KR102225666B1 - Manufacturing method of nucleic acid-based microneedle and nucleic acid-based microneedle thereby - Google Patents

Abstract

The present invention relates to a method of manufacturing a nucleic acid-based microneedle and a nucleic acid-based microneedle manufactured through the method, and more specifically, by placing an RNA membrane on the needle array and drying it, a coating layer made of RNA is easily formed on the outer surface of the needle body. It has a solid form and forms a coating layer using an RNA membrane made of nucleic acids, so a large amount of RNA can be stably delivered, and drug (RNA) can be uniformly applied to various types of needle arrays, and protein on the RNA membrane. Alternatively, a method for manufacturing a nucleic acid-based microneedle that can be used for immunotherapy using subcutaneous injection by making the needle body coated with an antigen or an immune adjuvant by making it contain DNA, and a nucleic acid-based microneedle manufactured through the method.

Description

Manufacturing method of nucleic acid-based microneedle and nucleic acid-based microneedle thereby

The present invention relates to a method of manufacturing a nucleic acid-based microneedle and a nucleic acid-based microneedle manufactured through the method, and more specifically, by placing an RNA membrane on the needle array and drying it, a coating layer made of RNA is easily formed on the outer surface of the needle body. It has a solid form and forms a coating layer using an RNA membrane made of nucleic acids, so a large amount of RNA can be stably delivered, and drug (RNA) can be uniformly applied to needle arrays of various shapes and materials. A method for manufacturing nucleic acid-based microneedles that can be used in immunotherapy using subcutaneous injection by making the needle body to be coated with protein or DNA so that antigens or immune adjuvants can be coated on the needle body, will be.

Microneedle (microneedle) is widely used for drug delivery to the skin because it reduces pain when injecting drugs into the body, and is quick and simple to use. In particular, there are a lot of immune cells under the skin, and if a microneedle is used for drug delivery subcutaneously, a vaccine or an immune enhancing drug can be effectively delivered to the immune cells, thereby effectively generating an immune response. Microneedles are divided into solid microneedle, coated microneedle, dissolving microneedle, and hollow microneedle according to the drug retention and delivery method. Lose. The double-coated microneedle can load polymeric drugs and has stability for long-term storage. Conventional coated microneedles are coated by immersing a drug on the surface of a microneedle formed of a polymer, metal, etc., as in the following patent documents, a method of coating a gel film using electrospray and then loading the drug so that the drug is impregnated, and a nanoparticle is centrifuged. It is manufactured by a method of coating a microneedle using, for example.

<Patent Literature>

Patent Document 1: Patent Laid-Open Publication No. 10-2015-0118136 (published on October 21, 2015) "Drug-retaining microneedle array and its manufacturing method"

Patent Document 2: Registration Patent No. 10-1724655 (registered on April 03, 2017) “Micro needle patch and its manufacturing method”

Patent Document 3: Registered Patent No. 10-1221192 (registered on Jan. 04, 2013) “Microarray and its manufacturing method”

However, in order to apply and deliver the drug to the microneedle, it is difficult to apply general application because it requires specific equipment or the solvent must not be harmful to the human body while using a liquid with high viscosity. There is a problem in that it is difficult to apply the drug in large amounts.

The present invention was devised to solve the above problems,

The present invention provides a nucleic acid-based microneedle manufacturing method capable of easily forming a coating layer made of RNA on the outer surface of a needle body by mounting an RNA membrane on a needle array and drying it, and a nucleic acid-based microneedle manufactured therethrough. There is a purpose.

In addition, since the present invention has a solid form and forms a coating layer using an RNA membrane made of only nucleic acids, a large amount of RNA can be stably delivered, and drug (RNA) can be uniformly applied to needle arrays of various shapes and materials. An object thereof is to provide a possible nucleic acid-based microneedle manufacturing method and a nucleic acid-based microneedle manufactured through the method.

In addition, the present invention provides a nucleic acid-based microneedle manufacturing method capable of coating an antigen or an immune adjuvant on the needle body, and a nucleic acid-based microneedle manufactured therethrough, in the case of manufacturing such that protein or DNA is included in the RNA membrane. There is a purpose.

The present invention is implemented by an embodiment having the following configuration in order to achieve the above object.

According to an embodiment of the present invention, a method of manufacturing a microneedle according to the present invention includes: an array preparation step of preparing a needle array having a substrate and a needle body protruding over the substrate; And a coating step of forming a coating layer made of RNA on the outer surface of the needle body by mounting the RNA membrane on the needle array and drying it.

According to another embodiment of the present invention, in the method of manufacturing the microneedle according to the present invention, the coating step includes a membrane forming step of forming an RNA membrane composed of a large amount of RNA having a solid form.

According to another embodiment of the present invention, in the method of manufacturing a microneedle according to the present invention, the coating step includes a seating step of taking the membrane formed in the membrane forming step out of the reaction vessel and seating it on the needle array together with water, It characterized in that it further comprises a drying step of forming a coating layer made of RNA on the outer surface of the needle body by drying the membrane at a certain temperature for a certain time after the seating step.

According to another embodiment of the present invention, in the method of manufacturing a microneedle according to the present invention, the membrane forming step is a first circular DNA formation by complementary bonding of the first linear DNA and the primer DNA. The DNA formation step of 1, and a second DNA formation step of forming a second circular DNA by complementarily combining a second linear DNA having a base sequence complementary to the first linear DNA and a primer DNA, and , The first and second circular DNA and RNA polymerase are added to the reaction vessel and reacted to replicate complementary and long RNA strands.After the cloning step, the vessel is opened and evaporated to make the replicated RNA strands complement each other. It characterized by including the assembly step of forming a membrane by inducing the concentration of RNA on the inner wall of the reaction vessel by allowing self-assembly while being entangled and bound together.

According to another embodiment of the present invention, in the method of manufacturing the microneedle according to the present invention, a solution containing an antigenic protein is additionally added to the reaction vessel in the cloning step, so that the protein can be additionally loaded into the coating layer. It is characterized by having.

According to another embodiment of the present invention, the method for manufacturing a microneedle according to the present invention is, after the coating step, by placing a solution containing circular DNA and DNA polymerase on the microneedle and reacting, DNA is replicated. To be self-assembled, it characterized in that it further comprises a DNA particle binding step of binding the particles made of DNA to the outer surface of the coating layer.

According to another embodiment of the present invention, in the method for manufacturing a microneedle according to the present invention, the needle array is manufactured using a 3D printer.

According to another embodiment of the present invention, in the method of manufacturing a microneedle according to the present invention, the needle array is made of resin or metal.

According to another embodiment of the present invention, the microneedle according to the present invention includes: a needle array having a substrate and a needle body protruding over the substrate; And a coating layer formed on the outer surface of the needle body, wherein the coating layer has a solid form and is made of RNA.

According to another embodiment of the present invention, in the microneedle according to the present invention, the coating layer is partially loaded with an antigenic protein.

According to another embodiment of the present invention, the microneedle according to the present invention is bonded to the outer surface of the coating layer and further comprises particles made of DNA.

The present invention can obtain the following effects by the above embodiment.

The present invention has the effect of being able to easily form a coating layer made of RNA on the outer surface of the needle body by placing the RNA membrane on the needle array and drying it.

In addition, the present invention has a solid form and forms a coating layer using an RNA membrane made of only nucleic acids, so that a large amount of RNA can be easily loaded and stably delivered, and even drug is applied to needle arrays of various shapes and materials. There is an effect that (RNA) can be applied.

In addition, the present invention has an effect that can be used for immunotherapy using subcutaneous injection by making the RNA membrane contain protein or DNA so that the needle body can be coated with an antigen or an immune adjuvant.

1 is a schematic diagram of a method of manufacturing a microneedle according to an embodiment of the present invention.
Figure 2 is a digital image of the RNA membrane.
3 is a digital image of a microneedle.
4 is a SEM image of the microneedle.
5 is a confocal microscope image measuring a tomography of a microneedle and a diagram in which it is quantified.
6 is a fluorescence microscope image of a microneedle manufactured by varying the shape and material of the needle array.
7 is a diagram showing the amount of RNA released by microneedles under physiological conditions and an image of a fluorescence microscope.
Figure 8 is a fluorescence microscope image for confirming that the protein is loaded on the RNA membrane.
9 is a confocal microscope image of measuring microneedles prepared using a protein-loaded RNA membrane.
10 is a chart showing the amount of protein released by microneedles having a protein-loaded RNA coating layer under physiological conditions.
11 is a fluorescence microscope image of a microneedle to which DNA particles are bound.
12 is an SEM image of a microneedle to which DNA particles are bound.
13 is a digital image showing the result of injecting and detaching the microneedle into the pig skin, dyeing the pig skin with trypan blue, and measuring the result.
14 is a microscope image showing a result of measuring a skin section obtained by injecting and detaching a microneedle into pig skin and cutting the pig skin after H&E staining.
Fig. 15 is a confocal microscope image of injecting and detaching a microneedle into a pork belly and measuring the pork belly.

Hereinafter, a method of manufacturing a nucleic acid-based microneedle according to the present invention and a nucleic acid-based microneedle manufactured through the method according to the present invention will be described in detail with reference to the drawings. Unless otherwise defined, all terms in this specification are the same as the general meaning of the terms understood by those of ordinary skill in the art to which the present invention belongs. According to the definitions used in the specification. In addition, detailed descriptions of known functions and configurations that may unnecessarily obscure the subject matter of the present invention will be omitted. Throughout the specification, when a part "includes" a certain component, it means that other components may be further included rather than excluding other components unless specifically stated to the contrary.

A method of manufacturing a nucleic acid-based microneedle according to an embodiment of the present invention will be described with reference to FIG. 1, and the manufacturing method of the microneedle includes a substrate 10 and a needle body 11 protruding over the substrate 10. An array preparation step of forming a needle array 1 having a; It characterized in that it comprises a coating step of forming a coating layer (2) made of RNA on the outer surface of the needle body 11 by mounting the RNA membrane on the needle array (1) and drying.

The array preparation step is a step of forming a needle array 1 having a substrate 10 and a needle body 11 protruding over the substrate 10, and a needle array having various types of needle bodies 11 ( 1) can be formed. For example, the needle array 1 may be manufactured using a 3D printer using resin as a material to have a conical needle body.

The coating step is a step of forming a coating layer 2 made of RNA on the outer surface of the needle body 11 by mounting the RNA membrane on the needle array 1 and drying it. Includes.

The membrane forming step is a step of forming an RNA membrane made of RNA having a solid form, and a first DNA forming step of forming a first circular DNA by complementary bonding of the first linear DNA and primer DNA, and , A second DNA formation step of forming a second circular DNA by complementarily combining a second linear DNA having a base sequence complementary to the first linear DNA and a primer DNA, and a reaction vessel (e.g., Tube, etc.), and the replication step of replicating complementary and long RNA strands by reacting with the first and second circular DNA and RNA polymerase, and the doubled RNA strands are complementary to each other by evaporating by opening the container after the replication step. It includes an assembly step of forming a membrane by inducing the concentration of RNA on the inner wall of the container by allowing self-assembly while being entangled and bound together. Through the membrane formation step, it is possible to prepare a membrane having a solid form, made of RNA, a thickness of several μm, and a horizontal and vertical length of several tens of mm. When the membrane formed in the assembly step is taken out of the container and dried, it becomes a stiff structure that maintains an independent structure without a medium, and the needle array is coated using the properties of the membrane.

The seating step is a step of taking the membrane formed in the membrane forming step out of the reaction vessel and seating it on the needle array 1 together with water.

The drying step is a step of forming a coating layer 2 made of RNA on the outer surface of the needle body 11 by drying the membrane at room temperature for a certain period of time after the seating step. The microneedle produced through the coating step is formed with a coating layer 2 made of RNA on the outer surface of the needle body 11, and, as in a conventional microneedle injection method, when the microneedle is injected into the skin, the coating layer 2 ) The needle body 11 formed therein penetrates the skin, and the RNA constituting the coating layer 2 is decomposed and transmitted to the tissue. Since it is possible to design the RNA forming the coating layer 2 into siRNA that induces gene silencing, mRNA that expresses a specific protein, or dsRNA or ssRNA that can promote an immune response, using the microneedle of the present invention When injected, it is possible to effectively release a drug consisting of RNA into the subcutaneous tissue. When a solution containing a protein such as an antigen is additionally added in the cloning step, an RNA membrane loaded with a protein is formed in the assembly step, and a mounting step and a drying step are performed using the RNA membrane loaded with the protein. When carried out, it is possible to manufacture microneedles having a coating layer 2 made of protein and RNA. Through this, by using the microneedle of the present invention, it is possible to induce an effective immune response by delivering an antigenic protein to the subcutaneous where a large number of immune cells are distributed.

According to another embodiment of the present invention, after the coating step, a solution containing a circular DNA and a DNA polymerase is placed on the microneedle, and then the DNA is duplicated to self-assemble (complementary rolling circle). Amplification (cRCA), a DNA particle binding step of binding particles made of DNA to the outer surface of the coating layer may be additionally included.Through this, DNA particles used as an adjuvant to cause an immune response to the microneedle of the present invention are loaded and subcutaneously It is possible to induce the activation of the immune response by delivering an adjuvant to the immune system.

Another embodiment of the present invention includes a microneedle manufactured by a method of manufacturing a microneedle.

Hereinafter, the present invention will be described in more detail through examples. However, these are only for describing the present invention in more detail, and the scope of the present invention is not limited thereto.

<Example 1> Preparation of RNA membrane

1. Preparation of the first circular DNA

(1) At both ends, a nucleotide sequence that enables complementary binding to the primer DNA (hereinafter referred to as'binding nucleotide sequence') and an arbitrary nucleotide sequence (hereinafter referred to as'arbitrary nucleotide sequence') in the center The first linear DNA [5'-Phosphate-ATAGTGAGTCGTATTA (SEQ ID NO: 1)-GCGACCGAGTTGCTCTTGCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC (SEQ ID NO: 2) -ATCCCT (SEQ ID NO: 3)-3'] was designed. In addition, primer DNA [5'-TAATACGACTCACTATAGGGAT-3' (SEQ ID NO: 4)] was designed.

(2) The first linear DNA and primer DNA were mixed together so that the final concentration was 10 μM, respectively, and the circular DNA was formed by complementary bonding through annealing. In order to connect the nick part where 3'and 5'of the first linear DNA meets to make a complete circle, add T4 ligase (Promega, cat. No. M1804) and react at room temperature for 15 hours, and finally, the first Circular DNA was formed.

2. Preparation of the second circular DNA

(1) A second linear DNA [[5'-Phosphate-ATAGTGAGTCGTATTA (SEQ ID NO: 1)-GTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACGGCAAGAGCAACTCGGTCGC (SEQ ID NO: )-ATCCCT (SEQ ID NO:3)-3'] was designed.

(2) The second linear DNA and primer DNA were mixed together so that the final concentration was 10 μM, respectively, and the circular DNA was formed by complementary bonding through annealing. T4 ligase (Promega, cat. No. M1804) was added and reacted at room temperature for 15 hours to make the nick part where 3'and 5'of the 2nd Linear DNA meet and make a whole circle, and finally the 2nd circular DNA was formed.

3. Synthesis of RNA Membrane

(1) In a tube, the first circular DNA (3 μM), the second circular DNA (3 μM), rNTP (3.75 mM), reaction buffer (60 mM Tris-HCl, 3 mM spermidine, 9 mM MgCl ₂ , 1.5 mM DTT) And T7 RNA polymerase (5U/μl) were mixed together to make a total volume of 100 μl, and reacted at 37° C. for 20 hours to infinitely replicate complementary and long RNA strands.

(2) Thereafter, the lid of the tube was opened and evaporated for 20 hours, so that the replicated RNA strands during the EISA (evaporation induced self-assembly) process complementarily bind to each other and become entangled to achieve self-assembly, thereby synthesizing an RNA membrane. Thereafter, the RNA membrane was stained with Gel red 100X, an RNA staining dye, and the remaining dye was removed, and then used for the manufacture of microneedles (Fig. 2 shows an RNA membrane image taken with a digital camera after staining with Gel red 100X).

<Example 2> Preparation of needle array

Using the Tinkercad program, a needle array with 42 needle bodies with a lower diameter of 500 μm and a height of 1000 μm was designed, and a needle array was fabricated with a 3D printer (ProJet 3510 HD) using UV curable resin (Visijet M3 crystal).

<Example 3> Preparation of microneedles

On the needle body prepared in Example 2, the RNA membrane prepared in Example 1 was taken out of the tube, the RNA membrane was settled with water, and then dried at room temperature for 15 hours to form a microneedle with an RNA coating layer formed on the needle body. Was prepared.

<Example 4> Confirmation of RNA coating layer formation on needle body

1. Each of the needle array prepared in Example 2 and the microneedle prepared in Example 3 were photographed using a digital camera, and the results are shown in FIG. 3. In addition, the needle array prepared in Example 2 and the microneedle prepared in Example 3 were measured by SEM, and the results are shown in FIG. 4. In addition, except for using a needle body including a needle body having a lower diameter of 250 μm and a height of 500 μm, a microneedle was manufactured according to Example 3 and photographed every 60 μm in the z direction using a confocal spectacle tomography image. And the results are shown in Fig. 5(a), and the results of Fig. 5(a) are numerically shown in Fig. 5(b). In FIGS. 3 and 4, a represents a needle array measurement result, and b represents a measurement result of a microneedle.

2. When comparing a and b of Fig. 3, it can be seen that a coating layer is formed on the needle body. Looking at Fig. 4, it can be seen that the surface has a rough surface before coating, but has a smooth surface after coating. It can be seen that RNA is uniformly coated along the outer surface of the needle body.

<Example 5> Confirmation that the RNA coating layer was formed even when the shape and material of the needle array were different

1. Except that each of the needle arrays having a needle body of the shape shown in Fig. 6a was prepared, and the staining dye of the RNA membrane placed on each needle array was differently used (each Cy3-CTP (orange), Sytox Orange (Yellow), SYBR Green II (green) and Hoechst 33342 (blue) dye used), a microneedle was prepared according to the method of Example 3 and photographed using a confocal microscope, and the results are shown in FIG. 6A, A microneedle was prepared according to the method of Example 3, except that a commercially available stainless steel-based needle ray (L'arcobaleno's MTS Dermastamp (1mm)) was used instead of the needle array, and the result was photographed using a fluorescence microscope. It is shown in b of FIG. 6.

2. Referring to Fig. 6, it can be seen that RNA is coated along the outer surface of the needle body even if the shape and material of the needle body are different, so that the coating method of the present invention can be applied to needle arrays of various shapes and materials. .

<Example 6> Confirmation of RNA release rate of microneedles

1.To confirm the amount of RNA delivered over time when the microneedle prepared in Example 3 was delivered to the skin, physiological conditions (proceeded in physiological saline (PBS) solution having an osmotic pressure balance similar to that of the body, 267mM Figure 7 by confirming the amount of RNA released by the microneedle over time in Potassium Chloride (KCl), 147mM Potassium Phosphate monobasic (KH2PO4), 13793mM Sodium Chloride (NaCl) and 806mM Sodium Phosphate dibasic (Na2HPO4-7H2O) In addition, the microneedles were confirmed with a fluorescence microscope according to time and are also shown in FIG. 7.

2. Referring to FIG. 7, it can be seen that about 60% of the drug is rapidly released until 6 hours and then slowly released to about 90% by 48 hours.

<Example 7> Confirmation of the possibility of loading proteins such as antigens into the microneedle

1.In Example 1, 0.123 mg/ml of ovalbumin (OVA) to which a fluorescent dye (alexa 488) for labeling a protein was bound was additionally added, and the amount of the first circular DNA and the second circular DNA was only 3 μM. In addition, 1 and 0.3 μM were also used to prepare a protein-loaded RNA membrane, and then photographed using a fluorescence microscope, and the results are shown in FIG. 8. In addition, a microneedle was prepared in the same manner as in Example 3, except that the protein-loaded RNA membrane (prepared using 1 μM of the amount of the first circular DNA and the second circular DNA) was used. , Using a confocal microscope to measure the appearance and tomography and the results are shown in Fig.9, and by checking the protein emission amount of the microneedles over time under physiological conditions (measure the fluorescence of the physiological saline solution at a specific time and The amount was measured by substituting it into the standard curve) shown in FIG. 10.

2. Referring to FIG. 8, it can be confirmed that RNA and OVA are present at the same location, so that OVA is loaded on the RNA membrane. Referring to FIG. 9, it can be confirmed that RNA and OVA are coated on the surface of the needle body. 10, it can be seen that the microneedles rapidly release the protein within 6 hours, so that the microneedles of the present invention can induce an effective immune response by delivering the antigen protein to the subcutaneous where the immune cells are largely distributed. Can be seen.

<Example 8> Additional coating of DNA on microneedles

1. Complementary rolling circle amplification (cRCA) was performed on the microneedle prepared in Example 3 (however, the RNA membrane was stained with SYBR Green II instead of Gel red 100X) to prepare a DNA-coated microneedle, followed by fluorescence. The results were measured using a microscope and shown in FIG. 11, and the results were shown in FIG. 12 by measuring by SEM. The cRCA was performed by dropping 40 μl of a cRCA reaction solution on a microneedle, reacting at 30° C. for 20 hours, and washing, and the cRCA reaction solution was composed of two complementary circular DNAs (CpG) that stimulate an immune response ( 0.5μM each), dNTP (2mM), Cy5-dCTP (0.08mM), Phi 29 DNA polymerase (1U/μl) and reaction buffer (100mM Tris-HCl, 20mM (NH ₂ ) ₂ SO ₄ , 8mM DTT and 20mM MgCl _It consists of 2 ). To prepare two complementary circular DNAs, Primer DNA (5'-GCCAAACATGAAACTACATTCC-3' (SEQ ID NO:6)), Linear DNA for CpG strand (5'-Phosphate-TAGTTTCATGTTTGGCTACTCTACTTAGATTAACGTCAGGAACGTCATGGACTGAGTACTTAGATTAACGTCAGGAACGTCATGGACTGAGTACTTAGATTAACGTCG-3'CATGTAGGATCGAGGAGAAT ), Linear DNA for complementary CpG strand (5'-Phosphate-TAGTTTCATGTTTGGCAATCTAAGTACTCAGAACGTCAGGAACGTCATGGAAATCTAAGTAGAGTAAACGTCAGGAACGTCATGGAGGAATG-3' (SEQ ID NO:8)) was used.

2. In FIGS. 11 and 12, a is the measurement result of the needle array prepared in Example 2, b is the measurement of the microneedle prepared in Example 3 (however, the RNA membrane was stained with SYBR Green II instead of Gel red 100X) As a result, c shows the measurement results of the DNA-coated microneedle prepared in Example 8 1, and FIG. 11 d is a different solution except that a solution consisting of Cy5-dCTP and a reaction buffer was used instead of the cRCA reaction solution. The measurement results of the microneedles prepared in the same manner as in Example 8 1 are shown.

3. Referring to Figure 11, it can be seen that the DNA is located together with the RNA on the needle body, which can be confirmed that the DNA was synthesized on the RNA, not simply Cy5-dCTP was adsorbed. In addition, referring to FIG. 12, it can be seen that the DNA replicated on the RNA was synthesized in the form of particles having a size of about 1 to 2 μm. Through this, it can be seen that the microneedle of the present invention is loaded with DNA particles used as an adjuvant for causing an immune response, and the immune adjuvant is delivered subcutaneously to induce the activation of the immune response.

<Example 9> Evaluation of subcutaneous injection possibility using microneedles

1.After injecting the microneedle prepared in Example 2 into pig skin (using Medikinetics' micropig skin) most similar to human skin, removing the microneedles, dyeing the pig skin with trypan blue and measuring the result. As shown in Fig. 13, the pig skin was fixed in neutral buffered formalin, made into a paraffin block, sectioned, stained with H&E staining, and measured. The results are shown in FIG. 14. In addition, the microneedle prepared in Example 3 was punctured on a pig's triangular meat and observed with a confocal microscope, and the results are shown in FIG. 15.

2. Referring to FIG. 13, it can be seen that the microneedle prepared in Example 3 has sufficient strength to penetrate the skin through the dyed blue color of the pig skin. Referring to FIG. 14, the epidermal layer including the stratum corneum of the pig skin is successfully As shown in FIG. 15, it can be seen that RNA is delivered to a thickness of about 300 μm of the pig skin.When the microneedle coated with the RNA membrane is injected into the pig skin, the loaded drug does not peel off and successfully reaches the dermis. It can be seen that it can be delivered.

In the above, the applicant has described the preferred embodiments of the present invention, but such embodiments are only one embodiment that implements the technical idea of the present invention, and any change or modification of the present invention as long as the technical idea of the present invention is implemented. It should be construed as falling within the scope.

1: needle array 2: coating layer 11: substrate
12: needle body

<110> University of seoul Industry Cooperation Foundation <120> Manufacturing method of nucleic acid-based microneedle and nucleic acid-based microneedle thereby <130> PDAHJ-18127 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> region of ssDNA for binding primer <400> 1 atagtgagtc gtatta 16 <210> 2 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> region of ssDNA for membrane generation <400> 2 gcgaccgagt tgctcttgcc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60 cgttatcaac 70 <210> 3 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> region of ssDNA for binding primer <400> 3 atccct 6 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for circular DNA generation <400> 4 taatacgact cactataggg at 22 <210> 5 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> region of ssDNA for membrane generation <400> 5 tagtttcatg tttggcaatc taagtactca gaacgtcagg aacgtcatgg aaatctaagt 60 agagtaaacg tcaggaacgt catggaggaa tg 92 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for circular DNA generation <400> 6 gccaaacatg aaactacatt cc 22 <210> 7 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> region of ssDNA for CpG generation <400> 7 tagtttcatg tttggctact ctacttagat taacgtcagg aacgtcatgg actgagtact 60 tagattaacg tcaggaacgt catggaggaa tg 92 <210> 8 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> region of ssDNA for CpG generation <400> 8 tagtttcatg tttggcaatc taagtactca gaacgtcagg aacgtcatgg aaatctaagt 60 agagtaaacg tcaggaacgt catggaggaa tg 92

Claims (11)

An array preparation step of preparing a needle array having a substrate and a needle body protruding over the substrate;
And a coating step of forming a coating layer made of RNA on the outer surface of the needle body by mounting the RNA membrane on the needle array and drying it. The method of claim 1, wherein the coating step
Method for producing a microneedle, characterized in that it has a solid form and comprises a membrane forming step of forming an RNA membrane made of RNA. The method of claim 2, wherein the coating step
A seating step in which the membrane formed in the membrane forming step is taken out of the reaction vessel and seated on the needle array with water, and a coating layer made of RNA is formed on the outer surface of the needle body by drying the membrane at a constant temperature for a certain period of time after the seating step. Method for manufacturing a microneedle, characterized in that it further comprises a drying step. The method of claim 3, wherein the membrane forming step
A first DNA formation step of forming a first circular DNA by complementary binding of the first linear DNA and primer DNA, and a second linear DNA having a base sequence complementary to the first linear DNA. A second DNA formation step of forming a second circular DNA by complementarily binding primer DNA, and a complementary and long RNA strand by adding the first and second circular DNA and RNA polymerase to the reaction vessel and reacting After the replication step, the container is opened and evaporated after the cloning step to form a membrane by inducing the concentration of RNA on the inner wall of the reaction container by self-assembly by complementary bonding and entanglement of the replicated RNA strands. Method for manufacturing a microneedle, characterized in that it comprises an assembly step. The method of claim 4,
The method of manufacturing a microneedle, characterized in that by adding a solution containing an antigenic protein to the reaction vessel in the cloning step, the protein can be additionally loaded into the coating layer. The method of claim 3, wherein the method of manufacturing the microneedle
After the coating step, a solution containing a circular DNA and a DNA polymerase is placed on the microneedle and reacted to replicate and self-assemble DNA, thereby binding DNA particles to the outer surface of the coating layer. Method for manufacturing a microneedle, characterized in that it further comprises a step. The method of claim 3, wherein the needle array
A method of manufacturing a microneedle, characterized in that it is manufactured using a 3D printer. The method of claim 3, wherein the needle array
Method for manufacturing a microneedle, characterized in that made of resin or metal. delete delete delete

Images