KR102207353B1 - Necrotic enteritis vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism - Google Patents

Abstract

The present application relates to a composition for preventing and/or treating necrotic enteritis in pigs, a vaccine manufacturing method, and a treatment method.

Description

[Necrotic enteritis vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism]

The present application relates to an antigenic substance targeting pigs, a CRISPR/Cas9 system, and a vaccine composition for necrotizing pigs including the same.

The present application relates to an antigenic substance targeting pigs, a CRISPR/Cas9 system, and a method for manufacturing a pig's necrotizing infection vaccine including the same.

The present application relates to a treatment method for treating necrotizing growth in pigs.

Vaccines are one of the most important measures that can be taken to prevent or/and treat disease.

Although various vaccines for various diseases have been developed so far, treatment or/and prevention is not possible with only the developed vaccines when mutations in the cause of the disease occur.

As described above, it is necessary to develop a vaccine capable of rapidly responding to mutations in the cause of the disease.

An object of the present application is to provide an antigenic substance, a CRISPR/Cas9 system, and a vaccine composition for gangrene of pigs including the same.

Another object of the present application is to provide a vaccine against a causative agent causing necrotizing growth in pigs and a method for producing the same.

Another object of the present application is to provide a use for preventing or/and treating necrotizing growth in pigs.

In order to solve the problems of the present application described above, according to an aspect of the present application, i) spores derived from bacteria; At this time, the bacterial-derived spores are spores having a sequence encoding an antigenic substance in genomic DNA,

ii) a spore coat protein present on the surface of the bacterial spore,

iii) porcine necrotizing antigenic substance linked to the spore coat protein

There is provided a vaccine composition for preventing or treating necrotizing growth in pigs comprising a.

In addition, the present application is a porcine necrotizing antigenic substance is SEQ ID NO. 1 and SEQ ID NO. It provides a vaccine composition for preventing or treating necrotizing growth in pigs, characterized in that at least one selected from among 2.

In addition, the present application provides a vaccine composition for preventing or treating necrotizing growth in pigs, characterized in that the concentration of the antigenic substance for necrotizing growth in pigs is 10 ¹⁰ to 10 ¹⁵ pcs/ml based on the composition.

In addition, in order to solve the problems of the present application described above, according to an aspect of the present application, i) knock-in antigenic substances using CRISPR/Cas9 in bacterial genomic DNA. step;

ii) forming spores of the bacteria; And

iii) expressing a porcine necrotizing antigenic substance on the spore surface of the bacteria;

There is provided a method for producing a vaccine for preventing or treating necrotizing inflammatory disease in pigs comprising a.

According to the present application, the following effects occur.

First, according to the present application, it is possible to provide a composition capable of preventing or/and treating necrotizing growth in pigs. In particular, it is possible to provide an antigenic substance, a CRISPR/Cas9 system, and a composition for preventing or/and treating necrotizing swine including the same.

Second, by using the composition provided by the present application, it is possible to provide an effect that can quickly respond when a mutation occurs in the cause of the necrotizing disease in pigs.

1 is a diagram showing a pHCas9 vector.
FIG. 2 is a diagram showing a pJB vector containing CotG CDS including a guide RNA of B. subtilis coat protein (CotG) and a promoter.
FIG. 3 is a diagram showing a pJB-GFP vector including CotG CDS and GFP including a guide RNA and promoter of B. subtilis coat protein (CotG).
4 is a diagram showing the epitope of porcine necrotizing growth salt used in the present application.
5 is a diagram showing a pJB009 vector containing CotG CDS and CPA1 containing a guide RNA and promoter of B. subtilis coat protein (CotG).
6 is a diagram showing a pJB010 vector containing CotG CDS and CPA2 including a guide RNA and promoter of B. subtilis coat protein (CotG).
7 is a diagram showing a pJB-sg02 vector containing a guide RNA targeting an ampicillin resistance gene for the deletion of an antibiotic resistance gene.
8 is a diagram showing a pJB-sg03 vector containing a guide RNA targeting a neomycin resistance gene for deletion of an antibiotic resistance gene.
9 is a diagram showing the results of PCR analysis performed to determine whether GFP is expressed on the spore surface of B. subtilis .
10 is a view showing the results of FACS analysis performed to determine whether GFP is expressed on the spore surface of B. subtilis .
11 is a diagram showing the results of PCR analysis performed to determine whether CPA1 and CPA2 are expressed on the spore surface of B. subtilis
12 is a view showing the PCR results performed to confirm that the antibiotic gene ampicillin is defective in the B. subtilis transformant into which the pJB-CPA expression vector has been introduced.
FIG. 13 is a diagram showing PCR results performed to confirm that the antibiotic gene neomycin was deleted in the B. subtilis transformant into which the pJB-CPA expression vector was introduced.
14 is a diagram showing the results of ELISA confirming the formation of antigen-specific antibodies.
15 is a diagram showing Western blot results confirming whether or not antigen-specific antibodies are formed.

Unless otherwise defined, terms or practices used in the technology disclosed by this application are microbiology, virology, bacteriology, genetics, immunology, biochemistry, molecular biology, microbiology, cell biology, genomics and conventional It has the same meaning as commonly understood by one of ordinary skill in the art using technology and the like.

1. Vaccine

One aspect of the present application relates to a vaccine.

“Vaccine” refers to a substance that produces a protective immunity against disease. The protective immunity may include antibodies or T cells that specifically recognize pathogens such as viruses, bacteria, and parasites, which exclude pathogens from the living body, but are not limited thereto. The vaccine may include all conventional vaccines such as killed vaccine, attenuated vaccine, toxoid vaccine, subnunit vaccine, and conjugated vaccine, but is not limited thereto. . The terms "vaccine" or "prophylactic injection" are used interchangeably. In order to prevent illness, getting the above vaccination is called vaccination.

The target of the vaccine may be human, pig, cow, dog, fish, insect, etc., but is not limited thereto.

For example, the subject of the vaccine in the present application may be a pig.

1-1. Spore

The vaccine may contain spores.

The spores may include spores in a natural state and variations thereof.

For example, spores may be spores of plants, yeast, fungi, bacteria, and the like.

In the spores of the bacteria, the bacteria may be Clostridium genus, Streptococcus genus, Bacillus genus, etc., but are not limited thereto.

The Clostridium genus may be, for example, C. difficile, C. botulinum, C. perfringens , but is not limited thereto.

The genus Bacillus may be, for example, B. subtilis, B. anthrasis, B. thuringiensis, B. cereus , but is not limited thereto.

For example, the present application may be a vaccine containing spores of B. subtilis .

The bacteria may include, for example, bacteria such as B. subtilis recognized as GRAS (generally recognized as safe).

In particular, if the present application is a vaccine containing spores, any bacteria recognized as GRAS can be used.

The spores may include exospores formed on the outside of plants, yeast, fungi, and bacteria, and endospores formed on the inside.

For example, the present application may be a vaccine containing endospores.

The exospore refers to spores that are produced outside the sporangia and come out as they are, and are involved in the reproductive function of spores.

The endospores refer to spores formed inside (specifically, cells) of spores, and refer to spores that have little metabolic activity and are temporarily formed when conditions difficult to survive.

For example, the present application may be a vaccine containing endospores of B. subtilis .

The conditions under which the endospores are formed are nutrient-depleted nutritional conditions, high or low temperature temperature conditions, high or low moisture moisture conditions, chemical conditions such as disinfectants and preservatives, acidic or alkaline pH conditions, etc. It may be formed, but is not limited thereto.

In this way, because endospores can be formed under conditions that are difficult to survive, they can survive for a long time in various environments. In other words, endospores can have tremendous resistance to harmful conditions such as heat, drying, toxic chemicals, nutrient depletion, and UV irradiation.

The spore may include an external spore protein. For example, the spore external protein may be a spore exosporium protein, a spore coat protein, a transmembrane protein, a spore appendage protein, a spore associated enzyme, and the like.

For example, the present application may use each other's spore proteins between spores of microorganisms of the same genus.

The spore exosporium protein may be, for example, BclA or InhA.

The spore coat protein is, for example, CotA, CotB, CotC, CotD, CotE, CotF, CotG, CotN, CotS, CotT, CotV, CotW, CotX, CotY, CotZ, CotH, CotJA, CotJC, CotK , CotL, CotM, etc.

The transmembrane protein may be, for example, prkC, OppA, or the like.

The spore appendage protein may be, for example, P29a, P29b, P85, or the like.

The spore associated enzyme may be, for example, CotA (laccase), oxalate decarboxylase (oxdD), reticuline oxidase-like protein (CotQ), transglutaminase (tgI), and the like.

The spores may have hydrophobic properties. At this time, all or part of the spore may have hydrophobicity.

The spores may be components of the spore system.

The vaccine may comprise a spore system.

The spore system refers to all of the systems in which the system construct is spores or contains spores, antigenic substances and additional substances.

The additional substances refer to all substances that can further enhance the efficacy of the vaccine. For example, aluminum gel particles (aluminum salts), oil adjuvants containing mineral oil as a main component, surfactant-like adjuvants such as saponins purified from white hyacinth beans, bacterial toxins ( LPS, etc.) may be derived from a TH1 inducing adjuvant, but is not limited thereto.

1-2. Antigenic substance

The present application may be a vaccine containing an antigenic substance.

The term "antigen" as used in the present application refers to a substance that causes an immune response. The antigen may include, for example, pathogens, viruses, proteins, polysaccharides, artificially synthesized substances, substances with mutations in vivo, etc., but is not limited thereto. The terms “antigen” or “immunogen” are used interchangeably.

The antigenic substance includes all substances that cause a protective immune response, and may be, for example, a pathogen, an epitope, a polypeptide, a protein, a non-protein molecule, and a fragment thereof.

The antigenic substance may be a wild type or a mutant type. In this case, the mutation may include a natural manipulation or an artificial manipulation, in which some or/and all of the antigenic substance is manipulated such as deletion or modification.

For example, it may be a vaccine containing a portion of the antigenic substance.

For example, it may be a vaccine including all of the antigenic substances.

Pathogen refers to a disease-causing individual, including, for example, viruses, bacteria, and bacteria.

For example, it may be a vaccine containing the pathogen itself as an antigenic substance.

For example, it may be a vaccine containing a portion of the pathogen as an antigenic substance.

The pathogen may be a specific site modified or manipulated. The transformation and manipulation can be made naturally or artificially.

The pathogen may be a pathogen of a disease targeting mammals.

For example, the mammal may be a pig, cow, sheep, goat, etc., but is not limited thereto.

For example, the pathogen may be Clostridium .

For example, the pathogen of a disease targeting mammals may be a toxin of Clostridium perfringens .

Clostridium pufflingens is a Gram-positive bacillus that forms spores and grows under anaerobic conditions without air. Clostridium pufflingens are classified into five (AE) types according to the production capacity of four toxins (alpha, beta, epsilon, iota), and the production of endotoxins (Enterotoxin, cpe) is mostly classified as type A, but It also appears in type D.

The vaccine of the present application may contain a porcine necrotizing pathogen.

An epitope is called an antigenic determinant and refers to a specific site on an antigen that allows identification of the antigen.

For example, it may be a vaccine containing the epitope itself as an antigenic substance.

For example, it may be a vaccine containing a portion of the epitope as an antigenic substance.

The epitope may be a specific site modified or manipulated. The transformation and manipulation can be made naturally or artificially.

The epitope may contain one or more toxins. Toxins can include exotoxins and endotoxins.

The toxins are Shiga toxin, heat-labile toxin, Clostridium perfringens toxin, Campylobacter jejuni enterotoxin, and Perchsis toxin. pertussis toxin), a shiga-like toxin (or verotoxin), and the like, but are not limited thereto.

For example, it may be a vaccine comprising one or more Clostridium perfringens toxin. In this case, the Clostridium perfringens toxin A (CPA) may be included, but is not limited thereto.

The epitope may include part or all of the C. perfringens domain sequence.

Phospholipase C (hereinafter, plc) of C. perfringens contains a total of two domains: plc domain 1 (Zn-dependent PLC) and plc domain 2 (PLAT).

The epitope may include part or all of the sequence of plc domain 1 or plc domain 2.

For example, the epitope may include some or all of the sequence of plc domain 2.

For example, the epitope of the present application is SEQ ID NO. It may include some or all of the sequence of 4.

The epitope may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of plc domain 2.

For example, the epitope of the present application is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 4.

For example, SEQ ID NO. 1 may include some or all of the sequence of plc domain 2.

For example, SEQ ID NO. 1 may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of plc domain 2.

For example, SEQ ID NO. 1 is SEQ ID NO. It may include some or all of the sequence of 4.

For example, SEQ ID NO. 1 is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 4.

For example, SEQ ID NO. 2 may include some or all of the sequence of plc domain 2.

For example, SEQ ID NO. 2 may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of plc domain 2.

For example, SEQ ID NO. 2 is SEQ ID NO. It may include some or all of the sequence of 4.

For example, SEQ ID NO. 2 is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 4.

The epitope may be a CPA gene of Clostridium pufflingens.

For example, the epitope may be a CPA1 or CPA2 gene of Clostridium pufflingens.

For example, the epitope of the present application may include CPA1 or CPA2 shown in FIG. 4.

For example, the epitope may include part or all of the sequence of the CPA1 gene.

For example, the epitope may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of the CPA1 gene.

For example, the epitope may include some or all of the sequence of the CPA2 gene.

For example, the epitope may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of the CPA2 gene.

For example, the sequence of the CPA1 gene of the present application is SEQ ID NO. It may include some or all of the sequence of 1.

For example, the sequence of the CPA1 gene of the present application is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 1.

For example, the sequence of the CPA2 gene of the present application is SEQ ID NO. It may include some or all of the sequence of 2.

For example, the sequence of the CPA2 gene of the present application is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 2.

The sequences of the CPA1 and CPA2 genes may have 70, 75, 80, 85, 90, 95 or 100% homology to each other.

For example, SEQ ID NO. 1 and SEQ ID NO. The sequences of 2 may have 70, 75, 80, 85, 90, 95 or 100% homology to each other.

The epitope may include part or all of the consensus sequence of the CPA1 and CPA2 genes.

For example, the epitope is SEQ ID NO. It may include some or all of the sequence of 3.

For example, the epitope is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 3.

For example, the sequence of the CPA1 gene is SEQ ID NO. It may include some or all of the sequence of 3.

For example, SEQ ID NO. 1 is SEQ ID NO. It may include some or all of the sequence of 3.

For example, SEQ ID NO. 1 is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 3.

For example, the sequence of the CPA2 gene is SEQ ID NO. It may include some or all of the sequence of 3.

For example, SEQ ID NO. 2 is SEQ ID NO. It may include some or all of the sequence of 3.

For example, SEQ ID NO. 2 is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 3.

The epitope may include CPA1 and CPA2 gene sequences of Clostridium pufflingens.

For example, the epitope may include part of the CPA1 gene sequence and the entire CPA2 gene sequence.

For example, the epitope may include a part of the CPA1 gene sequence and a part of the CPA2 gene sequence.

For example, the epitope may include the entire CPA1 gene sequence and a part of the CPA2 gene sequence.

For example, the epitope may include the entire CPA1 gene sequence and the entire CPA2 gene sequence.

For example, the epitope is SEQ ID NO. 1 part and SEQ ID NO. 2 may contain some.

For example, the epitope is SEQ ID NO. 1 part and SEQ ID NO. 2 May contain all.

For example, the epitope is SEQ ID NO. 1 full and SEQ ID NO. 2 May contain some.

For example, the epitope is SEQ ID NO. 1 full and SEQ ID NO. 2 May contain all.

The epitope may also include multiple epitopes in which two or more are linked to each other by, for example, a single bond or a double bond.

For example, the vaccine of the present application may contain a porcine necrotizing antigenic substance.

This application can solve or minimize the limitations of conventional vaccines. In particular, it is possible to solve or minimize the limitations of the conventional pig necrotizing vaccine.

The present application is a vaccine containing one or more antigenic substances, and can rapidly respond to mutations in the cause of the disease. In particular, since it contains one or more toxins of pig's necrotizing toxin as an antigenic substance, it can be easily used for prevention or/and treatment of pig's necrotizing inflammation.

2. Necrotic enteritis

The present application may be a vaccine targeting the prevention or/and treatment of necrotizing inflammation.

In particular, the present application may be a vaccine targeting the prevention or/and treatment of necrotizing growth in pigs.

The necrotizing growth of pigs is a disease caused by Clostridium bacteria.

The Clostridium bacterium may be Clostridium botulinum, Clostridium difficile, Clostridium perfringens , but is not limited thereto.

For example, the necrotizing growth salt of pigs of the present application may be Clostridium perfringens .

For example, the necrotizing growth salt of pigs of the present application may be homogeneous type A, type B, type C, and type D of Clostridium pufflingens.

The necrotizing inflammation is a disease in which capillaries of the intestine, mucous membranes of the intestine, etc. are damaged by toxins secreted by Clostridium pufflingens of Clostridium pufflingens.

Clostridium pufflingens type A bacteria produce α-toxin; Clostridium pufflingens type B bacteria produce alpha toxin (α-toxin), beta toxin (β-toxin), and epsilon toxin (ε-toxin); Clostridium pufflingens type C bacteria produce alpha toxin (α-toxin) and beta toxin (β-toxin); Clostridium pufflingens type D bacteria are known to produce toxins such as alpha toxin (α-toxin) and epsilon toxin (ε-toxin).

The Clostridium puffingens toxin may be a causative agent (or antigenic substance) that causes necrotizing growth in pigs.

Genes related to necrotizing growth in pigs may include, for example, alpha toxin (α-toxin), beta toxin (β-toxin), epsilon toxin (ε-toxin), etc. that are directly involved in pathogenicity, but the present application It is assumed that all factors related to porcine necrotizing disease are included.

For example, the pig's necrotizing infection vaccine of the present application may include Clostridium pufflingens type A.

For example, the porcine necrotizing infection vaccine is SEQ ID NO. It may include one or more selected from 1 or 2.

For example, the pig necrotitis vaccine of the present application is SEQ ID NO. It may contain some or all of 1.

For example, the pig necrotitis vaccine of the present application is SEQ ID NO. It may contain some or all of 2.

For example, the porcine necrotizing infection vaccine is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with one or more selected from 1 or 2.

The necrotizing growth infection vaccine may contain part or all of the sequence of plc domain 2.

For example, the porcine necrotizing infection vaccine is SEQ ID NO. It may contain some or all of 4.

The necrotizing vaccine may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of plc domain 2.

For example, the porcine necrotizing infection vaccine is SEQ ID NO. 4 and may include sequences with 70, 75, 80, 85, 90, 95 or 100% homology.

The necrotizing growth infection vaccine may contain a common sequence of CPA1 and CPA2.

For example, the porcine necrotizing infection vaccine is SEQ ID NO. It may contain some or all of 3.

When described as CPA below, it is interpreted as being a type A bacteria of Clostridium puffingens.

2-1. Necrotizing Vaccine

Necrotizing growthitis is caused by a toxin of Clostridium perfringens , and the toxin produced by this fungus damages the intestinal wall, increasing mortality and inhibiting growth.

Clostridium bacteria is one of the normal flora that normally exists in the intestine of healthy pigs, but it develops into a disease when the environment is formed in the intestine and is overgrown with a good environment for this bacteria to grow.

When pigs suffer from necrotizing growth, symptoms such as severe weight loss, diarrhea, etc. occur, and even lead to death.

Clostridium pufflingens type A is basically a spore-forming bacteria, and it is not easy to remove inside the farm because it has resistance to disinfectants from the outside. If the infected sows are stocked in the delivery house and the Clostridium puffingens type A bacteria in the feces settle in the delivery frame while looking at the stool, the next delivery person's stocking pigs are infected with the delivery piglets even though they are negative for Clostridium pufflingens type A Diarrhea may persist.

As of now, the best method that can be applied to farms where Clostridium pufflingens type A is a problem in domestic pig farms is conventionally, by adding antibiotics to compounded feed to suppress bacterial diseases, thereby acting as a stimulating agent for livestock. Productivity increased, but the addition of antibiotics was prohibited or restricted as the problem of antibiotic resistance was raised.

In spite of various efforts to prevent necrotizing growth in pigs, regulations on banning the use of antibiotics or growth promoters are increasing in Europe in recent years. .

Vaccines targeting the prevention or/and treatment of necrotizing growth are killed vaccines, attenuated vaccines, component vaccines, DNA vaccines, recombinant vaccines according to the manufacturing method. vaccine), etc., but any method capable of producing a vaccine is included, but is not limited thereto.

The dead vaccine refers to a vaccine prepared by inactivating all or part of a virus or bacteria using chemical substances or heat.

The attenuated vaccine refers to a vaccine manufactured by modifying a portion of a virus or bacteria causing a disease to have the ability to induce self-reproduction and immunity, but remove the ability to cause toxicity.

The component vaccine refers to a vaccine produced in the process of metabolism of a pathogen or by heating a toxin possessed by the pathogen itself or by treating a drug such as formalin. Component vaccines may also be referred to as subunit vaccines, subunit vaccines, and specific antigen extraction vaccines.

The DNA vaccine refers to a vaccine prepared by transferring a gene using plasmid DNA. The plasmid DNA has various genetic elements for expressing a gene, and when it enters a cell, it means that the antigen is expressed from the inserted gene.

The recombinant vaccine refers to a vaccine manufactured by genetic engineering only a site that acts as an antigen in a pathogen. In this case, genetic manipulation refers to a technology that introduces and expresses an antigen gene into another cell using recombinant technology.

The recombinant technology used when making the recombinant vaccine is not limited thereto as long as it is a technology capable of genetic manipulation such as a method using a vector, a method using a non-vector, and a method using genome editing.

The vector may include all of a non-viral vector, a viral vector, and the like, which have a function capable of carrying a gene.

The virus of the viral vector may be a DNA virus or an RNA virus.

The DNA virus may be a double-stranded DNA (ds DAN) virus or a single-stranded DNA (ss DNA) virus.

The viral vector may be an adenovirus vector, a retrovirus vector, a lentiviral vector, an adeno-associated virus (AAV) vector, a vaccinia virus vector, a poxvirus vector, a herpes simplex virus, etc., but is not limited thereto.

Viral vectors have high gene transfer efficiency, but because they are pathogenic viruses, safety issues and the size of genes that can be inserted into vectors may be limited.

The non-viral vector may be a plasmid, naked DNA, liposome, or the like, but is not limited thereto.

Non-viral vectors do not introduce viral genetic material into human cells, and their ease of production, unlimited size of the inserted gene in the vector, and low side effects due to low immune response to the host may be advantageous. Compared to this, there may be a disadvantage in that the efficiency of introduction into cells is significantly lower.

The non-vector may include methods such as electroporation, gene gun, ultrasonic perforation, self-injection, temporary cell compression or squeezing, lipid-mediated transfection, nanoparticles, silica, etc. If so, it is not limited thereto.

The method of using the genome editing may include ZFN (Zinc-finger nucleases), TALEN (transcription activator-like effector nucleases), CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/ CRISPR-associated sequences), etc. If it is a technology capable of editing a target site of a gene using an artificial enzyme used to cut a DNA site, it is not limited thereto.

The ZFN refers to a genome editing technology composed of a Zinc finger protein capable of recognizing and binding a specific DNA sequence and a FokI restriction endonuclease domain capable of cleaving DNA.

The TALEN refers to a genome editing technology composed of a DNA binding domain and a FokI nuclease domain.

The CRISPR/Cas is also called RGEN (RNA-guided endonuclease), and refers to a genome editing technique in which DNA sequence specificity is induced by RNA, unlike ZFN and TALEN.

The vaccine disclosed in the present application may be a pig's necrotizing infection vaccine made using CRISPR/Cas.

In particular, the vaccine disclosed in the present application may be a pig's necrotizing infection vaccine made using spCas9.

CRISPR/Cas refers to a combination of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and associated sequences (cas) distributed at periodic intervals.

The CRISPR/Cas system consists of a guide RNA and a Cas protein.

The guide RNA refers to an RNA capable of recognizing a target sequence, and refers to a function capable of guiding a Cas protein to a target sequence by binding to a Cas protein.

The guide RNA may include crRNA (CRISPR RNA) or/and tracrRNA (trans-activating crRNA). The form in which the crRNA and the specific site of the tracrRNA are fused may be referred to as sgRNA (sinlge-chain guide RNA).

The Cas protein refers to a protein that performs a function of cleaving a target sequence or gene, and the Cas protein may include an enzyme, and the enzyme may include a nuclease, a protease, a restriction enzyme, etc. It is not limited.

The gene-scissor protein may include an artificially generated enzyme or protein that exists or does not exist in a natural state, or a form in which a part of them is modified.

The enzyme may be a CRISPR enzyme.

The CRISPR enzyme is a protein constituting the CRISPR-Cas system, and may perform a function of cleaving or modifying a target sequence by binding to a guide nucleic acid to form a complex.

The CRISPR enzyme may include a form modified to have incomplete or partial activity by altering the activity of the enzyme.

The CRISPR enzymes are Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2 , Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csf3, Csf2, Csf4 , Cpf1, etc. may be present in a natural state or may include an artificially modified form, but is not limited thereto.

The CRISPR enzyme can be largely divided into 6 types according to the type of CRISPR system. Type I may be composed of Cas1, Cas2, Cas3, Cas8, and the like; Type II may be composed of Cas1, Cas2, Cas2/Cas4, Cas9, and the like; Type III may be composed of Cas5, Cas6, Cmr1, Cmr3, Cmr4, Cmr5, Cas5/Cmr1, Cam2, Cmr5, and the like; Type IV may be composed of Csf1, Csf2, Csf3, and the like; Type V may be composed of Cas1, Cas2, Cas1, Cas2, Cas4, Cpf1, Cpf2, and the like; Type VI may be composed of C2C2, Cas1, Cas2, etc., but is not limited thereto.

Among the types of the CRISPR enzyme, Type II Cas9 and Type V Cpf1 are generally used most.

In the CRISPR/Cas system of the present application, Cas9 may be used as the CRISPR enzyme.

The Cas9 is Streptococcus pyogenes , Streptococcus thermophilus , Streptococcus spp., Staphylococcus aureus , Nocardiopsis dassonville ( Nocardiopsis dassonville ) , Streptomyces pristinaespiralis , Streptomyces viridochromogenes , Streptomyces viridochromogenes , Streptomyces viridochromogenes , Streptosporangium roseum , Streptosporangium roseum , AlicyclobacHlus acidocaldarius , Bacillus pseudomycoides , Bacillus selenitireducense , Bacillus selenitireducens Exiguobacterium sibiricum , Lactobacillus delbrueckii , Lactobacillus salivarius , Microscilla marina , Burkholderiales bacterium , Burkholderiales bacterium Lenny Boran's (Polaromonas naphthalenivorans), Pseudomonas genus (Polaromonas spp.), Black COSPA Era watts soniyi (Crocosphaera watsonii), cyano tese in (Cyanothece spp.), micro-hour seutiseu Ah labor (Microcystis aeruginosa) rugi in a polar , Cinecocoker Synechococcus spp., Acetohalobium arabaticum , Ammonifex degensii , Caldiceluloforsiruptor bescii , Candidatus desulforudis , Candidatus desulforudis Clostridium botulinum , Clostridium difficile , Finegoldia magna , Natranaerobius thermophilus , Pelotomaculum , Pelotomaculum thermopropionicum ), Acidithiobacillus caldus , Acidithiobacillus ferrooxidans , Allochromatium vinosum , Marinobacter sp., Nitrophilus halo Scotland (Nitrosococcus halophilus), nitroso Caucus watt Sony (Nitrosococcus watsoni), pseudo Alteromonas halo flan large teeth (Pseudoalteromonas haloplanktis), keute also Novak Hotel racemic Pere (Ktedonobacter racemifer), to be meta furnace Away Avenue Frosty the Tomb ( Methanohalobium evestigatum ), Anabaena variabilis , Nodularia spumigena , Nostoc spp., Arthrospira maxima , Arthrospira maxima , Arthrospira platen Cis ( Arthrospira platensis ), Arthrospira spp., Lyngbya spp., Microcoleus chthonoplastes , Oscillatoria spp., Petrotoga mobilis , Thermosipho africanus or Acaryochloris marina , etc. It may be a microbial-derived Cas9.

In addition, the Cpf1 is Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacterium, Corynebacter, Carnobacterium, Rhodobacterium, Listtriceria, Paludidium, Francisaceae, Lepidella, Paludidium, Francis, , Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium or Cpf1 derived from Acidaminococcus.

The CRISPR enzyme may interact with a guide nucleic acid to form a complex, thereby performing a function of cleaving or modifying a target sequence of a target nucleic acid or gene. In this case, the function should include a protospacer adjacent motif (PAM) that is directly recognized by the CRISPR enzyme. That is, the base sequence of the PAM varies depending on the species of CRISPR enzyme. For example, in the case of the Cas9 protein derived from Streptococcus pyogenes , which is commonly used, 5'-NGG-3' becomes the PAM sequence. For example, the Cas9 protein derived from Staphylococcus aureus has 5'-NNGRRT-3' as the PMA sequence. As a result, when the target sequence of the target nucleic acid or gene is cut or modified, the base sequence of PAM is essentially changed according to the selection of the species of the CRISPR enzyme, thereby cutting the target sequence or modifying the position. Is determined.

The CRISPR/Cas system of the present application can be used to manipulate a target.

The manipulation may be any one or more selected from knock-out, knock-in, and knock-down.

For example, the manipulation may be knock-in.

For example, the manipulation may be a knockout.

The subject may be an organism containing a target nucleic acid or gene.

The organism may be a cell, tissue, plant, animal or human.

For example, the organism can be a mammal.

For example, the mammal may be a pig.

The cells may be prokaryotic cells or eukaryotic cells.

Therefore, the vaccine composition and manufacturing method targeting the prevention or/and treatment of pig necrotizing inflammation disclosed by the present application can be significantly superior to the existing pig necrotizing vaccine, and mutations in the cause of necrotizing growth in pigs It is expected that it will be able to respond quickly.

3. Necrotizing Vaccine Composition

In order to solve the problems of the present application described above, according to an aspect of the present application, there is provided a necrotizing vaccine composition.

In particular, according to an aspect of the present application, there is provided a pig necrotizing vaccine composition.

The porcine necrotizing infection vaccine composition comprises i) spores derived from bacteria; At this time, the bacteria-derived spores are spores having a sequence encoding an antigenic substance in genomic DNA, ii) a spore coat protein present on the surface of the bacterial spore, and iii) necrosis of a pig linked to the spore coat protein. Growth salt antigenic substances may be included.

The porcine necrotizing disease vaccine composition disclosed by the present application can quickly respond to mutations in pathogens.

Bacterial spores of the porcine necrotizing infection vaccine composition of the present application may be spores selected from B. subtilis, B. anthrasis, B. thuringiensis, and B. cereus .

For example, the bacterial spore of the porcine necrotizing infection vaccine composition of the present application may be a spore of B. subtilis .

The spore coat protein of the porcine necrotosis vaccine composition of the present application is CotA, CotB, CotC, CotD, CotE, CotF, CotG, CotN, CotS, CotT, CotV, CotW, CotX, CotY, CotZ, CotH, CotJA, CotJC, It may be a spore coat protein selected from CotK, CotL, and CotM.

For example, the spore coat protein of the porcine necrotitis vaccine composition of the present application may be a spore coat protein selected from CotB, CotC, and CotG.

The antigenic substance of the porcine necrotizing salt composition of the present application is alphatoxin (α-toxin) of Clostridium pufflingens type A bacteria; Or Clostridium pufflingens type B bacteria include alpha toxin (α-toxin) or beta toxin (β-toxin) or epsilon toxin (ε-toxin); Or alpha toxin (α-toxin) or beta toxin (β-toxin) of Clostridium pufflingens type C bacteria; Alternatively, the D-type bacteria of Clostridium pufflingens may be an antigenic substance selected from alpha toxin (α-toxin) and epsilon toxin (ε-toxin).

The antigenic material of the porcine necrotizing growth infection vaccine composition may include a Phospholipase C (hereinafter plc) domain sequence of C. perfringens .

For example, the plc domainin may include plc domain 1 or plc domain 2.

For example, the porcine necrotitis vaccine composition may contain some or all of the plc1 domain sequence.

For example, a porcine necrotitis vaccine composition may contain some or all of the plc2 domain sequence.

For example, the porcine necrotitis vaccine composition is SEQ ID NO. 4 May include some or all of the sequences.

For example, the porcine necrotitis vaccine composition is SEQ ID NO. 4 and may include sequences with 70, 75, 80, 85, 90, 95 or 100% homology.

The antigenic substance of the porcine necrotizing infection vaccine composition may be CPA.

For example, the antigenic substance of the porcine necrotizing vaccine composition may be CPA1 or/and CPA2.

For example, the antigenic substance of the porcine necrotizing infection vaccine composition of the present application may include CPA1 or CPA2 shown in FIG. 4.

For example, the antigenic substance of the porcine necrotitis vaccine composition of the present application is SEQ ID NO. 1 or/and SEQ ID NO. May contain 2.

The antigenic substance of the porcine necrotizing infection vaccine composition may include part or all of the CPA1 or/and CPA2 sequence.

For example, the antigenic substance of the porcine necrotitis vaccine composition of the present application is SEQ ID NO. 1 or/and SEQ ID NO. 2 may include some or all of the sequences.

The antigenic material of the porcine necrotizing infection vaccine composition may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology to the CPA1 or/and CPA2 sequence.

For example, the antigenic substance of the porcine necrotitis vaccine composition of the present application is SEQ ID NO. 1 or/and SEQ ID NO. It may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the 2 sequence.

The antigenic material of the pig's necrotizing infection vaccine composition may include a part or all of the sequence of plc domain 2.

For example, the antigenic material of the porcine necrotitis vaccine composition includes a sequence of 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100% homology with the sequence of plc domain 2 can do.

The antigenic substance of the porcine necrotizing infection vaccine composition may include a common sequence of CPA1 and CPA2.

For example, the antigenic substance of the porcine necrotizing infection vaccine composition may include some or all of the common sequences of CPA1 and CPA2.

For example, the antigenic substance of the porcine necrotitis vaccine composition is SEQ ID NO. 1 and SEQ ID NO. It may include some or all of the consensus sequence of 2.

For example, the antigenic substance of the porcine necrotitis vaccine composition is SEQ ID NO. It may include some or all of the sequence of 3.

The antigenic substance of the porcine necrotizing infection vaccine composition may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the consensus sequence of CPA1 and CPA2.

For example, the antigenic substance of the porcine necrotitis vaccine composition is SEQ ID NO. 1 and SEQ ID NO. It may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the consensus sequence of 2.

For example, the antigenic substance of the porcine necrotitis vaccine composition is SEQ ID NO. 3 may include sequences with 70, 75, 80, 85, 90, 95 or 100% homology.

The concentration of the antigenic substance in the composition may be about 10 ¹⁰ to 10 ²⁰ /ml.

For example, the concentration of the antigenic substance in the porcine necrotizing disease vaccine composition of the present application may be about 10 ¹⁰ to 10 ¹⁵ /ml.

The pig's necrotizing infection vaccine composition of the present application may include bacterial spores, one spore coat protein, and one antigenic substance.

The porcine necrotizing disease vaccine composition of the present application may include bacterial spores, one spore coat protein, and two or more antigenic substances.

The porcine necrotizing infection vaccine composition of the present application may include bacterial spores, two or more spore coat proteins, and one antigenic substance.

The porcine necrotizing infection vaccine composition of the present application may include bacterial spores, two or more spore coat proteins, and two or more antigenic substances.

For example, the porcine necrotizing infection vaccine composition of the present application may include at least one coat protein selected from bacterial spores, Cot B, Cot C, and Cot G, and at least one antigenic substance selected from CPA1 or CPA2.

For example, the pig's necrotizing growth infection vaccine composition of the present application includes at least one coat protein selected from bacterial spores, Cot B, Cot C and Cot G, SEQ ID NO. 1 or SEQ ID NO. It may contain one or more antigenic substances selected from among the two.

For example, the pig's necrotizing growth infection vaccine composition of the present application includes at least one coat protein selected from bacterial spores, Cot B, Cot C, and Cot G, SEQ ID NO. It may include an antigenic substance including part or all of the sequence of 3.

The porcine necrotizing disease vaccine composition may further include a linker connecting the spore coat protein and the antigenic substance.

For example, the pig's necrotizing infection vaccine composition of the present application may include at least one coat protein selected from bacterial spores, Cot B, Cot C, and Cot G, at least one antigenic substance selected from CPA1 or CPA2, and a linker. have.

For example, the pig's necrotizing growth infection vaccine composition of the present application includes at least one coat protein selected from bacterial spores, Cot B, Cot C and Cot G, SEQ ID NO. 1 or SEQ ID NO. It may include at least one antigenic substance selected from among 2 and a linker.

For example, the pig's necrotizing growth infection vaccine composition of the present application includes at least one coat protein selected from bacterial spores, Cot B, Cot C and Cot G, SEQ ID NO. It may include an antigenic substance including a part or all of the sequence of 3, a linker.

The linker may be an enzyme, a cleavage enzyme, a polypeptide, a protein, a nucleotide sequence, or an artificial nucleotide sequence that forms an artificial chemical bond, but is not limited thereto as long as it has a function capable of linking the spore coat protein and an antigenic substance. .

The pig's necrotizing vaccine composition is a stabilizer, emulsifier, aluminum hydroxide, aluminum phosphate, pH adjuster, surfactant, liposome, iscom adjuvant, synthetic glycopeptide, extender, carboxypolymethylene, bacterial cell wall, derivative of bacterial cell wall , Bacterial vaccine, animal poxvirus protein, subviral particle adjuvant, Clostridium perfringens toxin, N, N-dioctadecyl-N',N'-bis(2-hydroxyethyl)-propanediamine , Monophosphoryl lipid A, dimethyldioctadecyl-ammonium bromide, and any one or more second aids selected from the group consisting of a mixture thereof may be further included.

In addition, the pig's necrotizing vaccine composition includes medically acceptable carriers, diluents, binders, disintegrants, lubricants, pH adjusters, antioxidants, solubilizers, adjuvants, stabilizers, preservatives, antibacterial agents, antifungal agents, adsorption delaying agents, etc. It may further include an additive.

The carrier is defined as a compound that facilitates the addition of the compound into cells or tissues. For example, dimethyl sulfoxide (DMSO) can be used.

The diluent (buffer solution) is, for example, sugar, starch, microcrystalline cellulose, lactose (lactose hydrate), glucose, di-mannitol, alginate, alkaline earth metal salt, clay, polyethylene glycol, anhydrous calcium hydrogen phosphate, or Mixtures thereof and the like can be used; Binders are starch, microcrystalline cellulose, highly dispersible silica, mannitol, di-mannitol, sucrose, lactose hydrate, polyethylene glycol, polyvinylpyrrolidone (povidone), polyvinylpyrrolidone copolymer (copovidone), hypromellose , Hydroxypropyl cellulose, natural gum, synthetic gum, copovidone, gelatin, or a mixture thereof.

The disintegrant is, for example, starch or modified starch such as sodium starch glycolate, corn starch, potato starch or pregelatinized starch; Clay such as bentonite, montmorillonite, or veegum; Celluloses such as microcrystalline cellulose, hydroxypropyl cellulose, or carboxymethyl cellulose; Algins such as sodium alginate or alginic acid; Cross-linked celluloses such as croscarmellose sodium; Gums such as guar gum and xanthan gum; Crosslinked polymers such as crosslinked polyvinylpyrrolidone (crospovidone); Effervescent agents, such as sodium bicarbonate and citric acid, or mixtures thereof may be used.

The lubricants are, for example, talc, stearic acid, magnesium stearate, calcium stearate, sodium lauryl sulfate, hydrogenated vegetable oil, sodium benzoate, sodium stearyl fumarate, glyceryl behenate, glyceryl monorate, glyceryl monostea Rate, glyceryl palmitostearate, colloidal silicon dioxide, or mixtures thereof.

The pH adjusting agent, for example, acidifying agents such as acetic acid, adipic acid, ascorbic acid, sodium ascorbate, sodium etherate, malic acid, succinic acid, tartaric acid, fumaric acid, citric acid (citric acid), precipitated calcium carbonate, aqueous ammonia, A basifying agent such as meglumine, sodium carbonate, magnesium oxide, magnesium carbonate, sodium citrate, tribasic calcium phosphate, and the like can be used.

The antioxidant may be, for example, dibutyl hydroxy toluene, butylated hydroxyanisole, tocopherol acetate, tocopherol, propyl gallate, sodium hydrogen sulfite, sodium pyrosulfite, or the like.

The solubility aid may be, for example, polyoxyethylene sorbitan fatty acid esters such as sodium lauryl sulfate and polysorbate, sodium docusate, poloxamer, and the like.

In addition, an enteric polymer, a water-insoluble polymer, a hydrophobic compound, and a hydrophilic polymer may be included to make a delayed-release preparation.

The enteric polymer is, for example, hypromellose acetate succinate, hypromellose phthalate (hydroxypropylmethylcellulose phthalate), hydroxymethylethyl cellulose phthalate, cellulose acetate phthalate, cellulose acetate succinate, cellulose acetate malate. , Cellulose benzoate phthalate, cellulose propionate phthalate, methyl cellulose phthalate, carboxymethyl ethyl cellulose, ethyl hydroxyethyl cellulose phthalate, and enteric cellulose derivatives such as methyl hydroxyethyl cellulose; Styrene-acrylate ulose, acrylate methyl-acrylate ulose, acrylate methyl methacrylate (e.g., acrylic-ise), butyl acrylate-styrene-acrylate ulose, and methyl acrylate-methacrylic acid-acrylate octyulose The enteric acrylic acid-based ulose, such as; Poly(methyl methacrylate methacrylate) ulose (e.g. Eudragit L, Eudragit S, Evoselgermant, Carr (ethyl methacrylate) ulose (e.g. Eudragit L100-55) ), such as enteric carmethacrylate ulose; vinyl acetate-maleateyl cellulose cellulose, styrene-maleate cellulose cellulose, styrene-maleic acid monoester ulose, vinyl methyl ether-maleate cellulose cellulose, Enteric properties such as ethylene-maleate cellulose cellulose, vinyl butyl ether-maleate cellulose cellulose, acrylonitrile-methyl acrylate, maleate cellulose cellulose, and butyl acrylate-styrene-maleate cellulose cellulose And enteric polyvinyl derivatives such as ronitrile alcohol phthalate, ronitrile acetal phthalate, polyvinyl butyrate phthalate and polyvinyl acetacetal phthalate.

The water-insoluble polymer refers to a pharmaceutically acceptable water-insoluble polymer that controls drug release. For example, the water-insoluble polymer is polyvinyl acetate (e.g., colicoat SR30D), a water-insoluble polymethacrylate copolymer (e.g., poly(ethylacrylate-methyl methacrylate) copolymer (e.g. Eudragit NE30D) , Poly(ethylacrylate-methyl methacrylate-trimethylaminoethylmethacrylate) copolymer (eg Eudragit RSPO), etc.], ethylcellulose, cellulose ester, cellulose ether, cellulose acylate, cellulose diacylate, Cellulose triacylate, cellulose acetate, cellulose diacetate, and cellulose triacetate.

The hydrophobic compounds include, for example, fatty acids and fatty acid esters such as glyceryl palmitostearate, glyceryl stearate, glyceryl bihenate, cetyl palmitate, glyceryl monooleate and srearic acid; Fatty acid alcohols such as cetostearyl alcohol, cetyl alcohol and stearyl alcohol; Waxes such as carnauba wax, beeswax, and microcrystalline wax; And inorganic substances such as talc, precipitated calcium carbonate, calcium monohydrogen phosphate, zinc oxide, titanium oxide, kaolin, bentonite, montmorillonite and veggies.

The hydrophilic polymer is, for example, dextrin, polydextrin, dextran, pectin and pectin derivatives, alginate, polygalacturonic acid, xylan, arabinoxylan, arabinogalactan, starch, hydroxypropyl starch, amylose, And sugars such as amylopectin; Cellulose derivatives such as hypromellose, hydroxypropylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, methylcellulose, and sodium carboxymethylcellulose; Gums such as guar gum, locust bean gum, tragacanta, carrageenan, acacia gum, gum arabic, gellan gum, and xanthan gum; Proteins such as gelatin, casein, and zein; Polyvinyl derivatives such as polyvinyl alcohol, polyvinyl pyrrolidone, and polyvinyl acetaldiethylaminoacetate; Poly(butyl methacrylate-(2-dimethylaminoethyl)methacrylate-methylmethacrylate) copolymer (e.g. Eudragit E100, Evonik, Germany), poly(ethyl acrylate-methyl methacrylate- Hydrophilic polymethacrylate copolymers such as triethylaminoethyl-methacrylate chloride) copolymers (eg Eudragit RL, RS, Evonik, Germany); Polyethylene glycol, and polyethylene derivatives such as polyethylene oxide; Carbomer, etc.

In addition, the formulation of the present application may be formulated by using pharmaceutically acceptable additives as various additives selected from colorants and fragrances.

In the present application, the range of the additive is not limited to the use of the additive, and the additive may be formulated to contain a dosage in the usual range by selection.

In addition, the pig's necrotizing vaccine composition may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and sterile injectable solutions, respectively, according to conventional methods. . In the case of formulation, it can be prepared using diluents or excipients such as generally used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient such as starch, calcium carbonate, sucrose or lactose in the lecithin-like emulsifier. , Gelatin, etc. can be mixed to prepare. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. As liquid preparations for oral administration, suspensions, solvents, emulsions, syrups, etc. can be used. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweetening agents, fragrances, preservatives, etc. Can be included. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous agents, suspensions, emulsions, and freeze-dried formulations. As the non-aqueous preparation and suspension, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used, but are not limited thereto.

For oral dosage forms, the location of release may be the stomach, small intestine (duodenum, jejunum, ileum) or large intestine. One of ordinary skill in the art can use formulations that do not dissolve in the stomach, but release the substance to the duodenum or elsewhere in the intestine, for example by using an enteric coating. Examples of more common inert ingredients used as enteric coatings include cellulose acetate trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP), HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PVAP), and Eudragit. ) L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L, Eudragit S and Shellac. These coatings can be used as mixed films.

In addition, coatings or mixtures of coatings can be used on tablets that are not intended for protection against the stomach. This may include a sugar coating or a coating that makes the tablet easier to swallow. The capsule may be made of a hard shell (eg, gelatin) for transporting the dried therapeutic agent (ie, powder), or a soft gelatin shell may be used in the case of a liquid form. The shell material of the capsule can be thick starch or other edible paper. For tablets, lozenges, molded tablets or polished tablets, a moisture massing technique can be used. The formulation of substances for capsule administration may also be in the form of powders, lightly compressed plugs or even tablets. The therapeutic agent can be prepared by compression.

4. Necrotizing growth infection vaccine manufacturing method

In order to solve the problems of the present application described above, according to an aspect of the present application, a method for preparing a necrotizing growth infection vaccine is provided.

In particular, according to an aspect of the present application, there is provided a method for producing a vaccine for necrotizing swine.

For example, the method for preparing a pig's necrotizing growth infection vaccine of the present application includes: i) knock-in of an antigenic substance using CRISPR/Cas9 in bacterial genomic DNA; ii) forming spores of the bacteria; And iii) expressing an antigenic substance on the spore surface of the bacteria.

The method for preparing the pig's necrotizing infection vaccine may include inserting a foreign material as a donor into the bacterial genomic DNA.

The "donor" refers to an exogenous nucleotide capable of expressing a specific peptide or protein, and may be inserted into genomic DNA using, for example, an HDR mechanism. In this case, the donor may include a specific nucleic acid encoding a specific peptide or protein.

The donor may be a double-stranded nucleic acid or a single-stranded nucleic acid.

The donor may be linear or circular.

The donor may include a nucleic acid sequence having homology to a target gene or nucleic acid.

The donor may be a nucleic acid encoding an antigenic substance.

For example, the donor may be a nucleic acid encoding a porcine necrotizing antigenic substance. For example, alpha toxin (α-toxin) of type A bacteria of Clostridium pufflingens; Or Clostridium pufflingens type B bacteria include alpha toxin (α-toxin) or beta toxin (β-toxin) or epsilon toxin (ε-toxin); Or alpha toxin (α-toxin) or beta toxin (β-toxin) of Clostridium pufflingens type C bacteria; Alternatively, the D-type bacteria of Clostridium pufflingens may be a nucleic acid encoding any one or more selected from alpha toxin (α-toxin) and epsilon toxin (ε-toxin). As another example, the donor may be a nucleic acid encoding CPA1 or/and CPA2, which is an antigenic substance of porcine necrotizing inflammation.

In the method for preparing the porcine necrotizing infection vaccine of the present application, a modification may be applied to bacterial genomic DNA using CRISPR/Cas9 in one specific example.

The modification to the bacterial genomic DNA using the CRISPR/Cas9 may be one or more selected from knock-in, knock-out, and knock-down.

For example, CRISPR/Cas9 can be used to target specific regions of bacterial genomic DNA to knock-in foreign antigenic substances.

For example, CRISPR/Cas9 can be used to knock out specific genes of bacterial genomic DNA.

For example, CRISPR/Cas9 can be used to knock down specific genes in bacterial genomic DNA.

Hereinafter, a description will focus on a process of inserting (knock-in) a nucleic acid encoding a porcine necrotizing antigenic substance by targeting a specific region of the bacterial genomic DNA using CRISPR/Cas9.

To this end, in order to knock-in the antigenic substance of necrotizing growth salt of pigs, the target site sequence in the bacterial genomic DNA or the nucleotide sequence of the target gene is determined. In this case, the target sequence may be a CRISPR enzyme, that is, a base sequence located at a position close to a PAM sequence that can be recognized by Cas9 or Cpf1. The target sequence may have complementarity to or identical to the guide RNA.

For example, the target sequence data is collected using a known database (eg, NCBI), and the PAM sequence (eg, 5′-NGG-3), which is a site recognized by CRISPR/Cas9, is Guide RNA can be designed considering').

When the pig's necrotizing antigenic substance is 2 or more, the guide RNA may be 1 or more.

When the pig's necrotizing antigenic substance is 2 or more, each of the guide RNAs 2 or more may knock-in the antigenic substance into a specific region of the bacterial genomic DNA.

For example, if the pig's necrotizing virus vaccine contains a first antigenic substance and a second antigenic substance, the first antigenic substance and the second antigenic substance were used as the first CRISPR/Cas9 to By targeting a specific region of Mick DNA, antigenic substances can be knocked in.

For example, if the pig's necrotizing virus vaccine contains a first antigenic substance and a second antigenic substance, the first antigenic substance is the first CRISPR/Cas9, and the second antigenic substance is the second CRISPR/ Cas9 can be used to target a specific region of the bacterial genomic DNA to knock-in antigenic substances.

The Cas9 protein of CRISPR/Cas9 can be used from Streptococcus spp. For example, Streptococcus pyogenes Cas9 (spCas9) may be used, but is not limited thereto. In this case, the PAM sequence may be 5'-NGG-3' (N is A, T, G, or C).

Target genes or nucleic acids can be cleaved using CRISPR/Cas9. The cleaved target nucleic acid site may include modifications on the bacterial genomic DNA through NHEJ or HDR mechanisms.

Since CRISPR/Cas9 used as a specific example in the present application is a prokaryotic-derived system, it has the advantage of having high efficiency in modifying the genomic DNA of bacteria.

In particular, compared to eukaryotic cells, the HDR mechanism works better in bacteria, allowing the insertion of specific nucleic acids onto the bacterial genomic DNA with very high efficiency.

When an antigenic substance is inserted into the bacterial genomic DNA (transformation), it uses the bacterial genomic DNA's own expression system, so that the antigenic substance can be continuously expressed, so that it is transformed every time a vaccine is prepared. There is an advantage of being able to omit the process that needs to be performed.

In certain embodiments, alphatoxin of type A bacteria of Clostridium pufflingens (α-toxin); Or Clostridium pufflingens type B bacteria include alpha toxin (α-toxin) or beta toxin (β-toxin) or epsilon toxin (ε-toxin); Or alpha toxin (α-toxin) or beta toxin (β-toxin) of Clostridium pufflingens type C bacteria; Alternatively, Clostridium pufflingens D-type bacteria contain at least one porcine necrotic antigenic substance selected from alphatoxin (α-toxin) and epsilontoxin (ε-toxin) on genomic DNA in Bacillus with high efficiency. Inserted.

In an arbitrary example, at least one porcine necrotizing antigenic substance selected from CPA1 or/and CPA2 was inserted onto genomic DNA in Bacillus with high efficiency.

In any embodiment, SEQ ID NO. At least one porcine necrotizing antigenic substance selected from 1 or 2 was inserted onto the genomic DNA in Bacillus with high efficiency.

In any embodiment, SEQ ID NO. At least one part or all of the porcine necrotizing antigenic substances selected from 1 or 2 were inserted onto the genomic DNA in Bacillus with high efficiency.

In any embodiment, SEQ ID NO. Sequences with 70, 75, 80, 85, 90, 95 or 100% homology with 1 or 2 were inserted onto genomic DNA in Bacillus with high efficiency.

In an arbitrary example, a part of the consensus sequence of CPA1 and CPA2 or all of the porcine necrotizing antigenic substances were inserted onto the genomic DNA in Bacillus with high efficiency.

In any embodiment, SEQ ID NO. Part of or all of the consensus sequences 1 and 2 were inserted onto genomic DNA in Bacillus with high efficiency.

In any embodiment, SEQ ID NO. Part 3 or all of the porcine necrotizing antigenic substances were inserted onto the genomic DNA in Bacillus with high efficiency.

In an arbitrary example, a part or all of the sequence of plc domain 2 was inserted on the genomic DNA in Bacillus as a porcine necrotizing antigenic substance.

In any embodiment, the antigenic substance of porcine necrotitis is SEQ ID NO. Part or all of 4 was inserted onto genomic DNA in Bacillus with high efficiency.

In an arbitrary example, a sequence of 70, 75, 80, 85, 90, 95 or 100% homology to the sequence of plc domain 2 as a porcine necrotizing antigenic material was inserted onto genomic DNA in Bacillus with high efficiency. Made it.

In any embodiment, the antigenic substance of porcine necrotitis is SEQ ID NO. Sequences having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 4 were inserted onto genomic DNA in Bacillus with high efficiency.

In one embodiment of the present application, CPA1 or/and CPA2, which is a porcine necrotizing antigenic substance, was inserted onto genomic DNA in Bacillus with high efficiency.

On the other hand, in addition to the method of knock-in using CRISPR/Cas9, any technology capable of knock-in such as a method of using ZFN (Zinc-finger nucleases) and TALEN (transcription activator-like effector nucleases) is not limited thereto.

A vector can be used when performing the knock-in.

A vector can be prepared and transformed to knock-in bacteria using guide RNA, Cas9 and antigenic substances. The CRISPR/Cas9 vector and the antigenic substance vector may contain Cas9, a guide RNA and an antigenic substance in one vector, or may independently contain Cas9, a guide RNA and an antigenic substance in the same or different vector. .

The vector may be a viral vector or a non-viral vector.

The viral vector may be a viral vector such as retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), vaccinia virus, poxvirus, etc., but is not limited thereto.

The nonviral vector may be a plasmid or naked DNA, but is not limited thereto.

In addition, in addition to the method using the vector, an electroporation method, a gene gun, a magnetic injection method, an ultrasonic method, etc. may be used, but the present invention is not limited thereto.

After inserting a donor encoding a porcine necrotizing antigenic substance into the bacterial genomic DNA, a step of forming spores from the bacteria in order to use a spore display system is performed.

The step of ii) forming spores of the bacteria may include nutrient-depleted nutritional conditions, high or low temperature temperature conditions, high or low moisture moisture conditions, chemical conditions such as disinfectants and preservatives, acidic or alkaline Spores may be formed using pH conditions, etc., but are not limited thereto.

For example, the step of forming spores of bacteria when preparing the pig's necrotizing growth infection vaccine of the present application may consist of any one or more selected from nutrient-depleted nutritional conditions, high temperature or low temperature temperature conditions. .

Next, in the spores of the formed bacteria, a step of expressing an antigenic substance on the spore surface is performed (step iii).

The antigenic substance may be expressed by a) direct linkage with the spore coat protein expressed on the spore surface of bacteria, or b) indirectly linking to the expression.

The a) direct expression refers to a form in which a spore coat protein present on the spore surface of a bacteria and an antigenic substance are directly linked without a mediator (eg, a linker).

The b) indirect expression refers to a form in which the spore coat protein present on the spore surface of bacteria is indirectly linked by a linker that connects the antigenic substance.

In one embodiment of the present application, a spore coat protein and a porcine necrotizing antigenic substance may be expressed by linking with a linker.

The method of preparing the pig's necrotizing infection vaccine may optionally further include a curing step.

The curing step may be to obtain only the desired material or remove the unwanted material from the composition of the pig necrotizing infection vaccine.

For example, the curing step may be to remove a substance causing antibiotic resistance.

For example, the curing step may be to remove the foreign plasmid added during the vaccine manufacturing process.

The curing step may be performed in two or more passages, but is not limited thereto if it is a conventional curing method.

The method of preparing the porcine necrotizing infection vaccine may further include the step of adding an additional substance.

In this case, the additional substances are to include all additives that are usually pharmaceutically acceptable during vaccine production.

The pig's necrotizing disease vaccine is delivered intramuscular, intranasal, oral, intraperitoneal, subcutaneous, topical, intradermal and transdermal It is formulated for use.

The route of administration of the vaccine is selected from intramuscular, intranasal, oral, intraperitoneal, subcutaneous, topical, intradermal and transdermal delivery.

5. Treatment of necrotizing growth

In order to solve the problems of the present application described above, according to an aspect of the present application, a method for treating necrotizing growthitis is provided.

In particular, according to an aspect of the present application, there is provided a method for treating necrotizing growth in pigs.

The method for treating necrotizing growth in pigs is provided with a method of treating necrotizing growth in pigs by administering a composition comprising the composition as an active ingredient.

In the present application, the term "administration" means introducing the pharmaceutical composition of the present application to a mammal by any suitable method, and the route of administration of the pharmaceutical composition of the present application is administered through any general route as long as it can reach the target tissue. Can be. Oral administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, endothelial administration, intranasal administration, pulmonary administration, rectal administration, intranasal administration, intraperitoneal administration, intrathecal administration, but not limited thereto. In addition, the mammal may include pigs, cattle, sheep, goats, etc., but is not limited thereto.

In addition, a method of administering a composition containing the composition as an active ingredient may be administered as the following example, but is not limited thereto.

For example, when administering a composition comprising the composition as an active ingredient, the dosage for pigs may vary depending on the age, weight, sex, dosage form, health condition and degree of disease of the pig, and according to the judgment of a veterinarian or farmer. It may be administered in divided doses from once to several times a day at regular intervals.

The dose of the pig's necrotizing infection vaccine is preferably 1 µg to 100 µg of the derivative per animal, and this dose may partially vary depending on the size of the animal. For pigs, for example, a very suitable dosage is between 20 μg and 80 μg. For pigs, for example, a very suitable dosage is between 10 μg and 100 μg.

The method of administering the pig's necrotizing vaccine is intramuscular, intranasal, oral, intraperitoneal, subcutaneous, topical, intradermal. It can be administered by methods such as (intradermal) administration or transdermal administration, but any conventional administration method may be used.

For example, the pig's necrotizing infection vaccine of the present application may be administered intramuscularly.

For example, the pig's necrotizing infection vaccine of the present application may use an intranasal administration method.

For example, the pig's necrotizing infection vaccine of the present application may use an oral administration method.

For example, the pig's necrotizing infection vaccine of the present application may use an intraperitoneal administration method.

For example, the pig's necrotizing infection vaccine of the present application may use a subcutaneous administration method.

For example, the pig's necrotizing infection vaccine of the present application may use a topical administration method.

For example, the pig's necrotizing infection vaccine of the present application may use an intradermal administration method.

For example, the pig's necrotizing infection vaccine of the present application may use a transdermal administration method.

When a pig's necrotizing growth infection vaccine composition comprising the composition disclosed by the present application as an active ingredient is administered to a mammal, the concentration may be administered at a concentration of 1 mg/kg to 100 mg/kg.

The present application may provide a method of treating a pig's necrotizing growthitis by administering a composition comprising the composition as an active ingredient to a mammal.

For example, the present application may provide a method for treating a pig's necrotizing inflammatory disease by administering a composition comprising the composition as an active ingredient to a pig.

For example, if a composition containing the composition as an active ingredient is administered to a pig from 1 mg/kg to 100 mg/kg, a method of treating necrotizing inflammatory disease in pigs can be provided.

Therefore, if the composition disclosed by the present application is used to treat a pig's necrotizing growth infection, even if a pathogen mutation occurs, not only can it respond quickly, but it may be more effective than the existing pig's necrotizing growth infection vaccine.

[Forms for enforcement of application]

Hereinafter, the present application will be described in more detail through examples.

The following examples of the present application relate to the preparation of antigens, antibodies, and vaccines for a porcine necrotizing disease vaccine, but these examples are for illustrative purposes only, and the scope of the present application is not limited by these examples. This will be apparent to those of ordinary skill in the art to which this application belongs.

Example 1: Bacillus experimental species and vector production

i) Bacillus test species

Bacillus species used in the experiment was Bacillus subtilis 168, which was pre-sold at the Bacillus Genetic Stock Center and cultured at 37°C using Luria-Bertani (LB) broth and LB plate medium. The pre-sold cell stock was first screened (18hs) in LB solid medium, and a second liquid culture (18hs) was performed by securing one colony.

ii) B. subtilis Spore formation

A B. subtilis _{sporulation salt (1 M CaCl 2 1ml} / L, 0.1 M MnCl 2 1 ml / L, 0.01 M FeSO 4 1 ml / L) of NB medium (nutrient broth 8 g / L, MgSO 4 contain - 0.25 g/L, KCl-1 g/L) was used for shaking culture (48 h) at 37° C., centrifugation at 8,000 rpm 15 min, and harvesting.

It was concentrated and resuspended at 60% using cold water (D.W.) and reacted at 4° C. overnight (18 h). After that, heat inactivation is performed at 80°C for 30 minutes. After centrifugation at 8,000 rpm 15 min, resuspended in 1 X PBS after harvesting, the resulting spores were stored and used at 4°C.

iii) Vector production

(a) pHCas9 expression vector (Fig. 1)

As a pHCas9 vector for the expression of S. pyogenes Cas9 (SpCas9) protein in B. subtilis , the pHCas9 expression vector was distributed and used by Korea Research Institute of Bioscience and Biotechnology.

(b) epitope vector

A vector containing the guide RNA of B. subtilis coat protein (CotG), the CotG CDS containing the promoter, and the donor DNA, which is a gene complex containing the epitope, was constructed.

Using the guide RNA production program CCTOP (https://crispr.cos.uni-heidelberg.de) in the B. subtilis genome, guide RNA (SEQ ID NO. 3: TACGTTCATCCTTAACATATTTTTAAAAGGA) of the CotG region was produced, and restriction enzyme Nco I And EcoR V were introduced into the pHY300PLK vector and named pJB (Fig. 2).

At this time, a vector containing GFP and Clostridium perfringens toxin A (CPA) as epitopes were prepared.

● pJB-GFP (Figure 3)

In order to check whether the target epitope is located on the surface of B. subtilis spores, an expression vector containing a green fluorescent protein (eGFP) was constructed. The GFP gene was amplified through PCR by making a primer from the MDH1-PGK-GFP_2.0 vector (SEQ ID NOs. 4 and 5 in Table 1), and restriction enzyme Pst I at the 5'end and BamH I at the 3'end. Was produced. As for the amplified GFP DNA, pJB-GFP was prepared by removing and introducing the CPA1 site from the pJB009 vector using restriction enzymes Pst I and BamH I.

● pJB-CPA (pJB009 to pJB010) (Figs. 5 to 6)

To raise the epitope on the surface of B. subtilis spores, coat protein (enzyme site in B. subtilis gDNA) using CotG-Full_F and CotG-Full_R primers (Table 1; SEQ ID NO. 6, 7; bold in the sequence). CotG) promoter and CDS portion were amplified, and restriction enzyme Pst I including a restriction enzyme Hind III at the 5'end and a 15 bp linker at the 3'end was prepared. In addition, the antigen-determining site of porcine necrotizing enteritis ( Clostridium perfringens toxin A, CPA) was confirmed to be an antigen candidate region of two sites of Toxin A in Clostridium perfringens (FIG. 4). Clostridium perfringens toxin A genes were obtained using CPA_F and CPA2_F containing restriction enzymes Pst I and CPA1_R and CPA2_R containing BamH I. (Table 1; SEQ ID NO. 8 to 11; bold in the sequence is an enzyme site)

The obtained coat protein porcine necrotizing antigen candidate genes were digested with Pst I restriction enzyme and donor DNA was prepared using T4 Ligase. The prepared donor DNA was introduced into the pJB vector using the restriction enzymes Hind III and BamH I, and pJB009 into which the CPA1 region was inserted and pJB010 into which the CPA2 region was inserted were prepared and named.

No. Name Sequence (5'→ 3') SEQ ID NO. 4 GFP_F ATAAAGCTTATGGTGAGCAAG SEQ ID NO. 5 GFP_R TATGGATCCTTACTTGTACAG SEQ ID NO. 6 CotG-Full_F ATA AAGCTT AGTGTCCCTAGCTCCG SEQ ID NO. 7 CotG-Full_R TAT CTGCAG TGAACCCCCACCTCCTTTGTATTTCTTTTTG SEQ ID NO. 8 CPA1_F TCA CTGCAG AATGATCCATCAGTTG SEQ ID NO. 9 CPA1_R GTCGACTCTAGA GGATCC TTATTTTATATTATAAG SEQ ID NO. 10 CPA2_F TCA CTGCAG TATGCAGCAAAGGTAA SEQ ID NO. 11 CPA2_R GTCGACTCTAGA GGATCC GTTTTCTGGCTTATAAG

(c) antibiotic-deficient vector (pJB-sg02 to pJB-sg03) (Figs. 7 to 8)

For the deletion of the antibiotic resistance gene, a guide RNA (SEQ ID NO. 12: CGATACGTGCTCCGGTTCCCAACGATCAAGGA) for the purpose of the ampicillin resistance gene and a guide RNA (SEQ ID NO. 13: GACGAGT TATTAATAGCTGAATAAGAACGGT) for the neomycin resistance gene were prepared. The enzymes NcoI and EcoRV were used to introduce the pJB vector, and pJB-sg02 (amp deletion) and pJB-sg03 (neo deletion) vectors were constructed using the donor DNA in which the central nucleotide sequence of the antibiotic resistance gene was deleted.

Example 2: Preparation of Bacillus soluble cells ( B. subtilis Production of Competent Cell)

In order to introduce foreign substances (plasmid, phage DNA, etc.) into B. subtilis cells, it was performed as follows.

For the production of B. subtilis soluble cells, one B. subtilis colony was first cultured (18 hs) in a shaking incubator at 37°C using Growth medium (LB broth + 0.5M sorbitol), and then diluted 1/16 in the growth medium. Second culture was performed until 0.85-0.95 at .D600.

Cool the culture solution by reacting on ice for 10 minutes, centrifugation at 4 °C, 5000 X g for 5 minutes to discard the supernatant, and ice-cold Wash buffer (0.5 M sorbitol, 0.5 M mannitol, 10%) glycerol) repeatedly washed 4 times. Water-soluble cells were prepared by diluting electroporation solution (0.5 M sorbitol, 0.5 M mannitol, 10% glycerol) to 1-1.3 * 10 ¹⁰ cfu/mL, and then aliquoted into 60 μl and stored at -80 °C.

Example 3: B. subtilis Generating transformants

In order to transform the vector prepared in Example 1 into each of the B. subtilis soluble cells prepared in Example 2 (Competent cell), it was carried out as follows.

Transformation of B. subtilis was performed by the Electroporation method (Xue. et al. 1999) using the Gene Pulser System (BIO-RAD. USA). To the prepared B. subtilis soluble cells (60 μl), 5 μl (200 ng/μl) of the transgenic expression vector was added and mixed, reacted on ice for 3 minutes, and then put in an electroporation cuvette (0.1 cm gap). voltage; 2,100 V, time constant; 5 ms, No. of pulses; Under 1 condition, electric shock is applied to induce the transduction expression vector to be introduced into the cell. Then, incubate at 37°C for 3 hours to induce recovery of the transformed cells, spread on an antibiotic selective medium, and incubate at 37°C.

(a) B. subtilis transformant into which pHCas9 vector was introduced

The B. subtilis transformant into which the pHCas9 vector was introduced was cultured by adding Neomycin (10 μg/mL).

(b) B. subtilis transformant introduced with pJB-GFP vector

B. subtilis transformants into which the pJB-GFP vector was introduced were cultured in LB solid medium supplemented with Ampicillin (100 μg/mL) and Neomycin (10 μg/mL).

(c) B. subtilis transformants into which the pJB-CPA (pJB009 to pJB010) vector was introduced

B. subtilis transformants into which pJB009 to pJB010 vectors were introduced were cultured in LB solid medium to which Ampicillin (100 μg/mL) and Neomycin (10 μg/mL) were added.

(d) B. subtilis transformants introduced with antibiotic-deficient vectors (pJB-sg02 to pJB-sg03)

For the deletion of the antibiotic resistance gene, the B. subtilis transformants into which the pJB-sg02 or pJB-sg03 vector was introduced were first cultured in LB solid medium without antibiotics, and then each colony was transferred to the antibiotic medium. Colony that did not grow was selected.

Example 4: B. subtilis Confirmation of vector introduction in transformants

In order to confirm whether the GFP expression vector was introduced into the spores of B. subtilis and GFP was expressed on the surface of the spores, PCR analysis and flow cytometry were performed.

● PCR analysis

The colony of transformant B. subtilis was cultured in LB broth to isolate gDNA. Primer was prepared (SEQ ID NO. 14, 15 in Table 2; In-GFP_F, In-GFP_R) and PCR was performed to confirm the presence of a transgene in the transformant and wild-type DNA.

No. Name Sequence (5'→ 3') SEQ ID NO. 14 In-GFP_F ATCATGGCCGACAAGCAGAA SEQ ID NO. 15 In-GFP_R TCTCGTTGGGGTCTTTGCTC SEQ ID NO. 16 16S-F TCGCGGTTTCGCTGCCCTTT SEQ ID NO. 17 16S-R AAGTCCCGCAACGAGCGCAA SEQ ID NO. 18 In-CPA1_F GTGGTGAAAAAGATGCTGGAACA SEQ ID NO. 19 In-CPA1_R TCCTTGTCAACTACAACTTTTCCA SEQ ID NO. 20 In-CPA2_F ACTCTCAAAAAGGAACAGCAGGA SEQ ID NO. 21 In-CPA2_R AGTGTCTTTGCTTCCAGCCA

The result of PCR performed to confirm the expression of GFP on the surface of B. subtilis spores by introducing a GFP expression vector into the genome of B. subtilis cells is shown in FIG. 9.

As the band of GFP was confirmed in FIG. 9, it could be seen that GFP was expressed on the surface of the spores of B. subtilis cells.

● Flow cytometry (FACS)

To verify the surface expression of the introduced gene protein in the transformant of B. subtilis , it was confirmed by performing flow cytometry using the pJB-GFP vector.

For analysis by flow cytometry, B. subtilis transformed with the pJB-GFP vector was washed with 0.22 μm filtered 1.5×PBS and diluted. The concentration of microspheres was calculated in the range of 106 beads ^-1 , and B. subtilis cells were injected into the flow cytometer within a few minutes after resuspension. Analysis was performed using a FACScalibur (Becton Dickinson, Oxford, UK) instrument.

Fluorescence in the range of 515-545nm was detected through a fluorescence detector set at a voltage of 600V. Forward scattering (FS) was collected with a diode with an amplification factor of 10 and calculated as a log value. Side scatter (SS) was detected at log values by photomultiplier pipe set to 366V. For all output signals [Fluorescence (FL), FS and SS], the number of logarithmic channels is converted to linear intensity and the geometric mean with'G mean' is defined as: G mean = 10ΣlogX (i) / n; 10,000 signals were measured for each measurement.

The results of flow cytometry performed to confirm whether the pJB-GFP expression vector was introduced into B. subtilis cells are shown in FIG. 10.

In FIG. 10, it was confirmed that GFP expression was shifted in the pJB-GFP graph into which the pJB-GFP expression vector was introduced compared to the wild type graph into which the pJB-GFP expression vector was not introduced, in the same way as the PCR result, B. subtilis It was found that GFP was expressed on the surface of cell spores.

Example 5: B. subtilis Identification of the target epitope on the spore surface

In Example 4, a GFP expression vector was introduced into the spores of B. subtilis to confirm that GFP was expressed on the surface of the spore, and to confirm whether the desired antigen expression vector was expressed on the surface of the spore instead of the GFP expression vector, the target expression vector Expression of (pJB009 to pJB010) was confirmed through PCR analysis.

● PCR analysis

The colony of transformant B. subtilis was cultured in LB broth to isolate gDNA. A primer was prepared inside the 2 site of the introduced Clostridium perfringens toxin A region (SEQ ID NOs 18 to 21 in Table 2; In-CPA1_F, In-CPA1_R, In-CPA2_F, In-CPA2_R) and PCR was performed. Transgenes were confirmed in the transformant and wild-type DNA.

The results of PCR performed to confirm the expression of the expression vector of the target antigen on the surface of B. subtilis spores are shown in FIG. 11.

In FIG. 11, the amplification bands of CPA1 and CPA2 could be confirmed, through which it could be seen that the target antigen was expressed on the spore surface of B. subtilis .

Example 6: Confirmation of antibody formation

In order to remove the antibiotic resistance gene (eg, neo, amp, etc.) inserted into the genome of B. subtilis spores, the B. subtilis transformant into which the pJB-CPA expression vector was introduced was transformed with pJB-sg02, 03 vectors. Conversion was performed to induce deletion of the antibiotic resistance gene. The transformants were plated on LB plate medium to which antibiotics were not added, and then each single colony formed was negatively cultured on the antibiotic LB plate medium, and colonies that did not grow on the antibiotic LB plate medium were selected for antibiotic gene deletion B. subtilis . Secured.

● PCR analysis

Primer was prepared (SEQ ID NOs 22 to 25 in Table 3), and PCR was performed to confirm the deletion of the antibiotic gene of the transformant B. subtilis into which the CPA antigen gene was introduced.

No. Name Sequence (5'→ 3') SEQ ID NO. 22 AmpR_F TGATAACACTGCGGCCAACT SEQ ID NO. 23 AmpR_R TGACTCCCCGTCGTGTAGAT SEQ ID NO. 24 NeoR_F ACGGGCCAGTTTGTTGAAGA SEQ ID NO. 25 NeoR_R AAGCGGCCAATCTGATTCCA

The results of PCR performed to confirm that the antibiotic gene of the transformant of B. subtilis into which the pJB-CPA expression vector was introduced is defective are shown in FIGS. 12 and 13.

As the bands of AmpR and NeoR were not found in FIGS. 12 and 13, it could be seen that the antibiotic gene was deleted in the B. subtilis transformant.

B. subtilis spores were subjected to an inactivation step by high temperature treatment at 80˚C for 20 minutes to confirm immunity formation using a transformant of B. subtilis expressing the target antigen with a deficient antibiotic gene. . Mouse was C57BL/6, female, 8 weeks old, and 5 mice were set as one group.

The route of administration was to confirm the formation of immunity through the mucous membrane, and was administered directly into the stomach using a mouse sonde, and the dose was 5x10^10 spore/0.2ml. The administration was performed three times in total, and for one administration, it was administered for 3 consecutive days, and the interval between each dose was 2 weeks.

The antibody formation confirmation experiment was analyzed by ELISA and western blot using animal experiments.

Serum required for ELISA and western blot was collected one day prior to administration, after light anesthesia, orbital blood was collected, immobilized at room temperature for 30-60 minutes, and then centrifuged at 6000 rpm, 7 minutes, and 4°C to separate the supernatant.

● Indirect ELISA analysis

A method of coating the antigen on the plate was used, and the purified antigen candidate gene protein was coated at a concentration of 100 ng/well to detect the formation of antibodies specific for necrotizing in pigs. As the coating solution, 0.05M Carbonate/bicarbonate buffer (pH 9.6) was used.

The dilution factor of the antibody and the dilution factor of the secondary antibody were determined and analyzed using an immobilization solution (1% BSA) to establish ELISA assay conditions. The dilution factor of the primary antibody was 1:10 to 1:10,000, the secondary antibody was Goat-anti-mouse IgG-HRP, and the dilution factor was set in the range of 1:5,000 to 1:160,000, and analyzed. The concentration (1:10,000) in which the value of the reaction degree (B _T /B ₀ ) is maintained at 50% was selected and determined as the optimum concentration used in the assay.

The washing solution was a PBS buffer to which 0.05% Tween 20 was added, and the reaction in each step was incubated at room temperature for 2 hours to react. TMB was used as the substrate solution, and the reaction was stopped by injecting 100 ul of 0.16 MH ₂ SO ₄ (stop solution), and the OD value was measured at a wavelength of 450 nm in an ELISAreader (TECAN SUNRISE, BioSurplus) (Fig. 14).

14 shows the results of Indirect ELISA analysis.

Through the ELISA results of FIG. 14, it was found from the results of FIG. 14 that CPA2 was generated at week 4 and CPA1 was generated at week 6 (0.8 or more) among pigs' necrotizing antigen-specific antibodies in the blood of mice administered with the antigen. .

● Western blot analysis

Depending on the characteristics of the antigen candidate protein, the recombinant protein tagged with GST or ⁶ His was bound to glutathione or Ni-NTA resin, and then washed with a washing buffer to remove the protein that was not bound to the resin. The elution buffer was loaded onto the column, and the target protein attached to the resin was separated and extracted. The antigen candidate protein was purified by checking whether the extracted protein is located in the same size as the target protein by using SDS-PAGE.

The protein was separated by loading 500 ng/ml of the purified porcine necrotizing candidate gene protein onto a 10% SDS-PAGE gel. The separated protein was transferred to a polyvinylidene difluoride membrane (PVDF, Bio-rad) for 2 hours at 100 mA in a cold room at 4°C, and then a TBST (Tris buffered saline with Tween 20, pH 7.5) solution containing 5% skim milk. Blocking was performed at room temperature for 1 hour. Serum of blood collected from the mouse was diluted 1:10 or 1:100 in 5% skim milk and used. Each was reacted at 4° C. for 18 hours and washed 3 times with TBST for 5 minutes each. As a secondary antibody, horse radish peroxidase (HRP)-conjugated goat anti-mouse IgG H&L (abcam) was diluted 1:20,000 in 5% skim milk, reacted for 1 hour at room temperature, and washed three times with TBST. After reacting with ECL (Thermo Scientific, Rockford, IL, USA) substrate for 1 to 3 minutes, each protein band was visualized with LAS-3000 (FIG. 15).

15 shows the results of Western blot analysis.

Through the results of FIG. 15, it was confirmed through FIG. 15 that CPA2 among the necrotizing antigen-specific antibodies in the blood of mice administered with the antigen was generated at 4 weeks and CPA1 at 6 weeks.

In the CRISPR/Cas9-based Bacillus subtilis spores made by the method of the present application through the Indirect ELISA and Western blot analysis of FIGS. 14 and 15, the target antigen, the necrotic growth salt antigen of pig, is expressed on the surface of the spore of B. subtilis to obtain antibodies. It was confirmed that it can be formed.

<110> JBBiotech <120> Necrotic enteritis vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism <130> CP19-058 <160> 25 <170> KoPatentIn 3.0 <210> 1 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> CPA1 <400> 1 tatgcagcaa aggtaacttt agctaactct caaaaaggaa cagcaggata tatttataga 60 ttcttacacg atgtatcaga gggtaatgat ccatcagttg gaaataatgt aaaagaacta 120 gtagcttaca tatcaactag tggtgaaaaa gatgctggaa cagatgacta catgtatttt 180 ggaatcaaaa caaaggatgg aaaaactcaa gaatgggaaa tggacaaccc aggaaatgat 240 tttatggctg gaagcaaaga cacttatact ttcaaattaa aagatgaaaa tctaaaaatt 300 gatgatatac aaaatatgtg gattagaaaa agaaaatata cagcattccc agatgcttat 360 aagccagaaa ac 372 <210> 2 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> CPA2 <400> 2 aatgatccat cagttggaaa taatgtaaaa gaactagtag cttacatatc aactagtggt 60 gaaaaagatg ctggaacaga tgactacatg tattttggaa tcaaaacaaa ggatggaaaa 120 actcaagaat gggaaatgga caacccagga aatgatttta tggctggaag caaagacact 180 tatactttca aattaaaaga tgaaaatcta aaaattgatg atatacaaaa tatgtggatt 240 agaaaaagaa aatatacagc attcccagat gcttataagc cagaaaacat aaaggtaata 300 gcaaatggaa aagttgtagt tgacaaggat ataaatgagt ggatttcagg aaattcaact 360 tataatataa aataa 375 <210> 3 <211> 31 <212> RNA <213> Artificial Sequence <220> <223> CotG_gRNA <400> 3 tacgttcatc cttaacatat ttttaaaagg a 31 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GFP_F <400> 4 ataaagctta tggtgagcaa g 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GFP_R <400> 5 tatggatcct tacttgtaca g 21 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CotG-Full_F <400> 6 ataaagctta gtgtccctag ctccg 25 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> CotG-Full_R <400> 7 tatctgcagt gaacccccac ctcctttgta tttctttttg 40 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CPA1_F <400> 8 tcactgcaga atgatccatc agttg 25 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> CPA1_R <400> 9 gtcgactcta gaggatcctt attttatatt ataag 35 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CPA2_F <400> 10 tcactgcagt atgcagcaaa ggtaa 25 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> CPA2_R <400> 11 gtcgactcta gaggatccgt tttctggctt ataag 35 <210> 12 <211> 32 <212> RNA <213> Artificial Sequence <220> <223> Ampicillin_gRNA <400> 12 cgatacgtgc tccggttccc aacgatcaag ga 32 <210> 13 <211> 31 <212> RNA <213> Artificial Sequence <220> <223> Neomycin_gRNA <400> 13 gacgagttat taatagctga ataagaacgg t 31 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> In-GFP_F <400> 14 atcatggccg acaagcagaa 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> In-GFP_R <400> 15 tctcgttggg gtctttgctc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16S-F <400> 16 tcgcggtttc gctgcccttt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16S-R <400> 17 aagtcccgca acgagcgcaa 20 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> In-CPA1_F <400> 18 gtggtgaaaa agatgctgga aca 23 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> In-CPA1_R <400> 19 tccttgtcaa ctacaacttt tcca 24 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> In-CPA2_F <400> 20 actctcaaaa aggaacagca gga 23 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> In-CPA2_R <400> 21 agtgtctttg cttccagcca 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AmpR_F <400> 22 tgataacact gcggccaact 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AmpR_R <400> 23 tgactccccg tcgtgtagat 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NeoR_F <400> 24 acgggccagt ttgttgaaga 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NeoR_R <400> 25 aagcggccaa tctgattcca 20

Claims (19)

i) Spores from Bacillus;
ii) CotG protein, which is a spore coat protein present on the surface of the Bacillus-derived spores;
iii) a peptide linker linked to the spore coat protein;
iv) SEQ ID NO expressed by linking to the linker. Any one of 1 or 2 selected from pig necrotizing antigenic substance;
Including,
A sequence encoding an exogenous CotG, a sequence encoding a linker, and a sequence encoding an antigenic substance of pig necrotic growth are linked in sequence to the endogenous CotG locus of the genomic DNA of the Bacillus-derived spore. It is characterized in that it is a spore having a genomic DNA into which the sequence is inserted,
Immunogenic composition.
The method of claim 1,
The Bacillus is an immunogenic composition, characterized in that Bacillus subtilis (Bacillus subtilis).
delete The method of claim 1,
The porcine necrotizing antigenic substance is SEQ ID NO. 1 and SEQ ID NO. Immunogenic composition comprising part or all of the consensus sequence of 2.
delete The method of claim 1,
Immunogenic composition, characterized in that the concentration of the antigenic substance of pig necrotic growth in the composition is 10 ¹⁰ ~ 10 ¹⁵ /ml concentration based on the composition.
The method of claim 1,
The composition is for oral administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, endothelial administration, intranasal administration, pulmonary administration, rectal administration, intranasal administration, intraperitoneal administration Immunogenic composition, characterized in that any one or more selected from for, for intrathecal administration.
The method of claim 1,
Stabilizer, emulsifier, aluminum hydroxide, aluminum phosphate, pH adjuster, surfactant, liposome, iscom adjuvant, synthetic glycopeptide, extender, carboxypolymethylene, bacterial cell wall, derivative of bacterial cell wall, bacterial vaccine, animal poxvirus protein , Subviral particle adjuvant, Clostridium pufflingens toxin, N, N-dioctadecyl-N',N'-bis(2-hydroxyethyl)-propanediamine, monophosphoryl lipid A, dimethyl Immunogenic composition, characterized in that it further comprises any one or more selected from dioctadecyl-ammonium bromide.
Steps to introduce the following into Bacillus
i) Cas9 protein or nucleic acid encoding it;
ii) a nucleic acid encoded by SEQ ID NO: 3 or guide RNA transcribed therefrom;
iii) a nucleic acid encoding CotG, a nucleic acid encoding a linker, and SEQ ID NO, which is a porcine necrotizing antigenic substance. A donor comprising a nucleic acid encoding at least one of 1 or 2 and a nucleic acid encoding an antibiotic resistance gene;
Selecting a Bacillus having genomic DNA into which the donor is inserted into a sequence encoding CotG from among the genomic DNA sequences of Bacillus by treatment with antibiotics;
Knocking out the antibiotic resistance gene inserted into the genome of the selected Bacillus;
Forming spores with Bacillus knocked out of the antibiotic resistance gene;
The method for preparing the composition of claim 1, comprising a.
The method of claim 9,
The introduction method, characterized in that using a vector.
The method of claim 9,
The step of forming spores is a method of utilizing nutrient-depleted nutritional conditions; and
A method of using hot or cold temperature conditions;
A manufacturing method characterized in that it is carried out with any one or more selected from.
The method of claim 9,
The step of knocking out the antibiotic resistance gene,
To form indels in the nucleic acid sequence encoding the antibiotic resistance gene by additionally introducing a vector containing a guide RNA targeting the antibiotic resistance gene,
The guide RNA targeting the antibiotic resistance gene is SEQ ID NO. 12 or SEQ ID NO. Any one selected from among 13, wherein each of the ampicillin resistance gene or neomycin resistance gene is targeted. delete delete delete delete delete delete delete

Images