KR102224821B1 - Mutant Strain with Limonene Production Ability - Google Patents

Abstract

The present invention relates to a recombinant vector comprising a gene that increases limonene production ability, a mutant strain in Saccharomyces genus transformed with the recombinant vector, and a method for producing limonene using the mutant strain, wherein the mutant strain is a wild type Compared with the strain, it shows a remarkably increased limonene production ability.

Description

Mutant Strain with Limonene Production Ability {Mutant Strain with Limonene Production Ability}

The present invention relates to a mutant strain having limonene-producing ability.

delete

Limonene is a substance belonging to C10 terpenoid and is a substance with high commercial value used in a wide field as a fragrance component. In addition, limonene has recently attracted attention for its value as an alternative organic solvent with relatively low biotoxicity that can replace harmful organic solvents used in the chemical industry, and for this purpose, the need for a stable mass production method research is emerging. Existing limonene was extracted from the bark of Citrus-based plants such as oranges, but it has a limitation in that the supply is not large and is not stable. However, if the research on the production of limonene using microorganisms is carried out and commercialized, it will be possible to provide a stable supply for the demand required not only for an alternative organic solvent but also for various uses.

In general, studies on the production of limonene through microorganisms have been conducted using carbohydrates (glucose, galactose, etc.) as a carbon source, but there is a problem that production efficiency does not come out high in that the biosynthetic pathway itself is very long and the genes of eukaryote plants must be expressed .

In Saccharomyces cerevisiae strain, acetic acid and ethanol are directly converted to Acetyl-CoA, a major metabolic intermediate, to generate intracellular energy and assimilate cellular components. (Ergosterol) is introduced into the mevalonate route for synthesis. The product limonene is synthesized through NPP (Neryl-Pyrophosphate) from GPP (Geranyl-Pyrophosphate) produced by polymerization of DMAPP (Dimethylallyl-Pyrophosphate) and IPP (Isopentenyl-Pyrophosphate) produced through the mevalonate route.

delete

The present inventors have tried to produce a mutant strain having an increased limonene-producing ability, and as a result, the present invention by confirming the increased limonene-producing ability in a mutant strain prepared through genetic recombination of various enzymes involved in the limonene synthesis pathway. Completed.

Accordingly, an object of the present invention is to provide a recombinant vector comprising a gene involved in the limonene synthesis pathway.

Another object of the present invention is to provide a limonene-producing mutant strain transformed with the recombinant vector.

Another object of the present invention is to provide a method for producing limonene using the mutant strain of the present invention.

delete

According to one aspect of the present invention, the present invention is a mutant limonene synthase (truncated limonene synthase) gene encoded by the nucleotide sequence of the sequence listing first sequence; And

A mutant Geranyl-PP synthase gene encoded by the nucleotide sequence of SEQ ID NO: 2, and a mutant Neryl-PP synthase encoded by the nucleotide sequence of SEQ ID NO: 3 synthase) gene, acetyl-CoA acetyltransferase (ERG10) gene encoded by the nucleotide sequence of SEQ ID NO: 4, mutations encoded by the nucleotide sequence of SEQ ID NO: 5 NADPH-dependent HMG-CoA Acetyl-CoA Acetyltransferase/NADH-dependent HMG-CoA Reductase (Acetyl-CoA Acetyltransferase/NADH Dependent HMG-CoA) encoded by the truncated NADPH-dependent HMG-CoA Reductase gene, the nucleotide sequence of SEQ ID NO: 6 Reductase) gene, mevalonate kinase (ERG12) gene encoded by the nucleotide sequence of SEQ ID NO: 7, IPP delta isomerase (Isopentenyl-diphosphate delta) encoded by the nucleotide sequence of SEQ ID NO: 8 isomerase, IDI1) gene, Isocitrate Lyase (ICL1) gene encoded by the nucleotide sequence of SEQ ID NO: 9 and Malate Synthase, which is encoded by the nucleotide sequence of SEQ ID NO: 10. It relates to a recombinant vector comprising at least one gene selected from the group consisting of MLS1) genes.

The present inventors tried to produce a mutant strain having an increased limonene-producing ability, and as a result, it was confirmed that the limonene-producing ability was increased in the mutant strain prepared through genetic recombination of various enzymes involved in the limonene synthesis pathway.

According to one embodiment of the present invention, the recombinant vector comprises a mutated limonene synthase gene encoded by the nucleotide sequence of the first sequence of sequence listing; And it may be a recombinant vector comprising a mutated Geranyl-PP synthase gene encoded by the nucleotide sequence of SEQ ID NO: 2.

According to one embodiment of the present invention, the recombinant vector comprises a mutated limonene synthase gene encoded by the nucleotide sequence of the first sequence of sequence listing; It may be a recombinant vector containing a mutated Neryl-PP synthase gene encoded by the nucleotide sequence of SEQ ID NO: 3.

According to one embodiment of the present invention, the recombinant vector comprises a mutated limonene synthase gene encoded by the nucleotide sequence of the first sequence of sequence listing; A mutant Neryl-PP synthase gene encoded by the nucleotide sequence of SEQ ID NO: 3; Acetyl-CoA acetyltransferase (ERG10) gene encoded by the nucleotide sequence of SEQ ID NO: 4; And it may be a recombinant vector comprising a mutant NADPH dependent HMG-CoA reductase (truncated NADPH Dependent HMG-CoA Reductase) gene encoded by the nucleotide sequence of SEQ ID NO:5.

According to one embodiment of the present invention, the recombinant vector comprises a mutated limonene synthase gene encoded by the nucleotide sequence of the first sequence of sequence listing; A mutant Neryl-PP synthase gene encoded by the nucleotide sequence of SEQ ID NO: 3; Acetyl-CoA acetyltransferase (ERG10) gene encoded by the nucleotide sequence of SEQ ID NO: 4; And an acetyl-CoA acetyltransferase/NADH dependent HMG-CoA reductase (Acetyl-CoA Acetyltransferase/NADH Dependent HMG-CoA Reductase) gene encoded by the nucleotide sequence of SEQ ID NO:6.

According to one embodiment of the present invention, the recombinant vector comprises a mutated limonene synthase gene encoded by the nucleotide sequence of the first sequence of sequence listing; A mutant Neryl-PP synthase gene encoded by the nucleotide sequence of SEQ ID NO: 3; Acetyl-CoA acetyltransferase (ERG10) gene encoded by the nucleotide sequence of SEQ ID NO: 4; A mutant NADPH-dependent HMG-CoA reductase (truncated NADPH Dependent HMG-CoA Reductase) gene encoded by the nucleotide sequence of SEQ ID NO: 5; And a mevalonate kinase (ERG12) gene encoded by the nucleotide sequence of SEQ ID NO:7.

According to one embodiment of the present invention, the recombinant vector comprises a mutated limonene synthase gene encoded by the nucleotide sequence of the first sequence of sequence listing; A mutant Neryl-PP synthase gene encoded by the nucleotide sequence of SEQ ID NO: 3; Acetyl-CoA acetyltransferase (ERG10) gene encoded by the nucleotide sequence of SEQ ID NO: 4; A mutant NADPH-dependent HMG-CoA reductase (truncated NADPH Dependent HMG-CoA Reductase) gene encoded by the nucleotide sequence of SEQ ID NO: 5; Mevalonate kinase (ERG12) gene encoded by the nucleotide sequence of SEQ ID NO: 7; And an IPP delta isomerase (Isopentenyl-diphosphate delta isomerase, IDI1) gene encoded by the nucleotide sequence of SEQ ID NO: 8.

According to one embodiment of the present invention, the recombinant vector comprises a mutated limonene synthase gene encoded by the nucleotide sequence of the first sequence of sequence listing; A mutant Neryl-PP synthase gene encoded by the nucleotide sequence of SEQ ID NO: 3; Acetyl-CoA acetyltransferase (ERG10) gene encoded by the nucleotide sequence of SEQ ID NO: 4; A mutant NADPH-dependent HMG-CoA reductase (truncated NADPH Dependent HMG-CoA Reductase) gene encoded by the nucleotide sequence of SEQ ID NO: 5; Mevalonate kinase (ERG12) gene encoded by the nucleotide sequence of SEQ ID NO: 7; IPP delta isomerase (Isopentenyl-diphosphate delta isomerase, IDI1) gene encoded by the nucleotide sequence of SEQ ID NO: 8; Including the Isocitrate Lyase (ICL1) gene encoded by the nucleotide sequence of SEQ ID NO: 9 and the malate synthase (MLS1) gene encoded by the nucleotide sequence of SEQ ID NO: 10 It can be a recombinant vector.

The term "vector" means a means for expressing a gene of interest in a host cell. For example, plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retroviral vectors, and viral vectors such as adeno-associated virus vectors.

The recombinant vector can typically be constructed as a vector for cloning or as a vector for expression. The expression vector may be a conventional one used in the art to express foreign proteins in plants, animals, or microorganisms.

In addition, the recombinant vector can be constructed through various methods known in the art.

delete

According to another aspect of the present invention, the present invention relates to a mutant strain having the ability to produce limonene transformed with the recombinant vector.

According to an embodiment of the present invention, a transformant with improved limonene production capability can be made by inserting an expression vector into which the target protein is inserted into a host cell, and the transformant is obtained by introducing the recombinant vector into an appropriate host cell. Can be. The host cell is a cell capable of stably and continuously cloning or expressing the expression vector, and any host cell known in the art may be used, for example, it may be a strain of the genus Saccharomyces.

According to an embodiment of the present invention, the strain of the genus Saccharomyces is Saccharomyces cerevisiae , Saccharomyces uqvarum , Saccharomyces ellipsoideus . , Saccharomyces carlsbergensis , Saccharomyces sake , Saccharomyces coreanus , Saccharomyces lipolytica Saccharomyces bouladii ) Or Saccharomyces pastorianus , for example, Saccharomyces cerevisiae .

Transport (introduction) of the recombinant vector into a host cell may use a transport method well known in the art. For example, when the host cell is a prokaryotic cell, a CaCl ₂ method or an electroporation method may be used, and when the host cell is a eukaryotic cell, a microinjection method, a calcium phosphate precipitation method, an electroporation method, Liposome-mediated transfection method and gene bombardment may be used, but are not limited thereto.

The method of selecting the transformed host cell can be easily carried out according to a method well known in the art using a phenotype expressed by a selection label. For example, when the selection marker is a specific antibiotic resistance gene, the transformant can be easily selected by culturing the transformant in a medium containing the antibiotic.

According to an embodiment of the present invention, the mutant strain exhibits an effect of remarkably increasing the amount of limonene production compared to a control group not transformed with the recombinant vector.

In the present specification, the term "limonene" is one of terpenes in which two isoprene units are repeated, and is an orange-flavored component, and the chemical formula is C ₁₀ H ₁₆ . It is a vegetable essential oil that is abundant in pine and citrus fruits (especially the peel of oranges and lemons), and the name comes from lemon. Due to its unique scent, it is used as a raw material for perfume or as a fragrance. As optical isomers, d- and l-limonene exist. d-limonene is found in citrus fruits such as oranges, and l-limonene is found in pine trees. Limonene has various properties such as antibacterial, antiviral, antifungal, anti-larva, insect attractant, deodorant, and deodorant, and has the effect of generating taste.

According to an embodiment of the present invention, the mutant strain may be transformed by one or more recombinant vectors.

delete

According to another aspect of the present invention, the present invention relates to a method for producing limonene comprising culturing the mutant strain.

According to an embodiment of the present invention, the mutant strain may be cultured through various known culture methods in pre-culture or seed culture.

Natural or synthetic medium can be used in the present invention, and the carbon source of the medium may be, for example, acetic acid, ethanol, glucose, sucrose, dextrin, glycerol, starch, etc., and as a nitrogen source, peptone, meat extract, yeast Extracts, dried yeast, soybean cake, urea, thiourea, ammonium salts, nitrates and other organic or inorganic nitrogen-containing compounds may be used, but are not limited to these ingredients.

According to an embodiment of the present invention, limonene may be obtained from a culture solution obtained by culturing the mutant strain.

delete

1 is a diagram showing a metabolic circuit in which acetic acid and ethanol are converted into various biochemical substances including limonene in Saccharomyces cerevisiae.
Figure 2 is a diagram showing a production circuit for producing limonene and ergosterol from DMAPP and IPP.
3 is a diagram showing the mevalonate pathway from Acetyl-CoA to DMAPP and IPP.
4 is a schematic diagram of glyoxylate shunt.
5 shows the flask culture results for the mutant strain according to an embodiment of the present invention. Black bars represent absorbance at 600 nm, white bars represent total consumption of acetic acid and ethanol, and gray bars represent limonene concentration in the dodecane layer.
Figure 6a shows the batch culture results for the SCAL06 mutant strain according to an embodiment of the present invention.
Figure 6b shows the batch culture results for the SCAL11 mutant strain according to an embodiment of the present invention. The black diamond represents the ethanol concentration (mM), the black triangle represents the acetic acid concentration (mM), the gray square represents the absorbance at 600 nm, and the gray circle represents the limonene concentration in the dodecane layer.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example 1: Vector construction for a gene related to the limonene synthesis pathway

Saccharomyces cerevisiae In vivo, the C5 monomers DMAPP and IPP synthesized from Acetyl-CoA are synthesized through Geranyl-PP (Geranyl Pyrophosphate)-Farnesyl-PP (Farnesyl Pyrophosphate) to synthesize Ergosterol, an important cell component do. In the step of synthesizing Farneyl-PP from Geranyl-PP, a precursor of limonene synthesis, both DMAPP and Geranyl-PP synthase synthesizing IPP into Geranyl-PP are involved. Is known to be difficult to produce. Therefore, Codon-Optimized Geranyl-PP synthase (trGPPS2) from which the signal peptide known to have low Farnesyl-PP synthase activity, along with Codon-Optimized Truncated (S)-limonene synthase (trLS from Mentha spicata) from which the signal peptide was removed, was removed. from Abies grandis ) or Geranyl-PP and the signal peptide synthesizing Neryl Pyrophosphate (Neryl-PP), which has an isomer relationship with Geranyl-PP and cannot be a substrate for further reaction to Farnesyl-PP, has been removed from Codon-Optimized Neryl-PP synthase (trNDPS1 from Solanum lycopersicum ) was inserted into Yeast Episomal Plasmid pESC-TRP vector by combining Acetate-Ethanol Inducible ICL1 promoter, ADH1-CYC1 terminator using Gibson Assembly technique (NEB) and expression to produce limonene I made it possible.

primer Sequence (5'-3') Sequence listing number PICL1(trLS)_F (MluI) AGTATAATGTTACATGCGTAC ACGCGT TTTTGCTACTCGTCATCCGAT 11 PICL1(trLS)__R GACGTTCCAT TTTTCGTTGACTTTTTGTTATGTTATG 12 trLS_F TCAACGAAAA ATGGAACGTCGTTCTGGTAATT 13 trLS_R TAGAGCGGAT TTAAGCAAATGGCTCGAACAA 14 TCYC1_F ATTTGCTTAA ATCCGCTCTAACCGAAAAGG 15 TCYC1_R AGTAGCAAAA CTTCGAGCGTCCCAAAAC 16 PICL1(trGPPS2, trNDPS1)_F ACGCTCGAAG TTTTGCTACTCGTCATCCGAT 17 PICL1(trGPPS2)_F AATTCTACCAT TTTTCGTTGACTTTTTGTTATGTTATG 18 trGPPS2_F GTCAACGAAAA ATGGTAGAATTTGATTTTAACAAATATATGG 19 trGPPS2_R (XhoI) CGAAGAATTGTTAATTAA GAGCTC TTAATTTTGTCTGAATGCAACATAATC 20 PICL1(trNDPS1)_R TGGCGGACA TTTTCGTTGACTTTTTGTTATGTTATG 21 trNDPS1_F TCAACGAAAA ATGTCCGCCAGAGGATTG 22 trNDPS1_R (XhoI) CGAAGAATTGTTAATTAA GAGCTC TTAATATGTGTGTCCACCGAATCT 23

Example 2: Vector construction for genes related to the mevalonate synthesis pathway

For high-concentration production of limonene, it is necessary to enhance the flow of the mevalonate pathway from Acetyl-CoA to DMAPP and IPP. From the existing literature, the four stages of the bottle-neck of the mevalonate pathway were identified, and the pattern of how limonene production increased by solving the bottle-neck through gene overexpression was confirmed.

2-1. Vector construction for genes related to the upstream pathway of mevalonate synthesis

The stage from Acetyl-CoA to mevalonate is called the upper route, and the bottle-neck stage among the higher routes was to be strengthened first. Acetyl-CoA Acetyltransferase gene (ERG10, Homologous Expression) and 3-Hydroxy-3-Methyl-Glutaryl-CoA (HMG-CoA ) To synthesize mevalonate by reducing Truncated NADPH Dependent HMG-CoA Reductase (trHMG1, Homologous Expression) or Codon-Optimized Acetyl-CoA Acetyltransferase/NADH Dependent HMG-CoA Reductase ( mvaE from Enterococcus faecalis ) Acetate-Ethanible PCK1 In combination with the promoter, ADH1-CYC1 terminator, the Yeast Episomal Plasmid pESC-LEU vector was inserted (pASC-LEU1, 2 vectors) and expressed using Gibson Assembly technique (NEB) to confirm the increase in limonene production.

primer Sequence (5'-3') Sequence listing number PPCK1(ERG10)_F (MluI) AGTATAATGTTACATGCGTAC ACGCGT GATCTGGATTTCCTAATTTGGATACA 24 PPCK1(ERG10)_R GTTCTGAGACAT GTTGTTATTTTATTATGGAATAATTAGTTGC 25 ERG10_F TAAAATAACAAC ATGTCTCAGAACGTTTACATTGTATCG 26 ERG10_R TTAGAGCGGAT TCATATCTTTTCAATGACAATAGAGGA 27 TCYC1_F AAAAGATATGA ATCCGCTCTAACCGAAAAGG 28 TCYC1_R AATCCAGATC CTTCGAGCGTCCCAAAAC 29 PPCK1(trHMG1)_F ACGCTCGAAG GATCTGGATTTCCTAATTTGGATACA 30 PPCK1(trHMG1)_R CTGCTGCCAT GTTGTTATTTTATTATGGAATAATTAGTTGC 31 trHMG1_F AAATAACAAC ATGGCAGCAGACCAATTGGTGAAAACT 32 trHMG1_R (XhoI) CGAAGAATTGTTAATTAA GAGCTC T TAGGATTTAATGCAGGTGACG 33 PPCK1(mvaE)_R ACCGTTTTCAT GTTGTTATTTTATTATGGAATAATTAGTTGC 34 mvaE_F AAAATAACAAC ATGAAAACGGTTGTTATTATTGATGC 35 mvaE_F (XhoI) CGAAGAATTGTTAATTAAGAGCTC TTATTGTTTTCTGAGATCATTCAAGATAG 36

2-2. Vector construction for genes related to the upstream pathway of mevalonate synthesis

The step from mevalonate to DMAPP and IPP is called a sub-path, and the bottle-neck step among the sub-paths was reinforced to confirm an additional increase in limonene production. Mevalonate is phosphorylated by ATP to express only mevalonate kinase gene (ERG12, Homologous Expression), which becomes Phosphomevalonate (Mevalonate-P), or ERG13 isomerization between DMAPP and IPP to control the ratio of DMAPP and IPP. IPP Delta-Isomerase (IDI1, Homologous Expression) was combined with Acetate-Ethanol Inducible FBP1 promoter and ADH1-CYC1 terminator and inserted into Yeast Episomal Plasmid pESC-HIS Vector using Gibson Assembly technique (NEB) (pASC-HIS1, 2 Vector) and expression to confirm an increase in limonene production.

primer Sequence (5'-3') Sequence listing number PFBP1(ERG12, IDI1) _F (MluI) AGTATAATGTTACATGCGTAC ACGCGT AACCCATCAAACTGCATGGT 37 PFBO1(ERG12)_R GGTAATGACAT ATGTGTGGTAGTATGAGGGATGTTT 38 ERG12_F TACCACACAT ATGTCATTACCGTTCTTAACTTCTGC 39 ERG12_R (XhoI) CGAAGAATTGTTAATTAA GAGCTC TTATGAAGTCCATGGTAAATTCGTG 40 PFBP1(IDI1)_R CGGCAGTCAT ATGTGTGGTAGTATGAGGGATGTTT 41 IDI1_F TACCACACAT ATGACTGCCGACAACAATAGTATG 42 IDI1_R TTAGAGCGGAT TTATAGCATTCTATGAATTTGCCTGT 43 TCYC1_F AATGCTATAA ATCCGCTCTAACCGAAAAGG 44 TCYC1_R TTGATGGGTT CTTCGAGCGTCCCAAAAC 45 PFBP1(ERG12)_F ACGCTCGAAG AACCCATCAAACTGCATGGT 46

Example 3: Vector construction for genes related to the glyoxylic acid cycle

When bacteria grow and metabolize using acetic acid and ethanol, which are non-carbohydrate carbon sources, Glyoxylate Shunt is used to prevent the emission of carbon dioxide from the TCA cycle and accumulate carbon as oxalic acid for gluconeogenesis for synthesizing cellular components. It needs to be activated and maintained. The pESC-URA vector by combining the Glyoxylate Shunt component gene Isocitrate Lyase (ICL1, Homologous Expression) and malate synthase (MLS1, Homologous Expression) with the Acetate-Ethanol Inducible PGI1 promoter, ADH1-CYC1 terminator to increase the ability to utilize acetic acid and ethanol. In the Gibson Assembly technique, it was inserted (pASC-URA vector) and expressed to confirm the change in the production of limonene.

primer Sequence (5'-3') Sequence listing number PPGI1(ICL1)_F (MluI) AGTATAATGTTACATGCGTAC ACGCGT TAACAAAAATCACGATCTGGGT 47 PPGI1(ICL1)_R GGATAGGCAT TTTTAGGCTGGTATCTTGATTCTAAAT 48 ICL1_F CAGCCTAAAA ATGCCTATCCCCGTTGG 49 ICL1_R GTTAGAGCGGAT CTATTTCTTTACGCCATTTTCTTTG 50 TCYC1_F TAAAGAAATAG ATCCGCTCTAACCGAAAAGG 51 TCYC1_R ATTTTTGTTA CTTCGAGCGTCCCAAAAC 52 PPGI1(MLS1)_F ACGCTCGAAG TAACAAAAATCACGATCTGGGT 53 PPGI1(MLS1)_R CCTTAACCAT TTTTAGGCTGGTATCTTGATTCTAAAT 54 MLS1_F CAGCCTAAAA ATGGTTAAGGTCAGTTTGGATAACG 55 MLS1_R (XhoI) CGAAGAATTGTTAATTAA GAGCTC TCACAATTTGCTCAAATCAGTG 56

Designation Genotype Notes SCAL00 pESC-TRP, TRP1, pESC-LEU, LEU2, pESC-HIS, HIS3 Positive Control SCAL01 pSCAL-TRP1, TRP1, P _ICL1 -trGPPS2-T _ADH1 , P _ICL1 -trLS-T _CYC1
pESC-LEU, LEU2, pESC-HIS, HIS3 Codon optimized
trLS from
Mentha spicate

Codon optimized
trGPPS2 from
Abies grandis SCAL02 pSCAL-TRP2, TRP1, P _ICL1 -trNDPS1-T _ADH1 , P _ICL1 -trLS-T _CYC1
pESC-LEU, LEU2, pESC-HIS, HIS3 Codon optimized
trNDPS1 from
Solanum lycospersicum SCAL03 pSCAL-TRP2, TRP1, P _ICL1 -trNDPS1-T _ADH1 , P _ICL1 -trLS-T _CYC1
pSCAL-LEU1, LEU2, P _PCK1 -ERG10-T _ADH1 , P _PCK1 -trHMG1-T _CYC1
pESC-HIS, HIS3 SCAL04 pSCAL-TRP2, TRP1, P _ICL1 -trNDPS1-T _ADH1 , P _ICL1 -trLS-T _CYC1
pSCAL-LEU2, LEU2, P _PCK1 -ERG10-T _ADH1 , P _PCK1 - mvaE -T _CYC1
pESC-HIS, HIS3 Codon optimized
mvaE from
Enterococcus faecalis SCAL05 pSCAL-TRP2, TRP1, P _ICL1 -trNDPS1-T _ADH1 , P _ICL1 -trLS-T _CYC1
pSCAL-LEU1, LEU2, P _PCK1 -ERG10-T _ADH1 , P _PCK1 -trHMG1-T _CYC1
pSCAL-HIS1, HIS3, P _FBP1 -ERG12-T _ADH1 SCAL06 pSCAL-TRP2, TRP1, P _ICL1 -trNDPS1-T _ADH1 , P _ICL1 -trLS-T _CYC1
pSCAL-LEU1, LEU2, P _PCK1 -ERG10-T _ADH1 , P _PCK1 -trHMG1-T _CYC1
pSCAL-HIS2, HIS3, P _FBP1 -ERG12-T _ADH1 , P _FBP1 -IDI1-T _CYC1 SCAL11 pSCAL-TRP2, TRP1, P _ICL1 -trNDPS1-T _ADH1 , P _ICL1 -trLS-T _CYC1
pSCAL-LEU1, LEU2, P _PCK1 -ERG10-T _ADH1 , P _PCK1 -trHMG1-T _CYC1
pSCAL-HIS2, HIS3, P _FBP1 -ERG12-T _ADH1 , P _FBP1 -IDI1-T _CYC1
pSCAL-URA, URA3, P _PGI1 -ICL1-T _ADH1 , ,P _PGI1 -MLS1-T _CYC1

Example 4: Production of mutant strains

The pre-cultured culture solution was inoculated in 50 mL YPAD medium so that OD600 became 0.25, incubated until OD600 became 1.0, centrifuged at 1000Xg for 5 minutes, resuspended in 10 mL LTE buffer, and then again 1000Xg. It was centrifuged for 5 minutes. After resuspending in 0.5 mL LTE buffer, 50 μL was dispensed and 1 μg of the vector to be transformed was added. 300 μL of Transformation Mix was added, followed by incubation at 30°C for 30 minutes and then at 42°C for 15 minutes. 100 μL was spread on Seletion Agar Plate (SD dropout Agar) and incubated for 2 days at 30°C.

Example 5: Confirmation of the yield of limonene production of the recombinant mutant strain

5-1. Medium composition

SD Media SAE Media Phosphate Buffer 150mM (pH 5.7) Carbon Substrate Dextrose 20 g/L Acetate Buffer 50mM
Ethanol 150mM Ammonium Sulfate 5 g/L Monopotassium Phosphate 1 g/L Magnesium Sulfate 0.5 g/L Sodium Chloride 0.1 g/L Calcium Chloride 0.1 g/L Boric Acid 0.5 mg/L Manganese Sulfate 0.4 mg/L Zinc Sulfate 0.4 mg/L Ferric Chloride 0.2 mg/L Sodium Molybdate 0.2 mg/L Potassium Iodide 0.1 mg/L Copper Sulfate 0.04 mg/L Inositol 2 mg/L Niacin 0.4 mg/L Pyridoxin HCl 0.4 mg/L Thiamine HCl 0.4 mg/L Calcium Pantothenate 0.4 mg/L Riboflavin 0.2 mg/L p-Aminobenzoic Acid 0.2 mg/L Folic Acid 2 μg/L Biotin 2 μg/L Adenine Sulfate 200 mg/L Uracil 100 mg/L (Exceptional in -URA) L-Lysine HCl 150 mg/L L-Tryptophan 200 mg/L (Exceptional in -TRP) L-Leucine 300 mg/L (Exceptional in -LEU) L-Histidine 100 mg/L (Exceptional in -HIS) L-Arginine HCl 20 mg/L L-Aspartate 100 mg/L L-Glutamate 100 mg/L L-Methionine 20 mg/L L-Phenylalanine 50 mg/L L-Serine 375 mg/L L-Threonine 200 mg/L L-Tyrosine 30 mg/L L-Valine 150 mg/L

5-2. Culture and analysis conditions

Media & Culture Culture conditions analysis SAE-TRP-LEU-HIS(-URA) medium
(Synthetic Acetate-Alcohol Medium)
150 mM pH 5.7 phosphate buffer
50 mM sodium acetate
150 mM ethanol
OD = 0.6 inoculation
From SD-TRP-LEU-HIS(-URA) culture
(Synthetic dextrose medium)
Dodecane layer at 4 hours of incubation (10% v/v) Baffle flask
Agitation: 250 rpm
Working volume: 50 mL
Temperature: 30℃
72 hours incubation Aqueous Phase
Instrument: HPLC (Younglin)
Column: Hi Plex-H Column
Temperature: 80℃
Mobile phase: 0.1NH ₂ SO ₄
Organic Phase
Instrument: GC-MS (Agilent)
Column: HP5-MS Column
Temperature: 50℃ →? 90℃? →? 96℃?
Mobile phase: helium Batch culture
Agitation: 300 rpm
Aeration: 1.5 vvm
Working volume: 1L
Temperature: 30℃
72 hours incubation

As a result of incubation in the flask for 72 hours, the production of limonene was SCAL01<SCAL02 (trNDPS), SCAL04<SCAL03 (trHMG1), and SCAL05 <SCAL06 (ERG12, IDI). As a result of Glyoxylate Shunt Expression (SCAL11), the production rate decreased, but the yield increased (FIG. 5 and Table 8).

Cell Growth (A600) C2 Consumption (mM) Limonene Production (mg/L) SCAL00 14.896 0.82472 15.67242 0 0 0 SCAL01 12.46 0.60622 15.44173 0.39957 1.8032 0.17724 SCAL02 12.845 0.48452 15.67242 0 2.0556 0.19024 SCAL03 12.054 0.65774 15.59648 0.13154 7.8188 0.98304 SCAL04 14.168 0.57829 15.67242 0 2.6508 0.37604 SCAL05 7.973 0.72574 15.05039 0.82588 6.8048 0.05958 SCAL06 11.368 0.37703 15.56026 0.19427 9.2156 2.77338 SCAL11 4.99767 0.55267 8.82281 0.14503 7.05214 1.45027

As a result of batch culture for 72 hours, the growth rate of SCAL06 was faster (FIG. 6A and Table 9), but the limonene production in SCAL11 appeared at a concentration of about 12.6 mg/L Dodecane, recording the highest production amount (FIG. 6B and Table 9). 10).

Time (h) Cell Growth (A600) Acetate (mM) Ethanol (mM) Limonene (mg/L) 0 0.645 47.58265 142.1597 0 4 1.494 47.94271 134.7505 0 8 1.56 47.55288 116.7933 0.60549 11 1.674 46.7892 108.2449 0.83713 22 2.208 42.79486 75.26443 1.88687 34 3.33 31.91628 48.65299 3.70632 48 5.863 11.06765 19.36254 7.1103 58 7.436 0 0 9.40429 72 7.326 0 0 10.33353

Time (h) Cell Growth (A600) Acetate (mM) Ethanol (mM) Limonene (mg/L) 0 0.627 48.00402 142.4696 0 4 1.224 48.88074 135.1548 0 8 1.35 48.80533 121.0565 0.84101 11 1.452 48.593 111.9966 1.39103 22 1.758 47.16727 77.19594 2.22597 34 2.538 41.40302 45.10052 4.9424 48 3.806 29.84346 24.43126 8.46249 58 4.72 21.24138 14.4651 10.20487 72 6.061 0 0 12.64235

<110> SOGANG UNIVERSITY RESEARCH FOUNDATION <120> Mutant Strain with Limonene Production Ability <130> PN180368 <160> 56 <170> KoPatentIn 3.0 <210> 1 <211> 1635 <212> DNA <213> Artificial Sequence <220> <223> trLS, Codon-Optimized Truncated (S)-Limonene Synthase <400> 1 atggaacgtc gttctggtaa ttataatcca tctagatggg atgttaattt tatacaatct 60 ttgttgtcgg attataaaga ggataagcac gttattagag cttctgaatt ggttactttg 120 gttaaaatgg aattggaaaa agaaactgat caaattagac aattggaatt gatagacgat 180 ttgcagagaa tgggtttgtc cgatcatttc caaaatgaat tcaaagaaat cttgagctct 240 atttatttgg atcatcacta ttataaaaac ccattcccaa aagaagaaag ggacttgtac 300 tctacatctc tggctttcag attgctgcga gagcatggtt ttcaagtggc tcaagaagtt 360 tttgattctt ttaagaatga ggaaggcgaa tttaaggaat ccttgtctga tgataccaga 420 ggtttgttgc agttgtacga ggcttctttt ttgttgaccg agggtgagac aactttggaa 480 tctgcgagag aattcgctac caagtttttg gaagagaagg tcaacgaagg tggggttgat 540 ggggacttgt tgacgcgtat tgcttacagt ttggatattc ctctacattg gaggattaaa 600 cgaccaaacg ctccagtctg gattgaatgg tacagaaaaa gacccgatat gaatccagtt 660 gttttggaat tggcaattct cgatttgaat attgtacaag ctcagttcca ggaagaactt 720 aaagagtctt ttaggtggtg gaggaataca ggattcgtag aaaaattgcc gttcgcaaga 780 gatagactcg ttgaatgtta cttttggaat actggtatta tcgaaccgcg tcaacacgct 840 tctgcccgca tcatgatggg taaagttaat gctcttataa cggttattga tgacatctat 900 gatgtttacg gaactttgga agaattggag cagtttacgg acttgatcag gaggtgggat 960 atcaattcta tagatcagtt gcctgactat atgcagttgt gttttttggc ccttaataat 1020 tttgtcgatg atacttctta tgacgttatg aaggagaagg gtgtgaatgt tattccttat 1080 ttgagacaat cttgggttga cttggctgat aaatacatgg ttgaagctag atggttttat 1140 ggtggacata agccaagctt ggaagagtac ttggagaact cttggcaatc tatttctggc 1200 ccttgcatgt taacacacat attcttccgt gttacagact cattcactaa agaaaccgtt 1260 gatagtttgt ataagtatca cgatttggtt cgctggagct cttttgttct gagattggct 1320 gacgatttgg gtacttctgt ggaggaggtg tcccggggtg acgttcccaa gtctttgcaa 1380 tgttacatgt ctgactataa cgcttcggaa gcggaagcta ggaaacatgt taaatggttg 1440 atcgctgaag tttggaaaaa aatgaacgct gaaagagttt ctaaggattc cccttttggc 1500 aaggatttta ttgggtgcgc tgtggacctt ggtagaatgg ctcaattgat gtaccataac 1560 ggtgacggcc atggtactca acatccaatt atacatcaac aaatgactag aactttgttc 1620 gagccatttg cttaa 1635 <210> 2 <211> 897 <212> DNA <213> Artificial Sequence <220> <223> trGPPS2, Codon-Optimized Geranyl-PP Synthase <400> 2 atggtagaat ttgattttaa caaatatatg gactctaagg caatgactgt gaacgaagct 60 ttaaataaag ccattccttt aagataccca caaaaaatat atgagtcgat gagatattct 120 ttattagcgg gtggtaaaag agtccgtcca gtactttgca tcgcagcatg cgaacttgtc 180 ggtggtaccg aagaattagc tattccaaca gcatgcgcca ttgaaatgat ccatactatg 240 agtttaatgc atgatgatct accctgtatc gataacgacg atttaaggag gggcaagccg 300 acaaatcata aaatatttgg cgaggatacg gcagtcacag ctggtaatgc tttacatagc 360 tatgcttttg aacacattgc tgtgtccact tcaaagacag tgggtgcaga tagaatatta 420 aggatggtga gtgaattggg tcgagctacc ggctcagaag gtgttatggg aggacaaatg 480 gttgatattg cttccgaagg cgatccatca atcgatttgc aaactttaga gtggattcac 540 attcataaga ccgcaatgtt actagaatgt agtgttgtat gtggagctat aatagggggt 600 gcttctgaaa ttgtaattga aagagctaga agatacgcaa gatgtgtcgg tttattattt 660 caggttgttg atgacatctt agatgttacg aaaagctctg acgaactagg taaaactgcg 720 ggaaaggatt taatttcaga caaagcaaca taccctaagt tgatgggttt agaaaaagct 780 aaagaattct ccgacgaact tctaaatcgt gctaagggtg aattgtcttg tttcgatcca 840 gttaaagctg ctcctttatt gggacttgct gattatgttg cattcagaca aaattaa 897 <210> 3 <211> 783 <212> DNA <213> Artificial Sequence <220> <223> trNDPS1, Codon-Optimized Neryl-PP Synthase <400> 3 atgtccgcca gaggattgaa caaaattagt tgttctttga atctgcaaac ggaaaagttg 60 tgttatgagg ataatgacaa cgatttggat gaggaattga tgcctaagca tattgcattg 120 attatggatg gcaatagacg ttgggctaaa gataaaggct tggaagttta tgaaggacat 180 aaacatatta ttccaaagct aaaagagatc tgtgatattt cttctaagtt ggggattcaa 240 atcattacag cttttgcatt ttcaaccgag aactggaaga ggtccaagga agaagtcgac 300 tttttgctac agatgtttga agaaatatac gatgaatttt ctagatcggg tgtgagagta 360 agtattatcg gttgtaaaag cgatttgccc atgacgctcc aaaagtgcat cgctctaact 420 gaagaaacta ctaaaggaaa taagggtttg cacttggtaa ttgcgcttaa ctacggtggc 480 tactatgaca tattgcaggc cacaaagtca atagttaata aggccatgaa cggtcttctt 540 gacgtcgaag acataaataa aaacttgttc gatcaagaat tggagagcaa atgcccaaat 600 cctgacctgt tgatcagaac cgggggtgag caaagggttt caaacttcct gctttggcaa 660 ctagcatata ccgaattcta cttcactaac acattgtttc cagatttcgg tgaggaagat 720 ttgaaagaag ctataatgaa ctttcaacag agacatagaa gattcggtgg acacacatat 780 taa 783 <210> 4 <211> 1197 <212> DNA <213> Artificial Sequence <220> <223> ERG10, Acetyl-CoA Acetyltransferase <400> 4 atgtctcaga acgtttacat tgtatcgact gccagaaccc caattggttc attccagggt 60 tctctatcct ccaagacagc agtggaattg ggtgctgttg ctttaaaagg cgccttggct 120 aaggttccag aattggatgc atccaaggat tttgacgaaa ttatttttgg taacgttctt 180 tctgccaatt tgggccaagc tccggccaga caagttgctt tggctgccgg tttgagtaat 240 catatcgttg caagcacagt taacaaggtc tgtgcatccg ctatgaaggc aatcattttg 300 ggtgctcaat ccatcaaatg tggtaatgct gatgttgtcg tagctggtgg ttgtgaatct 360 atgactaacg caccatacta catgccagca gcccgtgcgg gtgccaaatt tggccaaact 420 gttcttgttg atggtgtcga aagagatggg ttgaacgatg cgtacgatgg tctagccatg 480 ggtgtacacg cagaaaagtg tgcccgtgat tgggatatta ctagagaaca acaagacaat 540 tttgccatcg aatcctacca aaaatctcaa aaatctcaaa aggaaggtaa attcgacaat 600 gaaattgtac ctgttaccat taagggattt agaggtaagc ctgatactca agtcacgaag 660 gacgaggaac ctgctagatt acacgttgaa aaattgagat ctgcaaggac tgttttccaa 720 aaagaaaacg gtactgttac tgccgctaac gcttctccaa tcaacgatgg tgctgcagcc 780 gtcatcttgg tttccgaaaa agttttgaag gaaaagaatt tgaagccttt ggctattatc 840 aaaggttggg gtgaggccgc tcatcaacca gctgatttta catgggctcc atctcttgca 900 gttccaaagg ctttgaaaca tgctggcatc gaagacatca attctgttga ttactttgaa 960 ttcaatgaag ccttttcggt tgtcggtttg gtgaacacta agattttgaa gctagaccca 1020 tctaaggtta atgtatatgg tggtgctgtt gctctaggtc acccattggg ttgttctggt 1080 gctagagtgg ttgttacact gctatccatc ttacagcaag aaggaggtaa gatcggtgtt 1140 gccgccattt gtaatggtgg tggtggtgct tcctctattg tcattgaaaa gatatga 1197 <210> 5 <211> 1584 <212> DNA <213> Artificial Sequence <220> <223> trHMG1, Truncated HMG-CoA Reductase <400> 5 atggcagcag accaattggt gaaaactgaa gtcaccaaga agtcttttac tgctcctgta 60 caaaaggctt ctacaccagt tttaaccaat aaaacagtca tttctggatc gaaagtcaaa 120 agtttatcat ctgcgcaatc gagctcatca ggaccttcat catctagtga ggaagatgat 180 tcccgcgata ttgaaagctt ggataagaaa atacgtcctt tagaagaatt agaagcatta 240 ttaagtagtg gaaatacaaa acaattgaag aacaaagagg tcgctgcctt ggttattcac 300 ggtaagttac ctttgtacgc tttggagaaa aaattaggtg atactacgag agcggttgcg 360 gtacgtagga aggctctttc aattttggca gaagctcctg tattagcatc tgatcgttta 420 ccatataaaa attatgacta cgaccgcgta tttggcgctt gttgtgaaaa tgttataggt 480 tacatgcctt tgcccgttgg tgttataggc cccttggtta tcgatggtac atcttatcat 540 ataccaatgg caactacaga gggttgtttg gtagcttctg ccatgcgtgg ctgtaaggca 600 atcaatgctg gcggtggtgc aacaactgtt ttaactaagg atggtatgac aagaggccca 660 gtagtccgtt tcccaacttt gaaaagatct ggtgcctgta agatatggtt agactcagaa 720 gagggacaaa acgcaattaa aaaagctttt aactctacat caagatttgc acgtctgcaa 780 catattcaaa cttgtctagc aggagattta ctcttcatga gatttagaac aactactggt 840 gacgcaatgg gtatgaatat gatttctaaa ggtgtcgaat actcattaaa gcaaatggta 900 gaagagtatg gctgggaaga tatggaggtt gtctccgttt ctggtaacta ctgtaccgac 960 aaaaaaccag ctgccatcaa ctggatcgaa ggtcgtggta agagtgtcgt cgcagaagct 1020 actattcctg gtgatgttgt cagaaaagtg ttaaaaagtg atgtttccgc attggttgag 1080 ttgaacattg ctaagaattt ggttggatct gcaatggctg ggtctgttgg tggatttaac 1140 gcacatgcag ctaatttagt gacagctgtt ttcttggcat taggacaaga tcctgcacaa 1200 aatgttgaaa gttccaactg tataacattg atgaaagaag tggacggtga tttgagaatt 1260 tccgtatcca tgccatccat cgaagtaggt accatcggtg gtggtactgt tctagaacca 1320 caaggtgcca tgttggactt attaggtgta agaggcccgc atgctaccgc tcctggtacc 1380 aacgcacgtc aattagcaag aatagttgcc tgtgccgtct tggcaggtga attatcctta 1440 tgtgctgccc tagcagccgg ccatttggtt caaagtcata tgacccacaa caggaaacct 1500 gctgaaccaa caaaacctaa caatttggac gccactgata taaatcgttt gaaagatggg 1560 tccgtcacct gcattaaatc ctaa 1584 <210> 6 <211> 2412 <212> DNA <213> Artificial Sequence <220> <223> Codon Optimized mvaE, Codon-Optimized Acetyl-CoA Acetyltransferase/NADH Dependent HMG-CoA Reductase <400> 6 atgaaaacgg ttgttattat tgatgctttg agaactccaa tagggaaata taagggttct 60 ttgtctcaag tttctgcggt tgatttgggt actcatgtca ctactcagtt gttgaagaga 120 cattctacta tttctgaaga aatcgatcag gttatttttg gtaatgtttt gcaagctggc 180 aatggtcaaa atcctgctag acaaattgct atcaattcag gtttgtctca cgaaattcca 240 gctatgactg ttaatgaagt atgtgggtct ggcatgaagg ctgtgatttt ggctaaacaa 300 ttgattcaat tgggggaagc tgaggttttg attgccggtg gaattgaaaa tatgtctcaa 360 gcgccaaaat tacaaaggtt taactatgaa actgagagtt acgatgctcc attctcttct 420 atgatgtatg atggtttgac tgatgctttt tcgggccaag ctatgggttt gactgctgaa 480 aatgttgctg aaaagtatca tgtaactagg gaagagcaag atcaattttc tgttcattct 540 cagttgaaag ccgctcaagc acaagctgaa ggaatctttg ctgatgaaat tgctcctttg 600 gaagtttctg gtactttggt tgaaaaagat gagggtatta gacctaattc tagcgttgaa 660 aaacttggta ctttgaagac tgtttttaaa gaggatggta ctgttactgc tggtaatgcc 720 agtactatta atgacggtgc ttcagctttg attattgctt ctcaagagta cgctgaagct 780 cacggactcc cttatttggc tattattaga gactctgttg aggtcggtat tgatcctgct 840 tacatgggta tttctccgat taaagctatt cagaaattgc tagctagaaa tcaattgact 900 actgaagaaa ttgatttgta cgaaattaac gaagcttttg ctgctacttc tattgtagtt 960 caaagagaat tggctttgcc ggaggagaaa gtgaatatat atggtggtgg aatttccttg 1020 ggtcacgcta taggtgctac gggtgctaga ttactcactt ctttgtctta tcagttgaac 1080 caaaaagaaa agaagtatgg tgttgcttct ttgtgcattg gtggtgggtt gggtttggct 1140 atgttgttgg aaaggccaca gcaaaaaaaa aactctagat tctaccaaat gtcgccagaa 1200 gaaaggttgg cttctcttct caatgaaggt caaatttctg ctgatactaa gaaagaattt 1260 gaaaatactg ctttgtcttc tcaaatcgct aatcatatga ttgagaatca aatctctgaa 1320 actgaagttc ccatgggtgt tggtttgcat ttgacagttg acgagaccga ttacttggtt 1380 ccaatggcta ctgaagaacc atctgttatt gctgctttgt caaatggtgc taagattgct 1440 caaggtttta aaactgttaa tcagcaaaga ttgatgaggg gtcaaatagt tttctacgat 1500 gttgctgacg ctgaatcttt gattgatgag ttgcaggtcc gtgaaactga gatttttcaa 1560 caagccgaac tttcttatcc aagtatcgtg aaaagaggtg gtgggttgag agatttgcaa 1620 tatcgggctt tcgacgaatc tttcgtttct gttgatttct tggttgatgt aaaagacgct 1680 atgggcgcta atattgttaa cgctatgttg gaaggtgttg ctgaattgtt tcgagaatgg 1740 tttgcggaac agaaaatttt gttcagtatt ttgtctaatt atgctacgga atctgttgtt 1800 actatgaaaa cagcgattcc cgtgtctaga ttgtcaaaag gttctaatgg tcgagaaatt 1860 gccgaaaaaa tcgttttggc ttctagatat gctagcttgg acccataccg cgctgttacc 1920 cataacaaag gtattatgaa tggtattgaa gctgtcgttt tagctactgg taatgacact 1980 agagctgttt ctgcttcttg tcatgctttc gcagttaaag aaggtagata ccaaggtttg 2040 acatcttgga ctttggacgg tgaacaactt attggtgaaa tttctgttcc attggctctt 2100 gcaactgtag gtggtgctac taaagtttta cctaagtctc aggctgctgc tgacttgttg 2160 gccgttacgg atgctaagga gttgtctaga gttgttgctg ctgttggtct ggctcagaat 2220 ttggccgctt tgagagcatt ggtgtctgaa gggattcaga aaggtcacat ggctttgcag 2280 gctagatcgt tagctatgac tgttggggct acaggtaaag aagtcgaagc tgttgctcaa 2340 cagttgaaga gacaaaaaac tatgaatcaa gatagagctt tagctatctt gaatgatctc 2400 agaaaacaat aa 2412 <210> 7 <211> 1332 <212> DNA <213> Artificial Sequence <220> <223> ERG12, Mevalonate Kinase <400> 7 atgtcattac cgttcttaac ttctgcaccg ggaaaggtta ttatttttgg tgaacactct 60 gctgtgtaca acaagcctgc cgtcgctgct agtgtgtctg cgttgagaac ctacctgcta 120 ataagcgagt catctgcacc agatactatt gaattggact tcccggacat tagctttaat 180 cataagtggt ccatcaatga tttcaatgcc atcaccgagg atcaagtaaa ctcccaaaaa 240 ttggccaagg ctcaacaagc caccgatggc ttgtctcagg aactcgttag tcttttggat 300 ccgttgttag ctcaactatc cgaatccttc cactaccatg cagcgttttg tttcctgtat 360 atgtttgttt gcctatgccc ccatgccaag aatattaagt tttctttaaa gtctacttta 420 cccatcggtg ctgggttggg ctcaagcgcc tctatttctg tatcactggc cttagctatg 480 gcctacttgg gggggttaat aggatctaat gacttggaaa agctgtcaga aaacgataag 540 catatagtga atcaatgggc cttcataggt gaaaagtgta ttcacggtac cccttcagga 600 atagataacg ctgtggccac ttatggtaat gccctgctat ttgaaaaaga ctcacataat 660 ggaacaataa acacaaacaa ttttaagttc ttagatgatt tcccagccat tccaatgatc 720 ctaacctata ctagaattcc aaggtctaca aaagatcttg ttgctcgcgt tcgtgtgttg 780 gtcaccgaga aatttcctga agttatgaag ccaattctag atgccatggg tgaatgtgcc 840 ctacaaggct tagagatcat gactaagtta agtaaatgta aaggcaccga tgacgaggct 900 gtagaaacta ataatgaact gtatgaacaa ctattggaat tgataagaat aaatcatgga 960 ctgcttgtct caatcggtgt ttctcatcct ggattagaac ttattaaaaa tctgagcgat 1020 gatttgagaa ttggctccac aaaacttacc ggtgctggtg gcggcggttg ctctttgact 1080 ttgttacgaa gagacattac tcaagagcaa attgacagct tcaaaaagaa attgcaagat 1140 gattttagtt acgagacatt tgaaacagac ttgggtggga ctggctgctg tttgttaagc 1200 gcaaaaaatt tgaataaaga tcttaaaatc aaatccctag tattccaatt atttgaaaat 1260 aaaactacca caaagcaaca aattgacgat ctattattgc caggaaacac gaatttacca 1320 tggacttcat aa 1332 <210> 8 <211> 867 <212> DNA <213> Artificial Sequence <220> <223> IDI1, Isopentenyl-PP Delta-Isomerase <400> 8 atgactgccg acaacaatag tatgccccat ggtgcagtat ctagttacgc caaattagtg 60 caaaaccaaa cacctgaaga cattttggaa gagtttcctg aaattattcc attacaacaa 120 agacctaata cccgatctag tgagacgtca aatgacgaaa gcggagaaac atgtttttct 180 ggtcatgatg aggagcaaat taagttaatg aatgaaaatt gtattgtttt ggattgggac 240 gataatgcta ttggtgccgg taccaagaaa gtttgtcatt taatggaaaa tattgaaaag 300 ggtttactac atcgtgcatt ctccgtcttt attttcaatg aacaaggtga attactttta 360 caacaaagag ccactgaaaa aataactttc cctgatcttt ggactaacac atgctgctct 420 catccactat gtattgatga cgaattaggt ttgaagggta agctagacga taagattaag 480 ggcgctatta ctgcggcggt gagaaaacta gatcatgaat taggtattcc agaagatgaa 540 actaagacaa ggggtaagtt tcacttttta aacagaatcc attacatggc accaagcaat 600 gaaccatggg gtgaacatga aattgattac atcctatttt ataagatcaa cgctaaagaa 660 aacttgactg tcaacccaaa cgtcaatgaa gttagagact tcaaatgggt ttcaccaaat 720 gatttgaaaa ctatgtttgc tgacccaagt tacaagttta cgccttggtt taagattatt 780 tgcgagaatt acttattcaa ctggtgggag caattagatg acctttctga agtggaaaat 840 gacaggcaaa ttcatagaat gctataa 867 <210> 9 <211> 1674 <212> DNA <213> Artificial Sequence <220> <223> ICL1, Isocitrate Lyase <400> 9 atgcctatcc ccgttggaaa tacgaagaac gattttgcag ctttacaagc aaaactagat 60 gcagatgctg ccgaaattga gaaatggtgg tctgactcac gttggagtaa gactaagaga 120 aattattcag ccagagatat tgctgttaga cgcgggacat tcccaccaat cgaataccca 180 tcttcggtca tggccagaaa attattcaag gtattagaga agcatcacaa tgagggtaca 240 gtctctaaaa ctttcggtgc cctagatcct gtccagattt ctcaaatggc aaaatactta 300 gacacaatct atatttctgg ttggcagtgt tcatcaactg cttccacctc aaatgaacct 360 ggtccagact tagctgatta tccaatggac accgttccaa acaaagtgga acatttgttc 420 aaggcccaat tgtttcacga cagaaaacaa ctagaggcac ggtcaaaggc taaatctcag 480 gaagaactcg atgagatggg tgccccaatt gactacctaa caccaattgt cgctgatgca 540 gacgcaggcc acggcggttt aaccgcagtc ttcaaattga ccaagatgtt cattgagcgt 600 ggtgctgctg ggatccacat ggaagaccag acatctacaa ataagaaatg tgggcatatg 660 gcaggaagat gtgttatacc cgttcaggaa catgttaaca gattggtgac tattagaatg 720 tgtgctgata tcatgcattc tgacttaatt gtcgttgcta ggactgattc agaagcagcc 780 actttgatta gctcaaccat cgataccaga gatcattatt tcattgtcgg tgccaccaat 840 ccaaatatcg agccatttgc cgaagtttta aatgatgcca tcatgagtgg tgcatcagga 900 caagaactag ctgacattga acaaaaatgg tgtagagacg ctggactcaa gttattccat 960 gaagccgtca ttgatgaaat tgaaagatca gccctgtcaa ataagcaaga attgattaag 1020 aaattcacct ctaaagtggg tccattgact gaaacatccc acagagaagc caagaagctc 1080 gctaaagaaa ttcttggcca cgaaattttc ttcgactggg agctaccacg cgtaagggaa 1140 gggttgtacc gttacagagg tgggacgcaa tgttctatca tgagggcccg tgcatttgct 1200 ccatatgctg atttggtatg gatggaatct aactacccag acttccaaca ggccaaggag 1260 tttgcagaag gtgttaaaga gaaattccct gaccaatggc tagcttacaa cttgtctcca 1320 tcctttaact ggccaaaagc catgtccgtt gatgaacaac acaccttcat ccaaaggctg 1380 ggtgatctag gttacatctg gcaatttatc acattggccg gtttacacac taacgcttta 1440 gctgtccata acttctctcg tgactttgcc aaggatggga tgaaagctta tgcccagaat 1500 gttcagcaga gggaaatgga cgatggtgtt gatgtgttga aacatcaaaa atggtctggt 1560 gcggagtaca tcgatgggtt attgaagtta gctcaaggtg gtgttagcgc aacagctgct 1620 atgggaaccg gtgtcacaga agatcaattc aaagaaaatg gcgtaaagaa atag 1674 <210> 10 <211> 1665 <212> DNA <213> Artificial Sequence <220> <223> MLS1, Malate Synthase <400> 10 atggttaagg tcagtttgga taacgtcaaa ttactggtgg atgttgataa ggagcctttc 60 tttaaaccat ctagtactac agtgggagat attcttacca aggatgctct agagttcatt 120 gttcttttac acagaacttt caacaacaag agaaaacaat tattggaaaa cagacaagtt 180 gttcagaaga aattagactc gggctcctat catctggatt tcctgcctga aactgcaaat 240 attagaaatg atcccacttg gcaaggtcca attttggcac cggggttaat taataggtca 300 acggaaatca cagggcctcc attgagaaat atgctgatca acgctttgaa tgctcctgtg 360 aacacctata tgactgattt tgaagattca gcttcaccta cttggaacaa catggtttac 420 ggtcaagtta atctctacga cgcgatcaga aatcaaatcg attttgacac accaagaaaa 480 tcgtacaaat tgaatggaaa tgtggccaac ttgcccacta ttatcgtgag accccgtggt 540 tggcacatgg tggaaaagca cctttatgta gatgatgaac caatcagcgc ttccatcttt 600 gattttggtt tatatttcta ccataatgcc aaagaattaa tcaaattggg caaaggtcct 660 tacttctatt tgccaaagat ggagcaccac ttggaagcta aactatggaa cgacgtcttc 720 tgtgtagctc aagattacat tgggatccca aggggtacaa tcagagctac tgtgttgatt 780 gaaactttgc ctgctgcttt ccaaatggaa gagatcatct atcaattaag acaacattct 840 agtgggttga attgcggacg ttgggactat attttctcta caatcaagag attaagaaat 900 gatcctaatc acattttgcc caatagaaat caagtgacta tgacttcccc attcatggat 960 gcatacgtga aaagattaat caatacctgt catcggaggg gtgttcatgc catgggtggt 1020 atggctgcgc aaatccctat caaagacgac ccggcagcca atgaaaaggc catgactaaa 1080 gtccgtaatg ataagattag agagctgaca aatggacatg atgggtcatg ggttgcacac 1140 ccagcactgg cccctatttg taatgaagtt ttcattaata tgggaacacc aaaccaaatc 1200 tatttcattc ctgaaaacgt tgtaacggct gctaatctgc tggaaaccaa aattccaaat 1260 ggtgagatta ctaccgaggg aattgtacaa aacttggata tcgggttgca gtacatggaa 1320 gcttggctca gaggctctgg atgtgtgccc atcaacaact tgatggaaga cgccgccact 1380 gctgaagtgt ctcgttgtca attgtatcaa tgggtgaaac acggtgttac tctaaaggac 1440 acgggagaaa aggtcacccc agaattaacc gaaaagattc taaaagaaca agtggaaaga 1500 ctgtctaagg caagtccatt gggtgacaag aacaaattcg cgctggccgc taagtatttc 1560 ttgccagaaa tcagaggcga gaaattcagt gaatttttga ctacattgtt gtacgacgaa 1620 attgtgtcca ctaaggcgac gcccactgat ttgagcaaat tgtga 1665 <210> 11 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> PICL1(trLS)_F (MluI) <400> 11 agtataatgt tacatgcgta cacgcgtttt tgctactcgt catccgat 48 <210> 12 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> PICL1(trLS)__R <400> 12 gacgttccat ttttcgttga ctttttgtta tgttatg 37 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> trLS_F <400> 13 tcaacgaaaa atggaacgtc gttctggtaa tt 32 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> trLS_R <400> 14 tagagcggat ttaagcaaat ggctcgaaca a 31 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> TCYC1_F <400> 15 atttgcttaa atccgctcta accgaaaagg 30 <210> 16 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> TCYC1_R <400> 16 agtagcaaaa cttcgagcgt cccaaaac 28 <210> 17 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> PICL1(trGPPS2, trNDPS1)_F <400> 17 acgctcgaag ttttgctact cgtcatccga t 31 <210> 18 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> PICL1(trGPPS2)_F <400> 18 aattctacca tttttcgttg actttttgtt atgttatg 38 <210> 19 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> trGPPS2_F <400> 19 gtcaacgaaa aatggtagaa tttgatttta acaaatatat gg 42 <210> 20 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> trGPPS2_R (XhoI) <400> 20 cgaagaattg ttaattaaga gctcttaatt ttgtctgaat gcaacataat c 51 <210> 21 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> PICL1(trNDPS1)_R <400> 21 tggcggacat tttcgttgac tttttgttat gttatg 36 <210> 22 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> trNDPS1_F <400> 22 tcaacgaaaa atgtccgcca gaggattg 28 <210> 23 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> trNDPS1_R (XhoI) <400> 23 cgaagaattg ttaattaaga gctcttaata tgtgtgtcca ccgaatct 48 <210> 24 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> PPCK1(ERG10)_F (MluI) <400> 24 agtataatgt tacatgcgta cacgcgtgat ctggatttcc taatttggat aca 53 <210> 25 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> PPCK1(ERG10)_R <400> 25 gttctgagac atgttgttat tttattatgg aataattagt tgc 43 <210> 26 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> ERG10_F <400> 26 taaaataaca acatgtctca gaacgtttac attgtatcg 39 <210> 27 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> ERG10_R <400> 27 ttagagcgga ttcatatctt ttcaatgaca atagagga 38 <210> 28 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> TCYC1_F <400> 28 aaaagatatg aatccgctct aaccgaaaag g 31 <210> 29 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> TCYC1_R <400> 29 aatccagatc cttcgagcgt cccaaaac 28 <210> 30 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> PPCK1(trHMG1)_F <400> 30 acgctcgaag gatctggatt tcctaatttg gataca 36 <210> 31 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> PPCK1(trHMG1)_R <400> 31 ctgctgccat gttgttattt tattatggaa taattagttg c 41 <210> 32 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> trHMG1_F <400> 32 aaataacaac atggcagcag accaattggt gaaaact 37 <210> 33 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> trHMG1_R (XhoI) <400> 33 cgaagaattg ttaattaaga gctcttagga tttaatgcag gtgacg 46 <210> 34 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> PPCK1(mvaE)_R <400> 34 accgttttca tgttgttatt ttattatgga ataattagtt gc 42 <210> 35 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> mvaE_F <400> 35 aaaataacaa catgaaaacg gttgttatta ttgatgc 37 <210> 36 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> mvaE_F (XhoI) <400> 36 cgaagaattg ttaattaaga gctcttattg ttttctgaga tcattcaaga tag 53 <210> 37 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> PFBP1(ERG12, IDI1) _F (MluI) <400> 37 agtataatgt tacatgcgta cacgcgtaac ccatcaaact gcatggt 47 <210> 38 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> PFBO1(ERG12)_R <400> 38 ggtaatgaca tatgtgtggt agtatgaggg atgttt 36 <210> 39 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> ERG12_F <400> 39 taccacacat atgtcattac cgttcttaac ttctgc 36 <210> 40 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> ERG12_R (XhoI) <400> 40 cgaagaattg ttaattaaga gctcttatga agtccatggt aaattcgtg 49 <210> 41 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> PFBP1(IDI1)_R <400> 41 cggcagtcat atgtgtggta gtatgaggga tgttt 35 <210> 42 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> IDI1_F <400> 42 taccacacat atgactgccg acaacaatag tatg 34 <210> 43 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> IDI1_R <400> 43 ttagagcgga tttatagcat tctatgaatt tgcctgt 37 <210> 44 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> TCYC1_F <400> 44 aatgctataa atccgctcta accgaaaagg 30 <210> 45 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> TCYC1_R <400> 45 ttgatgggtt cttcgagcgt cccaaaac 28 <210> 46 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> PFBP1(ERG12)_F <400> 46 acgctcgaag aacccatcaa actgcatggt 30 <210> 47 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> PPGI1(ICL1)_F (MluI) <400> 47 agtataatgt tacatgcgta cacgcgttaa caaaaatcac gatctgggt 49 <210> 48 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> PPGI1(ICL1)_R <400> 48 ggataggcat ttttaggctg gtatcttgat tctaaat 37 <210> 49 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ICL1_F <400> 49 cagcctaaaa atgcctatcc ccgttgg 27 <210> 50 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> ICL1_R <400> 50 gttagagcgg atctatttct ttacgccatt ttctttg 37 <210> 51 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> TCYC1_F <400> 51 taaagaaata gatccgctct aaccgaaaag g 31 <210> 52 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> TCYC1_R <400> 52 atttttgtta cttcgagcgt cccaaaac 28 <210> 53 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> PPGI1(MLS1)_F <400> 53 acgctcgaag taacaaaaat cacgatctgg gt 32 <210> 54 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> PPGI1(MLS1)_R <400> 54 ccttaaccat ttttaggctg gtatcttgat tctaaat 37 <210> 55 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> MLS1_F <400> 55 cagcctaaaa atggttaagg tcagtttgga taacg 35 <210> 56 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> MLS1_R (XhoI) <400> 56 cgaagaattg ttaattaaga gctctcacaa tttgctcaaa tcagtg 46

Claims (13)

A mutant limonene synthase gene encoded by the nucleotide sequence of SEQ ID NO: 1; And
A mutated Geranyl-PP synthase gene encoded by the nucleotide sequence of SEQ ID NO: 2; Or a recombinant vector comprising a mutant Neryl-PP synthase (truncated Neryl-PP synthase) gene encoded by the nucleotide sequence of SEQ ID NO: 3.
According to claim 1, The mutant limonene synthase (truncated limonene synthase) gene encoded by the nucleotide sequence of the first sequence of the sequence listing; And a recombinant vector comprising a mutant Neryl-PP synthase (truncated Neryl-PP synthase) gene encoded by the nucleotide sequence of SEQ ID NO: 3,
Acetyl-CoA acetyltransferase (ERG10) gene encoded by the nucleotide sequence of SEQ ID NO: 4; And
A mutant NADPH-dependent HMG-CoA reductase (truncated NADPH Dependent HMG-CoA Reductase) gene encoded by the nucleotide sequence of SEQ ID NO: 5; Or the acetyl-CoA acetyltransferase/NADH dependent HMG-CoA reductase (Acetyl-CoAAcetyltransferase/NADH Dependent HMG-CoA Reductase) gene encoded by the nucleotide sequence of SEQ ID NO:6.
According to claim 2, The acetyl-CoA acetyltransferase (Acetyl-CoAacetyltransferase, ERG10) gene encoded by the nucleotide sequence of the fourth sequence; And a recombinant vector further comprising a mutant NADPH-dependent HMG-CoA reductase (truncated NADPH Dependent HMG-CoA Reductase) gene encoded by the nucleotide sequence of SEQ ID NO: 5,
The recombinant vector further comprises a mevalonate kinase (ERG12) gene encoded by the nucleotide sequence of SEQ ID NO:7.
The method of claim 3, wherein the recombinant vector further comprises a mevalonate kinase (ERG12) gene encoded by the nucleotide sequence of SEQ ID NO:7,
The recombinant vector further comprises an IPP delta isomerase (Isopentenyl-diphosphate delta isomerase, IDI1) gene encoded by the nucleotide sequence of SEQ ID NO: 8.
The method of claim 4, wherein the recombinant vector comprising the IPP delta isomerase (Isopentenyl-diphosphate delta isomerase, IDI1) gene encoded by the nucleotide sequence of SEQ ID NO: 8,
Isocitrate Lyase (ICL1) gene encoded by the nucleotide sequence of SEQ ID NO: 9; And a malate synthase (MLS1) gene encoded by the nucleotide sequence of SEQ ID NO: 10. delete delete delete A mutant strain having limonene-producing ability transformed with the recombinant vector of claim 1.
The mutant strain according to claim 9, wherein the mutant strain is a strain of the genus Saccharomyces.
The method of claim 10, wherein the strain of the genus Saccharomyces is Saccharomyces cerevisiae , Saccharomyces uqvarum , Saccharomyces ellipsoideus, Saccharomyces carles Bergensis ( Saccharomyces carlsbergensis ), Saccharomyces sake (Saccharomyces sake ), Saccharomyces coreanus (Saccharomyces coreanus ), Saccharomyces lipolytica (Saccharomyces lipolytica) Saccharomyces bouladi (Saccharomyces boulardii ) or Saccharomyces boulardii Torianus ( Saccharomyces pastorianus ) that is, a mutant strain.
The mutant strain according to claim 9, wherein the mutant strain is transformed by one or more recombinant vectors.
Limonene production method comprising the step of culturing the mutant strain of claim 9.

Images