KR102211866B1 - Nanoparticle dimer linked by Y-shaped oligonucleotide conjugate, Method for producing the same, and Probe for single molecule observation comprising the same - Google Patents

Abstract

The present invention relates to a nanoparticle dimer linked by a Y-type oligonucleotide conjugate, a preparation method thereof, and a probe for single molecule observation including the same.In the present invention, a gyroscopic (rotational) plasmon nanoparticle was developed to develop a protein- It provides a single molecule stroboscopic imaging probe by enabling iterative validation of structural dynamics based on protein interactions and rotation and lateral velocities.

Description

Nanoparticle dimer linked by Y-shaped oligonucleotide conjugate, Method for producing the same, and Probe for single molecule observation comprising the same}

The present invention relates to a nanoparticle dimer linked by a Y-type oligonucleotide conjugate, a preparation method thereof, and a probe for single molecule observation including the same.

In living cells, the rotation and lateral movement of proteins are driven by thermal energy, and in biological processes, they are disturbed by biochemical and electrostatic interactions between biomolecules and biomolecules. Therefore, observing the direction and motion of each molecule in real time reveals both homogeneous or heterogeneous molecular interactions and their structural dynamics.

Recent studies based on single molecule tracking and Forster resonance energy transferForster (FRET) reveal protein-protein interactions and structural changes in biological processes, respectively. This microscopic method deconvolutes the temporal trajectory of individual biomolecular dynamics to obtain structure and motion data obscured by ensemble averaging.

However, the control of conformational dynamics and their transitions in the signaling process is still unclear. Rotational mechanics could provide new insights into the underlying molecular mechanisms.

Ideal probes for imaging membrane receptor rotation and lateral kinetics at the single molecule level include (i) a bright imaging domain sensitive to angular displacement, (ii) a rigid linker that prevents structural perturbation, and (iii) accurate at the major axis of rotation. It will include specific targeting domains for location and orientation.

While trying to develop a novel probe that satisfies the above requirements, the present inventors used the nanoparticle dimer linked by the Y-type oligonucleotide conjugate of the present invention to rotate the membrane protein and epidermal growth factor receptor (EGFR). It has been found that it can provide strategies to monitor motion and visualize unidentified structural dynamics, e.g. molecular assembly and structural changes in living cells without molecular perturbation, and can provide unique insights into the underlying mechanisms of molecular dynamics. It was confirmed that the present invention was completed.

Nano letters, 5(2), 301-304 Nano Letters, 1(1), 32-35

It is an object of the present invention to comprise (i) a bright imaging domain sensitive to angular displacement, (ii) a rigid linker that prevents structural perturbation, and (iii) a specific targeting domain for precise position and orientation in the main axis of rotation. To provide a nanoparticle dimer linked by a novel Y-type oligonucleotide conjugate for a probe for imaging membrane receptor rotation and lateral kinetics at the molecular level.

Another object of the present invention is to provide a method for preparing a nanoparticle dimer linked by the novel Y-type oligonucleotide conjugate.

Another object of the present invention is to provide a probe for single molecule observation comprising a nanoparticle dimer linked by the novel Y-type oligonucleotide conjugate.

To achieve the above object,

The present invention provides a Y-type oligonucleotide conjugate formed by complementary bonding of three oligonucleotides; And

It provides a nanoparticle dimer comprising; metal nanoparticles capable of two phlosmonic couplings connected by the Y-type oligonucleotide conjugate.

In addition, the present invention comprises the steps of preparing a first-third oligonucleotide comprising a complementary nucleotide sequence capable of forming a Y-type oligonucleotide conjugate;

Attaching the prepared first and second oligonucleotides to be monovalent with metal nanoparticles capable of phlosmonic coupling, respectively;

By mixing the metal nanoparticles capable of monovalent phlosmonic coupling to which the first oligonucleotide prepared in the above step is attached and the metal nanoparticles capable of monovalent phlosmonic coupling to which the second oligonucleotide is attached, the nanoparticles It provides a method for preparing a dimer comprising; preparing a dimer.

Further, the present invention provides a Y-type oligonucleotide conjugate formed by complementary bonding of three oligonucleotides; And

It provides a probe for single-molecule observation comprising; metal nanoparticles capable of two phlosmonic couplings connected by the Y-type oligonucleotide conjugate.

In addition, the present invention comprises the steps of preparing a first-third oligonucleotide comprising a complementary nucleotide sequence capable of forming a Y-type oligonucleotide conjugate;

Attaching the prepared first and second oligonucleotides to be monovalent with metal nanoparticles capable of phlosmonic coupling, respectively;

By mixing the metal nanoparticles capable of monovalent phlosmonic coupling to which the first oligonucleotide prepared in the above step is attached and the metal nanoparticles capable of monovalent phlosmonic coupling to which the second oligonucleotide is attached, the nanoparticles Preparing a dimer;

Functionalizing the third oligonucleotide to recognize the target single molecule;

Exposing the third oligonucleotide functionalized in said step to a sample comprising at least one target single molecule;

Hybridizing with a third oligonucleotide by treating the sample with the nanoparticle dimer; And

It provides a method for observing or detecting a single target molecule comprising; detecting a nanoparticle dimer in the sample.

The present inventors applied a nanoparticle dimer linked with a novel Y-type oligonucleotide conjugate to visualize the diffusive dynamics of lipid molecules in a lipid bilayer (SLB), a two-dimensional model membrane, and measured using various imaging probes. By comparing the diffusion coefficient, it was confirmed that the Y-type nanoparticle dimer (mGYRO) of the present invention can be used as a single molecule imaging probe without diffusion fluctuations, and the present invention is useful to provide a novel probe useful for single molecule observation or detection. It works.

Figure 1.(a) Synthesis of two single functionalized gold nanoparticles (mAu NPs) conjugated mGYRO, (b) TEM image of mGYRO showing functionalized control trajectory, (c) dark field (DF) of two mGYROs Images (discrete angles (top), left) and corresponding SEM images (top right), linearly polarized light is irradiated with a certain angle (arrow). The scattering intensities of the two particles are plotted as the angle changes and applied to a sine function. Depending on the difference between the two periods, the particles are at different angles of 1.32 in radians, which agrees well with the SEM. (d) Angular error distribution (θ _OM -θ _SEM , rad) of 0.14 deviation (n = 21). (e) The angular sensitivity was calculated as (I _max -I _min )/I _max , yielding a value of 0.14 ± 0.03 (mean ± SD) for Au sphere, 0.61 ± 0.08 for mGYRO, and 0.60 ± 0.09 for Au rod. do. (fi) Monitoring of lipid molecules in 0.2 mg/mL BSA cushioned SLB. (f) Lipid molecular orbital (diffusion coefficient, 0.52 μm ² /s) and (g) corresponding intensity and DF images. (h) The cumulative squared displacement (CSD) and the cumulative squared angular displacement (CSAD) are shown. (i) The average diffusion coefficient and angular velocity of lipid molecules are 0.35 ± 0.19 μm2/s, 52 rad/s, (n = 47), respectively.
Figure 2. (a) Design of EGFR colocalization, (b) relative scattering intensity of Au dimer according to the distance between particles. Three main types of observable colocalization of EGFR, (c) cavity, (d) transient contact, and (e) passing without physical contact (541 simultaneous out of 12 cells collected from 3 independent experiments) 3, 31, 66% respectively from the onset event), change in scattering intensity of each Au NP and HMM analysis (fh), cumulative square displacement (CSD)-HMM analysis from lateral diffusion data (ik), before and after colocalization With a constant CSD slope of (f, i), the two EGFRs are shown to pass without a simple collision (g, j), or physical contact (h, k).
Figure 3. Oligomerization and structural state of EGFR in living cells and their metastatic kinetics, (a) schematic representation of the targeting strategy of mGYRO, (b) dark field (DF) images showing specific labeling of mGYRO, (c) linear The scattering intensity of mGYRO fluctuates in the polarized DF image, (d) CSD (orange) and two separate states (red) analyzed through HMM analysis indicate that EGFR reversibly forms monomers and dimers ( Top). The three separate states analyzed via CSAD (blue green) and HMM (blue) indicate that EGFR changes their morphology with respect to the intracellular domain (ICD) (bottom). The corresponding trajectory is displayed with changes in intensity and contrast (artwork). (e) The transition of the oligomer state and the structural state is represented by state symbols and the proposed model. The residence times (τ) for each state are listed in the table. M1 = 100, M2 = 70, M3 = 0 (forbidden), D1 = 190, D2 = 20 and D3 = 11) A total of 400 distinct states were observed from 20 different cells.
Fig. 4. Overall synthesis strategy of mGYRO considering optical properties and surface valence.
To get the best performance for your imaging probe, you should check the optical properties of gold nanoparticles (Au NPs). (a) Schematic diagram of the synthesis strategy of mGYRO, first, the synthesis and characterization of Au NPs of various sizes by transmission electron microscopy (TEM) measurement (b) and dark field microscopy (inset). The size of the measured particles was 15 ± 1, 20 ± 2, 25 ± 3, 30 ± 3 nm (n = 118, 127, 53, 107). Next, for Au NPs functionalized with monovalent DNA, titration is performed as the concentration of thiolated DNA increases. (c) DNA concentrations of 0, 0.3, 0.5 and 1 equivalent were reacted with Au NPs and the number of multivalent particles increased as a function of DNA concentration. Agarose gel electrophoresis showed that polyvalent Au NPs migrate more slowly due to mass proliferation. (d) For each lane 1-4 the percentage of monovalent product is 0, 7, 16 and 24%. (eg) In the case of a rotating imaging probe, Au dimers were fabricated using two 25 nm Au NPs single functionalized with DNA complementary to each other. (e) Thus, the monovalent particles are separated by agarose gel electrophoresis, conjugated with the complementary monovalent particles, and then the dimers are separated so that the monomer particles move farther than the dimer particles (indicated in purple) (indicated in red). do. (f) UV-Vis spectrum was obtained for bulk measurement. The absorbance peak (top) is located at 523 nm for the monomer and shifts to 535 nm for the dimer, which agrees well with the theoretical finite difference time domain (FDTD) calculation data (bottom). (g) Then, the TEM image and the dark field microscope image of the dimer were confirmed. (h) U2OS cells expressing the SNAP-EGFR-GFP protein exhibit green (top), bright (bottom) and dark field channels (inserted areas) compared to the scattering intensity of endosomes in the intracellular area. (i) Comparison of the scattering intensity of Au NPs and endosomes. The intensity of mGYRO is significantly different (***; p <0.001, nonparametric t-test). However, monomeric Au NPs with a size of 15 ~ 30 nm did not have a statistically significant difference from the endosomes of living cells.
Figure 5. Optical stability of mGYRO. (a) Graphic of biotin-streptavidin interactions (see Protein Data Bank, 1MK5) (b) Biotin has multiple cooperative hydrogen bonds and hydrophobic interactions in streptavidin pockets (c) SNAP tag-benzylguanine interactions Graphics of (see PDB, 3KZZ and 3L00) (d) Benzyl groups have multiple hydrophobic interactions with Glu159A, Pro140A and Tyr154A and π-π interactions with Tyr158A within the pocket of SNAP. Gold nanoparticles are optically more stable (no photo bleaching and flickering) compared to conventional imaging probes such as organic dyes, and exhibit a high signal-to-noise ratio. Moreover, mGYRO uses double-stranded DNA as a linker, which is hard enough to not cause vibrational perturbation. (e) To confirm the stability, we conjugated biotin to the probe and ligated it to streptavidin bound to the label slip. The scattering intensity has little fluctuation and has been stably long lasting. (f) In contrast, Texas Red shows single molecule intensity fluctuations and photographic bleaching. Under high intensity irradiation, the molecules are bleached within 1 second.
Fig. 6. Enhancement of plasmonic coupling of gold dimers according to the size and distance between particles simulated by FDTD calculation. (a) Scattering intensity as a function of the distance between particles when the particle diameter is 25 nm. (b) As the distance increases by 2 nm, the maximum peak position becomes blue shifted as the intensity decreases due to the loss of the plasmon binding effect. When the particle distance is 1 nm, the transverse mode (546 nm) and longitudinal mode (601 nm) of plasmon resonance for asymmetric particles are observed. In other cases, the two modes are distinguished too closely. Relative intensities are plotted in (c) and fitted to a single exponential decay function. (d) Since asymmetric particles have two modes of plasmon resonance, the plasmon peak position depends on the angle of linear polarization. (e) The scattering intensity of a 25 nm gold dimer with 4 nm spacing between the particles is plotted as a function of the angle of incident polarization. When the particle is in the plane of light (0°), the intensity is the maximum value, but when the particle is in the outer surface of the light (90°), the intensity is at the minimum. (f) Comparing the intensities, the maximum intensity is more than three times higher than the minimum, and the plot is suitable for the cosine function.
Figure 7. Site-specific functionalization of imaging probes. The biggest advantage of mGYRO is its precise targeting of specific locations. (a) Y-type DNA hybridization is a schematic diagram showing that the linker can function at the center of the dimer. In this case, the linker is a complementary DNA attached to a 10 nm metal for the TEM measurement shown in (b). On the other hand, similar linear plasmon structures such as Au nanorods cannot control the connection point as shown in (c). Spherical nanoparticles non-specifically bind to the tip and side of the rod.
8. mGYRO was applied to monitor the diffusion kinetics of lipid molecules in the supported lipid bilayer (SLB). (a) Dark field snapshot of lipid molecules on SLB denoted mGYRO. The 2.5-s total trajectory of the particle in the dotted orange line is plotted in (b). Various probes were tested to ensure that mGYRO did not disturb Brownian rotation or lateral movement. (c) The cumulative distribution of the diffusion constants of lipid molecules (palmitic acid, C ₁₅ H ₃₁ -COOH) in SLB is shown. Various probes are gold monomer particles that are polyvalent (多價, green), monovalent (一價, blue) DNA, gold dimer particles (mGYRO, red), and Texas red (purple) on the surface. FRAP analysis (orange) was performed for ensemble measurement. Fixed Au particles non-specifically attached to the glass slide were also measured (gray). The cumulative distribution fits a Gaussian function. (Mean ± SD, gray, n = 10, 0.006 ± 0.005 μm ^2/ s, green, n = 16, 0.075 ± 0.23 μm ^2/ s; orange, n = 10, 0.65 ± 0.02 μm ^2/ s; blue, n = 80, 0.63 ± 0.31 μm ^2/ s; red, n = 64, 0.66 ± 0.34 μm ^2/ s; purple, n = 102, 0.65 ± 0.32 μm ^2/ s). However, the lipid molecules rotate too quickly to observe intensity fluctuations. Therefore, bovine serum albumin (BSA) protein is applied to slow down exercise. (d) As the BSA concentration increases, the lateral diffusion coefficient of the lipid molecule decreases. (Mean ± standard deviation, blue, n = 80, 0.63 ± 0.31 μm ^2/ s, yellow, n = 32, 0.35 ± 0.19 μm ^2/ s, purple, n = 33, 0.03 ± 0.04 μm ^2/ s). (e) Dark field micrograph of the first snapshot superimposed with the trajectory of particle movement. Examples of (f) particle trajectories and (g) intensity changes. Fast-moving particles (f, left) show non-continuous intensity changes (g, light gray line), while slow-moving particles (f, right) show continuous intensity changes (g, black line). The inserted picture is a dark field image of the particles during the period indicated by the red dotted line.
Figure 9. Specific labeling of EGFR with SNAP tag fusion in living cells. (a) A schematic of the SNAP tag protein in the extracellular domain of EGFR against the GFP protein and ligated to the intracellular domain for visualization is shown. The SNAP tag EGFR-GFP is well expressed in U2OS cells to produce a stable cell line. For specific labeling, Texas red (b) and gold dimer (c) were functionalized with probe DNA (DNA _TR and DNA _t3 , respectively) complementary to DNA linked to benzyl-guanine (BG-cDNA). U2OS cells expressing SNAP tagged EGFR were labeled with BG-cDNA followed by probe-DNA. Images were taken with a fluorescence microscope in the green channel of GFP, with the red channel in Texas Red, and the dark field image with a color camera. In the first line, normal U2OS cells were used. Therefore, there is no green fluorescence and there is no label on the probe. Also, in the absence of a linker such as BG-cDNA, no specific label was observed (second line); This is also the case when blocked with cDNA (DNAblack) as a positive control (line 4). Details of the DNA sequence are described in Table 1.
Figure 10. Statistical analysis of EGFR colocalization. (a-c) observable colocalization of EGFR Three main types of dark field microscopy images; (a) homogeneous cavity, (b) transient contact, (c) through. (de) The presence of plasmonic coupling was analyzed by relative scattering intensity (blue) and their HMM analysis (green), respectively. (gi) A total of 541 co-expression events occurring in 12 different single cells were analyzed. (g, h) There was a significant difference in the incidence of concordant events in each country. The average events observed for 10 seconds in the same field of view were 1.3 ± 0.7, 14.2 ± 4.6 and 29.6 ± 7.7 (mean ± standard deviation) for homogeneous cavity, transient contact and passage, respectively. (I, j) The period of colocalization shows an important difference. The mean durations were 220 ± 74, 72 ± 30 and 41 ± 18 ms, respectively. (Mean ± SD, ***, p <0.001, nonparametric t-test). With slightly higher enhancement indicating “pass” without plasmon coupling (m, n), highly ordered cavitation phenomena were rarely observed (k, i) (2 of 541).
Figure 11. An accident experiment evaluating HMM analysis using simulated Brownian outer and rotational trajectories. To detect discrete states of discrete and rotation from probabilistic changes, we applied a Bayesian model incorporating the hidden Markov algorithm (HMM-Bayes) and HaMMy on the trajectory of mGYRO-EGFR. (a) Schematic of accident experiment and (b) simulated trajectory by random number generation. We initially assumed model thinking experiments, where receptors were independent in two lateral diffusion and two rotational states, respectively because of their monomer-to-dimer state (M vs. D) and undeveloped and folded state (2 vs. 1). Represents dynamic change. Then, HMM is applied to separate the states, compare the results and calculate the cumulative squared (angular) displacements (CSD and CSAD) at the intended simulation transitions (c, d). Not all data appear to be completely separate in the results. Some fast state transitions cannot be analyzed with HMM. Thus, we verified the importance of the main period frame for HMM analysis. (eg) The intended state (red line) and the HMM analysis state (blue line) are indicated by the number of state duration frame changes. In each calculation, 500 frames were stacked and set so that the slow-to-fast state transition occurred 7 times. The number of state period frames is (e) 3, (f) 5 and (g) 9, respectively. (h) Separation probability graph as a function of state duration frames. Each point contains 7 calculations. As a result, state durations shorter than 5 frames were identified by HMM with low probability.
Figure 12. Oligomerization of EGFR after treatment with EGF ligand. Fluorescence images of SNAP-EGFR-GFP expressing cells (a) 0 and (b) 30 min after applying 20 μL of 100 ng/μL EGF. (c) The white dashed boxes in a and b are reconstructed from a three-dimensional image showing the intensity of the z-axis. It was clearly observed that the strength enhancement point indicates EGFR cluster formation. (df) FRAP measurements were performed to investigate the diffusion kinetics of EGFR after activation. After GFP bleaching for 30 seconds by irradiating a specific area with high intensity light, a picture was taken for 3 minutes without any interval at a wide opening with an exposure time of 100 ms. For 0 and 30 minutes after EGF treatment, the diffusion coefficients were calculated as 0.16 ± 0.05 μm ² /s and 0.09 ± 0.05 μm ² /s (mean ± SD), respectively. (**; p <0.01, nonparametric t-test). (gi) In addition, single molecule analysis was performed using Au NP and Texas Red (organic dye). Large aggregates were observed after EGF treatment, indicating that EGFR was concentrated.
Figure 13. Diffusion kinetics of SNAP-EGFR protein on the surface of living cells. Single particle tracking analysis was performed to obtain the diffusion coefficient for the SNAP-EGFR protein in U2OS living cells labeled by various probes. (a) Snapshot of dark field image overlapping the trajectory of particle motion. EGFR proteins are imaged as mGYRO (pink), monovalent Au NPs (orange) and polyvalent Au NPs (green). For multivalent Au NPs, biotin conjugated-EGFR antibodies and neutravidin conjugated-Au NPs were used. Due to the various reaction sites of neutravidin, aggregation of Au NPs was induced, resulting in a lower diffusion coefficient. Nonspecifically immobilized Au NPs on glass slides were also measured (gray). Endosomes can also be tracked and distinguished compared to the EGFR protein. (b) FRAP analysis (green) was performed for ensemble measurement. (c) The cumulative distribution function of the lateral diffusion coefficient that fits the Gaussian function is drawn. (n = 189, 0.18 ± 0.09 μm ² /s, pink, n = 150, 0.16 ± 0.14 μm ² /s, yellow, n = 64, 0.28 ± 0.12 μm ² /s, green, n = 57, 0.06 ± 0.04 μm ² /s, gray, n = 10, 0.008 ± 0.005 μm ² /s, FRAP, n = 25, 0.16 ± 0.05 μm ² /s).
14. Intensity fluctuations before and after insertion of a polarizer. (a) The intensity fluctuations originate from the polarized linear structure. The monomer and dimer show stable brightness before insertion of the polarizer, but only the dimer shows fluctuation after insertion of the polarizer. The results indicate that the change in intensity is due to angular displacement along the Z axis rather than artifacts, vibrations, or dislocations. (b) Picture of the setup for in-situ installation of a linear polarizer. The polarizer mounted on the electric rotation controller was installed on the 1-D rail stage.
Figure 15. Transitions between states including dimers and various rotational states by HMM analysis. (a) Analysis of six transitions by HMM. In a series of analyzes, the top panel shows a binary plot of the CSD distribution (orange) and the relative diffusion coefficients obtained by CSD-HMM analysis (red). The lower panel describes the rotational diffusion motion. CSAD distribution (cyan) and ternary plot of relative rotational diffusion coefficients obtained by CSAD-HaMMy analysis (blue). The transition between the monomer and the dimer or the three steric states appears as a change in contrast. (b) From dozens of trajectories, the rotational speed obtained from CSAD was plotted according to the state. In particular, the rotation rate (****; p <0.0001, nonparametric t-test) was significantly different in each structural state (M1 and M2 are different and D1, D2, D3 are different), but the same structural state D1 Or M2 and D2) did not show a statistically significant difference. The turnover rate of the monomers is 11 ± 11 rad ² / s (mean ± standard deviation), 51 ± 18 rad ² / s, respectively, the turnover rate of the dimer is 11 ± 10 rad ² / s, and 55 ± 14 rad ² /s , 86±28 rad ² /s for D1, D2 and D3, respectively. (c) The relative residence time (t) of each state is shown in the graph. The slowest structural states for both monomers and dimers (M1 and D1) are superior in time. The y-axis spacing is indicated by a tilde. The total residence time of each state is combined and displayed in the inset graph. The total time of the dimer state (D1, D2 and D3) is twice the total time of the monomeric state (M1 and M2). The results can be interpreted as indicating that the dimer oligomer state is energetically stable.

Hereinafter, a preferred embodiment is presented to aid the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the contents of the present invention are not limited by the examples.

In one aspect of the present invention, two oligonucleotides capable of complementary binding; And

There is provided a nanoparticle dimer comprising two metals capable of phlosmonic coupling, which are linked by two oligonucleotides capable of complementary binding.

More specifically, the nanoparticle dimer of the present invention is composed of two nanoparticles, an oligonucleotide is bonded to the surface of each nanoparticle, and has a structure that is linked through a hybrid bond between the two oligonucleotides. have.

In addition, since the hybrid bonding is performed, improved imaging may be provided by the plasmonic coupling effect of the two nanoparticles.

Here, a dimer may be formed through at least part of the complementary sequence between the oligonucleotides, for example, through at least part of the hybridization.

In the present invention, the metal capable of the psmonic coupling refers to a metal capable of all types of plasmonic coupling capable of plasmonic coupling, for example, gold or silver.

Therefore, as a preferred embodiment, the present invention is a nanoparticle dimer in which two gold or silver nanoparticles are connected, and the two nanoparticles perform plasmonic coupling.

The nanoparticle dimer of the present invention as described above may exist as a homodimer or a heterodimer. A homodimer is a unit in which two nanoparticles of the same size and structure are connected to form a dimer, and a heterodimer is a unit in which two nanoparticles having different sizes or structures are connected to form a dimer.

Preferably, the dimer of the present invention is a homodimer, and the size of the nanoparticles is not limited as long as it can have a plasmonic coupling, but, for example, 1-1000 nm, 1-500 nm, 1-100 nm, 1-50 nm, 1-40 nm, 1-30 nm, 2-50 nm, 5-50 nm, 10-40 nm, 20-40 nm, 20-30 nm, or having a size of about 25 nm , For example, the nanoparticles may be substantially spherical in shape, but nanoparticles of any shape or irregular shape may be used.

Meanwhile, the distance between the two particles is not limited as long as it can have plasmonic coupling, but, for example, 1 nm or more, 1-10 nm, 1-8 nm, 1-7 nm, 2-8 nm, 3 -6 nm, or about 4 nm.

One or more oligonucleotides may be functionalized by binding to the surface of the nanoparticles of the present invention, but preferably one oligonucleotide may be functionalized by binding. In particular, for controlled imaging, it is most preferable that one oligonucleotide is functionalized by binding to the surface of one nanoparticle.

One oligonucleotide having a 3'or 5'end modified with a thiol may be attached to the nanoparticle surface.

Here, each oligonucleotide of the two nanoparticles has a base sequence complementary to each other, and the two nanoparticles form a nanoparticle dimer structure through hybridization of each of the oligonucleotides.

However, although the nanodimer provided by the present invention is a dimer formed by oligonucleotides of each of the nanoparticles, at least each oligonucleotide must be a base capable of hybridizing with another third oligonucleotide. It is characterized by having a sequence.

That is, the nanoparticle dimer provided in the present invention is characterized by forming a Y-shaped complementary bond with another oligonucleotide except for the oligonucleotide attached to each surface between the two nanoparticles.

In particular, through this Y-shape, more rigid coupling is possible, and better quality imaging without perturbation (or fluctuation) is possible due to incomplete coupling.

Therefore, the nanoparticle dimer provided by the present invention has first and second oligonucleotides on the surfaces of each of the two nanoparticles, but the first and second oligonucleotides are capable of complementary binding, but must be a third oligonucleotide. Complementary bonding with and should be possible, and preferably, it should be selected as capable of Y-shaped rigid bonding.

Thus, without limitation, each of the first, second, and third oligonucleotides has at least some complementary base sequence, e.g., the first oligonucleotide is at least partially complementary to the second nucleotide. While having a sequence, it has a base sequence complementary to the third nucleotide as the rest. At the same time, the second nucleotide has a base sequence that is complementary to the first nucleotide and a base sequence that is complementary to the rest of the third oligonucleotide.

Of course, the complementary bond or the complementary nucleotide sequence may be continuous, or may be a nucleotide sequence having at least one spacer, and may form a bond between three oligonucleotides in a more rigid form to be provided by the present invention. If so, it is included in the present invention without limitation.

In the present invention, the term "a compound having a surface-binding functional group" refers to a compound in which the oligonucleotide is linked to the 3'or 5'end of each oligonucleotide in order to attach it to the surface of the core particle. The type of compound with such a surface binding functional group is not limited as long as it produces small aggregated nanoparticles that will not precipitate in solution. Methods for crosslinking-linking nanoparticles through a surface-binding functional group are known in the art (see Feldheim, The Electrochemical Society Interface, Fall, 2001, pp. 22-25). One end of the compound having a surface-binding functional group has a surface-binding functional group attached to the surface of the particle, preferably a sulfur-containing group, such as a thiol group or a sulfhydryl (HS) group. The reactor may be a compound having the formula of RSH containing sulfur as a derivative of alcohol and phenol. Alternatively, the reactor may be a thiol ester or a dithiol ester having a formula of RSSR' or RSR', respectively. Alternatively, the reactor may be an amino group (-NH2). Additionally, the compound having the surface-binding functional group is a reactive group for biomolecules such as DNA probes, antibodies, oligonucleotides and amino acids, such as -NH2, -COOH, -CHO, -NCO, and epoxy It can be connected to various reactors such as side groups. Many of these reactive groups are known in the art and can be used in the present methods and devices.

In addition, the opposite end of the compound having a surface-binding functional group in the oligonucleotide may include a spacer sequence, and the spacer sequence is appropriate without covering the target recognition sequence of the targeting oligonucleotide by the shell introduced to the core surface. It provides a space to maintain the shell thickness. In the present invention, as an example of the spacer sequence, A10-PEG may be used.

In another aspect of the present invention, a Y-type oligonucleotide conjugate formed by complementary bonding of three oligonucleotides; And

There is provided a nanoparticle dimer comprising; metal nanoparticles capable of two phlosmonic couplings connected by the Y-type oligonucleotide conjugate.

Here, the Y-type oligonucleotide conjugate may have a binding site capable of binding to a target target, or may be connected with an additional binding molecule to bind to a target target.

For example, the third oligonucleotide of the Y-type oligonucleotide conjugate is functionalized to selectively bind to the target before hybridization with the first and second oligonucleotides, or after hybridization to the Y-type, optionally the target It can be functionalized to be able to bind to.

Here, functionalization is optional, and if it is a target capable of recognizing a third oligonucleotide or forming an arbitrary bond, separate functionalization may not be required, or to recognize a target, or to allow any binding. It refers to functionalization, and the introduction of a substituent capable of recognizing or arbitrary binding to a Y-type oligonucleotide conjugate, introduction of a functional group, introduction of a molecule, modification, and the like can be performed.

On the other hand, the number of bases of the three oligonucleotides is not particularly limited, but may be, for example, the minimum number at which a Y-type oligonucleotide conjugate can be formed, and preferably a robust Y-type oligonucleotide conjugate is formed. The number can be selected so that perturbation is minimized or absent.

Although not limited thereto, the three oligonucleotides may each have 20-80, 25-70, or 26-50 bases.

In one embodiment of the present invention, the nanoparticle dimer,

First metal nanoparticles; Second metal nanoparticles; A first ss-oligo nucleotide bound to the first metal nanoparticle; A second ss-oligo nucleotide bound to the second metal nanoparticle; A third ss-oligo nucleotide;

The first ss-oligonucleotide forms a first binding region complementarily bonded to the third ss-oligonucleotide;

The second ss-oligo nucleotide forms a second binding region complementary to the first ss-oligo nucleotide;

The third ss-oligo nucleotide forms a third binding region complementary to the second ss-oligo nucleotide,

The first metal nanoparticle and the second metal nanoparticle may be connected by a Y-type oligonucleotide conjugate.

In one embodiment of the present invention, the three oligonucleotides consist of a first ss-DNA, a second ss-DNA, and a third ss-DNA,

Here, the first and second ss-DNAs are modified so that the 5'position can be combined with the metal nanoparticles capable of phlosmonic coupling, respectively, and the 5'position of the third ss-DNA is combined with the target target. It may be modified so as to be capable of, or may have a nucleotide sequence, or may be linked with an additional binding molecule.

In one embodiment of the present invention, the three oligonucleotides consist of a first ss-DNA, a second ss-DNA, and a third ss-DNA,

Here, the first ss-DNA includes the nucleotide sequence of SEQ ID NO: 1, the second ss-DNA includes the nucleotide sequence of SEQ ID NO: 2, and the third ss-DNA includes the nucleotide sequence of SEQ ID NO: 3 That, it may be a nanoparticle dimer.

SEQ ID NO: 1: 5'-CTTACGGCGAATGACCGAATCAGCCT-3'

SEQ ID NO: 2: 5'-AGGCTGATTCGGTTCATGCGGATCGA-3'

SEQ ID NO: 3: 5'-TCGATCCGCATGACATTCGCCGTAAG-3'

In another aspect of the invention,

Y-type oligonucleotide conjugate formed by the complementary linkage of three oligonucleotides; And

There is provided a probe for single molecule observation comprising; metal nanoparticles capable of two phlosmonic couplings connected by the Y-type oligonucleotide conjugate.

Here, the probe for single molecule observation may be understood as, for example, a nanoplasmonic biosensor, and the probe for single molecule observation is to be understood as observing or detecting a single molecule from detecting a nanoparticle dimer. I can.

In the present invention, as a sensor utilizing a plasmonic coupling phenomenon between two nanoparticles, it was confirmed that sensitive and accurate kinetic observation and detection for single molecules such as SLS and EGFR are possible.

In particular, since the nanoparticle dimer of the present invention is connected by a rigid linking group (Y-type DNA), a single molecule can be observed or detected without perturbation.

Here, the observation may be used without limitation, as long as it is a device capable of observing or detecting the nanoparticle dimer of the present invention, for example, a dark field microscope, a Raman-Reilly scattering microscopic system, etc. may be used, and SEM, TEM It can be used without restrictions. In addition, a device for measuring the light scattering spectrum, for example, a spectrograph or a CCD camera may be mounted to measure the light scattering spectrum.

Here, the probe for single molecule observation is, for example, amino acids, peptides, polypeptides, proteins, glycoproteins, lipoproteins, nucleosides, nucleotides, oligonucleotides, nucleic acids, sugars, carbohydrates, oligosaccharides, polysaccharides , Fatty acids, lipids, hormones, metabolites, cytokines, chemokines, receptors, neurotransmitters, antigens, allergens, antibodies, substrates, metabolites, cofactors, inhibitors, drugs, pharmaceuticals, nutrients, prions, toxins, poisons, Explosives, pesticides, chemical weapons, biohazard agents, radioisotopes, vitamins, heterocyclic aromatic compounds, carcinogens, mutagenesis, anesthetics, amphetamines, barbiturates, hallucinogens, wastes or contaminants can be observed or detected. It may be a probe for single molecule observation, characterized in that there is.

In another aspect of the invention,

Preparing a first-third oligonucleotide comprising a complementary nucleotide sequence capable of forming Y-type DNA;

Attaching the prepared first and second oligonucleotides to be monovalent with metal nanoparticles capable of phlosmonic coupling, respectively;

By mixing the metal nanoparticles capable of monovalent phlosmonic coupling to which the first oligonucleotide prepared in the above step is attached and the metal nanoparticles capable of monovalent phlosmonic coupling to which the second oligonucleotide is attached, the nanoparticles A method of preparing a dimer comprising; preparing a dimer is provided.

Here, the manufacturing method may further include a step of selectively hybridizing the prepared nanoparticle dimer with a third oligonucleotide.

Hereinafter, the method for preparing the nanoparticle dimer of the present invention will be described in detail step by step.

First, the step of preparing the first-third oligonucleotide comprising a complementary nucleotide sequence capable of forming a Y-type oligonucleotide conjugate is, as described above, the rigid and perturbation to be provided by the present invention ( It refers to the step of preparing three oligonucleotides containing a complementary nucleotide sequence so as to form a Y-type oligonucleotide conjugate to achieve imaging observation without agitation).

Next, the step of attaching the prepared first and second oligonucleotides to be monovalent with metal nanoparticles capable of phlosmonic coupling, respectively, includes controlled plasmonic coupling and imaging observation of the present invention. For this purpose, it may be understood as a step of reacting each of the complementary first and second oligonucleotides to be monovalent bonded to two metal nanoparticles capable of phlosmonic coupling.

Further, by mixing the metal nanoparticles capable of monovalent phlosmonic coupling to which the first oligonucleotide prepared in the above step is attached and the metal nanoparticles capable of monovalent phlosmonic coupling to which the second oligonucleotide is attached, This is the step of preparing a nanoparticle dimer.

The nanoparticle dimer prepared here means that the two nanoparticles are linked thereby to form a dimer through hybridization of the first and second oligonucleotides.

Here, the first and second oligonucleotides are capable of complementary binding, but it is preferable to have a minimum nucleotide sequence such that they are complementary to the third oligonucleotide at the same time.

In particular, in order to achieve the perturbation-free imaging probe to be provided by the present invention, a Y-type rigid complementary bond must be formed, and the nanoparticle dimer is evenly complementary to the third oligonucleotide. Even before, at least a portion of the first and second oligonucleotides must have a site capable of complementary binding to the third oligonucleotide.

In one aspect of the invention, exposing the nanoparticle dimer to a sample containing one or more target single molecules; And

A method of observing or detecting a target single molecule comprising; detecting a nanoparticle dimer in the sample is provided.

Here, the nanoparticle dimer may be prior to complementary binding with the third oligonucleotide, and may be selectively hybridized with the third oligonucleotide first and then recognized or bound to the target, or the third oligonucleotide may be first targeted. After recognition or binding to, the nanoparticles may be hybridized with the third oligonucleotide attached to the target.

In another aspect of the invention,

Preparing a first-third oligonucleotide comprising a complementary nucleotide sequence capable of forming Y-type DNA;

Attaching the prepared first and second oligonucleotides to be monovalent with metal nanoparticles capable of phlosmonic coupling, respectively;

By mixing the metal nanoparticles capable of monovalent phlosmonic coupling to which the first oligonucleotide prepared in the above step is attached and the metal nanoparticles capable of monovalent phlosmonic coupling to which the second oligonucleotide is attached, the nanoparticles Preparing a dimer;

Functionalizing the third oligonucleotide to recognize the target single molecule;

Exposing the third oligonucleotide functionalized in said step to a sample comprising at least one target single molecule;

Hybridizing with a third oligonucleotide by treating the sample with the nanoparticle dimer; And

A method of observing or detecting a single target molecule comprising; detecting a nanoparticle dimer in the sample may be provided.

Hereinafter, the present invention will be described in detail through Preparation Examples, Examples, and Experimental Examples. However, the following Preparation Examples, Examples, and Experimental Examples are only illustrative of the present invention, and the present invention is not limited by the following.

<Production Example 1> Synthesis of gold nanoparticles (Au NP)

The gold nanoparticles are Chem. Mater. The method disclosed in 2016, 28, 1066-1075 was synthesized with slight modifications. In the case of a 10 nm sphere, 1 mL of 25 mM HAuCl ₄ (aq) was injected into 150 mL of an aqueous solution of sodium citrate (2.2 mM) containing 100 μL of 25 μM tannic acid at 100°C. For the 25 nm sphere, the same synthetic procedure was repeated without tannic acid for seed formation. After the mixture was cooled to 90° C., an additional 1 mL of HAuCl ₄ was added and incubated for 30 minutes. This further injection was repeated once more, then the solution was cooled to room temperature.

For both spheres, the citrate ligand was exchanged with BSPP to improve colloidal stability by adding 20 mg of BSPP and reacted overnight. The nanoparticles were purified and concentrated to 100 nM by centrifugation and then redispersed in 1 mg/mL BSPP aqueous solution.

(Extinction coefficient: 1.01 x 10 ⁸ M ^-1 cm ^-1 at 520 nm and 2.15 x 10 ⁹ M ^-1 cm ^-1 at 524 nm, respectively, for 10 nm and 25 nm).

<Preparation Example 2> Synthesis of gold nanorods (Au NR) (65 x 22 nm)

Gold nanorods were synthesized by slightly modifying the anti-dust disclosed in ACS Nano 2012, 6, 2804-2817. For seed formation, 5 mL of 0.5 mM HAuCl ₄ was added to 5 mL of CTAB aqueous solution (0.2 M), and then 1 mL of NaBH ₄ (6.0 mM) was added to this mixture under vigorous stirring, and grown for 30 minutes. . For the growth of metal nanorods, 6 mL of 4.0 mM AgNO ₃ and 125 mL of 1.0 mM HAuCl ₄ were successively added to 125 mL of an aqueous solution of CTAB (4.5 g) and 5-bromosalicylic acid (0.55 g) under vigorous stirring. Next, 1 mL of ascorbic acid (64.0 mM) was added to reduce Au ³⁺ to Au ¹⁺ . Finally, 50 μL of the seed solution was injected and incubated for an additional 12 hours. Au NR was purified and concentrated to 10 nM by centrifugation (absorption coefficient: 3.58 x 10 ⁹ M ^-1 cm ^-1 at 707 nm).

For the functionalization of BSPP, 1 mL of 10 nM Au NR was centrifuged and redispersed in a 1:1 mixture of 10 mg/mL BSPP aqueous solution and phenol: chloroform: isoamyl alcohol (25:24:1). This solution was stirred for 12 hours. The aqueous layer was extracted and purified by centrifugation.

<Example> Preparation of mGYRO

First, the oligonucleotides used in the present invention are shown in Table 1 below.

Experiment used Oligonucleotide sequence Using Au dimer (mGYRO)
Single molecule rotation DNA _t1 5’- HS-CTTACGGCGAATGACCGAATCAGCCT -3’ DNA _t2 5’- HS-AGGCTGATTCGGTTCATGCGGATCGA -3’ DNA _t3 5'- (ACTG) ₅ TCGATCCGCATGACATTCGCCGTAAG -3' For a specific target in the center of the dimer
TEM measurement DNA _t3-thiol 5’- HS-TCGATCCGCATGACATTCGCCGTAAG -3’ Using unit price Au particles
Protein diffusion DNA _m 5’- HS-CTTACGGCGAATGTCATGCGGATCGA -3’ Pinned to a glass slide
Optical stability check DNA _biotin 5’- Biotin -TCGATCCGCATGACATTCGCCGTAAG -3’ Specific labeling test using organic dyes as comparative experiments, and diffusion DNA _TR 5'- (ACTG) ₅ -Texas red -3' Benzylguanine functionalized DNA preparation DNA _linker 5'- (CAGT) ₅ -NH ₂ -3' As a negative control experiment
Specific label test DNA _block 5’- (ACTG)5 -3’

Step 1: Monovalent conjugation of Au NP and ss-DNA

The concentration of BSP capped Au NP was determined by measuring the absorbance with a UV-Vis spectrometer. Because of the multiple reaction sites on the particle surface, the number of valency follows a Poisson distribution, resulting in a mixture of DNA unbound and multi-bound NPs.

To obtain a monovalent conjugation, the molar ratio between ss-DNA and Au NPs was adjusted. 45 nL of 100 nM Au NP and 45 nL of 30 nM disulfide-protected DNA were mixed in a 1.5 mL epi-tube.

10 µl of BSPP aqueous solution 10 mg/100 µl was added to reduce disulfide binding, and the mixture was incubated overnight. In the case of Au nanorods, 45 μL of 10 nM Au nanorods and 45 μL of 100 nM disulfide-protected DNA were mixed in a 1.5 mL epi-tube, and the following process is the same as the sphere.

The degree of DNA conjugation to Au NPs was confirmed by electrophoresis on a 3% agarose gel in TBE (pH 7.6) for 15 min at 150V.

Step 2: Separation of monovalent DNA-binding NPs through agarose gel electrophoresis

Au NPs coated with BSPP have a negative charge. Attaching DNA to Au NPs increases the hydrodynamic size. Thus, different numbers of attached DNA base pairs led to distinct bands during gel electrophoresis. The appropriate concentration of DNA for single functionalization was determined by gel electrophoresis on a 3% agarose gel. The shape of the narrow, separated gel bands was assigned a variable conjugation valency.

However, the conjugate Au was separated with a clean laser blade (smartSlicer Gel Cutting Tool & RaZor, Sigma-Aldrich) and extracted using a dialysis tube (SnakeSkin dialysis tubing, MWKO 10K, Thermo Scientific).

Step 3: Preparation of mGYRO using two monovalent Au NPs

First, DNA-attached NPs are separated using gel electrophoresis. DNA1 single conjugated Au NPs and DNA2 single conjugated Au NPs were washed by centrifugation at 10,000 rpm for 5 minutes and re-dispersed in PBS at a concentration of 1 nM. Two complementary single functionalized Au NPs (DNA1 and DNA2) were mixed together for 30 minutes.

Gel analysis revealed a new violet band with reduced mobility as a dimer. The bands were separated by the same procedure as for the separation of monovalent DNA-binding NPs. During several extraction and concentration processes, no new bands were observed except for the dimer band, indicating that the Au-DNA complex was stably conjugated without DNA separation. The separated dimer was surface modified with HS-EG6-CO ₂ H (3 μL, 10 mM) to prevent aggregation. (Fig. 1e)

<Experimental Example 1> Optical stability of mGYRO in PEG coated glass

In order to check the direction and angular sensitivity of a single mGYRO, the probe was fixed to the coverslip using a biotin-streptavidin linker, and the brightness of each spot was observed while changing the incident linear polarization angle Δθ. The scattering intensity of each single probe was measured as a function of θ and fitted to a sine-function with π periods.

Specifically, in order to confirm optical stability without perturbation, a cover slip coated with biotin was prepared. The cover slip was washed with a cleaner to remove dust, immersed in 1.0M NaOH for 30 minutes, and sonicated with acetone. 1 mL of APTES was added to 100 mL of MeOH solution containing 5 mL of acetic acid. The cover slip was incubated in MeOH solution for 30 minutes, washed 3 times with MeOH, and dried over Ar. 84 mg of NaHCO ₃ was dissolved in 10 mL of deionized water to prepare a reaction buffer (0.1 M, pH 8.5) for PEGylation. 0.2 mg of biotin-PEG-SC and 8 mg of mPEG-SC were mixed in an epi-tube. 64 μL of reaction buffer is added to the PEG mixture and 70 μL is dropped onto the washed slide glass.

Incubated in a dark and humid environment to prevent drying overnight. The cover slip was soaked in deionized water to remove excess PEG, separated, washed with deionized water, and dried. 50 μL of 0.1 mg/mL streptavidin in 10 mM T50 buffer (10 mM Tris-HCl, pH 8.0, 50 mM NaCl) was incubated for 1 minute. After washing with T50 buffer, DNA biotin was ligated and excess DNA was removed with PBS. Finally, the mGYRO image probe was cultured and conjugated.

As a result, the orientation was determined as a fitted function, and it showed an angle-dependent pattern with an error of ~8° by being well matched with the orientation from SEM imaging. The angular sensitivity was 4.4 times that of the spherical particles, and was similar to that of the rod, which is commonly used with straight particles.

As a result, the mGYRO of the present invention can easily measure a two-dimensional orientation (direction) under polarized light.

The present inventors synthesized a monovalent (m)-, gold dimer assembled into a Y-shaped oligonucleotide structure as a rotating probe (mGYRO). These dimer gold nanoparticles (Au NP) have an interparticle distance of 4 nm and are optimized for a size of 25 nm.

This probe is distinguished from cytosolic organelles when observed under a dark-field (DF) microscope, and the double-stranded DNA (dsDNA) and linker exhibit adequate stability and robustness without any perturbation consistent with previous TEM and X-ray observations. The size and distance between the two nanoparticles are evaluated experimentally and theoretically through the finite-ifference time domain method (FDTD). TEM analysis actually provided direct evidence that the probe was formed in a dimeric form.

Advantages of using DNA include the ease of targeting molecular assembly easily at the exact center of the Au dimer, the modularity to conjugate more functional groups, and commercial availability.

The present inventors observed an aggregate of nanoparticles, containing small Au nanoparticles as the center of the Au dimer, and specifying the probe target in a site-specific and stoichiometric manner, whereas Au nanorods, which have a similar linear plasmon structure, It showed non-location specificity.

<Experimental Example 2> Imaging of diffusive dynamics of lipid molecules

The present inventors applied this rotating probe to visualize the diffusive dynamics of lipid molecules in the lipid bilayer (SLB), a two-dimensional model membrane, and by comparing the measured diffusion coefficients using various imaging probes, mGYRO is diffused. It was confirmed that it could be used as a single molecule imaging probe without shaking.

Preparation of a lipid bilayer (SLB) supported on glass

Small single lamellar vesicles (SUVs) were prepared in chloroform solution by DOPC. This chloroform mixture was removed by a stream of argon and resuspended in 500 μL of PBS to make a final concentration of 4.0 μM. Large vesicles were divided into SUVs using a probe-tip sonicator (Sonics, VCX 750) with a 2 mm layered microtip (cat # 630-0423). The suspension was sonicated for 40 minutes until the emulsion became clear. Glass bottom dishes (MatTek, No. 0 glass, 10 mm wells, 35 mm dishes) were washed with 1.0 M NaOH for 30 min and with DI water. 160 μL of PBS containing 10 μL of SUV suspension was deposited on the glass. The solution was produced SLB on glass for 30 min and washed carefully 3 times with PBS. BSA (150 μL/0 ~ 0.5 mg/mL) was applied before SLB formation to control the diffusion rate of lipid molecules.

Preparation of lipid-conjugated DNA (lipid-DNA)

To link the lipid molecule and DNA, the carboxyl group of palmitic acid was bonded to the amine group of the amine-terminated DNA (DNA linker) by EDC/NHS coupling to form a stable amide bond.

0.064 g of palmitic acid in DCM and 0.035 g of NHS in 5 mL of THF were mixed in a 25 mL round bottom flask. Then 0.575 g of EDC was added to the flask, sonicated until the mixture became clear, and stirred at room temperature for an additional 12 hours. The reaction mixture was washed with a saturated aqueous NaHCO ₃ solution to separate an organic layer and an aqueous layer. The selected organic solution was filtered through anhydrous Na ₂ SO ₄ column, dried, and the solution was evaporated by rotation. The product was confirmed by NMR analysis.

7 mg/mL of NHS-activated palmitic acid was dissolved in dry DMSO and stored at -20°C. In order to obtain a stable amide bond, the reaction was carried out under slightly alkaline conditions. 20 μL of 100 μM DNA linker, 38 μL of deionized water, 20 μL of HEPES buffer (0.5 M, pH 8.5), and 7 mg/mL of NHS-activated palmitic acid were placed in a 20 mL epi-tube. The mixture was sonicated for 10 minutes and incubated for 1 hour at room temperature. The product was desalted using a 7k MWCO 0.5 mL zevaspin desalting column (Thermo fisher) and precipitated with ethanol. The lipid-DNA palette was resuspended in 200 μL DI water at a final concentration of 10 μM and stored at 4°C.

Fluorescence recovery after photobleaching (FRAP) analysis

To identify the imaging probes, FRAP analysis must be performed in live cells as well as in supported lipid bilayers (SLB), which do not disturb the diffusivity of the linked molecules.

In the lipid bilayer, 3 μL of a 1 μM solution of lipid-DNA was incubated for 15 minutes, intercalated in SLB, and carefully washed with PBS.

3 μL of 1 μM DNATR was incubated for 30 minutes and washed again. For FRAP analysis, the field diaphragm of microscopy was closed to allow light to pass through the 16 μm diameter field of view into the lipid bilayer. The fluorescent material was bleached for 10 seconds by irradiating light with high intensity.

The geological bilayer image immediately returns to low light and the diagram is fully open. Slow imaging was performed without intervals for 3 minutes using a 100 ms exposure time.

Tracking single lipid molecules in SLB using a variety of probes

In the case of a conventional organic dye probe, 6 μL of 1 μM Texas Red-DHPE was inserted into PBS and inserted into the SLB. In the case of mGYRO, the same amount of lipid DNA was intercalated into SLB to share about 2% of the lipid and DNA ₃ was deposited. Excess DNA was washed 3 times with PBS. 3 nL of 100 nM mGYRO was added and incubated for an additional 5 minutes. In the case of Au probe, DNAm-conjugated Au NPs were added.

Unconjugated probes were washed with PBS. Slow microscopy was recorded for 10 seconds without a 5 second exposure time with a slow microscope.

Single molecule tracking and HMM analysis.

Image J's TrackMate Plugin was used for single molecule tracking and trajectory analysis. Mean squared displacement (MSD) calculated the maximum time delay as 1/10 of the trajectory duration. The MSD plot was fitted to a linear equation corresponding to Brownian motion. The first 10 points of the MSD were used to evaluate the diffusion coefficient.

A software based on Hidden Markov modeling using Bayesian model selection (HMM-Bayes) was used to infer the number of lateral diffusion states and their transitions from a single diffusion EGFR trajectory.

Another software using Hidden Markov Modeling (HaMMy) was used to analyze intensity trajectories separating the rotational diffusion states.

HMM-Bayes and HaMMy were evaluated using simulated tracking data, which were generated with random numbers to mimic Brownian lateral and rotational displacements.

We changed the number of state periods from 2 to 10 to see the number of frames required for reliable results.

On the other hand, the lipid molecule was too fast to observe the rotational motion, so 0.2 mg/mL BSA was used to slow the diffusion kinetics of SLB.As a result, the lipid molecule was 0.35 ± 0.19 μm ² /s due to the observable rotational kinetics. It was slowed down and showed a continuous intensity change.

The mGYRO of the present invention is a clear, non-shaken single molecule imaging agent that displays Brownian rotation and lateral movement of lipid molecules with gradient changes.

<Experimental Example 3> Single EGFR imaging in living cells

First, in order to apply a monovalent nanoprobe for single EGFR imaging in living cells, a stable cell line expressing SNAP-EGFR-GFP was generated and the receptor was specifically labeled with benzylguanine (BG), linker DNA and mGYRO.

SNAP-EGFR-GFP expressing cell line

SNAP-EGFR-GFP was constructed by classical PCR cloning technique. The pSNAPf vector (NEB) was inserted into the N-terminus of the EGFR-GFP construct (Addgene). The SNAP-EGFR-GFP plasmid was transformed into the top 10 E. coli (Thermo Fisher) by heat shock transformation. E. coli was cultured to an OD600 of 2-4. Plasmid purification followed the manufacturer's protocol (Qiagen, miniprep). Neon Transfection of SNAP-EGFR-GFP according to the manufacturer's protocol (parameters, tips: 10 μL, number of cells: 3.5 x 10 ⁵ , plasmid: 1 μg, pulse voltage, width and number: 1,230 V, 10 ms, 4, respectively). System (Thermo Fisher, MPK5000) was used to transfect U2OS cell lines. Subsequently, 1,000 µg/ml G418 was selected for 10 days. Cells were cultured in DMEM containing 10% FBS and cultured every 3-4 days in T25 flasks (Corning). All cells were maintained at 37 ℃ and 5% CO ₂ in a humidifier incubator (Binder, Model C 170). A U2OS stable cell line expressing SNAP-EGFR-GFP was used without further selection.

For microscopic observation with a high NA target, cells were plated on a 35 mm glass bottom dish (MatTek, P35G-0-10-C) coated with collagen I, and the apical surface of lamellipodia was selected. This avoids physical contact with focal adhesion and steep slopes around the cell body.

Preparation of benzylguanine-NHS

The benzylguanine-NHS linker can be purchased from New England Biolabs (), and was synthesized by performing the following reaction scheme. Unless otherwise specified, all chemical reactions were carried out at room temperature (rt) under nitrogen (99.999%) atmosphere.

[Reaction Scheme]

¹ H-NMR (400 MHz, DMSO-d6): δ = 1.74 (t, 2H), 2.18 (m, 4H), 2.60 (t, 4H), 4.24 (d, 2H), 5.44 (s, 2H), 6.27(s, 2H), 7.26(d, 2H), 7.43(d, 2H), 7.80(s, 1H), 8.33(t, 1H), 12.4(s, 1H) /Yield: 84% (0.0502 mmol, 0.024 g)

Preparation of benzyl guanine binding DNA (BG-DNA)

BG-NHS was dissolved in DMSO and stored at -20°C at a concentration of 10mg/mL. To bind BG-NHS and amineterminated DNA (DNA linker), 20 μL of 100 μM DNA binding agent, 38 μL of DI water, 20 μL of HEPES buffer (0.5 M, pH 8.5) and 10 mg/mL NHS 2 mL of active benzyl guanine was added to the epitube. The solution was mixed by sonication for 10 minutes and incubated for an additional hour. The product was purified using a Zeba spin desalting column (Thermo fisher, 7k MWCO, 0.5 mL) and precipitated with ethanol. Subsequently, the BG-DNA palette was resuspended in a stock having a final concentration of 50 μM in DI water and stored at 4°C.

Specific labeling of mGYRO in living cells

Cells stably expressing SNAP-EGFR-GFP were plated on a collagen I coated glass bottom dish at a density of ~ 50%. Before labeling, 50 μL of 1 μM BG-DNA and 50 μL of 1.2 μM DNA _T3 were mixed and the cells were incubated with the DNA mixture at 37° C. for 10 minutes. After washing the cells three times with a culture medium containing 10% FBS, 1 nM mGYRO dispersed in a culture medium containing 0.5% alkali-soluble casein was treated to the cells. After incubation for 4 minutes at rt, unbound probes were washed with medium before microscopy. For dye-comparative single molecule diffusion experiments, 1.2 μM DNA _TR was used to react with BG-DNA.

Imaging probe design to monitor the rotation of membrane proteins in living cells

As asymmetric nanoparticles show an angle-dependent intensity change, Au NRs have been used as orientation sensors or monitoring probes for rotational dynamics of biomolecules. For example, it monitors the dynamics of enzymes and motor proteins in living cells. In order to maximize the angle-dependent properties, the linker that connects the biomolecule to the nanoparticle should be located at the center of the nanoparticle. However, it is difficult to functionalize the site-selective linker. To place the linker in the center of the nanoprobe, we designed nanoparticles dimerized with two gold NPs and Y-type DNA.

Au dimer is similar to Au NR (nanorod) in terms of optical properties due to plasmon bonding.

The plasmonic properties of Au dimers depend on the particle size, distance and angle of incident polarization. For best performance as a monitoring probe, the optimized particle size and particle-to-particle distance must be determined. When considering perturbation, a small Au dimer is most preferred. However, living cells have many endosomes. To act as a probe, nano probes must be distinguished from endosomes. We measured the strength of nanoparticles and endosomes of various sizes.

Although 30 nm nanoparticles are not experimentally distinguished from endosomes in living cells, 25 nm dimer nanoparticles are much brighter than endosomes and are clearly distinguished in living cells. In addition, it was confirmed that the 25 nm Au dimer did not cause perturbation in protein migration.

In consideration of the plasmon binding effect, the shorter the distance between particles, the exponentially greater scattering intensity and can be controlled by the number of DNA base pairs. However, DNA duplex stability should also be considered.

DNA double stability is due to Van der Waals interactions between adjacent hydrophobic bases. More stacked base pairs provide better stability. Therefore, both factors must be considered.

Regarding the thermal stability of DNA base pairs, at least 10 pairs are required at 37°C, and the melting temperature is about 50°C with a standard deviation of 10°C. Heat induces DNA double degradation. Also, considering the orientation of the three Y-shaped single strands, each double helix needs 10-13 pairs to have one turn. Therefore, we choose 13 pairs of bases to bind for each complementary moiety, giving 4 nm spacing between the particles.

FDTD (finite-difference time-domain) calculations were used to validate the distance with a rotating probe. The 25 nm Au dimer with 4 nm gap had an intensity three times higher than that of the uncoupled dimer and showed sufficient intensity difference for polarized light. In addition, since all spectra are located between 500 nm and 600 nm at 4 nm intervals, there is no problem in applying optical devices (mercury lamp (380-600 nm), polarization filter (400-700 nm), EM CCD (400-900 nm). nm), etc.).

Selection of the direction of rotation during EGFR dimerization

In particular, even though the oligomer states were different, almost the same rotational motility values were measured in the same rotational state, and when the oligomer state was changed (ie, from M1 to D1 or vice versa), rotational speed maintenance was observed, thus "preserving rotational speed during dimerization" Confirmed.

To evaluate the moment of inertia (I) of the EGFR transmembrane domain (TM), atomic coordinates were obtained from the protein main data bank (PDB, 2M0B), and the main axis of rotation was assumed to be the z-axis passing through the center of mass.

The moment of inertia calculated from the coordinates x, y, z and the mass of each atomic mass is obtained using equation (1), and the equation of angular momentum (L) is obtained from equation (2).

Here, m, r and w represent the atomic mass, the vertical distance and angular velocity of each atom from the main axis, respectively.

The calculated I ratio is assuming that i) dimers of two single EGFRs are in complete inelastic collision, ii) angular momentum of the system is preserved, and iii) dimers occur when the rotation directions of the two EGFRs coincide, ~ 0.5 (IM and ID 5.80, 11.02 x 10-39 g m2, respectively), which is consistent with conservation of rotational speed.

Fluorescence recovery after photobleaching (FRAP) analysis

For analysis of the proliferation of EGFR in living cells, FRAP analysis was performed in living cells stably expressing SNAP-EGFR-GFP.

This process is similar to that performed on the lipid bilayer, except that fluorescence is irradiated for 30 seconds.

The diffusion coefficient is determined as follows. D = r ² γ/4t _1/2 , where r is the radius of the bleached area, γ is a parameter dependent on the shape of the bleached area (γ = 1 in the case of a circle), and t _1/2 is the recovery That's half the time.

First, the normalized FRAP curve was fitted to an exponential growth function and half time (t _1/2 ) was obtained. The half width (r) of the bleached area is defined as the half width (FWHM) of the intensity distribution to which the Gaussian function is applied.

The scattering intensity and traces of the x-y position were obtained through a DF microscope. According to recent studies, EGFR shows a dynamic change in lateral diffusion mainly due to protein-protein interactions from reversible dimerization. However, the existence of dimers is still debatable.

Long time observations are essential to verify the oligomer state of EGFR and its corresponding diffusivity (> 1 min, time resolution: ~ 20 ms). We initially followed the colocalization event of a single receptor (n = 541) using monovalent Au NPs (mAu) in living cells.

To confirm the oligomerization state, the bound plasmon intensity, a function of the distance (d) between the two Au NPs, and the lateral diffusivity as a function of the number of associated proteins were measured simultaneously.

To detect discrete states from stochastic transitions of oligomers from trajectories, a Bayesian model incorporating statistical machine learning analysis, Hidden Markov model (HMM-Bayes) and HaMMy was used.

On the other hand, since the epidermal growth factor receptor (EGFR) protein was much slower than the lipid molecule at 0.16 ± 0.14 μm ² /s, there was no difficulty in observing the protein.

We evaluated the temporal accuracy of the HMM method by simulating Brownian outer and rotational trajectories and confirmed the consistency of the results.

HMM analysis of the EGFR trajectory indicated reversible EGFR dimerization with rare observation of high-order oligomerization in ligand (EGF)-free conditions.

In addition, we investigated EGFR dynamics after ligand binding.

Fluorescent protein (GFP) and organic dye (Texas Red) as well as clustered Au NPs were observed, indicating EGFR oligomerization.

Next, we confirmed that mGYRO specifically targets SNAP-EGFR-GFP and does not change EGFR mobility in living cells.

To minimize optical crosstalk between adjacent probes, polarized DF at low labeling density exhibits a sparse indication of diffuse EGFR with fluctuations in the scattering intensity (IEGFR) of mGYRO.

Based on these results, we investigated abrupt changes in both lateral diffusion and rotational diffusion, indicating that several states exist.

To investigate the origin of the fluctuations, we measured the intensity between fixed mGYROs with different polarization angles (parallel, constant and vertical, I+).

Here, (i) all probes fixed under unpolarized polarized irradiation have stable brightness, (ii) maintain stability even if the probe is diffused under non-polar light, and (iii) IEGFR was always between work and I+ (iv) IEGFR fluctuated probabilistically.

Thus, the change in IEGFR from the diffusion probe is not due to artifacts or oscillations between Au NPs or potentials along the z axis, but rather due to the angular displacement of mGYRO under polarized light.

In principle, the angular and lateral diffusion coefficients (DR, DL) of the conventional cylinder model of the transmembrane (TM) protein in the cell membrane follow the Saffman-Delbruck relationship.

Here, T, η, h and r represent the temperature, viscosity, and height and radius of the TM protein of the lipid membrane, respectively.

In live cell experiments of single molecule EGFR diffusion, T and η around the TM domain must be constant, and the change in morphological factors (r, h) is negligible due to the inherent structural stability of the helical TM domain.

Therefore, we hypothesized that there are additional factors that change the morphological factor.

Asymmetric binding of kinase domains (KDs) in EGFR dimerization is an important step, and recent nuclear magnetic resonance and molecular dynamics studies have confirmed that KD dimerization is inhibited when KD is itself buried in the plasma membrane.

Ligand-induced EGFR dimerization stabilizes the active structure of the intracellular domain (ICD) by allostically entangled membrane interacting elements (especially the LRRLL motif and KD within the membrane membrane portion) from the plasma membrane.

Therefore, we interpret the origin of the probabilistic change in angular displacement of EGFR as the interaction of ICD and lipid membrane.

In addition, it has a relatively dominant rotational mobility compared to the lateral mobility due to its dependence on r (α r-2 vs ln (r-1)), which means that the hydrophobic interaction between the ICD and the lipid bilayer results in the rotational oligomer state. no.

To determine the correlation between the number of structural states due to ICD docking and oligomer states, we analyzed both CSAD and CSD from trajectories with HMM.

The results were inferred from the measured trajectories. It includes two oligomer states of CSD (M, D) and three structural states of CSAD (1, 2, 3).

Three notable observations were obtained in dozens of orbits:

(i) Two monomers (M1, M2) and three dimers (D1, D2, D3) states were observed, and almost the same angular velocity was observed in the same rotational state, despite significant differences between the rotational states. (M1-D1 vs M2-D2 vs D3, ~10, 50, 90 rad ² /s).

(Ii) Considering the residence time (τ) of each state, the slowest rotational states (M1 and D1) predicting the EGFR form in which KD is buried are energetically stable.

(iii) When considering state symbols, more detailed investigations of temporal transitions are needed. Each observation requires independent consideration.

First, the rotational state is maintained while the oligomer state changes (i.e., M1 to D1 and vice versa), which may indicate dimerization that occurs when the directions of rotation of the two EGFRs coincide.

Second, although ICD isolated from the membrane is an important consideration of EGFR activation, the M3 state was not detected during hundreds of dynamic transitions.

The undetected M3 state can be interpreted in such a way that subsequent dimerization further stabilizes the dissociated ICD form, which is also consistent with the proposed form of EGFR KD.

Finally, it was found that most of the transitions occur between the M1 and D1 states, including the observation that the transition occurs only between the monomer and the dimer.

In summary, this study uncovered the structural kinetics of the ICD of EGFR, which was previously undetectable at the living cell, single-molecule level using field-specific plasmon nanoparticles, strobe contrast imaging methods, and mathematical algorithms.

This method allowed the visualization of molecular diffusion and rotation, as well as the analysis of the structural transfer of proteins during signal transduction.

The inventive success of imaging rotations and transitions is due to robust optical stability and precisely controlled nanomaterial surface chemistry.

<110> DAEGU GYEONGBUK INSTITUTE OF SCIENCE AND TECHNOLOGY <120> Nanoparticle dimer linked by Y-shaped oligonucleotide conjugate, Method for producing the same, and Probe for single molecule observation comprising the same <130> 2019P-01-046 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> one of the 3 polynucleotides for forming self-assemblable Y structured DNA <400> 1 cttacggcga atgaccgaat cagcct 26 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> one of the 3 polynucleotides for forming self-assemblable Y structured DNA <400> 2 aggctgattc ggttcatgcg gatcga 26 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> one of the 3 polynucleotides for forming self-assemblable Y structured DNA <400> 3 tcgatccgca tgacattcgc cgtaag 26 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for forming monovalent Au particle <400> 4 cttacggcga atgtcatgcg gatcga 26 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for Specific labeling test <400> 5 actgactgac tgactgactg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for Specific labeling test <400> 6 cagtcagtca gtcagtcagt 20

Claims (12)

Y-type oligonucleotide conjugate formed by the complementary linkage of three oligonucleotides; And
Including; metal nanoparticles capable of two phlosmonic couplings connected by the Y-type oligonucleotide conjugate,
The distance between the two metal nanoparticles capable of phlosmonic coupling is 1 nm to 10 nm,
Nanoparticle dimer, characterized in that the diameter of the metal nanoparticles capable of the phlosmonic coupling is 15nm to 30nm.
The method of claim 1,
The Y-type oligonucleotide conjugate has a binding site capable of binding to a target of interest, or is linked with an additional binding molecule so as to bind to a target of interest.
The method of claim 1,
The three oligonucleotides each containing 26-50 base sequences, nanoparticle dimer.
The method of claim 1,
The three oligonucleotides consist of a first ss-DNA, a second ss-DNA, and a third ss-DNA,
Here, the first and second ss-DNAs are modified so that the 5'position can be combined with the metal nanoparticles capable of phlosmonic coupling, respectively, and the 5'position of the third ss-DNA is combined with the target target. It is modified to be able to, or further has a nucleotide sequence, or will be linked with an additional binding molecule, nanoparticle dimer.
The method of claim 1,
The nanoparticle dimer,
First metal nanoparticles; Second metal nanoparticles; A first ss-oligo nucleotide bound to the first metal nanoparticle; A second ss-oligo nucleotide bound to the second metal nanoparticle; A third ss-oligo nucleotide;
The first ss-oligonucleotide forms a first binding region complementarily bonded to the third ss-oligonucleotide;
The second ss-oligo nucleotide forms a second binding region complementary to the first ss-oligo nucleotide;
The third ss-oligo nucleotide forms a third binding region complementary to the second ss-oligo nucleotide,
The first metal nanoparticles and the second metal nanoparticles are connected by a Y-type oligonucleotide conjugate.
delete Y-type oligonucleotide conjugate formed by the complementary linkage of three oligonucleotides; And
Including; metal nanoparticles capable of two phlosmonic couplings connected by the Y-type oligonucleotide conjugate,
The distance between the two metal nanoparticles capable of phlosmonic coupling is 1 nm to 10 nm,
The probe for single molecule observation, characterized in that the diameter of the metal nanoparticles capable of phlosmonic coupling is 15nm to 30nm.
The method of claim 7,
The probe for single molecule observation,
Amino acids, peptides, polypeptides, proteins, glycoproteins, lipoproteins, nucleosides, nucleotides, oligonucleotides, nucleic acids, sugars, carbohydrates, oligosaccharides, polysaccharides, fatty acids, lipids, hormones, metabolites, cytokines, Chemokines, receptors, neurotransmitters, antigens, allergens, antibodies, substrates, metabolites, cofactors, inhibitors, drugs, pharmaceuticals, nutrients, prions, toxins, poisons, explosives, insecticides, chemical weapons, biohazard agents, radiation Isotopes, vitamins, heterocyclic aromatic compounds, carcinogens, mutagenic factors, anesthetics, amphetamines, barbiturates, hallucinogens, wastes or pollutants, characterized in that it can observe or detect, single molecule observation probe.
Preparing a first-third oligonucleotide comprising a complementary nucleotide sequence capable of forming Y-type DNA;
Attaching the prepared first and second oligonucleotides to be monovalent with metal nanoparticles capable of phlosmonic coupling, respectively;
By mixing the metal nanoparticles capable of monovalent phlosmonic coupling to which the first oligonucleotide prepared in the above step is attached and the metal nanoparticles capable of monovalent phlosmonic coupling to which the second oligonucleotide is attached, the nanoparticles Including; preparing a dimer;
The distance between the metal nanoparticles capable of monovalent phlosmonic coupling to which the first oligonucleotide is attached and the metal nanoparticles capable of monovalent phosmonic coupling to which the second oligonucleotide is attached is 1 nm to 10 nm,
The method of manufacturing a nanoparticle dimer, characterized in that the diameter of the metal nanoparticles capable of the phlosmonic coupling is 15nm to 30nm.
The method of claim 9,
Hybridizing the prepared nanoparticle dimer with a third oligonucleotide; characterized in that it further comprises, the method of producing a nanoparticle dimer.
Exposing the nanoparticle dimer of claim 1 to a sample comprising one or more target single molecules; And
Detecting the nanoparticle dimer in the sample; containing, observation or detection method of the target single molecule.
Preparing a first-third oligonucleotide comprising a complementary nucleotide sequence capable of forming Y-type DNA;
Attaching the prepared first and second oligonucleotides to be monovalent with metal nanoparticles capable of phlosmonic coupling, respectively;
By mixing the metal nanoparticles capable of monovalent phlosmonic coupling to which the first oligonucleotide prepared in the above step is attached and the metal nanoparticles capable of monovalent phlosmonic coupling to which the second oligonucleotide is attached, the nanoparticles Preparing a dimer;
Functionalizing the third oligonucleotide to recognize the target single molecule;
Exposing the third oligonucleotide functionalized in said step to a sample comprising at least one target single molecule;
Hybridizing with a third oligonucleotide by treating the sample with the nanoparticle dimer; And
Including; detecting a nanoparticle dimer in the sample,
The distance between the metal nanoparticles capable of monovalent phlosmonic coupling to which the first oligonucleotide is attached and the metal nanoparticles capable of monovalent phosmonic coupling to which the second oligonucleotide is attached is 1 nm to 10 nm,
The method of observing or detecting a single target molecule, characterized in that the diameter of the metal nanoparticles capable of the phlosmonic coupling is 15 nm to 30 nm.

Images