpreted from the description of the claims to be described later and therefrom.

In addition, terms used in the present specification are terms used to properly express preferred embodiments of the present invention, which may vary depending on the intention of users or operators, or customs in the field to which the present invention belongs. Therefore, definitions of these terms should be made based on the contents throughout the present specification. Throughout the specification, when a part "includes" a certain component, it means that other components may be further included rather than excluding other components unless specifically stated to the contrary.

Throughout this specification,'%' used to indicate the concentration of a specific substance is (w/w)% for solid/solid, (w/v)% for solid/liquid, and Liquid/liquid is (v/v) %.

In one aspect, the present invention provides a recombinant vector having enhanced siderophore production capability, including a glyceraldehyde phosphate dehydrogenase (GPD) promoter and an AbHapX gene operably linked to the promoter.

In the present invention, the term "recombinant vector" refers to a vector capable of expressing a protein of interest or RNA of interest in a suitable host cell, and refers to a genetic construct comprising essential regulatory elements operably linked to express a gene insert.

In the present invention, the term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein or RNA of interest to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect the expression of the encoding nucleic acid sequence. The operative linkage with the recombinant vector can be prepared using gene recombination techniques well known in the art, and site-specific DNA cleavage and linkage use enzymes generally known in the art.

The vector system of the present invention can be constructed through various methods known in the art, and specific methods for this are disclosed in Sambrook et al. (2001), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, This document is incorporated herein by reference.

Hereinafter, the present invention will be described in more detail through examples. However, the above embodiments and experimental examples are presented as examples of the present invention, and if it is determined that a detailed description of a technique or configuration well known to those skilled in the art may unnecessarily obscure the subject matter of the present invention, the detailed description thereof will be omitted. And the invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of equality interpreted from the description of the claims to be described later and therefrom.

Preparation Example 1. Culture conditions of mushroom fungus

Three kinds of wild-type mushroom fungi collected from farms were collected and dried from various compost extracts, extracted at 50 g/L, and cultured, and their growth characteristics were investigated. After inoculating each strain in a solid plate medium with the medium composition shown in Table 1, it was cultured at 25° C. for 2 weeks, and the diameter of the cultured mycelium was measured. As a result, the Mushroom Mushroom NH strain showed the best growth in the sawdust extract No. 3 medium.

badge Furtherance Growth by strain (cm) NH HO TM PDA PDA 24 g/L 1.2±0.1 1.4±0.1 1.1±0.1 Sawdust 1 PDA 24 g/L, sawdust 1 extract 20% 2.2±0.2 2.0±0.2 2.4±0.1 Sawdust 2 PDA 24 g/L, sawdust 2 extract 20% 2.3±0.2 2.4±0.2 2.2±0.1 Sawdust 3 PDA 24 g/L, sawdust 3 extract 20% 2.5±0.2 2.4±0.2 2.4±0.2 Rice straw PDA 24 g/L, rice straw extract 20% 2.2±0.2 2.3±0.1 2.3±0.2 chaff PDA 24 g/L, rice husk extract 20% 2.1±0.1 2.0±0.2 2.0±0.1 straw PDA 24 g/L, 20% straw extract 1.7±0.2 1.5±0.2 2.4±0.1

Preparation Example 2. Securing AbHapX and Pgpd (GDP promoter) genes

In order to secure the AbHapX gene from the Mushroom NH strain of Preparation Example 1, the mushroom fungi were cultured in a potato-dextrose liquid medium (PDB) for 2 weeks. The culture medium was centrifuged to obtain mycelium, and chromosomal DNA was extracted from the mycelium.

In order to obtain the AbHapX gene from the isolated chromosomal DNA, the base sequences of the HapX gene derived from existing fungi were compared and analyzed to obtain nucleotide sequences corresponding to both ends of the HapX gene, and based on this, a primer set (Table 2) was prepared.

purpose Sequence number Primer name Sequence (5' to 3') Made by AbHapX One hapX-F GAATTCATTTAAATCATGTCCGCAGCACTCCTAC 2 hapX-R GAATTCGGGCCCATTTGGGGAACGTCAGTCGT

Using the prepared primers and the extracted chromosomal DNA, the HapX gene of the Mushroom NH strain was amplified by a conventional PCR method, and the base sequence was determined. Mushroom AbHapX gene has a total length of 4750bp (SEQ ID NO: 4), and 12 introns were included in the gene. For the constant expression of the HapX gene, a GDP promoter (SEQ ID NO: 3; Pgpd) that regulates the expression of a house-keeping gene, GDP (glyceraldehyde phosphate dehydrogenase), was used, and the upstream 264 bp of the GPD sequence was used. It was obtained by PCR in a similar manner to the above-described AbHapX gene acquisition process.

Preparation Example 3. Analysis of AbHapX gene

The protein sequence encoded by the obtained AbHapX gene was analyzed using a protein translation tool (https://web.expasy.org/translate/) to obtain a protein sequence consisting of 1258 amino acids (SEQ ID NO: 5).

In order to confirm whether this protein is a HapX protein, the Motif Scan (https://myhits.isb-sib.ch/cgi-bin/motif_scan) program is used to bind the bZip transcription factor domain of HapX and the yeast Hap4 in the protein sequence. It was confirmed as shown in FIG. 1 that the protein binding domain exists. In addition, it was confirmed as shown in FIG. 2 that AbHapX is grouped into the same group as HapX of Basidiomyces in the result of comparison with the fungal HapX whose sequence is known. It can be seen that the above results indicate that AbHapX is HapX of mushroom mushrooms.

Example 1. Recombinant vector construction and Agrobacterium tumefaciens Transformant production

The eGFP gene was removed from the binary vector pBGgHg, and the AbHapX gene regulated by the GPD promoter was inserted to prepare a recombinant vector (pBGgHg2-hapX) as shown in FIG. 3.

The prepared pBGgHg2-hapX was introduced into the Agrobacterium tumefaciens AGL-1 strain. To this end, A. tumefaciens AGL-1 strain was inoculated into 10 mL LB medium, cultured at 28° C. _{until an OD 600 nm} value of 0.5 to 0.8, and the culture solution was centrifuged at 13000 rpm for 10 minutes to isolate the bacteria. The separated bacteria were suspended in 1X TE buffer, washed, and then centrifuged again. The isolated A. tumefaciens AGL-1 bacteria were resuspended in 2 mL 10% LB medium, dispensed at 250 μL, and rapidly frozen in liquid nitrogen and stored at -70°C.

For the introduction of pBGgHg2-hapX, 10 μL of 100 ng/μL of pBGgHg2-hapX vector was added to the prepared Competent cell, mixed, and heat-treated at 37° C. for 5 minutes. Thereafter, 1 mL LB medium was added, cultured at 28° C. for 2 hours, and centrifuged to separate cells. The isolated cells were suspended in 200 μL of LB medium, plated on LB agar medium containing 50 mg/L of kanamycin, and cultured at 28° C. for 2 days to obtain A. tumefaciens AGL-1 transformed with pBGgHg2-hapX.

Example 2. Preparation of Mushroom Mushroom Transformants

In order to introduce the AbHapX gene into the Mushroom NH strain, the transformed A. tumefaciens AGL-1 strain was cultured at 28° C. in _{100 mL LB medium until the OD 600 nm value became 0.8.} The culture medium was centrifuged at 5000 rpm to remove the supernatant, and the precipitated bacteria were collected in 100 mL AB-IM medium containing 200 μM Acetosyringone (Glucose 2 g/L, Glycerol 5 mL/L, NH ₄ Cl 1 g/L, MgSO ₄ 0.3 g/L, KCl 0.15 g/L, CaCl ₂ 0.01 g/L, FeSO ₄ 0.0025 g/L, 0.5M MES buffer (pH5.3) 80 mL/L) and incubated at 25°C for 6 hours I did.

The wrinkled tissue of mushrooms was cut into 1 mm size, mixed with A. tumefaciens AGL-1 culture solution transformed with pBGgHg2-hapX, and incubated for 15 minutes. AB-IM agar medium (Glucose 2 g/L, Glycerol 5 mL/L, NH ₄ Cl 1 g/L, MgSO ₄ 0.3 g/L, KCl 0.15 g/L, CaCl ₂ 0.01 g/L, FeSO ₄ 0.0025 g/L, 0.5M MES buffer (pH5.3) 80 mL/L, Agar 16 g/L, Kanamycin 50 mg/L) at regular intervals and then at 25°C for 3 days Cultured.

The cultivation of the wrinkled mushrooms of mushrooms is the primary selective medium (PDB 24 g/L, Compost extract 200 mL/L, Agar 16 g/L, HygromycinB 30 mg/L, Cefotaxime 150 mg/L, Ampicillin 100 mg/L) , Kanamycin 100 mg/L, Chloramphenicol 25 mg/L, Gentamycin 100 mg/L) and incubated for 10 days at 25°C. The tissue where the mycelium grows in the primary selective medium is transferred to the secondary selective medium (PDB 24 g/L, Compost extract 200 mL/L, Agar 16 g/L, HygromycinB 50 mg/L) and cultured again at 25°C for 10 days. I did. Transformants were isolated by separating the hyphae of the tissues that the hyphae protruded and settled in the medium and subcultured with a new secondary selective medium (see FIG. 4).

Example 3. Identification of transformants

The successful transformation of the transformant produced through the above-described transformation method using Agrobacterium was confirmed by the presence or absence of the inserted Pgpd-AbHapX gene, the vector side hph gene, and the mushroom ITS gene marker. As a result, as shown in FIG. 5, three markers representing successful transformation were detected in 42 samples out of a total of 172 samples, showing a total transformation success rate of 24.4%.

To confirm whether the identified transformants express the AbHapX gene, the four Mushroom Mushroom Transformants T1, T2, T3, and T4 and the wild-type Mushroom Mushrooms were each prepared in a minimal liquid medium containing 0.1 mM _{FeCl 3 or not for 1 week.} After incubation, total RNA was extracted. The extracted RNA was analyzed for mRNA expression of sideropoa biosynthetic gene through RT-PCR analysis. As a result, as shown in FIG. 6, AbHapX gene was expressed only in the absence of iron ions in the wild type, but AbHapX was expressed in all four transformants regardless of the presence or absence of iron ions.

In addition, as shown in FIG. 7, it was confirmed that in T1, T2 and T3, the AbSidD gene encoding the NRPS enzyme gene, which is the final step of sideropoa biosynthesis, was expressed in a pattern similar to that of AbHapX.

Example 4. Stability analysis of transformants

In order to find out whether the transformant stably maintains the introduced gene, each transformant was serially subcultured 20 times in PDA medium without antibiotics (hygromycin). As a result of cultivation, even if the number of subcultures increased, there was no change in the growth capacity of the mycelium, and there was no change in the shape of the mycelium colony. In addition, it was confirmed that AbHapX and hph genes were stably maintained on chromosomal DNA after 20 generations as shown in FIG. The above results prove that the AbHapX gene was successfully inserted into the mushroom genome.

Example 5. Confirmation of production of sideropoa

The ability of the transformant to produce siderophores was cultured in the above-described liquid medium, and the concentration of siderophores in the supernatant was analyzed by HPLC to verify. A C18 column was used for HPLC analysis. As shown in FIG. 9, when wild-type mushroom mushrooms were cultured in the presence of iron ions, no siderophores in the culture medium were observed, and 600 mAU of sideropores were produced only in the absence of iron ions. On the other hand, in transformant T1, sideropores of 6000 mAU or more were produced regardless of the presence or absence of iron ions, and the sideropore production ability of the transformants was improved by more than 10 times regardless of iron ions.

Example 6. Confirmation of iron binding ability of sideropoa

The ability of transformants to produce sideropoa was investigated by the ability to bind iron ions using Chrome azurol S (CAS). CAS-iron ion complex (CAS-Fe ³⁺ ), in which CAS and iron ions are bound, shows strong absorption ability near 650 nm. On the other hand, CAS without iron ions reduces absorbance at 650 nm, so observing the change in absorbance can verify the production of sideropoa.

In the present invention, after culturing wild-type and transformant T2 in a complex medium for 1 week, absorbance was investigated by adding a culture solution (0.25 ml) to a CAS reagent (0.75 ml) bound with iron ions.

In the case of the wild-type culture medium as shown in Figure 10, there was no change in the absorbance of the CAS-iron ion complex, which indicates that the wild-type mushrooms do not produce siderophores that take iron ions from ^{CAS-Fe 3+.} On the other hand, it was observed that the absorbance of 650 nm was rapidly decreased in transformant T2. These results indicate that the siderophore produced by the transformant is actually sideropoa with the activity of binding to iron ions.

As confirmed in the above examples, the present inventors confirmed that the Mushroom Mushroom Transformant T2 strain improved sideropoa production capacity by 10 times or more and the excellent iron ion binding ability compared to the wild-type Mushroom Mushroom, regardless of the presence or absence of iron ions. Thus, the present invention was completed.

So far, the present invention has been looked at around its preferred embodiments.

Those of ordinary skill in the art to which the present invention pertains will be able to understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from a descriptive point of view rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the above description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

Biological Resource Center KCTC18789P 20191018

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> Method for production of siderophore using mushrooms <130> PN1910-510 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of AbHapX gene <400> 1 gaattcattt aaatcatgtc cgcagcactc ctac 34 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of AbHapX gene <400> 2 gaattcgggc ccatttgggg aacgtcagtc gt 32 <210> 3 <211> 264 <212> DNA <213> Artificial Sequence <220> <223> GDP promoter <400> 3 gaggtccgca agtagattga aagttcagta cgtttttaac aatagagcat tttcgaggct 60 tgcgtcattc tgtgtcaggc tagcagttta taagcgttga ggatctagag ctgctgttcc 120 cgcgtctcga atgttctcgg tgtttagggg ttagcaatct gatatgataa taatttgtga 180 tgacatcgat agtacaaaaa ccccaattcc ggtcacatcc accatctccg ttttctccca 240 tctacacaca acaacttatc gccg 264 <210> 4 <211> 4860 <212> DNA <213> Agaricus bisporus <400> 4 catgtccgca gcactcctac aagatccaga agacattgac tactctgata tcgaaaacaa 60 gtaaactcga aggctacctg tagatcaacg tactcactgt ctgctagata caaaatccaa 120 tatgatgaaa gtttcgataa cgtgctcctt gtagatggtg tacccatcat cggaaaggac 180 aagctcgaaa aattgttggc aaaaatctgc aaagagttct cgagaaaggg ggttactatc 240 aaacctgatg acattcacgt cccatgggac gattcgactg gcaaaagcaa agggtgtgtg 300 tgcaacccaa aaactttttt cccggctaca ttttctcacc tacggttacg aaacagtttc 360 atctttgtag agcttcgcag tgttgacgag gctaatcttg ctttggtgtc gctccacaac 420 catccgtttg atgccagaca tatcttcaag cttaatcggt ttaccgatat agagaaattt 480 gcagaacttg atgaagtata tgtagagcca gaagaggaag agttcgctcc caaggtaagt 540 ctgtgtttcc agggaagcat tctttggtga aattaatgac gattatagga acatttgagg 600 gcttggttgg cagatcctca aggacgggat caatatgtca cataccgtgg cgaagaggtt 660 ttaattcact ggcatgggaa gccttcacag tatgagattg catacaaacc agtgcgttct 720 tttccccccg taatccatgt ttagcctctc agttccgaat ggtaggaatg gaaagatttt 780 ctctacgttg cgtggtcgcc attaggtacc tatgtcgcaa ccttacaccg gcaaggcgtc 840 cgactatggg gtggtccatc ctggaagcca caacaaagat ttgctcatcc ctttgtcaag 900 ttgattgatt tctccccatg cgagaactat atcgtcacat ggtctaatga gccaattgtt 960 gttcctgagg gtgccgtaca aggtcctcaa tatttctcac cagacgacga aggaaacaat 1020 atagctgtct gggacatcaa atctggacat cttcttcgca cattctccac atatcacgaa 1080 ggcgaaaccc ctggacagaa aaagcagatg caatggccga tcttgaaatg gagtccagac 1140 gataaattca tcgcacgctt gaccccgagt cagatgataa gcatttacga gcttccggac 1200 atgggcttgc acgggaaaaa gagtttgaag atagaaggcg tcgtagattt cgagtggtgt 1260 cctcttgggg aaagagataa agaggtgacg gagagagatg caaaaggagg aattaaaacg 1320 acgaagaaag cgcgggaaaa catgcttgtg tattggaccc ccgaagtggt gaaccaacca 1380 gcgcgtgtta ctttactcag cttccccggt cgttcaatct tgcgtcaaaa aaatcttttc 1440 aatgtcactg aagtaagttc actgttggga gatttgatat cgttgcttac gcgctactta 1500 gtgtaagctt tattggcaaa accaaggaga cttcctttgc gtcaaggtcg atcgacatac 1560 gaaaaccaaa aaatctattt tttgcaacct ggagatcttt cgaatgcgcg aaaaggactt 1620 cccagttgaa gtcattgaac tcaaaggtat acatcctatt ttggtcttgg tcatattctc 1680 actcacagct aattcccaga cactgtaact gatttctcat gggaaccaaa gggagatagg 1740 tttgcaattg tttctagtag cgatcccaac ctggggaatc ccggtcctgg catcactgtg 1800 aagaccgacg tcggtttcta tcaactcgat cactccaaaa atgattttag gctcttgcgt 1860 gagtttattc ccttgtccgt cattcgccaa tttaacgcgt ggcaggtaca ctttcttctc 1920 gcacgagtaa tgccattcgg tggtctccac gagggcgcca tgtggtgcta gcaactgtcg 1980 gttcctctac caaatcggaa ctggaatttt gggatcttga ctttaactct gacgatgcga 2040 atcgaaagga aggccaagct tctaaggatg attggggcag tggaatccag ttacttgggt 2100 ctgccgacca ctatggtgtc acagacgttg aatgggatcc aagtggccga tatctcgcta 2160 ccagcgcgag cgcttggact cacacggtac cggatttcgc accttatact tgaccacttg 2220 acgacgttgc ctttcctttc cttttatagc tagagaacgg ttatgcagtc tgggatttcc 2280 gaggacaaga actaacaaag cagatccaag atcgtttcaa gcaatttatt tggcggccga 2340 ggccccctac tctactgaca aaggagcaac aaaggactat tagaaggaac ctgcgagagt 2400 atagtcgcgt attcgatgag gaggatgcgg ccgaggaaag caatgttagc gcagagcttg 2460 ttgctttgcg gaaacgtctt gtggacgaat ggaatgcttg gcgtacattg cgcaaacggg 2520 aattggctga tgaacgtggg cacaaaaccg ataagcacga agtgagcgag gccaaggagg 2580 agattgaggt gtgggtagac gaagtcattg aacaaatcga ggaggtatta gaataatgaa 2640 tgtagggtcg gtttcgatcg catcccctgc ttggattcga attcacgcat tgatgagaaa 2700 ataagattgg ggcacatggc tgcccggaaa agaggaatgg tccgggaaga aataagctgt 2760 ttgtctgaat gaccgatcgc ctatttcgtg acagaggccg gtaatcgtgg atacgcctga 2820 ggaatctctc actcttccgt cgtgacggct tacacgtcgc ggaaaaatgg acacgcacgc 2880 tcgcgaaggc gctcatcctg ggacaggccc gcttctcacg ccacggtgtg aacttgatga 2940 aggcggggtt gcgtccccgc gggaccgaag ttgccggcta cggtaatctg ataagacaac 3000 ctccggcatc attaaagacc gtctctccct ccactttccc cgtcgcacat gtcgactccc 3060 tccccctctc ctactactct ctgggcaaca ggtatttcct ctccatctcc ctcctcttct 3120 tcctctctca tcgccgcaaa gcttccaagg aatgggtcat acaacccaaa cccaagcccg 3180 ggcgcaagcc taagaaagac ttgtcggccg ccgtcaagga cgaggaagag gcatgtgttg 3240 cctaccttcc cctttccagc gcatgctaat ctattgtcta gagtgactcc aagggccgtc 3300 gggtccagaa taggtgggtt atcgcaatca gatagtcgaa tgtcacccat ctcatcagtt 3360 tcggcagagc tgctcagcgc gctttccgcg agcgcaagca atctcaacta gccgagctac 3420 aatcacgtat acaacaatac gaacaaggag agatcgaacg caatgtcgcg cttcagaaca 3480 tcgcaaaacg cttgaaggaa gagaatgaag ctctgcgaag ggaaaattct ctgctcaaag 3540 agagaataac aaagcaagag caagagcagc gggcagccaa cgaaaagaag cgttggagag 3600 acaattcccc cggtagtgtc cattcaccta aagctcctgc acgcaagaaa ccgcgcttca 3660 gtcccgaaac acacgacaag cctttgtcaa cttatttgcc ttccccccct tcgatgctcg 3720 attcccccaa ctcttcaaat tcatcggaca gcggattttc acccatgtac gaagtgcaat 3780 cttccgaagc gacgcaccct atcatcgcca acatcgatct aaacaataca aatagatcaa 3840 tatctctcga gtcctttgat tactctcctt ctttcaattg tggattctgt agcgacgata 3900 caccttgtgt ctgcagagag cttgctgcgc aacaggtttc tgagcgctcg aatctcagca 3960 atttcaagtc ggaggaattt acgggtgttg ttcatctaga gccggctcca caaccccaat 4020 cgagccggtc ttccatccta gataatctgc ccgcttatcg gccccctgtg cccctccgcc 4080 gccgtgaaac cccttgtacg gttaactcga tttttccagt tcaggtcttg ccagaaactc 4140 gaccccctac catctcttct cagccaacat gttcgggaga cccatcgaac tgtctcgctt 4200 gcgcagatga tgcctttggt aaggccttct gttctgcaat taaagagacg attgctgctc 4260 gcccttcctg tgttgattat cccggaggtg ttccatcatc ttctcacaat ccttgtaaca 4320 gccgaggcgg ttgtgaacat tgtatatcag atccgacggc gaacctcaat ggctatgatt 4380 cttcagaatc aattcctacg aacgcggcgt ggcagcaaat caaggctcac cccaacgtct 4440 catttgccga cctctcttta cttgctaatg tggtggccag ccgctcgaga tgtactggtc 4500 cccggatccc actttctcca agtccagaat caaagtttac tcctccgaca ccaccccttg 4560 ccccgcccgc cgacaatgag actattgtac tcacagaccc tcatgcgcaa tataaagaga 4620 aagagaaagc tcagcgtgag ggggcctcac ctccacctcg ggacgtttta gctcgctgtg 4680 ggagaatccg cgaagtttca acgtctgcgg tgcacgacgc cctacgacta cttgatgtca 4740 agttcccata gctggcatca gaacgatttg taaattgcat aactagtatt ttgtatatga 4800 tcaatcctca atgtagtata tattacacca ttacattata acgactgacg ttccccaaat 4860 4860 <210> 5 <211> 1258 <212> PRT <213> Agaricus bisporus <400> 5 Met Ser Ala Ala Leu Leu Gln Asp Pro Glu Asp Ile Asp Tyr Ser Asp 1 5 10 15 Ile Glu Asn Lys Tyr Lys Ile Gln Tyr Asp Glu Ser Phe Asp Asn Val 20 25 30 Leu Leu Val Asp Gly Val Pro Ile Ile Gly Lys Asp Lys Leu Glu Lys 35 40 45 Leu Leu Ala Lys Ile Cys Lys Glu Phe Ser Arg Lys Gly Val Thr Ile 50 55 60 Lys Pro Asp Asp Ile His Val Pro Trp Asp Asp Ser Thr Gly Lys Ser 65 70 75 80 Lys Gly Phe Ile Phe Val Glu Leu Arg Ser Val Asp Glu Ala Asn Leu 85 90 95 Ala Leu Val Ser Leu His Asn His Pro Phe Asp Ala Arg His Ile Phe 100 105 110 Lys Leu Asn Arg Phe Thr Asp Ile Glu Lys Phe Ala Glu Leu Asp Glu 115 120 125 Val Tyr Val Glu Pro Glu Glu Glu Glu Phe Ala Pro Lys Glu His Leu 130 135 140 Arg Ala Trp Leu Ala Asp Pro Gln Gly Arg Asp Gln Tyr Val Thr Tyr 145 150 155 160 Arg Gly Glu Glu Val Leu Ile His Trp His Gly Lys Pro Ser Gln Tyr 165 170 175 Glu Ile Ala Tyr Lys Pro Glu Trp Lys Asp Phe Leu Tyr Val Ala Trp 180 185 190 Ser Pro Leu Gly Thr Tyr Val Ala Thr Leu His Arg Gln Gly Val Arg 195 200 205 Leu Trp Gly Gly Pro Ser Trp Lys Pro Gln Gln Arg Phe Ala His Pro 210 215 220 Phe Val Lys Leu Ile Asp Phe Ser Pro Cys Glu Asn Tyr Ile Val Thr 225 230 235 240 Trp Ser Asn Glu Pro Ile Val Val Pro Glu Gly Ala Val Gln Gly Pro 245 250 255 Gln Tyr Phe Ser Pro Asp Asp Glu Gly Asn Asn Ile Ala Val Trp Asp 260 265 270 Ile Lys Ser Gly His Leu Leu Arg Thr Phe Ser Thr Tyr His Glu Gly 275 280 285 Glu Thr Pro Gly Gln Lys Lys Gln Met Gln Trp Pro Ile Leu Lys Trp 290 295 300 Ser Pro Asp Asp Lys Phe Ile Ala Arg Leu Thr Pro Ser Gln Met Ile 305 310 315 320 Ser Ile Tyr Glu Leu Pro Asp Met Gly Leu His Gly Lys Lys Ser Leu 325 330 335 Lys Ile Glu Gly Val Val Asp Phe Glu Trp Cys Pro Leu Gly Glu Arg 340 345 350 Asp Lys Glu Val Thr Glu Arg Asp Ala Lys Gly Gly Ile Lys Thr Thr 355 360 365 Lys Lys Ala Arg Glu Asn Met Leu Val Tyr Trp Thr Pro Glu Val Val 370 375 380 Asn Gln Pro Ala Arg Val Thr Leu Leu Ser Phe Pro Gly Arg Ser Ile 385 390 395 400 Leu Arg Gln Lys Asn Leu Phe Asn Val Thr Glu Cys Lys Leu Tyr Trp 405 410 415 Gln Asn Gln Gly Asp Phe Leu Cys Val Lys Val Asp Arg His Thr Lys 420 425 430 Thr Lys Lys Ser Ile Phe Cys Asn Leu Glu Ile Phe Arg Met Arg Glu 435 440 445 Lys Asp Phe Pro Val Glu Val Ile Glu Leu Lys Asp Thr Val Thr Asp 450 455 460 Phe Ser Trp Glu Pro Lys Gly Asp Arg Phe Ala Ile Val Ser Ser Ser 465 470 475 480 Asp Pro Asn Leu Gly Asn Pro Gly Pro Gly Ile Thr Val Lys Thr Asp 485 490 495 Val Gly Phe Tyr Gln Leu Asp His Ser Lys Asn Asp Phe Arg Leu Leu 500 505 510 Arg Thr Leu Ser Ser Arg Thr Ser Asn Ala Ile Arg Trp Ser Pro Arg 515 520 525 Gly Arg His Val Val Leu Ala Thr Val Gly Ser Ser Thr Lys Ser Glu 530 535 540 Leu Glu Phe Trp Asp Leu Asp Phe Asn Ser Asp Asp Ala Asn Arg Lys 545 550 555 560 Glu Gly Gln Ala Ser Lys Asp Asp Trp Gly Ser Gly Ile Gln Leu Leu 565 570 575 Gly Ser Ala Asp His Tyr Gly Val Thr Asp Val Glu Trp Asp Pro Ser 580 585 590 Gly Arg Tyr Leu Ala Thr Ser Ala Ser Ala Trp Thr His Thr Leu Glu 595 600 605 Asn Gly Tyr Ala Val Trp Asp Phe Arg Gly Gln Glu Leu Thr Lys Gln 610 615 620 Ile Gln Asp Arg Phe Lys Gln Phe Ile Trp Arg Pro Arg Pro Pro Thr 625 630 635 640 Leu Leu Thr Lys Glu Gln Gln Arg Thr Ile Arg Arg Asn Leu Arg Glu 645 650 655 Tyr Ser Arg Val Phe Asp Glu Glu Asp Ala Ala Glu Glu Ser Asn Val 660 665 670 Ser Ala Glu Leu Val Ala Leu Arg Lys Arg Leu Val Asp Glu Trp Asn 675 680 685 Ala Trp Arg Thr Leu Arg Lys Arg Glu Leu Ala Asp Glu Arg Gly His 690 695 700 Lys Thr Asp Lys His Glu Val Ser Glu Ala Lys Glu Glu Ile Glu Val 705 710 715 720 Trp Val Asp Glu Val Ile Glu Gln Ile Glu Glu Gly Arg Pro Ser Leu 725 730 735 Pro Pro Leu Ser Pro Ser His Met Ser Thr Pro Ser Pro Ser Pro Thr 740 745 750 Thr Leu Trp Ala Thr Ala Ser Lys Glu Trp Val Ile Gln Pro Lys Pro 755 760 765 Lys Pro Gly Arg Lys Pro Lys Lys Asp Leu Ser Ala Ala Val Lys Asp 770 775 780 Glu Glu Glu Ser Asp Ser Lys Gly Arg Arg Val Gln Asn Arg Ala Ala 785 790 795 800 Gln Arg Ala Phe Arg Glu Arg Lys Gln Ser Gln Leu Ala Glu Leu Gln 805 810 815 Ser Arg Ile Gln Gln Tyr Glu Gln Gly Glu Ile Glu Arg Asn Val Ala 820 825 830 Leu Gln Asn Ile Ala Lys Arg Leu Lys Glu Glu Asn Glu Ala Leu Arg 835 840 845 Arg Glu Asn Ser Leu Leu Lys Glu Arg Ile Thr Lys Gln Glu Gln Glu 850 855 860 Gln Arg Ala Ala Asn Glu Lys Lys Arg Trp Arg Asp Asn Ser Pro Gly 865 870 875 880 Ser Val His Ser Pro Lys Ala Pro Ala Arg Lys Lys Pro Arg Phe Ser 885 890 895 Pro Glu Thr His Asp Lys Pro Leu Ser Thr Tyr Leu Pro Ser Pro Pro 900 905 910 Ser Met Leu Asp Ser Pro Asn Ser Ser Asn Ser Ser Asp Ser Gly Phe 915 920 925 Ser Pro Met Tyr Glu Val Gln Ser Ser Glu Ala Thr His Pro Ile Ile 930 935 940 Ala Asn Ile Asp Leu Asn Asn Thr Asn Arg Ser Ile Ser Leu Glu Ser 945 950 955 960 Phe Asp Tyr Ser Pro Ser Phe Asn Cys Gly Phe Cys Ser Asp Asp Thr 965 970 975 Pro Cys Val Cys Arg Glu Leu Ala Ala Gln Gln Val Ser Glu Arg Ser 980 985 990 Asn Leu Ser Asn Phe Lys Ser Glu Glu Phe Thr Gly Val Val His Leu 995 1000 1005 Glu Pro Ala Pro Gln Pro Gln Ser Ser Arg Ser Ser Ile Leu Asp Asn 1010 1015 1020 Leu Pro Ala Tyr Arg Pro Pro Val Pro Leu Arg Arg Arg Glu Thr Pro 1025 1030 1035 1040 Cys Thr Val Asn Ser Ile Phe Pro Val Gln Val Leu Pro Glu Thr Arg 1045 1050 1055 Pro Pro Thr Ile Ser Ser Gln Pro Thr Cys Ser Gly Asp Pro Ser Asn 1060 1065 1070 Cys Leu Ala Cys Ala Asp Asp Ala Phe Gly Lys Ala Phe Cys Ser Ala 1075 1080 1085 Ile Lys Glu Thr Ile Ala Ala Arg Pro Ser Cys Val Asp Tyr Pro Gly 1090 1095 1100 Gly Val Pro Ser Ser Ser His Asn Pro Cys Asn Ser Arg Gly Gly Cys 1105 1110 1115 1120 Glu His Cys Ile Ser Asp Pro Thr Ala Asn Leu Asn Gly Tyr Asp Ser 1125 1130 1135 Ser Glu Ser Ile Pro Thr Asn Ala Ala Trp Gln Gln Ile Lys Ala His 1140 1145 1150 Pro Asn Val Ser Phe Ala Asp Leu Ser Leu Leu Ala Asn Val Val Ala 1155 1160 1165 Ser Arg Ser Arg Cys Thr Gly Pro Arg Ile Pro Leu Ser Pro Ser Pro 1170 1175 1180 Glu Ser Lys Phe Thr Pro Pro Thr Pro Pro Leu Ala Pro Pro Ala Asp 1185 1190 1195 1200 Asn Glu Thr Ile Val Leu Thr Asp Pro His Ala Gln Tyr Lys Glu Lys 1205 1210 1215 Glu Lys Ala Gln Arg Glu Gly Ala Ser Pro Pro Pro Arg Asp Val Leu 1220 1225 1230 Ala Arg Cys Gly Arg Ile Arg Glu Val Ser Thr Ser Ala Val His Asp 1235 1240 1245 Ala Leu Arg Leu Leu Asp Val Lys Phe Pro 1250 1255

Claims (13)

delete delete delete delete In a novel Agaricus bisporus strain with enhanced sideropoa production capacity in mushroom mushrooms,
The strain is characterized in that it generates sideropoa regardless of the presence or absence of iron ions in the medium,
The strain is a novel Agaricus bisporus (Agaricus bisporus) strain (accession number KCTC18789P), characterized in that the iron ion (Fe3+) binding ability is increased, the ability to produce siderophores in mushroom mushrooms is enhanced. delete The method of claim 5,
The strain is characterized in that, regardless of the presence or absence of iron ions (Fe3+) 6000 mAU to 6500 mAU of sideropoa is produced, strain. Cultivated from the strain of claim 5, the mushroom mushrooms with enhanced production of siderophores. delete The composition for production of sideropoa in mushroom mushroom, comprising the strain of claim 5, the lysate of the strain, the culture supernatant of the strain, the fruiting body of the strain, or a mixture thereof. A method for producing sideropoa from mushrooms, comprising the step of cultivating mushrooms from the strain of claim 5.
delete delete

Images