KR102207353B1 - Necrotic enteritis vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism - Google Patents
Necrotic enteritis vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism Download PDFInfo
- Publication number
- KR102207353B1 KR102207353B1 KR1020190106048A KR20190106048A KR102207353B1 KR 102207353 B1 KR102207353 B1 KR 102207353B1 KR 1020190106048 A KR1020190106048 A KR 1020190106048A KR 20190106048 A KR20190106048 A KR 20190106048A KR 102207353 B1 KR102207353 B1 KR 102207353B1
- Authority
- KR
- South Korea
- Prior art keywords
- necrotizing
- seq
- sequence
- vaccine
- bacillus
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/08—Clostridium, e.g. Clostridium tetani
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/385—Haptens or antigens, bound to carriers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/33—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Clostridium (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
- A61K2039/6031—Proteins
- A61K2039/6068—Other bacterial proteins, e.g. OMP
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Cell Biology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Crystallography & Structural Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
본 출원은 돼지를 대상으로 하는 항원성 물질, CRISPR/Cas9 시스템 및 이를 포함한 돼지의 괴사성장염 백신 조성물에 관한 것이다.The present application relates to an antigenic substance targeting pigs, a CRISPR/Cas9 system, and a vaccine composition for necrotizing pigs including the same.
본 출원은 돼지를 대상으로 하는 항원성 물질, CRISPR/Cas9 시스템 및 이를 포함한 돼지의 괴사성장염 백신 제조방법에 관한 것이다.The present application relates to an antigenic substance targeting pigs, a CRISPR/Cas9 system, and a method for manufacturing a pig's necrotizing infection vaccine including the same.
본 출원은 돼지의 괴사성장염을 치료하는 치료방법에 관한 것이다.The present application relates to a treatment method for treating necrotizing growth in pigs.
백신은 질병 예방 또는/및 치료를 위해 조치할 수 있는 가장 중요한 수단 중 하나이다.Vaccines are one of the most important measures that can be taken to prevent or/and treat disease.
현재까지 여러 질병들에 대한 다양한 백신이 개발되어 왔음에도 불구하고 질병을 일으키는 원인체의 변이가 일어날 경우 개발되어 있는 백신만으로는 치료 또는/및 예방이 불가능하다.Although various vaccines for various diseases have been developed so far, treatment or/and prevention is not possible with only the developed vaccines when mutations in the cause of the disease occur.
이와 같이, 질병을 일으키는 원인체의 변이에도 신속하게 대응할 수 있는 백신의 개발은 필요하다.As described above, it is necessary to develop a vaccine capable of rapidly responding to mutations in the cause of the disease.
본 출원의 일 과제는, 항원성 물질, CRISPR/Cas9 시스템 및 이를 포함한 돼지의 괴사성장염 백신 조성물을 제공하는 것을 목적으로 한다.An object of the present application is to provide an antigenic substance, a CRISPR/Cas9 system, and a vaccine composition for gangrene of pigs including the same.
본 출원의 다른 과제는, 돼지의 괴사성장염을 일으키는 원인체에 대한 백신 및 이의 제조 방법을 제공하는 것을 목적으로 한다.Another object of the present application is to provide a vaccine against a causative agent causing necrotizing growth in pigs and a method for producing the same.
본 출원의 또 다른 과제는, 돼지의 괴사성장염을 예방 또는/및 치료하기 위한 용도를 제공하는 것을 목적으로 한다.Another object of the present application is to provide a use for preventing or/and treating necrotizing growth in pigs.
전술한 본 출원의 과제를 해결하기 위하여, 본 출원의 일 양태에 의하면, i) 박테리아 유래 포자; 이 때, 상기 박테리아 유래 포자는 지노믹 DNA에 항원성 물질을 코딩하는 서열을 가지고 있는 포자이며, In order to solve the problems of the present application described above, according to an aspect of the present application, i) spores derived from bacteria; At this time, the bacterial-derived spores are spores having a sequence encoding an antigenic substance in genomic DNA,
ii) 상기 박테리아 포자의 표면에 존재하는 포자 코트 단백질, ii) a spore coat protein present on the surface of the bacterial spore,
iii) 상기 포자 코트 단백질에 연결된 돼지의 괴사성장염 항원성 물질iii) porcine necrotizing antigenic substance linked to the spore coat protein
을 포함하는 돼지의 괴사성장염 예방 또는 치료용 백신 조성물이 제공된다.There is provided a vaccine composition for preventing or treating necrotizing growth in pigs comprising a.
또한, 본 출원은 돼지의 괴사성장염 항원성 물질이 SEQ ID NO. 1 및 SEQ ID NO. 2 중 선택되는 하나 이상인 것을 특징으로 하는 돼지의 괴사성장염 예방 또는 치료용 백신 조성물을 제공한다.In addition, the present application is a porcine necrotizing antigenic substance is SEQ ID NO. 1 and SEQ ID NO. It provides a vaccine composition for preventing or treating necrotizing growth in pigs, characterized in that at least one selected from among 2.
또한, 본 출원은 돼지의 괴사성장염 항원성 물질의 농도가 조성물 기준으로 1010 ~1015개/ml 농도인 것을 특징으로 하는 돼지의 괴사성장염 예방 또는 치료용 백신 조성물을 제공한다.In addition, the present application provides a vaccine composition for preventing or treating necrotizing growth in pigs, characterized in that the concentration of the antigenic substance for necrotizing growth in pigs is 10 10 to 10 15 pcs/ml based on the composition.
또한, 전술한 본 출원의 과제를 해결하기 위하여, 본 출원의 일 양태에 의하면, i) 박테리아의 지노믹 DNA(genomic DNA)에 CRISPR/Cas9을 이용하여 항원성 물질을 넉인(Knock-in) 시키는 단계; In addition, in order to solve the problems of the present application described above, according to an aspect of the present application, i) knock-in antigenic substances using CRISPR/Cas9 in bacterial genomic DNA. step;
ii) 상기 박테리아의 포자를 형성시키는 단계; 및 ii) forming spores of the bacteria; And
iii) 상기 박테리아의 포자 표면에 돼지의 괴사성장염 항원성 물질을 발현시키는 단계; iii) expressing a porcine necrotizing antigenic substance on the spore surface of the bacteria;
를 포함하는 것을 특징으로 하는 돼지의 괴사성장염 예방 또는 치료용 백신 제조방법이 제공된다.There is provided a method for producing a vaccine for preventing or treating necrotizing inflammatory disease in pigs comprising a.
본 출원에 따르면 다음과 같은 효과가 발생된다.According to the present application, the following effects occur.
첫째, 본 출원에 의하면, 돼지의 괴사성장염의 예방 또는/및 치료할 수 있는 조성물을 제공할 수 있게 된다. 특히, 항원성 물질, CRISPR/Cas9 시스템 및 이를 포함한 돼지의 괴사성장염의 예방 또는/및 치료 조성물을 제공할 수 있게 된다.First, according to the present application, it is possible to provide a composition capable of preventing or/and treating necrotizing growth in pigs. In particular, it is possible to provide an antigenic substance, a CRISPR/Cas9 system, and a composition for preventing or/and treating necrotizing swine including the same.
둘째, 본 출원에 의해 제공되는 조성물을 이용함으로써, 돼지의 괴사성장염 질병을 일으키는 원인체에 변이가 발생했을 때 신속하게 대응할 수 있는 효과를 제공할 수 있게 된다. Second, by using the composition provided by the present application, it is possible to provide an effect that can quickly respond when a mutation occurs in the cause of the necrotizing disease in pigs.
도 1은 pHCas9 벡터를 도시한 도면이다.
도 2는 B. subtilis coat protein (CotG)의 가이드 RNA 그리고 promoter를 포함하는 CotG CDS 를 포함하는 pJB 벡터를 도시한 도면이다.
도 3은 B. subtilis coat protein (CotG)의 가이드 RNA 그리고 promoter를 포함하는 CotG CDS와 GFP를 포함하는 pJB-GFP 벡터를 도시한 도면이다.
도 4는 본 출원에서 사용한 돼지 괴사성장염의 항원결정부위를 도시한 도면이다.
도 5는 B. subtilis coat protein (CotG)의 가이드 RNA 그리고 promoter를 포함하는 CotG CDS와 CPA1을 포함하는 pJB009 벡터를 도시한 도면이다.
도 6은 B. subtilis coat protein (CotG)의 가이드 RNA 그리고 promoter를 포함하는 CotG CDS와 CPA2를 포함하는 pJB010 벡터를 도시한 도면이다.
도 7는 항생제 저항성유전자의 결손을 위해 ampicillin 저항성 유전자를 목적으로 하는 가이드 RNA를 포함하는 pJB-sg02 벡터를 도시한 도면이다.
도 8은 항생제 저항성유전자의 결손을 위해 neomycin 저항성 유전자를 목적으로 하는 가이드 RNA를 포함하는 pJB-sg03 벡터를 도시한 도면이다.
도 9는 B. subtilis의 포자 표면에 GFP가 발현되는지 확인하기 위해 수행한 PCR 분석 결과를 나타낸 도면이다.
도 10은 B. subtilis의 포자 표면에 GFP가 발현되는지 확인하기 위해 수행한 FACS 분석 결과를 나타낸 도면이다.
도 11는 B. subtilis의 포자 표면에 CPA1, CPA2가 발현되는지 확인하기 위해 수행한 PCR 분석 결과를 나타낸 도면이다
도 12는 pJB-CPA 발현벡터가 도입된 B. subtilis 형질전환체에 항생제 유전자 ampicillin이 결손된 것을 확인하기 위해 수행한 PCR 결과를 나타낸 도면이다.
도 13은 pJB-CPA 발현벡터가 도입된 B. subtilis 형질전환체에 항생제 유전자 neomycin이 결손된 것을 확인하기 위해 수행한 PCR 결과를 나타낸 도면이다.
도 14는 항원 특이적 항체 형성여부를 확인한 ELISA 결과를 나타낸 도면이다.
도 15는 항원 특이적 항체 형성여부를 확인한 Western blot 결과를 나타낸 도면이다.1 is a diagram showing a pHCas9 vector.
FIG. 2 is a diagram showing a pJB vector containing CotG CDS including a guide RNA of B. subtilis coat protein (CotG) and a promoter.
FIG. 3 is a diagram showing a pJB-GFP vector including CotG CDS and GFP including a guide RNA and promoter of B. subtilis coat protein (CotG).
4 is a diagram showing the epitope of porcine necrotizing growth salt used in the present application.
5 is a diagram showing a pJB009 vector containing CotG CDS and CPA1 containing a guide RNA and promoter of B. subtilis coat protein (CotG).
6 is a diagram showing a pJB010 vector containing CotG CDS and CPA2 including a guide RNA and promoter of B. subtilis coat protein (CotG).
7 is a diagram showing a pJB-sg02 vector containing a guide RNA targeting an ampicillin resistance gene for the deletion of an antibiotic resistance gene.
8 is a diagram showing a pJB-sg03 vector containing a guide RNA targeting a neomycin resistance gene for deletion of an antibiotic resistance gene.
9 is a diagram showing the results of PCR analysis performed to determine whether GFP is expressed on the spore surface of B. subtilis .
10 is a view showing the results of FACS analysis performed to determine whether GFP is expressed on the spore surface of B. subtilis .
11 is a diagram showing the results of PCR analysis performed to determine whether CPA1 and CPA2 are expressed on the spore surface of B. subtilis
12 is a view showing the PCR results performed to confirm that the antibiotic gene ampicillin is defective in the B. subtilis transformant into which the pJB-CPA expression vector has been introduced.
FIG. 13 is a diagram showing PCR results performed to confirm that the antibiotic gene neomycin was deleted in the B. subtilis transformant into which the pJB-CPA expression vector was introduced.
14 is a diagram showing the results of ELISA confirming the formation of antigen-specific antibodies.
15 is a diagram showing Western blot results confirming whether or not antigen-specific antibodies are formed.
본 출원에 의해 개시되는 기술에서 사용되는 용어 또는 실시는 달리 정의되지 않는 한, 당업계의 기술 내에 있는 미생물학, 바이러스학, 세균학, 유전학, 면역학, 생화학, 분자 생물학, 미생물학, 세포 생물학, 유전체학 및 통상의 기술 등을 사용하는 당업자에 의해 통상적으로 이해되는 것과 동일한 의미를 가진다.Unless otherwise defined, terms or practices used in the technology disclosed by this application are microbiology, virology, bacteriology, genetics, immunology, biochemistry, molecular biology, microbiology, cell biology, genomics and conventional It has the same meaning as commonly understood by one of ordinary skill in the art using technology and the like.
1. 백신(vaccine)1. Vaccine
본 출원의 일 태양은 백신에 관한 것이다.One aspect of the present application relates to a vaccine.
"백신(vaccine)"은 질병에 대한 방어 면역을 생성하는 물질을 지칭한다. 상기 방어 면역은 바이러스, 세균, 기생충 등의 병원체를 특이적으로 인식하는 항체나 T세포(T cell)로 생체에서 병원체를 배제하는 모두 포함할 수 있으나, 이에 한정하지는 않는다. 상기 백신은 사백신(killed vaccine), 생백신(attenuated vaccine), 독소백신(toxoid vaccine), 조각백신(subnunit vaccine), 결합백신(conjugated vaccine) 등 통상의 백신은 모두 포함할 수 있으며, 이에 한정하지는 않는다. 용어 "백신" 또는 "예방주사"는 상호교환 가능하게 사용된다. 병을 예방하기 위해 상기 예방주사를 맞는 것을 예방접종이라고 한다.“Vaccine” refers to a substance that produces a protective immunity against disease. The protective immunity may include antibodies or T cells that specifically recognize pathogens such as viruses, bacteria, and parasites, which exclude pathogens from the living body, but are not limited thereto. The vaccine may include all conventional vaccines such as killed vaccine, attenuated vaccine, toxoid vaccine, subnunit vaccine, and conjugated vaccine, but is not limited thereto. . The terms "vaccine" or "prophylactic injection" are used interchangeably. In order to prevent illness, getting the above vaccination is called vaccination.
상기 백신의 대상은 인간, 돼지, 소, 개, 어류, 곤충 등일 수 있으나, 이에 제한하지 않는다.The target of the vaccine may be human, pig, cow, dog, fish, insect, etc., but is not limited thereto.
예를 들어, 본 출원에서 백신의 대상은 돼지일 수 있다.For example, the subject of the vaccine in the present application may be a pig.
1-1. 포자1-1. Spore
상기 백신은 포자를 포함할 수 있다.The vaccine may contain spores.
상기 포자는 자연 상태의 포자 및 그 변형물을 포함할 수 있다.The spores may include spores in a natural state and variations thereof.
예를 들어, 포자는 식물, 효모, 진균, 박테리아 등의 포자일 수 있다.For example, spores may be spores of plants, yeast, fungi, bacteria, and the like.
상기 박테리아의 포자에서 박테리아는 Clostridium 속, Streptococcus 속, Bacillus 속 등일 수 있으나, 이에 한정하지는 않는다.In the spores of the bacteria, the bacteria may be Clostridium genus, Streptococcus genus, Bacillus genus, etc., but are not limited thereto.
상기 Clostridium 속은 예를 들어, C. difficile, C. botulinum, C. perfringens 등 일 수 있으나 이에 한정하지는 않는다.The Clostridium genus may be, for example, C. difficile, C. botulinum, C. perfringens , but is not limited thereto.
상기 Bacillus 속은 예를 들어, B. subtilis, B. anthrasis, B. thuringiensis, B. cereus 등 일 수 있으나 이에 한정하지는 않는다.The genus Bacillus may be, for example, B. subtilis, B. anthrasis, B. thuringiensis, B. cereus , but is not limited thereto.
예를 들어, 본 출원은 B. subtilis의 포자를 포함한 백신일 수 있다.For example, the present application may be a vaccine containing spores of B. subtilis .
상기 박테리아는 GRAS(generally recognized as safe)로 인정되고 있는 예를 들어, B. subtilis 등의 박테리아를 포함할 수 있다.The bacteria may include, for example, bacteria such as B. subtilis recognized as GRAS (generally recognized as safe).
특히, 본 출원이 포자를 포함한 백신일 경우, GRAS로 인정되는 박테리아라면 모두 사용할 수 있다.In particular, if the present application is a vaccine containing spores, any bacteria recognized as GRAS can be used.
상기 포자는 식물, 효모, 진균, 박테리아 등의 외부에 형성되는 외생포자(exospore) 및 내부에 형성되는 내생포자(endospore)를 포함할 수 있다.The spores may include exospores formed on the outside of plants, yeast, fungi, and bacteria, and endospores formed on the inside.
예를 들어, 본 출원은 내생포자를 포함한 백신일 수 있다.For example, the present application may be a vaccine containing endospores.
상기 외생포자는 포자가 포자낭 밖에서 만들어져서 그대로 분리되어 나오는 것으로, 포자의 생식기능에 관여하는 포자를 지칭한다.The exospore refers to spores that are produced outside the sporangia and come out as they are, and are involved in the reproductive function of spores.
상기 내생포자는 포자의 내부(구체적으로, 세포 안)에 형성하는 포자를 지칭하며, 대사활동이 거의 없으며 생존이 어려운 조건이 오면 일시적으로 형성되는 포자를 지칭한다.The endospores refer to spores formed inside (specifically, cells) of spores, and refer to spores that have little metabolic activity and are temporarily formed when conditions difficult to survive.
예를 들어, 본 출원은 B. subtilis의 내생포자를 포함한 백신일 수 있다.For example, the present application may be a vaccine containing endospores of B. subtilis .
상기 내생포자가 형성되는 조건은 영양분이 고갈된 영양학적 조건, 고온 또는 저온의 온도적 조건, 고수분 또는 저수분의 수분적 조건, 살균제, 보존제 등의 화학적 조건, 산성 또는 알칼리성의 pH적 조건 등에서 형성될 수 있으나, 이에 한정하지는 않는다.The conditions under which the endospores are formed are nutrient-depleted nutritional conditions, high or low temperature temperature conditions, high or low moisture moisture conditions, chemical conditions such as disinfectants and preservatives, acidic or alkaline pH conditions, etc. It may be formed, but is not limited thereto.
이와 같이 내생포자는 생존이 어려운 조건에서 형성될 수 있기 때문에, 다양한 환경에서 오랫동안 살아남을 수 있다. 즉, 내생포자는 열, 건조, 독성 화학물질, 영양분 고갈, 자외선 조사 등과 같은 해로운 조건에 엄청난 저항성을 가질 수 있다.In this way, because endospores can be formed under conditions that are difficult to survive, they can survive for a long time in various environments. In other words, endospores can have tremendous resistance to harmful conditions such as heat, drying, toxic chemicals, nutrient depletion, and UV irradiation.
상기 포자는 포자외부단백질을 포함할 수 있으며, 예를 들어 상기 포자외부단백질은 spore exosporium protein, spore coat protein, transmembrane protein, spore appendage protein, spore associated enzyme 등 일 수 있다.The spore may include an external spore protein. For example, the spore external protein may be a spore exosporium protein, a spore coat protein, a transmembrane protein, a spore appendage protein, a spore associated enzyme, and the like.
예를 들어, 본 출원은 동일한 속의 미생물들의 포자 간에는 서로의 포자외부단백질을 사용할 수 있다.For example, the present application may use each other's spore proteins between spores of microorganisms of the same genus.
상기 spore exosporium protein은 예를 들어, BclA, InhA 등 일 수 있다.The spore exosporium protein may be, for example, BclA or InhA.
상기 포자 코트단백질(coat protein)은 예를 들어, CotA, CotB, CotC, CotD, CotE, CotF, CotG, CotN, CotS, CotT, CotV, CotW, CotX, CotY, CotZ, CotH, CotJA, CotJC, CotK, CotL, CotM 등 일 수 있다.The spore coat protein is, for example, CotA, CotB, CotC, CotD, CotE, CotF, CotG, CotN, CotS, CotT, CotV, CotW, CotX, CotY, CotZ, CotH, CotJA, CotJC, CotK , CotL, CotM, etc.
상기 transmembrane protein은 예를 들어, prkC, OppA 등 일 수 있다.The transmembrane protein may be, for example, prkC, OppA, or the like.
상기 spore appendage protein은 예를 들어, P29a, P29b, P85 등 일 수 있다.The spore appendage protein may be, for example, P29a, P29b, P85, or the like.
상기 spore associated enzyme은 예를 들어, CotA(laccase), oxdD(oxalate decarboxylase), CotQ(reticuline oxidase-like protein), tgI(transglutaminase)등 일 수 있다.The spore associated enzyme may be, for example, CotA (laccase), oxalate decarboxylase (oxdD), reticuline oxidase-like protein (CotQ), transglutaminase (tgI), and the like.
상기 포자는 소수성(hydrophobic)을 지니고 있을 수 있다. 이 때 포자 전체 또는 일부에서 소수성을 지니고 있을 수 있다.The spores may have hydrophobic properties. At this time, all or part of the spore may have hydrophobicity.
상기 포자는 포자 시스템의 구성요소일 수 있다.The spores may be components of the spore system.
상기 백신은 포자 시스템을 포함할 수 있다.The vaccine may comprise a spore system.
상기 포자 시스템은 시스템 구조체가 포자이거나 포자, 항원성 물질 및 부가 물질을 포함한 시스템 모두를 지칭한다.The spore system refers to all of the systems in which the system construct is spores or contains spores, antigenic substances and additional substances.
상기 부가 물질은 백신의 효능을 더 증진시킬 수 있는 물질 모두를 지칭한다. 예를 들어, 알루미늄 겔 입자(알루미늄염), 광유(mineral oil)를 주성분으로 함유하는 오일 어쥬번트, 백편두(white hyacinth bean)로부터 정제된 사포닌과 같은 계면활성제-유사 어쥬번트, 세균 내 독소(LPS 등) 유래의 TH1 유도형 어쥬번트 등 일 수 있으나, 이에 한정하지는 않는다.The additional substances refer to all substances that can further enhance the efficacy of the vaccine. For example, aluminum gel particles (aluminum salts), oil adjuvants containing mineral oil as a main component, surfactant-like adjuvants such as saponins purified from white hyacinth beans, bacterial toxins ( LPS, etc.) may be derived from a TH1 inducing adjuvant, but is not limited thereto.
1-2. 항원성 물질1-2. Antigenic substance
본 출원은 항원성 물질을 포함한 백신일 수 있다.The present application may be a vaccine containing an antigenic substance.
본 출원에서 사용되는 용어 "항원(antigen)"은 면역 반응을 일으키는 물질을 지칭한다. 상기 항원은 예를 들어, 병원균, 바이러스, 단백질, 다당류, 인위적으로 합성된 물질, 생체 내에서 변이가 생긴 물질 등을 포함할 수 있으나, 이에 한정하지는 않는다. 용어 "항원" 또는 "면역원"은 상호교환 가능하게 사용된다.The term "antigen" as used in the present application refers to a substance that causes an immune response. The antigen may include, for example, pathogens, viruses, proteins, polysaccharides, artificially synthesized substances, substances with mutations in vivo, etc., but is not limited thereto. The terms “antigen” or “immunogen” are used interchangeably.
상기 항원성 물질은 방어 면역 반응을 일으키는 모든 물질을 포함하며, 예를 들어 병원체, 에피토프, 폴리펩티드, 단백질, 비단백질 분자 및 이들의 단편 등일 수 있다.The antigenic substance includes all substances that cause a protective immune response, and may be, for example, a pathogen, an epitope, a polypeptide, a protein, a non-protein molecule, and a fragment thereof.
상기 항원성 물질은 야생형(wild type), 변이형(mutant type)일 수 있다. 이 때, 상기 변이는 항원성 물질의 일부 또는/및 전체가 결실, 변형 등의 조작이 이루어진 것으로 자연적인 조작 또는 인위적인 조작을 포함할 수 있다.The antigenic substance may be a wild type or a mutant type. In this case, the mutation may include a natural manipulation or an artificial manipulation, in which some or/and all of the antigenic substance is manipulated such as deletion or modification.
예를 들어, 상기 항원성 물질의 일부를 포함한 백신일 수 있다.For example, it may be a vaccine containing a portion of the antigenic substance.
예를 들어, 상기 항원성 물질의 전체를 포함한 백신일 수 있다.For example, it may be a vaccine including all of the antigenic substances.
병원체(pathogen)는 예를 들어, 바이러스, 세균, 박테리아 등을 포함하는 질병을 일으키는 개체를 지칭한다.Pathogen refers to a disease-causing individual, including, for example, viruses, bacteria, and bacteria.
예를 들어, 병원체 자체를 항원성 물질로 포함한 백신일 수 있다.For example, it may be a vaccine containing the pathogen itself as an antigenic substance.
예를 들어, 병원체의 일부를 항원성 물질로 포함한 백신일 수 있다.For example, it may be a vaccine containing a portion of the pathogen as an antigenic substance.
상기 병원체는 특정 부위가 변형 또는 조작된 것일 수 있다. 상기 변형과 조작은 자연적으로 또는 인위적으로 이루어질 수 있다.The pathogen may be a specific site modified or manipulated. The transformation and manipulation can be made naturally or artificially.
상기 병원체는 포유류 대상 질병의 병원체일 수 있다.The pathogen may be a pathogen of a disease targeting mammals.
예를 들어, 포유류는 돼지, 소, 양, 염소 등일 수 있으나 이에 제한하지는 않는다.For example, the mammal may be a pig, cow, sheep, goat, etc., but is not limited thereto.
예를 들어, 병원체는 클로스트리디움속(Clostridium)일 수 있다.For example, the pathogen may be Clostridium .
예를 들어, 포유류 대상 질병의 병원체는 클로스트리디움 퍼프링겐스(Clostridium perfringens)의 독소일 수 있다.For example, the pathogen of a disease targeting mammals may be a toxin of Clostridium perfringens .
클로스트리디움 퍼프링겐스는 그람 양성의 간균으로 포자를 형성하며 공기가 없는 혐기적 조건하에서 성장하는 혐기성 균이다. 클로스트리디움 퍼프링겐스는 4가지 독소(alpha, beta, epsilon, iota)의 생산 능력에 따라 5가지(A-E) 유형으로 분류되며 내독소(Enterotoxin, cpe)의 생산은 대부분 A 유형으로 분류되지만 C와 D 유형에서도 나타난다. Clostridium pufflingens is a Gram-positive bacillus that forms spores and grows under anaerobic conditions without air. Clostridium pufflingens are classified into five (AE) types according to the production capacity of four toxins (alpha, beta, epsilon, iota), and the production of endotoxins (Enterotoxin, cpe) is mostly classified as type A, but It also appears in type D.
본 출원의 백신은 돼지의 괴사성장염 병원체를 포함할 수 있다.The vaccine of the present application may contain a porcine necrotizing pathogen.
에피토프(epitope)는 항원 결정기라고 불리며, 항원을 식별하게 해주는 항원의 특정한 부위를 지칭한다.An epitope is called an antigenic determinant and refers to a specific site on an antigen that allows identification of the antigen.
예를 들어, 에피토프 자체를 항원성 물질로 포함한 백신일 수 있다.For example, it may be a vaccine containing the epitope itself as an antigenic substance.
예를 들어, 에피토프의 일부를 항원성 물질로 포함한 백신일 수 있다.For example, it may be a vaccine containing a portion of the epitope as an antigenic substance.
상기 에피토프는 특정 부위가 변형 또는 조작된 것일 수 있다. 상기 변형과 조작은 자연적으로 또는 인위적으로 이루어질 수 있다.The epitope may be a specific site modified or manipulated. The transformation and manipulation can be made naturally or artificially.
상기 에피토프는 1 이상의 독소를 포함할 수 있다. 독소는 외독소와 내독소를 포함할 수 있다. The epitope may contain one or more toxins. Toxins can include exotoxins and endotoxins.
상기 독소는 시가톡신(Shiga toxin), 이열성 독소(heat-labile toxin), 클로스트리디움 퍼프링겐스 톡신(Clostridium perfringens toxin), 캄필로박터 제주니 장독소(Campylobacter jejuni enterotoxin), 퍼츄시스 톡신(pertussis toxin), 시가 유사 톡신(shiga-like toxin 또는 verotoxin) 등을 포함할 수 있으나, 이에 한정하지는 않는다.The toxins are Shiga toxin, heat-labile toxin, Clostridium perfringens toxin, Campylobacter jejuni enterotoxin, and Perchsis toxin. pertussis toxin), a shiga-like toxin (or verotoxin), and the like, but are not limited thereto.
예를 들어, 1 이상의 클로스트리디움 퍼프링겐스 톡신(Clostridium perfringens toxin)을 포함한 백신일 수 있다. 이 때, 클로스트리디움 퍼프링겐스 톡신은 CPA(Clostridium perfringens toxin A)등을 포함할 수 있으나, 이에 한정하지는 않는다.For example, it may be a vaccine comprising one or more Clostridium perfringens toxin. In this case, the Clostridium perfringens toxin A (CPA) may be included, but is not limited thereto.
상기 항원결정부위는 클로스트리디움 퍼프링겐스(C.perfringens) 도메인 서열의 일부 또는 전체를 포함할 수 있다.The epitope may include part or all of the C. perfringens domain sequence.
상기 C.perfringens의 Phospholipase C (이하 plc)는 plc 도메인 1(Zn-dependent PLC), plc 도메인 2(PLAT)의 총 2개의 도메인을 포함하고 있다.Phospholipase C (hereinafter, plc) of C. perfringens contains a total of two domains: plc domain 1 (Zn-dependent PLC) and plc domain 2 (PLAT).
상기 항원결정부위는 plc 도메인 1 또는 plc 도메인 2 의 서열 일부 또는 전체를 포함할 수 있다.The epitope may include part or all of the sequence of
예를 들어, 항원결정부위는 plc 도메인 2의 서열 일부 또는 전체를 포함할 수 있다.For example, the epitope may include some or all of the sequence of
예를 들어, 본 출원의 항원결정부위는 SEQ ID NO. 4의 서열 일부 또는 전체를 포함할 수 있다.For example, the epitope of the present application is SEQ ID NO. It may include some or all of the sequence of 4.
상기 항원결정부위는 plc 도메인 2 의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.The epitope may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of
예를 들어, 본 출원의 항원결정부위는 SEQ ID NO. 4의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, the epitope of the present application is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 4.
예를 들어, SEQ ID NO. 1은 plc 도메인 2의 서열 일부 또는 전체를 포함할 수 있다.For example, SEQ ID NO. 1 may include some or all of the sequence of
예를 들어, SEQ ID NO. 1은 plc 도메인 2의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, SEQ ID NO. 1 may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of
예를 들어, SEQ ID NO. 1은 SEQ ID NO. 4의 서열 일부 또는 전체를 포함할 수 있다.For example, SEQ ID NO. 1 is SEQ ID NO. It may include some or all of the sequence of 4.
예를 들어, SEQ ID NO. 1은 SEQ ID NO. 4의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, SEQ ID NO. 1 is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 4.
예를 들어, SEQ ID NO. 2는 plc 도메인 2의 서열 일부 또는 전체를 포함할 수 있다.For example, SEQ ID NO. 2 may include some or all of the sequence of
예를 들어, SEQ ID NO. 2는 plc 도메인 2의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, SEQ ID NO. 2 may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of
예를 들어, SEQ ID NO. 2는 SEQ ID NO. 4의 서열 일부 또는 전체를 포함할 수 있다.For example, SEQ ID NO. 2 is SEQ ID NO. It may include some or all of the sequence of 4.
예를 들어, SEQ ID NO. 2는 SEQ ID NO. 4의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, SEQ ID NO. 2 is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 4.
상기 항원결정부위는 클로스트리디움 퍼프링겐스의 CPA 유전자일 수 있다.The epitope may be a CPA gene of Clostridium pufflingens.
예를 들어, 상기 항원결정부위는 클로스트리디움 퍼프링겐스의 CPA1 또는 CPA2 유전자일 수 있다.For example, the epitope may be a CPA1 or CPA2 gene of Clostridium pufflingens.
예를 들어, 본 출원의 항원결정부위는 도 4에 도시된 CPA1 또는 CPA2를 포함할 수 있다.For example, the epitope of the present application may include CPA1 or CPA2 shown in FIG. 4.
예를 들어, 항원결정부위는 CPA1 유전자의 서열 일부 또는 전체를 포함할 수 있다.For example, the epitope may include part or all of the sequence of the CPA1 gene.
예를 들어, 항원결정부위는 CPA1 유전자의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, the epitope may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of the CPA1 gene.
예를 들어, 항원결정부위는 CPA2 유전자의 서열 일부 또는 전체를 포함할 수 있다.For example, the epitope may include some or all of the sequence of the CPA2 gene.
예를 들어, 항원결정부위는 CPA2 유전자의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, the epitope may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of the CPA2 gene.
예를 들어, 본 출원의 CPA1 유전자의 서열은 SEQ ID NO. 1의 서열 일부 또는 전체를 포함할 수 있다.For example, the sequence of the CPA1 gene of the present application is SEQ ID NO. It may include some or all of the sequence of 1.
예를 들어, 본 출원의 CPA1 유전자의 서열은 SEQ ID NO. 1의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, the sequence of the CPA1 gene of the present application is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 1.
예를 들어, 본 출원의 CPA2 유전자의 서열은 SEQ ID NO. 2의 서열 일부 또는 전체를 포함할 수 있다.For example, the sequence of the CPA2 gene of the present application is SEQ ID NO. It may include some or all of the sequence of 2.
예를 들어, 본 출원의 CPA2 유전자의 서열은 SEQ ID NO. 2의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, the sequence of the CPA2 gene of the present application is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 2.
상기 CPA1 및 CPA2 유전자의 서열은 서로 70, 75, 80, 85, 90, 95 또는 100% 상동성이 존재할 수 있다.The sequences of the CPA1 and CPA2 genes may have 70, 75, 80, 85, 90, 95 or 100% homology to each other.
예를 들어, SEQ ID NO. 1과 SEQ ID NO. 2의 서열은 서로 70, 75, 80, 85, 90, 95 또는 100% 상동성이 존재할 수 있다.For example, SEQ ID NO. 1 and SEQ ID NO. The sequences of 2 may have 70, 75, 80, 85, 90, 95 or 100% homology to each other.
상기 항원결정부위는 CPA1 및 CPA2 유전자의 공통서열 일부 또는 전체를 포함할 수 있다.The epitope may include part or all of the consensus sequence of the CPA1 and CPA2 genes.
예를 들어, 항원결정부위는 SEQ ID NO. 3의 서열 일부 또는 전체를 포함할 수 있다.For example, the epitope is SEQ ID NO. It may include some or all of the sequence of 3.
예를 들어, 항원결정부위는 SEQ ID NO. 3의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, the epitope is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 3.
예를 들어, CPA1 유전자의 서열은 SEQ ID NO. 3의 서열 일부 또는 전체를 포함할 수 있다.For example, the sequence of the CPA1 gene is SEQ ID NO. It may include some or all of the sequence of 3.
예를 들어, SEQ ID NO. 1은 SEQ ID NO. 3의 서열 일부 또는 전체를 포함할 수 있다.For example, SEQ ID NO. 1 is SEQ ID NO. It may include some or all of the sequence of 3.
예를 들어, SEQ ID NO. 1은 SEQ ID NO. 3의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, SEQ ID NO. 1 is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 3.
예를 들어, CPA2 유전자의 서열은 SEQ ID NO. 3의 서열 일부 또는 전체를 포함할 수 있다.For example, the sequence of the CPA2 gene is SEQ ID NO. It may include some or all of the sequence of 3.
예를 들어, SEQ ID NO. 2는 SEQ ID NO. 3의 서열 일부 또는 전체를 포함할 수 있다.For example, SEQ ID NO. 2 is SEQ ID NO. It may include some or all of the sequence of 3.
예를 들어, SEQ ID NO. 2는 SEQ ID NO. 3의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100% 인 서열을 포함할 수 있다.For example, SEQ ID NO. 2 is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 3.
상기 항원결정부위는 클로스트리디움 퍼프링겐스의 CPA1 및 CPA2 유전자 서열을 포함할 수 있다.The epitope may include CPA1 and CPA2 gene sequences of Clostridium pufflingens.
예를 들어, 상기 항원결정부위는 CPA1 유전자 서열 일부 및 CPA2 유전자 서열 전체를 포함할 수 있다.For example, the epitope may include part of the CPA1 gene sequence and the entire CPA2 gene sequence.
예를 들어, 상기 항원결정부위는 CPA1 유전자 서열 일부 및 CPA2 유전자 서열 일부를 포함할 수 있다.For example, the epitope may include a part of the CPA1 gene sequence and a part of the CPA2 gene sequence.
예를 들어, 상기 항원결정부위는 CPA1 유전자 서열 전체 및 CPA2 유전자 서열 일부를 포함할 수 있다.For example, the epitope may include the entire CPA1 gene sequence and a part of the CPA2 gene sequence.
예를 들어, 상기 항원결정부위는 CPA1 유전자 서열 전체 및 CPA2 유전자 서열 전체를 포함할 수 있다.For example, the epitope may include the entire CPA1 gene sequence and the entire CPA2 gene sequence.
예를 들어, 상기 항원결정부위는 SEQ ID NO. 1 일부 및 SEQ ID NO. 2 일부를 포함할 수 있다.For example, the epitope is SEQ ID NO. 1 part and SEQ ID NO. 2 may contain some.
예를 들어, 상기 항원결정부위는 SEQ ID NO. 1 일부 및 SEQ ID NO. 2 전체를 포함할 수 있다.For example, the epitope is SEQ ID NO. 1 part and SEQ ID NO. 2 May contain all.
예를 들어, 상기 항원결정부위는 SEQ ID NO. 1 전체 및 SEQ ID NO. 2 일부를 포함할 수 있다.For example, the epitope is SEQ ID NO. 1 full and SEQ ID NO. 2 May contain some.
예를 들어, 상기 항원결정부위는 SEQ ID NO. 1 전체 및 SEQ ID NO. 2 전체를 포함할 수 있다.For example, the epitope is SEQ ID NO. 1 full and SEQ ID NO. 2 May contain all.
상기 에피토프는 2 이상이 서로 예를 들어 단일 결합, 이중 결합 등의 결합 방식에 의해 연결된 다중 에피토프도 포함할 수 있다.The epitope may also include multiple epitopes in which two or more are linked to each other by, for example, a single bond or a double bond.
예를 들어, 본 출원의 백신은 돼지의 괴사성장염 항원성 물질을 포함할 수 있다.For example, the vaccine of the present application may contain a porcine necrotizing antigenic substance.
본 출원은 종래 백신의 한계를 해결 또는 최소화 할 수 있다. 특히, 종래 돼지의 괴사성장염 백신의 한계를 해결 또는 최소화 할 수 있다.This application can solve or minimize the limitations of conventional vaccines. In particular, it is possible to solve or minimize the limitations of the conventional pig necrotizing vaccine.
본 출원은 상기 항원성 물질을 1 이상 포함한 백신으로, 질병을 일으키는 원인체의 변이에 신속하게 대응할 수 있다. 특히, 1 이상의 돼지의 괴사성장염 독소를 항원성 물질로 포함하고 있어서 돼지의 괴사성장염의 예방 또는/및 치료에 용이하게 사용할 수 있다.The present application is a vaccine containing one or more antigenic substances, and can rapidly respond to mutations in the cause of the disease. In particular, since it contains one or more toxins of pig's necrotizing toxin as an antigenic substance, it can be easily used for prevention or/and treatment of pig's necrotizing inflammation.
2. 괴사성장염(Necrotic enteritis)2. Necrotic enteritis
본 출원은 괴사성장염의 예방 또는/및 치료를 표적 하는 백신일 수 있다.The present application may be a vaccine targeting the prevention or/and treatment of necrotizing inflammation.
특히, 본 출원은 돼지의 괴사성장염의 예방 또는/및 치료를 표적하는 백신일 수 있다.In particular, the present application may be a vaccine targeting the prevention or/and treatment of necrotizing growth in pigs.
상기 돼지의 괴사성장염은 클로스트리디움균에 의한 질병이다.The necrotizing growth of pigs is a disease caused by Clostridium bacteria.
상기 클로스트리디움균은 Clostridium botulinum, Clostridium difficile, Clostridium perfringens 등일 수 있으나 이에 한정하지는 않는다.The Clostridium bacterium may be Clostridium botulinum, Clostridium difficile, Clostridium perfringens , but is not limited thereto.
예를 들어, 본 출원의 돼지의 괴사성장염은 클로스트리디움 퍼프링겐스 (Clostridium perfringens)일 수 있다.For example, the necrotizing growth salt of pigs of the present application may be Clostridium perfringens .
예를 들어, 본 출원의 돼지의 괴사성장염은 클로스트리디움 퍼프링겐스의 A형 균, B형 균, C형 균, D형 균일 수 있다.For example, the necrotizing growth salt of pigs of the present application may be homogeneous type A, type B, type C, and type D of Clostridium pufflingens.
상기 괴사성장염은 클로스트리디움 퍼프링겐스의 클로스트리디움 퍼프링겐스균이 분비하는 독소에 의해 장의 모세혈관, 장의 점막 등이 손상되는 질병이다.The necrotizing inflammation is a disease in which capillaries of the intestine, mucous membranes of the intestine, etc. are damaged by toxins secreted by Clostridium pufflingens of Clostridium pufflingens.
클로스트리디움 퍼프링겐스의 A형 균은 알파톡신(α-toxin)을 생성; 클로스트리디움 퍼프링겐스의 B형 균은 알파톡신(α-toxin), 베타톡신(β-toxin), 엡실론톡신(ε-toxin)을 생성; 클로스트리디움 퍼프링겐스의 C형 균은 알파톡신(α-toxin), 베타톡신(β-toxin)을 생성; 클로스트리디움 퍼프링겐스의 D형 균은 알파톡신(α-toxin), 엡실론톡신(ε-toxin)의 독소를 생성하는 것으로 알려져 있다.Clostridium pufflingens type A bacteria produce α-toxin; Clostridium pufflingens type B bacteria produce alpha toxin (α-toxin), beta toxin (β-toxin), and epsilon toxin (ε-toxin); Clostridium pufflingens type C bacteria produce alpha toxin (α-toxin) and beta toxin (β-toxin); Clostridium pufflingens type D bacteria are known to produce toxins such as alpha toxin (α-toxin) and epsilon toxin (ε-toxin).
상기 클로스트리디움 퍼프링겐스 독소는 돼지의 괴사성장염을 일으키는 원인체(또는 항원성 물질)일 수 있다.The Clostridium puffingens toxin may be a causative agent (or antigenic substance) that causes necrotizing growth in pigs.
상기 돼지의 괴사성장염과 관련 있는 유전자는 병원성에 직접적으로 관여하는 예를 들어 알파톡신(α-toxin), 베타톡신(β-toxin), 엡실론톡신(ε-toxin) 등이 있을 수 있으나, 본 출원에서는 돼지의 괴사성장염과 관련된 모든 인자를 포함하는 것으로 한다.Genes related to necrotizing growth in pigs may include, for example, alpha toxin (α-toxin), beta toxin (β-toxin), epsilon toxin (ε-toxin), etc. that are directly involved in pathogenicity, but the present application It is assumed that all factors related to porcine necrotizing disease are included.
예를 들어, 본 출원의 돼지의 괴사성장염 백신은 클로스트리디움 퍼프링겐스의 A형 균을 포함할 수 있다.For example, the pig's necrotizing infection vaccine of the present application may include Clostridium pufflingens type A.
예를 들어, 상기 돼지의 괴사성장염 백신은 SEQ ID NO. 1 또는 2에서 선택되는 1이상을 포함할 수 있다.For example, the porcine necrotizing infection vaccine is SEQ ID NO. It may include one or more selected from 1 or 2.
예를 들어, 본 출원의 돼지의 괴사성장염 백신은 SEQ ID NO. 1의 일부 또는 전체를 포함할 수 있다.For example, the pig necrotitis vaccine of the present application is SEQ ID NO. It may contain some or all of 1.
예를 들어, 본 출원의 돼지의 괴사성장염 백신은 SEQ ID NO. 2의 일부 또는 전체를 포함할 수 있다.For example, the pig necrotitis vaccine of the present application is SEQ ID NO. It may contain some or all of 2.
예를 들어, 상기 돼지의 괴사성장염 백신은 SEQ ID NO. 1 또는 2에서 선택되는 1이상과 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 포함할 수 있다.For example, the porcine necrotizing infection vaccine is SEQ ID NO. It may include a sequence of 70, 75, 80, 85, 90, 95 or 100% homology with one or more selected from 1 or 2.
상기 괴사성장염 백신은 plc 도메인2의 서열의 일부 또는 전체를 포함할 수 있다.The necrotizing growth infection vaccine may contain part or all of the sequence of
예를 들어, 상기 돼지의 괴사성장염 백신은 SEQ ID NO. 4의 일부 또는 전체를 포함할 수 있다.For example, the porcine necrotizing infection vaccine is SEQ ID NO. It may contain some or all of 4.
상기 괴사성장염 백신은 plc 도메인2의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 포함할 수 있다.The necrotizing vaccine may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of
예를 들어, 상기 돼지의 괴사성장염 백신은 SEQ ID NO. 4와 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 포함할 수 있다.For example, the porcine necrotizing infection vaccine is SEQ ID NO. 4 and may include sequences with 70, 75, 80, 85, 90, 95 or 100% homology.
상기 괴사성장염 백신은 CPA1과 CPA2의 공통서열을 포함할 수 있다.The necrotizing growth infection vaccine may contain a common sequence of CPA1 and CPA2.
예를 들어, 상기 돼지의 괴사성장염 백신은 SEQ ID NO. 3의 일부 또는 전체를 포함할 수 있다.For example, the porcine necrotizing infection vaccine is SEQ ID NO. It may contain some or all of 3.
이하에서 CPA로 기재될 경우 클로스트리디움 퍼프링겐스의 A형 균인 것으로 해석하는 것으로 한다.When described as CPA below, it is interpreted as being a type A bacteria of Clostridium puffingens.
2-1. 괴사성장염 백신2-1. Necrotizing Vaccine
괴사성장염은 클로스트리디움 퍼프링겐스(Clostridium perfringens)의 독소에 의해 발병하며 이 균이 생성한 독소가 장관벽을 손상시켜 사망률을 증가시키고 성장을 저해하는 질병이다. Necrotizing growthitis is caused by a toxin of Clostridium perfringens , and the toxin produced by this fungus damages the intestinal wall, increasing mortality and inhibiting growth.
클로스트리디움균은 건강한 돼지의 장관에 정상적으로 존재하는 정상 세균총(Normal flora)의 하나이지만 이 세균이 증식하기 좋은 환경이 장관에서 형성되어 과증식되는 경우 질병으로 발전된다.Clostridium bacteria is one of the normal flora that normally exists in the intestine of healthy pigs, but it develops into a disease when the environment is formed in the intestine and is overgrown with a good environment for this bacteria to grow.
돼지가 괴사성장염에 걸리면 심각한 체중 저하, 설사 등의 증상이 생기고 심지어 폐사에까지 이르게 한다. When pigs suffer from necrotizing growth, symptoms such as severe weight loss, diarrhea, etc. occur, and even lead to death.
클로스트리디움 퍼프링겐스 A형 균은 기본적으로 아포를 형성하는 균으로, 외부에서 소독약에 저항성을 가지게 되어 농장내에서 제거하기가 쉽지 않다. 감염모돈이 분만사내에 입식되어 변을 보면서 분변내 클로스트리디움 퍼프링겐스 A형균이 분만틀에 자리를 잡으면, 다음 분만사 입식돈이 클로스트리디움 퍼프링겐스 A형균에 음성이라도 분만자돈에 감염되어 이에 의한 설사가 지속될 수 있다.Clostridium pufflingens type A is basically a spore-forming bacteria, and it is not easy to remove inside the farm because it has resistance to disinfectants from the outside. If the infected sows are stocked in the delivery house and the Clostridium puffingens type A bacteria in the feces settle in the delivery frame while looking at the stool, the next delivery person's stocking pigs are infected with the delivery piglets even though they are negative for Clostridium pufflingens type A Diarrhea may persist.
현재로서 국내 양돈장에서 클로스트리디움 퍼프링겐스 A형균이 문제가 되는 농장에서 적용할 수 있는 최선의 방법으로는 종래에는 배합사료에 항생제를 첨가하여 세균성 질병 억제 등을 통해 성창촉진제로 역할을 하여 가축 생산성이 증가하였으나, 항생제 내성 문제가 제기 되면서 항생제 첨가를 금지하거나 제한되었다.As of now, the best method that can be applied to farms where Clostridium pufflingens type A is a problem in domestic pig farms is conventionally, by adding antibiotics to compounded feed to suppress bacterial diseases, thereby acting as a stimulating agent for livestock. Productivity increased, but the addition of antibiotics was prohibited or restricted as the problem of antibiotic resistance was raised.
돼지의 괴사성장염을 예방하기 위한 여러 노력에도 불구하고 최근 유럽에서는 항생제 또는 성장 촉진제 등의 사용금지에 대한 규제가 증가하고 있어 이제 따라 본 질병이 더욱 증가하는 추세로 새로운 돼지의 괴사성장염 백신이 필요하다.In spite of various efforts to prevent necrotizing growth in pigs, regulations on banning the use of antibiotics or growth promoters are increasing in Europe in recent years. .
상기 괴사성장염의 예방 또는/및 치료를 표적 하는 백신은 제조방법에 따라 사백신(killed vaccine), 약독화백신(attenuated vaccine), 성분백신(Component vaccine), DNA 백신 (DNA vaccine), 재조합 백신(recombinant vaccine) 등을 이용한 백신일 수 있으나 백신을 제조할 수 있는 방법이라면 모두 포함하는 것으로 하며, 이에 제한하지는 않는다.Vaccines targeting the prevention or/and treatment of necrotizing growth are killed vaccines, attenuated vaccines, component vaccines, DNA vaccines, recombinant vaccines according to the manufacturing method. vaccine), etc., but any method capable of producing a vaccine is included, but is not limited thereto.
상기 사백신은 바이러스나 세균의 전부 도는 일부를 화학물질이나 열 등을 이용화여 불활화시켜 제조한 백신을 지칭한다.The dead vaccine refers to a vaccine prepared by inactivating all or part of a virus or bacteria using chemical substances or heat.
상기 약독화 백신은 질병을 일으키는 바이러스나 세균의 일부분을 변형시켜 자기 번식 및 면역 유발 능력은 있으나 독성을 일으키는 능력은 제거시켜 제조한 백신을 지칭한다.The attenuated vaccine refers to a vaccine manufactured by modifying a portion of a virus or bacteria causing a disease to have the ability to induce self-reproduction and immunity, but remove the ability to cause toxicity.
상기 성분 백신은 병원체의 대사과정에서 생성되거나 병원체 자체가 가지고 있는 독소(toxin)를 가열하거나 포르말린 등의 약품을 처리하여 제조한 백신을 지칭한다. 성분 백신은 소단위백신(subunit vaccine), 아단위백신, 특이항원 추출백신으로도 지칭될 수 있다.The component vaccine refers to a vaccine produced in the process of metabolism of a pathogen or by heating a toxin possessed by the pathogen itself or by treating a drug such as formalin. Component vaccines may also be referred to as subunit vaccines, subunit vaccines, and specific antigen extraction vaccines.
상기 DNA 백신은 플라스미드 DNA(plasmid DNA)를 사용하여 유전자를 전달하는 방법으로 제조된 백신을 지칭한다. 상기 플라스미드 DNA는 유전자를 발현하기 위한 여러 가지 유전 요소들을 가지고 있어, 세포 내에 들어가면 삽입되어 있는 유전자로부터 항원을 발현하게 하는 것을 의미한다.The DNA vaccine refers to a vaccine prepared by transferring a gene using plasmid DNA. The plasmid DNA has various genetic elements for expressing a gene, and when it enters a cell, it means that the antigen is expressed from the inserted gene.
상기 재조합 백신은 병원체에서 항원으로 작용하는 부위만을 유전자조작을 통하여 만들어 제조된 백신을 지칭한다. 이 때, 유전자조작은 재조합기술을 이용하여 항원의 유전자를 다른 세포 내에 도입하여 발현시키는 기술을 지칭한다.The recombinant vaccine refers to a vaccine manufactured by genetic engineering only a site that acts as an antigen in a pathogen. In this case, genetic manipulation refers to a technology that introduces and expresses an antigen gene into another cell using recombinant technology.
상기 재조합 백신을 만들 때 사용되는 재조합기술은 벡터를 이용하는 방법, 비벡터를 이용하는 방법, 유전체 편집을 이용하는 방법 등 유전자조작이 가능한 기술이라면 이에 제한하지 않는다.The recombinant technology used when making the recombinant vaccine is not limited thereto as long as it is a technology capable of genetic manipulation such as a method using a vector, a method using a non-vector, and a method using genome editing.
상기 벡터는 비바이러스 벡터, 바이러스 벡터 등 통상적으로 유전자를 운반할 수 있는 기능을 가진 기능을 가진 모두를 포함할 수 있다.The vector may include all of a non-viral vector, a viral vector, and the like, which have a function capable of carrying a gene.
상기 바이러스 벡터의 바이러스는 DNA 바이러스 또는 RNA 바이러스일 수 있다.The virus of the viral vector may be a DNA virus or an RNA virus.
상기 DNA 바이러스는 이중가닥 DNA(ds DAN)바이러스 또는 단일가닥 DNA(ss DNA)바이러스 일 수 있다.The DNA virus may be a double-stranded DNA (ds DAN) virus or a single-stranded DNA (ss DNA) virus.
상기 바이러스 벡터는 아데노바이러스 벡터, 레트로바이러스 벡터, 렌티바이러스 벡터, 아데노-연관 바이러스(AAV) 벡터, 백시니아바이러스 벡터, 폭스바이러스 벡터, 단순포진바이러스 등일 수 있으나, 이에 제한하지는 않는다.The viral vector may be an adenovirus vector, a retrovirus vector, a lentiviral vector, an adeno-associated virus (AAV) vector, a vaccinia virus vector, a poxvirus vector, a herpes simplex virus, etc., but is not limited thereto.
바이러스 벡터는 유전자전달 효율이 높으나 병원성이 있는 바이러스이므로 안전성의 문제 및 벡터 내 삽입 가능한 유전자의 크기에도 제한적일 수 있다.Viral vectors have high gene transfer efficiency, but because they are pathogenic viruses, safety issues and the size of genes that can be inserted into vectors may be limited.
상기 비바이러스 벡터는 플라스미드(Plasmid), 네이키드 DNA(naked DNA), 리포좀(Liposome) 등일 수 있으나, 이에 제한하지는 않는다.The non-viral vector may be a plasmid, naked DNA, liposome, or the like, but is not limited thereto.
비바이러스 벡터는 인체 세포 내 바이러스 유전물질의 유입이 되지 않으며 생산의 용이성, 벡터 내 삽입 유전자의 크기 무제한성 및 숙주에 대한 면역 반응이 낮음에 따른 낮은 부작용 등이 장점이 될 수도 있으나, 바이러스 벡터에 비해 세포 내 도입 효율이 현저하게 낮은 단점이 발생할 수 있다.Non-viral vectors do not introduce viral genetic material into human cells, and their ease of production, unlimited size of the inserted gene in the vector, and low side effects due to low immune response to the host may be advantageous. Compared to this, there may be a disadvantage in that the efficiency of introduction into cells is significantly lower.
상기 비벡터는 전기천공법, 유전자총, 초음파천공법, 자기주입법, 일시적인 세포의 압축 또는 스퀴징, 지질-매개 형질감염, 나노입자, 실리카 등의 방법을 포함할 수 있으나 벡터를 사용하지 않는 방법이라면 이에 제한하지 않는다.The non-vector may include methods such as electroporation, gene gun, ultrasonic perforation, self-injection, temporary cell compression or squeezing, lipid-mediated transfection, nanoparticles, silica, etc. If so, it is not limited thereto.
상기 유전체 편집을 이용하는 방법은 ZFN(Zinc-finger nucleases), TALEN(transcription activator-like effector nucleases), CRISPR/Cas(Clustered Regularly Interspaced Short Palindromic Repeats/ CRISPR-associated sequences)의 등을 포함할 수 있으나, 특정 DNA부위를 자르는데 사용하는 인공 효소를 이용하여 유전자의 표적 부위를 편집할 수 있는 기술이라면 이에 제한하지 않는다.The method of using the genome editing may include ZFN (Zinc-finger nucleases), TALEN (transcription activator-like effector nucleases), CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/ CRISPR-associated sequences), etc. If it is a technology capable of editing a target site of a gene using an artificial enzyme used to cut a DNA site, it is not limited thereto.
상기 ZFN는 특정 DNA 염기서열을 인식하여 결합할 수 있는 Zinc finger protein과 DNA를 절단할 수 있는 FokI restriction endonuclease 도멘인으로 구성되어 있는 유전체 편집 기술을 지칭한다.The ZFN refers to a genome editing technology composed of a Zinc finger protein capable of recognizing and binding a specific DNA sequence and a FokI restriction endonuclease domain capable of cleaving DNA.
상기 TALEN은 DNA binding domain과 FokI nuclease domain으로 구성되어 있는 유전체 편집 기술을 지칭한다.The TALEN refers to a genome editing technology composed of a DNA binding domain and a FokI nuclease domain.
상기 CRISPR/Cas는 RGEN(RNA-guided endonuclease)로도 불리며, 상기 ZFN 및 TALEN과는 다르게 RNA에 의해 DNA 염기서열 특이성이 유도되는 유전체 편집 기술을 지칭한다.The CRISPR/Cas is also called RGEN (RNA-guided endonuclease), and refers to a genome editing technique in which DNA sequence specificity is induced by RNA, unlike ZFN and TALEN.
본 출원에서 개시되는 백신은 CRISPR/Cas를 이용하여 만든 돼지의 괴사성장염 백신 일 수 있다.The vaccine disclosed in the present application may be a pig's necrotizing infection vaccine made using CRISPR/Cas.
특히, 본 출원에서 개시되는 백신은 spCas9을 이용하여 만든 돼지의 괴사성장염 백신일 수 있다.In particular, the vaccine disclosed in the present application may be a pig's necrotizing infection vaccine made using spCas9.
CRISPR/Cas는 주기적 간격으로 분포하는 짧은 회문 구조의 반복(Clustered Regularly Interspaced Short Palindromic Repeats: CRISPR)과, 연관된 서열(cas)과의 조합된 것을 지칭한다.CRISPR/Cas refers to a combination of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and associated sequences (cas) distributed at periodic intervals.
상기 CRISPR/Cas 시스템은 가이드 RNA 및 Cas 단백질로 구성되어 있다.The CRISPR/Cas system consists of a guide RNA and a Cas protein.
상기 가이드 RNA는 표적 서열을 인식할 수 있는 RNA를 의미하며, Cas 단백질과 결합하여 Cas 단백질을 표적 서열로 안내할 수 있는 기능을 가진 것을 지칭한다.The guide RNA refers to an RNA capable of recognizing a target sequence, and refers to a function capable of guiding a Cas protein to a target sequence by binding to a Cas protein.
상기 가이드 RNA는 crRNA(CRISPR RNA) 또는/및 tracrRNA(trans-activating crRNA)를 포함할 수 있다. 상기 crRNA와 상기 tracrRNA의 특정 부위가 융합된 형태를 sgRNA(sinlge-chain guide RNA)로 지칭할 수 있다.The guide RNA may include crRNA (CRISPR RNA) or/and tracrRNA (trans-activating crRNA). The form in which the crRNA and the specific site of the tracrRNA are fused may be referred to as sgRNA (sinlge-chain guide RNA).
상기 Cas 단백질은 표적 서열 또는 유전자를 절단할 수 있는 기능을 수행하는 단백질을 지칭하며, 상기 Cas 단백질은 효소를 포함할 수 있으며 상기 효소는 뉴클레아제, 프로테아제, 제한효소 등을 포함할 수 있으나 이에 제한하지는 않는다.The Cas protein refers to a protein that performs a function of cleaving a target sequence or gene, and the Cas protein may include an enzyme, and the enzyme may include a nuclease, a protease, a restriction enzyme, etc. It is not limited.
상기 유전자가위 단백질은 자연 상태에 존재하는 또는 존재하지 않는 인위적으로 생성된 효소 또는 단백질의 형태 또는 그것들의 일부가 변형된 형태를 포함할 수 있다.The gene-scissor protein may include an artificially generated enzyme or protein that exists or does not exist in a natural state, or a form in which a part of them is modified.
상기 효소는 CRISPR 효소일 수 있다.The enzyme may be a CRISPR enzyme.
상기 CRISPR 효소는 CRISPR-Cas 시스템을 구성하는 단백질로서, 가이드핵산과 결합하여 복합체를 형성하여 표적 서열을 절단 또는 위치를 변형시키는 기능을 수행할 수 있다.The CRISPR enzyme is a protein constituting the CRISPR-Cas system, and may perform a function of cleaving or modifying a target sequence by binding to a guide nucleic acid to form a complex.
상기 CRISPR 효소는 효소의 활성을 변경시켜 불완전 또는 부분 활성을 가지도록 변형한 형태를 포함할 수 있다.The CRISPR enzyme may include a form modified to have incomplete or partial activity by altering the activity of the enzyme.
상기 CRISPR 효소는 Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9(Csn1 및 Csx12로도 알려짐), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1 등의 자연상태로 존재하는 것 또는 인위적으로 변형된 형태를 포함할 수 있으나, 이에 제한하지는 않는다.The CRISPR enzymes are Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2 , Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csf3, Csf2, Csf4 , Cpf1, etc. may be present in a natural state or may include an artificially modified form, but is not limited thereto.
상기 CRISPR 효소는 CRISPR 시스템의 종류에 따라 크게 6가지의 Type으로 나눌 수 있다. Type I은 Cas1, Cas2, Cas3, Cas8 등으로 구성될 수 있고; Type II는 Cas1, Cas2, Cas2/Cas4, Cas9 등으로 구성될 수 있고; Type III는 Cas5, Cas6, Cmr1, Cmr3, Cmr4, Cmr5, Cas5/Cmr1, Cam2, Cmr5 등으로 구성될 수 있고; Type IV는 Csf1, Csf2, Csf3 등으로 구성될 수 있고; Type V는 Cas1, Cas2, Cas1, Cas2, Cas4, Cpf1, Cpf2 등으로 구성될 수 있고; Type VI는 C2C2, Cas1, Cas2 등으로 구성될 수 있으나, 이에 한정하지 않는다.The CRISPR enzyme can be largely divided into 6 types according to the type of CRISPR system. Type I may be composed of Cas1, Cas2, Cas3, Cas8, and the like; Type II may be composed of Cas1, Cas2, Cas2/Cas4, Cas9, and the like; Type III may be composed of Cas5, Cas6, Cmr1, Cmr3, Cmr4, Cmr5, Cas5/Cmr1, Cam2, Cmr5, and the like; Type IV may be composed of Csf1, Csf2, Csf3, and the like; Type V may be composed of Cas1, Cas2, Cas1, Cas2, Cas4, Cpf1, Cpf2, and the like; Type VI may be composed of C2C2, Cas1, Cas2, etc., but is not limited thereto.
상기 CRISPR 효소의 Type 중 Type II의 Cas9과 Type V의 Cpf1이 일반적으로 가장 많이 사용된다.Among the types of the CRISPR enzyme, Type II Cas9 and Type V Cpf1 are generally used most.
본 출원의 CRISPR/Cas 시스템에서 CRISPR 효소는 Cas9을 사용할 수 있다.In the CRISPR/Cas system of the present application, Cas9 may be used as the CRISPR enzyme.
상기 Cas9은 스트렙토코커스 피오게네스(Streptococcus pyogenes), 스트렙토코커스 써모필러스(Streptococcus thermophilus), 스트렙토코커스 속(Streptococcus spp.), 황색포도상구균(Staphylococcus aureus), 노카르디옵시스 다손빌레이(Nocardiopsis dassonvillei), 스트렙토마이세스 프리스티네스피랄리스(Streptomyces pristinaespiralis), 스트렙토마이세스 비리도크로모게네스(Streptomyces viridochromogenes), 스트렙토마이세스 비리도크로모게네스(Streptomyces viridochromogenes), 스트렙토스포랑기움 로세움(Streptosporangium roseum), 스트렙토스포랑기움 로세움(Streptosporangium roseum), 알리사이클로바클루스 아시도칼다리우스(AlicyclobacHlus acidocaldarius), 바실러스 슈도마이코이데스(Bacillus pseudomycoides), 바실러스 셀레니티레두센스(Bacillus selenitireducens), 엑시구오박테리움 시비리쿰(Exiguobacterium sibiricum), 락토바실러스 델브루에키이(Lactobacillus delbrueckii), 락토바실러스 살리바리우스(Lactobacillus salivarius), 미크로스 킬라 마리나(Microscilla marina), 부르크홀데리아레스 박테리움(Burkholderiales bacterium), 폴라로모나스 나프탈레니보란스(Polaromonas naphthalenivorans), 폴라로모나스 속(Polaromonas spp.), 크로코스파에라 와트소니이(Crocosphaera watsonii), 시아노테세 속(Cyanothece spp.), 마이크로시스티스 아에루기노사(Microcystis aeruginosa), 시네코코커스 속(Synechococcus spp.), 아세토할로비움 아라바티쿰(Acetohalobium arabaticum), 암모니펙스 데겐시이(Ammonifex degensii), 칼디셀룰로시럽토 베시이(Caldicelulosiruptor bescii), 칸디다투스 데술포루디스(Candidatus Desulforudis), 클로스트리듐 보툴리눔(Clostridium botulinum), 클로스트리듐 디피실레(Clostridium difficile), 피네골디아 마그나(Finegoldia magna), 나트라나에로비우스 써모필러스 (Natranaerobius thermophilus), 펠로토마쿨럼 써모프로피오니쿰(Pelotomaculum thermopropionicum), 아시디티오바실러스 칼두스(Acidithiobacillus caldus), 아시디티오바실러스 페로옥시단스(Acidithiobacillus ferrooxidans), 알로크로마티움 비노숨(Allochromatium vinosum), 마리노박터 속(Marinobacter sp.), 니트로소코커스 할로필러스(Nitrosococcus halophilus), 니트로소코커스 와트소니(Nitrosococcus watsoni), 슈도알테로 모나스 할로플란크티스(Pseudoalteromonas haloplanktis), 크테도노박테르 라세미페르(Ktedonobacter racemifer), 메타노할로비움 에베스티가툼(Methanohalobium evestigatum), 아나베나 바리아빌리스(Anabaena variabilis), 노둘라리아 스푸미게나(Nodularia spumigena), 노스톡 속(Nostoc spp.), 아르트로스피라 맥시마(Arthrospira maxima), 아르트로스피라 플라텐시스(Arthrospira platensis), 아르트로스피라 속(Arthrospira spp.), 링비아속(Lyngbya spp.), 마이크로콜레우스 크토노플라스테스(Microcoleus chthonoplastes), 오실라토리아 속(Oscillatoria spp.), 페트로토가 모빌리스(Petrotoga mobilis), 써모시포 아프리카누스(Thermosipho africanus) 또는 아카리오클로리스 마리나(Acaryochloris marina) 등 다양한 미생물 유래의 Cas9일 수 있다.The Cas9 is Streptococcus pyogenes , Streptococcus thermophilus , Streptococcus spp., Staphylococcus aureus , Nocardiopsis dassonville ( Nocardiopsis dassonville ) , Streptomyces pristinaespiralis , Streptomyces viridochromogenes , Streptomyces viridochromogenes , Streptomyces viridochromogenes , Streptosporangium roseum , Streptosporangium roseum , AlicyclobacHlus acidocaldarius , Bacillus pseudomycoides , Bacillus selenitireducense , Bacillus selenitireducens Exiguobacterium sibiricum , Lactobacillus delbrueckii , Lactobacillus salivarius , Microscilla marina , Burkholderiales bacterium , Burkholderiales bacterium Lenny Boran's (Polaromonas naphthalenivorans), Pseudomonas genus (Polaromonas spp.), Black COSPA Era watts soniyi (Crocosphaera watsonii), cyano tese in (Cyanothece spp.), micro-hour seutiseu Ah labor (Microcystis aeruginosa) rugi in a polar , Cinecocoker Synechococcus spp., Acetohalobium arabaticum , Ammonifex degensii , Caldiceluloforsiruptor bescii , Candidatus desulforudis , Candidatus desulforudis Clostridium botulinum , Clostridium difficile , Finegoldia magna , Natranaerobius thermophilus , Pelotomaculum , Pelotomaculum thermopropionicum ), Acidithiobacillus caldus , Acidithiobacillus ferrooxidans , Allochromatium vinosum , Marinobacter sp., Nitrophilus halo Scotland (Nitrosococcus halophilus), nitroso Caucus watt Sony (Nitrosococcus watsoni), pseudo Alteromonas halo flan large teeth (Pseudoalteromonas haloplanktis), keute also Novak Hotel racemic Pere (Ktedonobacter racemifer), to be meta furnace Away Avenue Frosty the Tomb ( Methanohalobium evestigatum ), Anabaena variabilis , Nodularia spumigena , Nostoc spp., Arthrospira maxima , Arthrospira maxima , Arthrospira platen Cis ( Arthrospira platensis ), Arthrospira spp., Lyngbya spp., Microcoleus chthonoplastes , Oscillatoria spp., Petrotoga mobilis , Thermosipho africanus or Acaryochloris marina , etc. It may be a microbial-derived Cas9.
또한, 상기 Cpf1은 Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium 또는 Acidaminococcus 유래의 Cpf1일 수 있다.In addition, the Cpf1 is Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacterium, Corynebacter, Carnobacterium, Rhodobacterium, Listtriceria, Paludidium, Francisaceae, Lepidella, Paludidium, Francis, , Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium or Cpf1 derived from Acidaminococcus.
상기 CRISPR 효소는 가이드핵산과 상호작용하여 복합체를 형성하여 표적 핵산 또는 유전자의 표적 서열을 절단 또는 위치를 변형시키는 기능을 수행할 수 있다. 이 때, 그 기능은 상기 CRISPR 효소가 직접적으로 인지하는 PAM(protospacer adjacent motif)을 포함해야 한다. 즉, 상기 PAM의 염기서열은 CRISPR 효소의 종에 따라 달라진다. 예를 들어, 일반적으로 많이 사용되는, Streptococcus pyogenes 에서 유래된 Cas9 단백질의 경우 5'-NGG-3'가 PAM 염기서열이 된다. 예를 들어, Staphylococcus aureus 에서 유래된 Cas9 단백질은 5'-NNGRRT-3'를 PMA 염기서열로 가진다. 결과적으로 상기 표적 핵산 또는 유전자의 표적 서열을 절단 또는 위치의 변형을 수행할 때, CRISPR 효소의 종의 선택에 따라 필수적으로 PAM의 염기서열이 바뀌며, 그것들에 의해 표적 서열을 절단 또는 위치의 변형이 결정된다. The CRISPR enzyme may interact with a guide nucleic acid to form a complex, thereby performing a function of cleaving or modifying a target sequence of a target nucleic acid or gene. In this case, the function should include a protospacer adjacent motif (PAM) that is directly recognized by the CRISPR enzyme. That is, the base sequence of the PAM varies depending on the species of CRISPR enzyme. For example, in the case of the Cas9 protein derived from Streptococcus pyogenes , which is commonly used, 5'-NGG-3' becomes the PAM sequence. For example, the Cas9 protein derived from Staphylococcus aureus has 5'-NNGRRT-3' as the PMA sequence. As a result, when the target sequence of the target nucleic acid or gene is cut or modified, the base sequence of PAM is essentially changed according to the selection of the species of the CRISPR enzyme, thereby cutting the target sequence or modifying the position. Is determined.
본 출원의 CRISPR/Cas 시스템은 대상(target)을 조작하는데 사용될 수 있다.The CRISPR/Cas system of the present application can be used to manipulate a target.
상기 조작은 넉아웃(Knock-out), 넉인(Knock-in), 넉다운(Knock-down) 중 선택되는 어느 하나 이상일 수 있다.The manipulation may be any one or more selected from knock-out, knock-in, and knock-down.
예를 들어, 상기 조작은 넉인일 수 있다.For example, the manipulation may be knock-in.
예를 들어, 상기 조작은 넉아웃일 수 있다.For example, the manipulation may be a knockout.
상기 대상은 표적 핵산 또는 유전자를 포함하는 유기체일 수 있다.The subject may be an organism containing a target nucleic acid or gene.
상기 유기체는 세포, 조직, 식물, 동물 또는 인간일 수 있다.The organism may be a cell, tissue, plant, animal or human.
예를 들어, 상기 유기체는 포유류일 수 있다.For example, the organism can be a mammal.
예를 들어, 상기 포유류는 돼지일 수 있다.For example, the mammal may be a pig.
상기 세포는 원핵세포 또는 진핵세포일 수 있다.The cells may be prokaryotic cells or eukaryotic cells.
따라서, 본 출원에 의해 개시되는 돼지의 괴사성장염의 예방 또는/및 치료를 표적 하는 백신 조성물 및 제조방법은 기존의 돼지의 괴사성장염 백신에 비해 효과가 월등히 뛰어날 수 있으며, 돼지의 괴사성장염 원인체의 변이에도 신속하게 대응할 수 있을 것으로 기대된다.Therefore, the vaccine composition and manufacturing method targeting the prevention or/and treatment of pig necrotizing inflammation disclosed by the present application can be significantly superior to the existing pig necrotizing vaccine, and mutations in the cause of necrotizing growth in pigs It is expected that it will be able to respond quickly.
3. 괴사성장염 백신 조성물3. Necrotizing Vaccine Composition
전술한 본 출원의 과제를 해결하기 위하여, 본 출원의 일 양태에 의하면, 괴사성장염 백신 조성물이 제공된다.In order to solve the problems of the present application described above, according to an aspect of the present application, there is provided a necrotizing vaccine composition.
특히, 본 출원의 일 양태에 의하면, 돼지의 괴사성장염 백신 조성물이 제공된다.In particular, according to an aspect of the present application, there is provided a pig necrotizing vaccine composition.
상기 돼지의 괴사성장염 백신 조성물은 i) 박테리아 유래 포자; 이 때, 상기 박테리아 유래 포자는 지노믹 DNA에 항원성 물질을 코딩하는 서열을 가지고 있는 포자이며, ii) 상기 박테리아 포자의 표면에 존재하는 포자 코트 단백질 및 iii) 상기 포자 코트 단백질에 연결된 돼지의 괴사성장염 항원성 물질을 포함할 수 있다.The porcine necrotizing infection vaccine composition comprises i) spores derived from bacteria; At this time, the bacteria-derived spores are spores having a sequence encoding an antigenic substance in genomic DNA, ii) a spore coat protein present on the surface of the bacterial spore, and iii) necrosis of a pig linked to the spore coat protein. Growth salt antigenic substances may be included.
본 출원에 의해 개시되는 돼지의 괴사성장염 백신 조성물은 병원 원인체의 변이에 신속하게 대응할 수 있다.The porcine necrotizing disease vaccine composition disclosed by the present application can quickly respond to mutations in pathogens.
본 출원의 돼지의 괴사성장염 백신 조성물의 박테리아 포자는 B. subtilis, B. anthrasis, B. thuringiensis, B. cereus 중 선택되는 포자일 수 있다.Bacterial spores of the porcine necrotizing infection vaccine composition of the present application may be spores selected from B. subtilis, B. anthrasis, B. thuringiensis, and B. cereus .
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물의 박테리아 포자는 B. subtilis의 포자일 수 있다.For example, the bacterial spore of the porcine necrotizing infection vaccine composition of the present application may be a spore of B. subtilis .
본 출원의 돼지의 괴사성장염 백신 조성물의 포자 코트 단백질은 CotA, CotB, CotC, CotD, CotE, CotF, CotG, CotN, CotS, CotT, CotV, CotW, CotX, CotY, CotZ, CotH, CotJA, CotJC, CotK, CotL, CotM 중 선택되는 포자 코트 단백질일 수 있다.The spore coat protein of the porcine necrotosis vaccine composition of the present application is CotA, CotB, CotC, CotD, CotE, CotF, CotG, CotN, CotS, CotT, CotV, CotW, CotX, CotY, CotZ, CotH, CotJA, CotJC, It may be a spore coat protein selected from CotK, CotL, and CotM.
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물의 포자 코트 단백질은 CotB, CotC, CotG 중 선택되는 포자 코트 단백질일 수 있다.For example, the spore coat protein of the porcine necrotitis vaccine composition of the present application may be a spore coat protein selected from CotB, CotC, and CotG.
본 출원의 돼지의 괴사성장염 조성물의 항원성 물질은 클로스트리디움 퍼프링겐스의 A형 균의 알파톡신(α-toxin); 또는 클로스트리디움 퍼프링겐스의 B형 균은 알파톡신(α-toxin) 또는 베타톡신(β-toxin) 또는 엡실론톡신(ε-toxin); 또는 클로스트리디움 퍼프링겐스의 C형 균의 알파톡신(α-toxin) 또는 베타톡신(β-toxin); 또는 클로스트리디움 퍼프링겐스의 D형 균은 알파톡신(α-toxin), 엡실론톡신(ε-toxin) 중 선택되는 항원성 물질일 수 있다.The antigenic substance of the porcine necrotizing salt composition of the present application is alphatoxin (α-toxin) of Clostridium pufflingens type A bacteria; Or Clostridium pufflingens type B bacteria include alpha toxin (α-toxin) or beta toxin (β-toxin) or epsilon toxin (ε-toxin); Or alpha toxin (α-toxin) or beta toxin (β-toxin) of Clostridium pufflingens type C bacteria; Alternatively, the D-type bacteria of Clostridium pufflingens may be an antigenic substance selected from alpha toxin (α-toxin) and epsilon toxin (ε-toxin).
상기 돼지의 괴사성장염 백신 조성물의 항원성 물질은 C. perfringens의 Phospholipase C (이하 plc) 도메인 서열을 포함할 수 있다.The antigenic material of the porcine necrotizing growth infection vaccine composition may include a Phospholipase C (hereinafter plc) domain sequence of C. perfringens .
예를 들어, plc 도멘인은 plc 도메인 1 또는 plc 도메인 2를 포함할 수 있다.For example, the plc domainin may include
예를 들어, 돼지의 괴사성장염 백신 조성물은 plc1 도메인 서열을 일부 또는 전체를 포함할 수 있다.For example, the porcine necrotitis vaccine composition may contain some or all of the plc1 domain sequence.
예를 들어, 돼지의 괴사성장염 백신 조성물은 plc2 도메인 서열을 일부 또는 전체를 포함할 수 있다.For example, a porcine necrotitis vaccine composition may contain some or all of the plc2 domain sequence.
예를 들어, 돼지의 괴사성장염 백신 조성물은 SEQ ID NO. 4 서열의 일부 또는 전체를 포함할 수 있다.For example, the porcine necrotitis vaccine composition is SEQ ID NO. 4 May include some or all of the sequences.
예를 들어, 돼지의 괴사성장염 백신 조성물은 SEQ ID NO. 4와 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 포함할 수 있다.For example, the porcine necrotitis vaccine composition is SEQ ID NO. 4 and may include sequences with 70, 75, 80, 85, 90, 95 or 100% homology.
상기 돼지의 괴사성장염 백신 조성물의 항원성 물질은 CPA일 수 있다.The antigenic substance of the porcine necrotizing infection vaccine composition may be CPA.
예를 들어, 돼지의 괴사성장염 백신 조성물의 항원성 물질은 CPA1 또는/및 CPA2일 수 있다.For example, the antigenic substance of the porcine necrotizing vaccine composition may be CPA1 or/and CPA2.
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물의 항원성 물질은 도 4에 도시된 CPA1 또는 CPA2를 포함할 수 있다.For example, the antigenic substance of the porcine necrotizing infection vaccine composition of the present application may include CPA1 or CPA2 shown in FIG. 4.
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물의 항원성 물질은 SEQ ID NO. 1 또는/및 SEQ ID NO. 2를 포함할 수 있다.For example, the antigenic substance of the porcine necrotitis vaccine composition of the present application is SEQ ID NO. 1 or/and SEQ ID NO. May contain 2.
상기 돼지의 괴사성장염 백신 조성물의 항원성 물질은 CPA1 또는/및 CPA2 서열의 일부 또는 전체를 포함할 수 있다.The antigenic substance of the porcine necrotizing infection vaccine composition may include part or all of the CPA1 or/and CPA2 sequence.
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물의 항원성 물질은 SEQ ID NO. 1 또는/및 SEQ ID NO. 2 서열의 일부 또는 전체를 포함할 수 있다.For example, the antigenic substance of the porcine necrotitis vaccine composition of the present application is SEQ ID NO. 1 or/and SEQ ID NO. 2 may include some or all of the sequences.
상기 돼지의 괴사성장염 백신 조성물의 항원성 물질은 CPA1 또는/및 CPA2 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 포함할 수 있다.The antigenic material of the porcine necrotizing infection vaccine composition may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology to the CPA1 or/and CPA2 sequence.
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물의 항원성 물질은 SEQ ID NO. 1 또는/및 SEQ ID NO. 2 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 포함할 수 있다.For example, the antigenic substance of the porcine necrotitis vaccine composition of the present application is SEQ ID NO. 1 or/and SEQ ID NO. It may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the 2 sequence.
상기 돼지의 괴사성장염 백신 조성물의 항원성 물질은 plc 도메인2의 서열 일부 또는 전체를 포함할 수 있다.The antigenic material of the pig's necrotizing infection vaccine composition may include a part or all of the sequence of
예를 들어, 돼지의 괴사성장염 백신 조성물의 항원성 물질은 plc 도메인2의 서열과 상동성이 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100%인 서열을 포함할 수 있다.For example, the antigenic material of the porcine necrotitis vaccine composition includes a sequence of 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100% homology with the sequence of
상기 돼지의 괴사성장염 백신 조성물의 항원성 물질은 CPA1과 CPA2의 공통서열을 포함할 수 있다.The antigenic substance of the porcine necrotizing infection vaccine composition may include a common sequence of CPA1 and CPA2.
예를 들어, 돼지의 괴사성장염 백신 조성물의 항원성 물질은 CPA1과 CPA2의 공통서열을 일부 또는 전체를 포함할 수 있다.For example, the antigenic substance of the porcine necrotizing infection vaccine composition may include some or all of the common sequences of CPA1 and CPA2.
예를 들어, 돼지의 괴사성장염 백신 조성물의 항원성 물질은 SEQ ID NO. 1과 SEQ ID NO. 2의 공통서열의 일부 또는 전체를 포함할 수 있다.For example, the antigenic substance of the porcine necrotitis vaccine composition is SEQ ID NO. 1 and SEQ ID NO. It may include some or all of the consensus sequence of 2.
예를 들어, 돼지의 괴사성장염 백신 조성물의 항원성 물질은 SEQ ID NO. 3의 서열 일부 또는 전체를 포함할 수 있다.For example, the antigenic substance of the porcine necrotitis vaccine composition is SEQ ID NO. It may include some or all of the sequence of 3.
상기 돼지의 괴사성장염 백신 조성물의 항원성 물질은 CPA1과 CPA2의 공통서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 포함할 수 있다.The antigenic substance of the porcine necrotizing infection vaccine composition may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the consensus sequence of CPA1 and CPA2.
예를 들어, 돼지의 괴사성장염 백신 조성물의 항원성 물질은 SEQ ID NO. 1과 SEQ ID NO. 2의 공통서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 포함할 수 있다.For example, the antigenic substance of the porcine necrotitis vaccine composition is SEQ ID NO. 1 and SEQ ID NO. It may include a sequence having 70, 75, 80, 85, 90, 95 or 100% homology with the consensus sequence of 2.
예를 들어, 돼지의 괴사성장염 백신 조성물의 항원성 물질은 SEQ ID NO. 3 과 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 포함할 수 있다.For example, the antigenic substance of the porcine necrotitis vaccine composition is SEQ ID NO. 3 may include sequences with 70, 75, 80, 85, 90, 95 or 100% homology.
상기 조성물에서 항원성 물질의 농도는 약1010 내지 1020개/ml 정도의 농도일 수 있다.The concentration of the antigenic substance in the composition may be about 10 10 to 10 20 /ml.
예를 들어, 본 출원의 돼지 괴사성장염 백신 조성물에서 항원성 물질의 농도는 약1010 내지 1015개/ml 정도의 농도일 수 있다.For example, the concentration of the antigenic substance in the porcine necrotizing disease vaccine composition of the present application may be about 10 10 to 10 15 /ml.
본 출원의 돼지의 괴사성장염 백신 조성물은 박테리아 포자, 1개의 포자 코트 단백질 및 1 개의 항원성 물질을 포함할 수 있다.The pig's necrotizing infection vaccine composition of the present application may include bacterial spores, one spore coat protein, and one antigenic substance.
본 출원의 돼지의 괴사성장염 백신 조성물은 박테리아 포자, 1개의 포자 코트 단백질 및 2 이상의 항원성 물질을 포함할 수 있다.The porcine necrotizing disease vaccine composition of the present application may include bacterial spores, one spore coat protein, and two or more antigenic substances.
본 출원의 돼지의 괴사성장염 백신 조성물은 박테리아 포자, 2 이상의 포자 코트 단백질 및 1개의 항원성 물질을 포함할 수 있다.The porcine necrotizing infection vaccine composition of the present application may include bacterial spores, two or more spore coat proteins, and one antigenic substance.
본 출원의 돼지의 괴사성장염 백신 조성물은 박테리아 포자, 2 이상의 포자 코트 단백질 및 2 이상의 항원성 물질을 포함할 수 있다.The porcine necrotizing infection vaccine composition of the present application may include bacterial spores, two or more spore coat proteins, and two or more antigenic substances.
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물은 박테리아 포자, Cot B, Cot C, Cot G 중 선택되는 1이상의 코트 단백질, CPA1 또는 CPA2 중 선택되는 1이상의 항원성 물질을 포함할 수 있다.For example, the porcine necrotizing infection vaccine composition of the present application may include at least one coat protein selected from bacterial spores, Cot B, Cot C, and Cot G, and at least one antigenic substance selected from CPA1 or CPA2.
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물은 박테리아 포자, Cot B, Cot C, Cot G 중 선택되는 1이상의 코트 단백질, SEQ ID NO. 1 또는 SEQ ID NO. 2 중 선택되는 1이상의 항원성 물질을 포함할 수 있다.For example, the pig's necrotizing growth infection vaccine composition of the present application includes at least one coat protein selected from bacterial spores, Cot B, Cot C and Cot G, SEQ ID NO. 1 or SEQ ID NO. It may contain one or more antigenic substances selected from among the two.
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물은 박테리아 포자, Cot B, Cot C, Cot G 중 선택되는 1이상의 코트 단백질, SEQ ID NO. 3의 서열 일부 또는 전체를 포함하는 항원성 물질을 포함할 수 있다.For example, the pig's necrotizing growth infection vaccine composition of the present application includes at least one coat protein selected from bacterial spores, Cot B, Cot C, and Cot G, SEQ ID NO. It may include an antigenic substance including part or all of the sequence of 3.
상기 돼지의 괴사성장염 백신 조성물은 포자 코트 단백질 및 항원성 물질을 연결하는 링커(linker)를 더 포함할 수 있다.The porcine necrotizing disease vaccine composition may further include a linker connecting the spore coat protein and the antigenic substance.
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물은 박테리아 포자, Cot B, Cot C, Cot G 중 선택되는 1이상의 코트 단백질, CPA1 또는 CPA2 중 선택되는 1이상의 항원성 물질, 링커를 포함할 수 있다.For example, the pig's necrotizing infection vaccine composition of the present application may include at least one coat protein selected from bacterial spores, Cot B, Cot C, and Cot G, at least one antigenic substance selected from CPA1 or CPA2, and a linker. have.
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물은 박테리아 포자, Cot B, Cot C, Cot G 중 선택되는 1이상의 코트 단백질, SEQ ID NO. 1 또는 SEQ ID NO. 2 중 선택되는 1이상의 항원성 물질, 링커를 포함할 수 있다.For example, the pig's necrotizing growth infection vaccine composition of the present application includes at least one coat protein selected from bacterial spores, Cot B, Cot C and Cot G, SEQ ID NO. 1 or SEQ ID NO. It may include at least one antigenic substance selected from among 2 and a linker.
예를 들어, 본 출원의 돼지의 괴사성장염 백신 조성물은 박테리아 포자, Cot B, Cot C, Cot G 중 선택되는 1이상의 코트 단백질, SEQ ID NO. 3의 서열 일부 또는 전체를 포함하는 항원성 물질, 링커를 포함할 수 있다.For example, the pig's necrotizing growth infection vaccine composition of the present application includes at least one coat protein selected from bacterial spores, Cot B, Cot C and Cot G, SEQ ID NO. It may include an antigenic substance including a part or all of the sequence of 3, a linker.
상기 링커는 효소, 절단효소, 폴리펩타이드, 단백질, 염기서열, 인위적인 화학적 결합을 형성하고 있는 인공 염기서열 등일 수 있으나 상기 포자 코트 단백질 및 항원성 물질을 연결할 수 있는 기능을 가진 것이라면, 이에 한정하지 않는다. The linker may be an enzyme, a cleavage enzyme, a polypeptide, a protein, a nucleotide sequence, or an artificial nucleotide sequence that forms an artificial chemical bond, but is not limited thereto as long as it has a function capable of linking the spore coat protein and an antigenic substance. .
상기 돼지의 괴사성장염 백신 조성물은 안정제, 유화제, 수산화알루미늄, 인산알루미늄, pH 조정제, 계면활성제, 리포솜, 이스콤 (iscom) 보조제, 합성 글리코펩티드, 증량제, 카복시폴리메틸렌, 세균 세포벽, 세균 세포벽의 유도체, 세균백신, 동물 폭스바이러스 단백질, 바이러스 일부 (subviral) 입자 보조제, 클로스트리디움 퍼프링겐스 독소, N, N-디옥타데실-N',N'-비스(2-하이드록시에틸)-프로판디아민, 모노포스포릴 지질 A, 디메틸디옥타데실-암모늄 브로마이드 및 이의 혼합물로 구성된 군에서 선택된 어느 하나 이상의 제2보조제를 추가로 포함할 수 있다.The pig's necrotizing vaccine composition is a stabilizer, emulsifier, aluminum hydroxide, aluminum phosphate, pH adjuster, surfactant, liposome, iscom adjuvant, synthetic glycopeptide, extender, carboxypolymethylene, bacterial cell wall, derivative of bacterial cell wall , Bacterial vaccine, animal poxvirus protein, subviral particle adjuvant, Clostridium perfringens toxin, N, N-dioctadecyl-N',N'-bis(2-hydroxyethyl)-propanediamine , Monophosphoryl lipid A, dimethyldioctadecyl-ammonium bromide, and any one or more second aids selected from the group consisting of a mixture thereof may be further included.
또한, 상기 돼지의 괴사성장염 백신 조성물은 의학적으로 허용 가능한 담체, 희석제, 결합제, 붕해제, 윤활제, pH 조절제, 산화방지제, 용해보조제, 항원 보강제, 안정제, 보존제, 항균제, 항진균제, 흡착 지연제 등의 첨가제를 추가로 더 포함할 수 있다. In addition, the pig's necrotizing vaccine composition includes medically acceptable carriers, diluents, binders, disintegrants, lubricants, pH adjusters, antioxidants, solubilizers, adjuvants, stabilizers, preservatives, antibacterial agents, antifungal agents, adsorption delaying agents, etc. It may further include an additive.
상기 담체는 세포 또는 조직내로의 화합물의 부가를 용이하게 하는 화합물로 정의된다. 예를 들어, 디메틸 술폭사이드(DMSO)를 사용할 수 있다.The carrier is defined as a compound that facilitates the addition of the compound into cells or tissues. For example, dimethyl sulfoxide (DMSO) can be used.
상기 희석제(버퍼 용액)는, 예를 들어, 슈가, 전분, 미결정셀룰로오스, 유당(유당수화물), 포도당, 디-만니톨, 알기네이트, 알칼리토금속류염, 클레이, 폴리에틸렌글리콜, 무수인산수소칼슘, 또는 이들의 혼합물 등을 사용할 수 있으며; 결합제는 전분, 미결정셀룰로오스, 고분산성 실리카, 만니톨, 디-만니톨, 자당, 유당수화물, 폴리에틸렌글리콜, 폴리비닐피롤리돈(포비돈), 폴리비닐피롤리돈 공중합체(코포비돈), 히프로멜로오스, 히드록시프로필셀룰로오스, 천연검, 합성검, 코포비돈, 젤라틴, 또는 이들의 혼합물 등을 포함할 수 있다. The diluent (buffer solution) is, for example, sugar, starch, microcrystalline cellulose, lactose (lactose hydrate), glucose, di-mannitol, alginate, alkaline earth metal salt, clay, polyethylene glycol, anhydrous calcium hydrogen phosphate, or Mixtures thereof and the like can be used; Binders are starch, microcrystalline cellulose, highly dispersible silica, mannitol, di-mannitol, sucrose, lactose hydrate, polyethylene glycol, polyvinylpyrrolidone (povidone), polyvinylpyrrolidone copolymer (copovidone), hypromellose , Hydroxypropyl cellulose, natural gum, synthetic gum, copovidone, gelatin, or a mixture thereof.
상기 붕해제는 예를 들어, 전분글리콘산나트륨, 옥수수전분, 감자전분 또는 전호화전분 등의 전분 또는 변성전분; 벤토나이트, 몬모릴로나이트, 또는 비검(veegum) 등의 클레이; 미결정셀룰로오스, 히드록시프로필셀룰로오스 또는 카르복시메틸셀룰로오스 등의 셀룰로오스류; 알긴산나트륨 또는 알긴산 등의 알긴류; 크로스카멜로스(croscarmellose)나트륨 등의 가교 셀룰로오스류; 구아검, 잔탄검 등의 검류; 가교 폴리비닐피롤리돈(crospovidone) 등의 가교 중합체; 중탄산나트륨, 시트르산 등의 비등성 제제, 또는 이들의 혼합물을 사용할 수 있다.The disintegrant is, for example, starch or modified starch such as sodium starch glycolate, corn starch, potato starch or pregelatinized starch; Clay such as bentonite, montmorillonite, or veegum; Celluloses such as microcrystalline cellulose, hydroxypropyl cellulose, or carboxymethyl cellulose; Algins such as sodium alginate or alginic acid; Cross-linked celluloses such as croscarmellose sodium; Gums such as guar gum and xanthan gum; Crosslinked polymers such as crosslinked polyvinylpyrrolidone (crospovidone); Effervescent agents, such as sodium bicarbonate and citric acid, or mixtures thereof may be used.
상기 윤활제는 예를 들어, 탈크, 스테아린산, 스테아린산 마그네슘, 스테아린산 칼슘, 라우릴설페이트나트륨, 수소화식물성오일, 나트륨벤조에이트, 나트륨스테아릴푸마레이트, 글리세릴 베헤네이트, 글리세릴 모노레이트, 글리세릴모노스테아레이트, 글리세릴 팔미토스테아레이트, 콜로이드성 이산화규소 또는 이들의 혼합물 등을 사용할 수 있다.The lubricants are, for example, talc, stearic acid, magnesium stearate, calcium stearate, sodium lauryl sulfate, hydrogenated vegetable oil, sodium benzoate, sodium stearyl fumarate, glyceryl behenate, glyceryl monorate, glyceryl monostea Rate, glyceryl palmitostearate, colloidal silicon dioxide, or mixtures thereof.
상기 pH 조절제는 예를 들어, 초산, 아디프산, 아스코르빈산, 아스코르빈산 나트륨, 에테르산 나트륨, 사과산, 숙신산, 주석산, 푸마르산, 구연산(시트르산)과 같은 산성화제와 침강 탄산 칼슘, 암모니아수, 메글루민, 탄산 나트륨, 산화 마그네슘, 탄산 마그네슘, 구연산 나트륨, 삼염기칼슘인산염과 같은 염기성화제 등을 사용할 수 있다.The pH adjusting agent, for example, acidifying agents such as acetic acid, adipic acid, ascorbic acid, sodium ascorbate, sodium etherate, malic acid, succinic acid, tartaric acid, fumaric acid, citric acid (citric acid), precipitated calcium carbonate, aqueous ammonia, A basifying agent such as meglumine, sodium carbonate, magnesium oxide, magnesium carbonate, sodium citrate, tribasic calcium phosphate, and the like can be used.
상기 산화방지제는 예를 들어, 디부틸 히드록시 톨루엔, 부틸레이티드 히드록시아니솔, 초산 토코페롤, 토코페롤, 프로필 갈레이트, 아황산수소나트륨, 피로아황산나트륨 등을 사용할 수 있다. The antioxidant may be, for example, dibutyl hydroxy toluene, butylated hydroxyanisole, tocopherol acetate, tocopherol, propyl gallate, sodium hydrogen sulfite, sodium pyrosulfite, or the like.
상기 용해보조제는 예를 들어, 라우릴황산나트륨, 폴리소르베이트 등의 폴리옥시에틸렌 소르비탄 지방산 에스테류, 도큐세이트 나트륨, 폴록사머(poloxamer) 등을 사용할 수 있다. The solubility aid may be, for example, polyoxyethylene sorbitan fatty acid esters such as sodium lauryl sulfate and polysorbate, sodium docusate, poloxamer, and the like.
또한, 지연방출성 제제를 만들기 위해 장용성 고분자, 수불용성 중합체, 소수성 화합물, 및 친수성 고분자를 포함할 수 있다. In addition, an enteric polymer, a water-insoluble polymer, a hydrophobic compound, and a hydrophilic polymer may be included to make a delayed-release preparation.
상기 장용성 고분자는 예를 들어, 히프로멜로오스아세테이트숙시네이트, 히프로멜로오스프탈레이트(히드록시프로필메틸셀룰로오스 프탈레이트), 히드록시메틸에틸셀룰로오스프탈레이트, 셀룰로오스아세테이트프탈레이트, 셀룰로오스아세테이트숙시네이트, 셀룰로오스아세테이트말레이트, 셀룰로오스벤조에이트프탈레이트, 셀룰로오스프로피오네이트프탈레이트, 메틸셀룰로오스프탈레이트, 카르복시메틸에틸셀룰로오스, 에틸히드록시에틸셀룰로오스프탈레이트 및 메틸히드록시에틸셀룰로오스과 같은 장용성 셀룰로오스 유도체; 스티렌-아크릴산 룰로오스, 아크릴산메틸-아크릴산 룰로오스, 아크릴산메틸메타크릴산 룰로오스(예컨대, 아크릴-이즈), 아크릴산부틸-스티렌-아크릴산 룰로오스, 및 아크릴산메틸-메타크릴산-아크릴산옥틸룰로오스와 같은 상기 장용성 아크릴산계 룰로오스; 폴리(메타크릴산 메틸 메타크릴레이트) 룰로오스(예컨대, 유드라짓 L, 유드라짓 S, 에보셀독일트, 카르 (메타크릴산 에틸아크릴레이트) 룰로오스 (예컨대, 유드라짓 L100-55)와 같은 장용성 카르메타크릴레이트 룰로오스; 아세트산비닐-말레인산틸셀룰물 룰로오스, 스티렌-말레인산틸셀룰물 룰로오스, 스티렌-말레인산모노에스테를 룰로오스, 비닐메틸에테르-말레인산틸셀룰물 룰로오스, 에틸렌-말레인산틸셀룰물 룰로오스, 비닐부틸에테르-말레인산틸셀룰물 룰로오스, 아크릴로니트릴-크릴산메틸ㆍ말레인산틸셀룰물 룰로오스, 및 아크릴산부틸-스티렌-말레인산틸셀룰물 룰로오스와 같은 장용성 말레인산계 룰로오스; 및 로니트릴알콜프탈레이트, 로니트릴아세탈프탈레이트, 폴리비닐부틸레이트프탈레이트 및 폴리비닐아세트아세탈프탈레이트와 같은 장용성 폴리비닐 유도체가 있다. The enteric polymer is, for example, hypromellose acetate succinate, hypromellose phthalate (hydroxypropylmethylcellulose phthalate), hydroxymethylethyl cellulose phthalate, cellulose acetate phthalate, cellulose acetate succinate, cellulose acetate malate. , Cellulose benzoate phthalate, cellulose propionate phthalate, methyl cellulose phthalate, carboxymethyl ethyl cellulose, ethyl hydroxyethyl cellulose phthalate, and enteric cellulose derivatives such as methyl hydroxyethyl cellulose; Styrene-acrylate ulose, acrylate methyl-acrylate ulose, acrylate methyl methacrylate (e.g., acrylic-ise), butyl acrylate-styrene-acrylate ulose, and methyl acrylate-methacrylic acid-acrylate octyulose The enteric acrylic acid-based ulose, such as; Poly(methyl methacrylate methacrylate) ulose (e.g. Eudragit L, Eudragit S, Evoselgermant, Carr (ethyl methacrylate) ulose (e.g. Eudragit L100-55) ), such as enteric carmethacrylate ulose; vinyl acetate-maleateyl cellulose cellulose, styrene-maleate cellulose cellulose, styrene-maleic acid monoester ulose, vinyl methyl ether-maleate cellulose cellulose, Enteric properties such as ethylene-maleate cellulose cellulose, vinyl butyl ether-maleate cellulose cellulose, acrylonitrile-methyl acrylate, maleate cellulose cellulose, and butyl acrylate-styrene-maleate cellulose cellulose And enteric polyvinyl derivatives such as ronitrile alcohol phthalate, ronitrile acetal phthalate, polyvinyl butyrate phthalate and polyvinyl acetacetal phthalate.
상기 수불용성 중합체는 약물의 방출을 제어하는 약제학적으로 허용 가능한 물에 용해되지 않는 고분자를 말한다. 예를 들어, 수불용성 중합체는 폴리비닐아세테이트(예컨대, 콜리코트 SR30D), 수불용성 폴리메타크릴레이트 공중합체[예컨대, 폴리(에틸아크릴레이트-메틸 메타크릴레이트) 공중합체(예컨대, 유드라짓 NE30D, 폴리(에틸아크릴레이트-메틸 메타크릴레이트-트리메틸아미노에틸메타크릴레이트)공중합체(예컨대, 유드라짓RSPO)등], 에틸셀룰로오스, 셀룰로오스 에스테르, 셀룰로오스 에테르, 셀룰로오스 아실레이트, 셀룰로오스 디아실레이트, 셀룰로오스 트리아실레이트, 셀룰로오스 아세테이트, 셀룰로오스 디아세테이트 및 셀룰로오스 트리아세테이트 등이 있다. The water-insoluble polymer refers to a pharmaceutically acceptable water-insoluble polymer that controls drug release. For example, the water-insoluble polymer is polyvinyl acetate (e.g., colicoat SR30D), a water-insoluble polymethacrylate copolymer (e.g., poly(ethylacrylate-methyl methacrylate) copolymer (e.g. Eudragit NE30D) , Poly(ethylacrylate-methyl methacrylate-trimethylaminoethylmethacrylate) copolymer (eg Eudragit RSPO), etc.], ethylcellulose, cellulose ester, cellulose ether, cellulose acylate, cellulose diacylate, Cellulose triacylate, cellulose acetate, cellulose diacetate, and cellulose triacetate.
상기 소수성 화합물은 예를 들어, 글리세릴 팔미토스테아레이트, 글리세릴 스테아레이트, 글리세릴 비헤네이트, 세틸 팔미테이트, 글리세릴 모노 올레이트 및 스레아린산과 같은 지방산 및 지방산 에스테르류; 세토스테아릴 알코올, 세틸알코올 및 스테아릴알코올과 같은 지방산 알코올류; 카르나우바왁스, 밀납, 및 미결정왁스와 같은 왁스류; 탈크, 침강탄산칼슘, 인산일수소칼슘, 산화아연, 산화티탄, 카올린, 벤토나이트, 몬모릴로나이트 및 비검과 같은 무기질 물질 등이 있다. The hydrophobic compounds include, for example, fatty acids and fatty acid esters such as glyceryl palmitostearate, glyceryl stearate, glyceryl bihenate, cetyl palmitate, glyceryl monooleate and srearic acid; Fatty acid alcohols such as cetostearyl alcohol, cetyl alcohol and stearyl alcohol; Waxes such as carnauba wax, beeswax, and microcrystalline wax; And inorganic substances such as talc, precipitated calcium carbonate, calcium monohydrogen phosphate, zinc oxide, titanium oxide, kaolin, bentonite, montmorillonite and veggies.
상기 친수성 고분자는 예를 들어, 덱스트린, 폴리덱스트린, 덱스트란, 펙틴 및 펙틴 유도체, 알긴산염, 폴리갈락투론산, 자일란, 아라비노자일란, 아라비노갈락탄, 전분, 히드록시프로필스타치, 아밀로오스, 및 아밀로펙틴와 같은 당류; 히프로멜로오스, 히드록시프로필셀룰로오스, 히드록시메틸셀룰로오스, 히드록시에틸셀룰로오스, 메틸셀룰로오스 및 카르복시메틸셀룰로오스 나트륨과 같은 셀룰로오스 유도체; 구아검, 로커스트 콩 검, 트라가칸타, 카라기난, 아카시아검, 아라비아검, 젤란검, 및 잔탄검과 같은 검류; 젤라틴, 카제인, 및 제인과 같은 단백질; 폴리비닐 알코올, 폴리비닐 피롤리돈, 및 폴리비닐아세탈디에틸아미노아세테이트와 같은 폴리비닐유도체; 폴리(부틸 메타크릴레이트-(2-디메틸아미노에틸)메타크릴레이트-메틸메타크릴레이트) 공중합체(예컨대, 유드라짓E100, 에보닉, 독일), 폴리(에틸 아크릴레이트-메틸 메타크릴레이드-트리에틸아미노에틸- 메타크릴레이트 클로라이드) 공중합체 (예컨대, 유드라짓 RL, RS, 에보닉, 독일)와 같은 친수성 폴리메타크릴레이트 공중합체; 폴리에틸렌 글리콜, 및 폴리에틸렌 옥사이드와 같은 폴리에틸렌 유도체; 카보머 등이 있다. The hydrophilic polymer is, for example, dextrin, polydextrin, dextran, pectin and pectin derivatives, alginate, polygalacturonic acid, xylan, arabinoxylan, arabinogalactan, starch, hydroxypropyl starch, amylose, And sugars such as amylopectin; Cellulose derivatives such as hypromellose, hydroxypropylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, methylcellulose, and sodium carboxymethylcellulose; Gums such as guar gum, locust bean gum, tragacanta, carrageenan, acacia gum, gum arabic, gellan gum, and xanthan gum; Proteins such as gelatin, casein, and zein; Polyvinyl derivatives such as polyvinyl alcohol, polyvinyl pyrrolidone, and polyvinyl acetaldiethylaminoacetate; Poly(butyl methacrylate-(2-dimethylaminoethyl)methacrylate-methylmethacrylate) copolymer (e.g. Eudragit E100, Evonik, Germany), poly(ethyl acrylate-methyl methacrylate- Hydrophilic polymethacrylate copolymers such as triethylaminoethyl-methacrylate chloride) copolymers (eg Eudragit RL, RS, Evonik, Germany); Polyethylene glycol, and polyethylene derivatives such as polyethylene oxide; Carbomer, etc.
이외에도 착색제, 향료 중에서 선택된 다양한 첨가제로서 약학적으로 허용 가능한 첨가제를 선택 사용하여 본 출원의 제제를 제제화할 수 있다. In addition, the formulation of the present application may be formulated by using pharmaceutically acceptable additives as various additives selected from colorants and fragrances.
본 출원에서 첨가제의 범위가 상기 첨가제를 사용하는 것으로 한정되는 것은 아니며, 상기한 첨가제를 선택에 의하여 통상 범위의 용량을 함유하여 제제화할 수 있다.In the present application, the range of the additive is not limited to the use of the additive, and the additive may be formulated to contain a dosage in the usual range by selection.
또한, 상기 돼지의 괴사성장염 백신 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 제제화할 경우에는 보통 사용되는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제할 수 있다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 레시틴 유사 유화제에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트 (calciumcarbonate), 수크로오스 또는 락토오스, 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용할 수 있다. 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등을 사용할 수 있으며, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수용성제, 현탁제, 유제, 동결건조제제가 포함된다. 비수용성제제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있으나, 이에 제한되지 않는다.In addition, the pig's necrotizing vaccine composition may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and sterile injectable solutions, respectively, according to conventional methods. . In the case of formulation, it can be prepared using diluents or excipients such as generally used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient such as starch, calcium carbonate, sucrose or lactose in the lecithin-like emulsifier. , Gelatin, etc. can be mixed to prepare. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. As liquid preparations for oral administration, suspensions, solvents, emulsions, syrups, etc. can be used. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweetening agents, fragrances, preservatives, etc. Can be included. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous agents, suspensions, emulsions, and freeze-dried formulations. As the non-aqueous preparation and suspension, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used, but are not limited thereto.
경구용 제형의 경우, 방출 위치는 위, 소장(십이지장, 공장(jejunum), 회장(ileum)) 또는 대장일 수 있다. 본 기술분야의 통상의 기술자는 예컨대 장용 코팅을 사용함으로써 위에서는 용해되지 않지만 그 물질을 장내의 십이지장 또는 다른 곳에 방출하는 제형을 이용할 수 있다. 장용 코팅으로 사용되는 보다 일반적인 불활성 성분의 예는 셀룰로오스 아세테이트 트리멜리테이트(CAT), 히드록시프로필메틸셀룰로오스 프탈레이트(HPMCP), HPMCP 50, HPMCP 55, 폴리비닐 아세테이트 프탈레이트(PVAP), 유드라짓(Eudragit) L30D, 아쿠아테릭(Aquateric), 셀룰로오스 아세테이트 프탈레이트(CAP), 유드라짓 L, 유드라짓 S 및 쉘락(Shellac)이다. 이들 코팅은 혼합된 필름으로 사용될 수 있다.For oral dosage forms, the location of release may be the stomach, small intestine (duodenum, jejunum, ileum) or large intestine. One of ordinary skill in the art can use formulations that do not dissolve in the stomach, but release the substance to the duodenum or elsewhere in the intestine, for example by using an enteric coating. Examples of more common inert ingredients used as enteric coatings include cellulose acetate trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP),
또한, 코팅 또는 코팅의 혼합물은 위에 대한 보호를 목적으로 하지 않는 정제 위에 사용될 수 있다. 이것은 당 코팅 또는 상기 정제를 삼키기 쉽게 만드는 코팅을 포함할 수 있다. 캡슐은 건조된 치료제(즉, 분말)의 운반용으로 경질의 쉘(hard shell)(예컨대, 젤라틴)로 이루어질 수 있거나, 액체 형태의 경우 연질 젤라틴 쉘이 사용될 수 있다. 캡슐의 쉘 물질은 두꺼운 전분 또는 다른 식용 종이일 수 있다. 알약, 로젠지, 성형된 정제 또는 정제 연마물의 경우, 습기 매싱 기술(moist massing technique)이 사용될 수 있다. 캡슐 투여용 물질의 제형은 또한 분말, 가볍게 압착된 플러그 또는 심지어 정제의 형태일 수 있다. 상기 치료제는 압착에 의해 제조될 수 있다.In addition, coatings or mixtures of coatings can be used on tablets that are not intended for protection against the stomach. This may include a sugar coating or a coating that makes the tablet easier to swallow. The capsule may be made of a hard shell (eg, gelatin) for transporting the dried therapeutic agent (ie, powder), or a soft gelatin shell may be used in the case of a liquid form. The shell material of the capsule can be thick starch or other edible paper. For tablets, lozenges, molded tablets or polished tablets, a moisture massing technique can be used. The formulation of substances for capsule administration may also be in the form of powders, lightly compressed plugs or even tablets. The therapeutic agent can be prepared by compression.
4. 괴사성장염 백신 제조방법 4. Necrotizing growth infection vaccine manufacturing method
전술한 본 출원의 과제를 해결하기 위하여, 본 출원의 일 양태에 의하면, 괴사성장염 백신 제조방법이 제공된다.In order to solve the problems of the present application described above, according to an aspect of the present application, a method for preparing a necrotizing growth infection vaccine is provided.
특히, 본 출원의 일 양태에 의하면, 돼지의 괴사성장염 백신 제조방법이 제공된다.In particular, according to an aspect of the present application, there is provided a method for producing a vaccine for necrotizing swine.
예를 들어 본 출원의 돼지의 괴사성장염 백신 제조 방법은, i) 박테리아의 지노믹 DNA(genomic DNA)에 CRISPR/Cas9을 이용하여 항원성 물질을 넉인(Knock-in) 시키는 단계; ii) 상기 박테리아의 포자를 형성시키는 단계; 및 iii) 상기 박테리아의 포자 표면에 항원성 물질을 발현시키는 단계;를 포함할 수 있다.For example, the method for preparing a pig's necrotizing growth infection vaccine of the present application includes: i) knock-in of an antigenic substance using CRISPR/Cas9 in bacterial genomic DNA; ii) forming spores of the bacteria; And iii) expressing an antigenic substance on the spore surface of the bacteria.
상기 돼지의 괴사성장염 백신 제조 방법은 박테리아의 지노믹 DNA에 도너(donor)로서 외래물질을 삽입시키는 단계를 포함할 수 있다. The method for preparing the pig's necrotizing infection vaccine may include inserting a foreign material as a donor into the bacterial genomic DNA.
상기 "도너(donor)"는 특정 펩타이드 또는 단백질을 발현시킬 수 있는, exogenous nucleotide를 의미하며, 예를 들어, HDR 메커니즘을 이용하여 지노믹 DNA 내로 삽입될 수 있다. 이때, 도너는 특정 펩타이드 또는 단백질을 코딩하는 특정 핵산을 포함할 수 있다. The "donor" refers to an exogenous nucleotide capable of expressing a specific peptide or protein, and may be inserted into genomic DNA using, for example, an HDR mechanism. In this case, the donor may include a specific nucleic acid encoding a specific peptide or protein.
상기 도너는 이중가닥 핵산 또는 단일가닥 핵산일 수 있다.The donor may be a double-stranded nucleic acid or a single-stranded nucleic acid.
상기 도너는 선형 또는 원형일 수 있다.The donor may be linear or circular.
상기 도너는 표적 유전자 또는 핵산에 상동성을 가지는 핵산서열을 포함할 수 있다.The donor may include a nucleic acid sequence having homology to a target gene or nucleic acid.
상기 도너는 항원성 물질을 코딩하는 핵산일 수 있다.The donor may be a nucleic acid encoding an antigenic substance.
예를 들어, 상기 도너는 돼지의 괴사성장염 항원성 물질을 코딩하는 핵산일 수 있다. 일 예로, 클로스트리디움 퍼프링겐스의 A형 균의 알파톡신(α-toxin); 또는 클로스트리디움 퍼프링겐스의 B형 균은 알파톡신(α-toxin) 또는 베타톡신(β-toxin) 또는 엡실론톡신(ε-toxin); 또는 클로스트리디움 퍼프링겐스의 C형 균의 알파톡신(α-toxin) 또는 베타톡신(β-toxin); 또는 클로스트리디움 퍼프링겐스의 D형 균은 알파톡신(α-toxin), 엡실론톡신(ε-toxin) 중 선택되는 어느 하나 이상을 코딩하는 핵산일 수 있다. 다른 예로 상기 도너는 돼지의 괴사성장염 항원성 물질인 CPA1 또는/및 CPA2를 코딩하고 있는 핵산일 수 있다. For example, the donor may be a nucleic acid encoding a porcine necrotizing antigenic substance. For example, alpha toxin (α-toxin) of type A bacteria of Clostridium pufflingens; Or Clostridium pufflingens type B bacteria include alpha toxin (α-toxin) or beta toxin (β-toxin) or epsilon toxin (ε-toxin); Or alpha toxin (α-toxin) or beta toxin (β-toxin) of Clostridium pufflingens type C bacteria; Alternatively, the D-type bacteria of Clostridium pufflingens may be a nucleic acid encoding any one or more selected from alpha toxin (α-toxin) and epsilon toxin (ε-toxin). As another example, the donor may be a nucleic acid encoding CPA1 or/and CPA2, which is an antigenic substance of porcine necrotizing inflammation.
본 출원의 상기 돼지의 괴사성장염 백신을 제조방법은 일 구체예서, CRISPR/Cas9을 이용하여 박테리아의 지노믹 DNA(genomic DNA)에 변형을 가할 수 있다. In the method for preparing the porcine necrotizing infection vaccine of the present application, a modification may be applied to bacterial genomic DNA using CRISPR/Cas9 in one specific example.
상기 CRISPR/Cas9을 이용하는 박테리아의 지노믹 DNA(genomic DNA)에 변형은 넉인(Knock-in), 넉아웃(Knock-out), 넉다운(Knock-Downn) 중 선택되는 1 이상일 수 있다.The modification to the bacterial genomic DNA using the CRISPR/Cas9 may be one or more selected from knock-in, knock-out, and knock-down.
예를 들어, CRISPR/Cas9을 사용하여 박테리아의 지노믹 DNA(genomic DNA)의 특정 영역을 타겟하여 외래성 항원성 물질을 넉인시킬 수 있다.For example, CRISPR/Cas9 can be used to target specific regions of bacterial genomic DNA to knock-in foreign antigenic substances.
예를 들어 CRISPR/Cas9을 사용하여 박테리아의 지노믹 DNA(genomic DNA)의 특정 유전자를 넉아웃시킬 수 있다.For example, CRISPR/Cas9 can be used to knock out specific genes of bacterial genomic DNA.
예를 들어 CRISPR/Cas9을 사용하여 박테리아의 지노믹 DNA(genomic DNA)의 특정 유전자를 넉다운시킬 수 있다.For example, CRISPR/Cas9 can be used to knock down specific genes in bacterial genomic DNA.
이하, CRISPR/Cas9을 이용하여 박테리아의 지노믹 DNA(genomic DNA)의 특정 영역을 타겟팅하여 돼지의 괴사성장염 항원성 물질을 코딩하는 핵산을 삽입(넉인)하는 과정을 중심으로 설명한다.Hereinafter, a description will focus on a process of inserting (knock-in) a nucleic acid encoding a porcine necrotizing antigenic substance by targeting a specific region of the bacterial genomic DNA using CRISPR/Cas9.
이를 위해, 돼지의 괴사성장염 항원성 물질을 넉인 하기 위해서, 박테리아의 지노믹 DNA 내 표적 부위 서열 또는 표적 유전자의 염기서열을 결정한다. 이 때, 상기 표적 서열은 CRISPR 효소, 즉 Cas9 또는 Cpf1이 인식할 수 있는 PAM 서열에 근접한 위치에 위치한 염기서열일 수 있다. 상기 표적 서열은 가이드 RNA와 상보성을 가지거나 동일할 수 있다.To this end, in order to knock-in the antigenic substance of necrotizing growth salt of pigs, the target site sequence in the bacterial genomic DNA or the nucleotide sequence of the target gene is determined. In this case, the target sequence may be a CRISPR enzyme, that is, a base sequence located at a position close to a PAM sequence that can be recognized by Cas9 or Cpf1. The target sequence may have complementarity to or identical to the guide RNA.
예를 들어, 공지의 데이터베이스(예를 들어, NCBI)를 이용하여 표적 염기서열 데이터를 수집하고, 상기 염기서열 중 CRISPR/Cas9이 인식하는 부위인 PAM서열(예를 들어, 5'-NGG-3')을 고려한 가이드 RNA를 설계할 수 있다.For example, the target sequence data is collected using a known database (eg, NCBI), and the PAM sequence (eg, 5′-NGG-3), which is a site recognized by CRISPR/Cas9, is Guide RNA can be designed considering').
상기 돼지의 괴사성장염 항원성 물질이 2 이상일 경우, 가이드 RNA는 1이상일 수 있다.When the pig's necrotizing antigenic substance is 2 or more, the guide RNA may be 1 or more.
상기 돼지의 괴사성장염 항원성 물질이 2 이상일 경우, 가이드 RNA 2 이상이 각각 항원성 물질을 박테리아의 지노믹 DNA의 특정영역에 넉인시킬 수 있다.When the pig's necrotizing antigenic substance is 2 or more, each of the
예를 들어, 돼지의 괴사성장염 백신이 제 1항원성 물질 및 제 2항원성 물질을 포함하고 있을 경우, 제 1항원성 물질 및 제 2항원성 물질은 제 1 CRISPR/Cas9을 이용하여 박테리아의 지노믹 DNA의 특정 영역을 타겟하여 항원성 물질을 넉인시킬 수 있다.For example, if the pig's necrotizing virus vaccine contains a first antigenic substance and a second antigenic substance, the first antigenic substance and the second antigenic substance were used as the first CRISPR/Cas9 to By targeting a specific region of Mick DNA, antigenic substances can be knocked in.
예를 들어, 돼지의 괴사성장염 백신이 제 1항원성 물질 및 제 2항원성 물질을 포함하고 있을 경우, 제 1항원성 물질은 제 1 CRISPR/Cas9로, 제 2항원성 물질은 제 2 CRISPR/Cas9를 이용하여 박테리아의 지노믹 DNA의 특정 영역을 타겟하여 항원성 물질을 넉인시킬 수 있다.For example, if the pig's necrotizing virus vaccine contains a first antigenic substance and a second antigenic substance, the first antigenic substance is the first CRISPR/Cas9, and the second antigenic substance is the second CRISPR/ Cas9 can be used to target a specific region of the bacterial genomic DNA to knock-in antigenic substances.
CRISPR/Cas9의 Cas9 단백질은 스트렙토코커스 속(Streptococcus spp.) 유래를 사용할 수 있다. 예를 들어, Streptococcus pyogenes Cas9(spCas9)을 사용할 수 있으나, 이에 제한하지 않는다. 이 때, 상기 PAM 서열은 5'-NGG-3' (N은 A, T, G, 또는 C임)일 수 있다.The Cas9 protein of CRISPR/Cas9 can be used from Streptococcus spp. For example, Streptococcus pyogenes Cas9 (spCas9) may be used, but is not limited thereto. In this case, the PAM sequence may be 5'-NGG-3' (N is A, T, G, or C).
CRISPR/Cas9을 이용하여 표적 유전자 또는 핵산이 절단될 수 있다. 상기 절단된 표적 핵산 부위는 NHEJ 또는 HDR 메커니즘을 통해 박테리아의 지노믹 DNA 상에 변형을 포함할 수 있다. Target genes or nucleic acids can be cleaved using CRISPR/Cas9. The cleaved target nucleic acid site may include modifications on the bacterial genomic DNA through NHEJ or HDR mechanisms.
본 출원에서 일 구체예로서 사용하는 CRISPR/Cas9는 원핵생물 유래 시스템이기 때문에, 박테리아의 지노믹 DNA의 변형에 높은 효율을 가지는 장점이 있다.Since CRISPR/Cas9 used as a specific example in the present application is a prokaryotic-derived system, it has the advantage of having high efficiency in modifying the genomic DNA of bacteria.
특히, 진핵세포와 비교하여, 박테리아 내에서 HDR 메커니즘이 보다 잘 작동하여, 매우 높은 효율로 박테리아의 지노믹 DNA 상에 특정 핵산을 삽입시킬 수 있다.In particular, compared to eukaryotic cells, the HDR mechanism works better in bacteria, allowing the insertion of specific nucleic acids onto the bacterial genomic DNA with very high efficiency.
박테리아의 지노믹 DNA에 항원성 물질이 삽입되면(형질전환 되면), 이는 박테리아 지노믹 DNA의 자체 발현 시스템을 이용하기 때문에, 계속해서 상기 항원성 물질이 발현될 수 있어, 백신의 제조 시마다 형질전환을 수행해야 하는 과정을 생략할 수 있는 장점이 있다.When an antigenic substance is inserted into the bacterial genomic DNA (transformation), it uses the bacterial genomic DNA's own expression system, so that the antigenic substance can be continuously expressed, so that it is transformed every time a vaccine is prepared. There is an advantage of being able to omit the process that needs to be performed.
임의의 실시예로 클로스트리디움 퍼프링겐스의 A형 균의 알파톡신(α-toxin); 또는 클로스트리디움 퍼프링겐스의 B형 균은 알파톡신(α-toxin) 또는 베타톡신(β-toxin) 또는 엡실론톡신(ε-toxin); 또는 클로스트리디움 퍼프링겐스의 C형 균의 알파톡신(α-toxin) 또는 베타톡신(β-toxin); 또는 클로스트리디움 퍼프링겐스의 D형 균은 알파톡신(α-toxin), 엡실론톡신(ε-toxin) 중 선택되는 1 이상의 돼지의 괴사성장염 항원성 물질을 높은 효율로 바실러스 내 지노믹 DNA 상에 삽입시켰다.In certain embodiments, alphatoxin of type A bacteria of Clostridium pufflingens (α-toxin); Or Clostridium pufflingens type B bacteria include alpha toxin (α-toxin) or beta toxin (β-toxin) or epsilon toxin (ε-toxin); Or alpha toxin (α-toxin) or beta toxin (β-toxin) of Clostridium pufflingens type C bacteria; Alternatively, Clostridium pufflingens D-type bacteria contain at least one porcine necrotic antigenic substance selected from alphatoxin (α-toxin) and epsilontoxin (ε-toxin) on genomic DNA in Bacillus with high efficiency. Inserted.
임의의 실시예로 CPA1 또는/및 CPA2 중 선택되는 1이상의 돼지의 괴사성장염 항원성 물질을 높은 효율로 바실러스 내 지노믹 DNA상에 삽입시켰다.In an arbitrary example, at least one porcine necrotizing antigenic substance selected from CPA1 or/and CPA2 was inserted onto genomic DNA in Bacillus with high efficiency.
임의의 실시예로 SEQ ID NO. 1 또는 2에서 선택되는 1이상의 돼지의 괴사성장염 항원성 물질을 높은 효율로 바실러스 내 지노믹 DNA상에 삽입시켰다.In any embodiment, SEQ ID NO. At least one porcine necrotizing antigenic substance selected from 1 or 2 was inserted onto the genomic DNA in Bacillus with high efficiency.
임의의 실시예로 SEQ ID NO. 1 또는 2에서 선택되는 1이상의 일부 또는 전체의 돼지의 괴사성장염 항원성 물질을 높은 효율로 바실러스 내 지노믹 DNA상에 삽입시켰다.In any embodiment, SEQ ID NO. At least one part or all of the porcine necrotizing antigenic substances selected from 1 or 2 were inserted onto the genomic DNA in Bacillus with high efficiency.
임의의 실시예로 SEQ ID NO. 1 또는 2과 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 높은 효율로 바실러스 내 지노믹 DNA상에 삽입시켰다.In any embodiment, SEQ ID NO. Sequences with 70, 75, 80, 85, 90, 95 or 100% homology with 1 or 2 were inserted onto genomic DNA in Bacillus with high efficiency.
임의의 실시예로 CPA1 및 CPA2의 공통서열의 일부 또는 전체의 돼지의 괴사성장염 항원성 물질을 높은 효율로 바실러스 내 지노믹 DNA상에 삽입시켰다.In an arbitrary example, a part of the consensus sequence of CPA1 and CPA2 or all of the porcine necrotizing antigenic substances were inserted onto the genomic DNA in Bacillus with high efficiency.
임의의 실시예로 SEQ ID NO. 1 및 2의 공통서열의 일부 또는 전체의 돼지의 괴사성장염 항원성 물질을 높은 효율로 바실러스 내 지노믹 DNA상에 삽입시켰다.In any embodiment, SEQ ID NO. Part of or all of the
임의의 실시예로 SEQ ID NO. 3의 일부 또는 전체의 돼지의 괴사성장염 항원성 물질을 높은 효율로 바실러스 내 지노믹 DNA상에 삽입시켰다.In any embodiment, SEQ ID NO. Part 3 or all of the porcine necrotizing antigenic substances were inserted onto the genomic DNA in Bacillus with high efficiency.
임의의 실시예로 돼지의 괴사성장염 항원성 물질로 plc 도메인 2의 서열의 일부 또는 전체를 바실러스 내 지노믹 DNA상에 삽입시켰다.In an arbitrary example, a part or all of the sequence of
임의의 실시예로 돼지의 괴사성장염 항원성 물질로 SEQ ID NO. 4의 일부 또는 전체를 높은 효율로 바실러스 내 지노믹 DNA상에 삽입시켰다.In any embodiment, the antigenic substance of porcine necrotitis is SEQ ID NO. Part or all of 4 was inserted onto genomic DNA in Bacillus with high efficiency.
임의의 실시예로 돼지의 괴사성장염 항원성 물질로 plc 도메인2의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 높은 효율로 바실러스 내 지노믹 DNA상에 삽입시켰다.In an arbitrary example, a sequence of 70, 75, 80, 85, 90, 95 or 100% homology to the sequence of
임의의 실시예로 돼지의 괴사성장염 항원성 물질로 SEQ ID NO. 4의 서열과 상동성이 70, 75, 80, 85, 90, 95 또는 100%인 서열을 높은 효율로 바실러스 내 지노믹 DNA상에 삽입시켰다.In any embodiment, the antigenic substance of porcine necrotitis is SEQ ID NO. Sequences having 70, 75, 80, 85, 90, 95 or 100% homology with the sequence of 4 were inserted onto genomic DNA in Bacillus with high efficiency.
본 출원의 일 실시예에서는 돼지의 괴사성장염 항원성 물질인 CPA1 또는/및 CPA2를 높은 효율로 바실러스 내 지노믹 DNA 상에 삽입시켰다.In one embodiment of the present application, CPA1 or/and CPA2, which is a porcine necrotizing antigenic substance, was inserted onto genomic DNA in Bacillus with high efficiency.
한편, 상기 CRISPR/Cas9을 이용하여 넉인 시키는 방법 이외에도 ZFN(Zinc-finger nucleases), TALEN(transcription activator-like effector nucleases)을 이용하는 방법 등 넉인이 가능한 기술이라면 이에 제한하지 않는다.On the other hand, in addition to the method of knock-in using CRISPR/Cas9, any technology capable of knock-in such as a method of using ZFN (Zinc-finger nucleases) and TALEN (transcription activator-like effector nucleases) is not limited thereto.
상기 넉인을 할 때 벡터를 이용할 수 있다.A vector can be used when performing the knock-in.
박테리아에 가이드 RNA, Cas9 및 항원성 물질을 이용하여 넉인 시키기 위해 벡터를 제조하여 형질전환 할 수 있다. CRISPR/Cas9 벡터와 항원성 물질 벡터는 하나의 벡터에 Cas9, 가이드 RNA 및 항원성 물질을 포함할 수도 있고, Cas9, 가이드 RNA 및 항원성 물질을 서로 동일한 또는 상이한 벡터에 각각 독립적으로 포함할 수도 있다.A vector can be prepared and transformed to knock-in bacteria using guide RNA, Cas9 and antigenic substances. The CRISPR/Cas9 vector and the antigenic substance vector may contain Cas9, a guide RNA and an antigenic substance in one vector, or may independently contain Cas9, a guide RNA and an antigenic substance in the same or different vector. .
상기 벡터는 바이러스 벡터 또는 비바이러스 벡터일 수 있다.The vector may be a viral vector or a non-viral vector.
상기 바이러스 벡터는 레트로바이러스, 렌티바이러스, 아데노바이러스, 아데노-연관 바이러스(AAV), 백시니아바이러스, 폭스바이러스 등의 바이러스 벡터일 수 있으나, 이에 제한하지는 않는다.The viral vector may be a viral vector such as retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), vaccinia virus, poxvirus, etc., but is not limited thereto.
상기 비바이러스 벡터는 플라스미드, 네이키드 DNA 등일 수 있으나, 이에 제한하지는 않는다.The nonviral vector may be a plasmid or naked DNA, but is not limited thereto.
또한, 벡터를 이용하는 방법 이외에도, 전기천공법, 유전자총, 자기주입법, 초음파천공법 등을 사용할 수 있으나, 이에 제한하지는 않는다.In addition, in addition to the method using the vector, an electroporation method, a gene gun, a magnetic injection method, an ultrasonic method, etc. may be used, but the present invention is not limited thereto.
박테리아의 지노믹 DNA에 돼지의 괴사성장염 항원성 물질을 코딩하는 도너를 삽입한 후, 포자 디스플레이(spore display) 시스템을 이용하기 위하여 상기 박테리아로부터 포자를 형성시키는 단계를 수행한다.After inserting a donor encoding a porcine necrotizing antigenic substance into the bacterial genomic DNA, a step of forming spores from the bacteria in order to use a spore display system is performed.
상기 ii) 상기 박테리아의 포자를 형성시키는 단계는 영양분이 고갈된 영양학적 조건, 고온 또는 저온의 온도적 조건, 고수분 또는 저수분의 수분적 조건, 살균제, 보존제 등의 화학적 조건, 산성 또는 알칼리성의 pH적 조건 등을 이용하여 포자를 형성시킬 수 있으나, 이에 한정하지는 않는다.The step of ii) forming spores of the bacteria may include nutrient-depleted nutritional conditions, high or low temperature temperature conditions, high or low moisture moisture conditions, chemical conditions such as disinfectants and preservatives, acidic or alkaline Spores may be formed using pH conditions, etc., but are not limited thereto.
예를 들어, 본 출원의 돼지의 괴사성장염 백신을 제조할 때 박테리아의 포자를 형성시키는 단계는 영양분이 고갈된 영양학적 조건, 고온 또는 저온의 온도적 조건 중 선택되는 어느 하나 이상으로 이루어 질 수 있다.For example, the step of forming spores of bacteria when preparing the pig's necrotizing growth infection vaccine of the present application may consist of any one or more selected from nutrient-depleted nutritional conditions, high temperature or low temperature temperature conditions. .
다음으로, 상기 형성된 박테리아의 포자에서, 포자 표면에 항원성 물질을 발현시키는 단계를 수행한다(상기 iii) 단계).Next, in the spores of the formed bacteria, a step of expressing an antigenic substance on the spore surface is performed (step iii).
상기 항원성 물질은 박테리아의 포자 표면에 발현된 포자 코트 단백질과 a) 직접적으로 연결되어 발현되거나 또는 b)간접적으로 연결되어 발현될 수 있다. The antigenic substance may be expressed by a) direct linkage with the spore coat protein expressed on the spore surface of bacteria, or b) indirectly linking to the expression.
상기 a) 직접 발현은 박테리아의 포자 표면에 존재하는 포자 코트 단백질과 항원성 물질이 매개물질(예를 들어, 링커)없이 직접적으로 연결되어 있는 형태를 의미한다.The a) direct expression refers to a form in which a spore coat protein present on the spore surface of a bacteria and an antigenic substance are directly linked without a mediator (eg, a linker).
상기 b) 간접 발현은 박테리아의 포자 표면에 존재하는 포자 코트 단백질과 항원성 물질 사이를 연결시켜주는 링커(linker)에 의해 간접적으로 연결되어 있는 형태를 의미한다. The b) indirect expression refers to a form in which the spore coat protein present on the spore surface of bacteria is indirectly linked by a linker that connects the antigenic substance.
본 출원의 일 구체예서, 포자 코트 단백질과 돼지의 괴사성장염 항원성 물질을 링커로 연결하여 발현시킬 수 있다.In one embodiment of the present application, a spore coat protein and a porcine necrotizing antigenic substance may be expressed by linking with a linker.
상기 돼지의 괴사성장염 백신을 제조하는 방법은 큐어링(curing)단계를 선택적으로 더 포함할 수 있다.The method of preparing the pig's necrotizing infection vaccine may optionally further include a curing step.
상기 큐어링 단계는 돼지의 괴사성장염 백신의 조성에서 목적하는 물질만 수득하거나 원하지 않는 물질을 제거하는 것일 수 있다.The curing step may be to obtain only the desired material or remove the unwanted material from the composition of the pig necrotizing infection vaccine.
예를 들어, 큐어링 단계는 항생제 내성 유발 물질을 제거하는 것일 수 있다.For example, the curing step may be to remove a substance causing antibiotic resistance.
예를 들어, 큐어링 단계는, 백신 제조과정에서 첨가된 외래 플라스미드를 제거하는 것일 수 있다.For example, the curing step may be to remove the foreign plasmid added during the vaccine manufacturing process.
상기 큐어링 단계는 2회 이상의 계대 배양으로 수행될 수 있으나, 통상의 큐어링 방법이라면 이에 제한하지는 않는다.The curing step may be performed in two or more passages, but is not limited thereto if it is a conventional curing method.
상기 돼지의 괴사성장염 백신을 제조하는 방법은 부가적인 물질을 추가하는 단계를 더 포함할 수 있다.The method of preparing the porcine necrotizing infection vaccine may further include the step of adding an additional substance.
이 때, 부가적인 물질은 백신 제조시, 통상적으로 약학적으로 허용 가능한 첨가제라면 모두 포함하는 것으로 한다.In this case, the additional substances are to include all additives that are usually pharmaceutically acceptable during vaccine production.
상기 돼지의 괴사성장염 백신은 근육내(intramuscular), 비강내(intranasal), 경구(oral), 복강내(intraperitoneal), 피하(subcutaneous), 국소(topical), 피내(intradermal)와 경피(transdermal) 전달용으로 조제된다.The pig's necrotizing disease vaccine is delivered intramuscular, intranasal, oral, intraperitoneal, subcutaneous, topical, intradermal and transdermal It is formulated for use.
백신의 투여 경로는 근육내, 비강내, 경구, 복강내, 피하, 국소, 피내 그리고 경피 전달에서 선택된다.The route of administration of the vaccine is selected from intramuscular, intranasal, oral, intraperitoneal, subcutaneous, topical, intradermal and transdermal delivery.
5. 괴사성장염 치료방법5. Treatment of necrotizing growth
전술한 본 출원의 과제를 해결하기 위하여, 본 출원의 일 양태에 의하면, 괴사성장염 치료방법이 제공된다.In order to solve the problems of the present application described above, according to an aspect of the present application, a method for treating necrotizing growthitis is provided.
특히, 본 출원의 일 양태에 의하면, 돼지의 괴사성장염 치료방법이 제공된다.In particular, according to an aspect of the present application, there is provided a method for treating necrotizing growth in pigs.
상기 돼지의 괴사성장염 치료방법은 상기 조성물을 유효성분으로 포함하는 조성물을 투여하여 돼지의 괴사성장염을 치료하는 방법이 제공된다.The method for treating necrotizing growth in pigs is provided with a method of treating necrotizing growth in pigs by administering a composition comprising the composition as an active ingredient.
본 출원에서 용어, "투여"는 어떠한 적절한 방법으로 포유류에 본 출원의 약학조성물을 도입하는 것을 의미하며, 본 출원의 약학 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 경구 투여, 복강내 투여, 정맥내 투여, 근육내 투여, 피하 투여, 내피 투여, 비내 투여, 폐내투여, 직장내 투여, 강내 투여, 복강내 투여, 경막내 투여될 수 있으며, 이에 제한되지 않는다. 또한 상기 포유류는 돼지, 소, 양, 염소 등을 포함할 수 있으나, 이에 제한되지는 않는다.In the present application, the term "administration" means introducing the pharmaceutical composition of the present application to a mammal by any suitable method, and the route of administration of the pharmaceutical composition of the present application is administered through any general route as long as it can reach the target tissue. Can be. Oral administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, endothelial administration, intranasal administration, pulmonary administration, rectal administration, intranasal administration, intraperitoneal administration, intrathecal administration, but not limited thereto. In addition, the mammal may include pigs, cattle, sheep, goats, etc., but is not limited thereto.
또한, 상기 조성물을 유효성분으로 포함하는 조성물을 투여하는 방법은 다음의 예시와 같이 투여될 수 있으나, 이에 한정하지는 않는다. In addition, a method of administering a composition containing the composition as an active ingredient may be administered as the following example, but is not limited thereto.
예를 들어 상기 조성물을 유효성분으로 포함하는 조성물 투여시, 돼지에 대한 투여용량은 돼지의 나이, 무게, 성별, 투여형태, 건강상태 및 질병 정도에 따라 달라질 수 있으며, 수의사 또는 농장주의 판단에 따라 일정 시간간격으로 1일 1회 내지 수회로 분할 투여할 수도 있다.For example, when administering a composition comprising the composition as an active ingredient, the dosage for pigs may vary depending on the age, weight, sex, dosage form, health condition and degree of disease of the pig, and according to the judgment of a veterinarian or farmer. It may be administered in divided doses from once to several times a day at regular intervals.
상기 돼지의 괴사성장염 백신의 투여량은 동물 당 유도체 1 ㎍ 내지 100 ㎍이 바람직한데, 이 투여량은 동물의 크기에 따라 부분적으로 달라질 수 있다. 예를 들어, 돼지의 경우, 매우 적합한 투여량은 20 ㎍ 내지 80 ㎍이다. 예를 들어, 돼지의 경우, 매우 적합한 투여량은 10 ㎍ 내지 100 ㎍이다.The dose of the pig's necrotizing infection vaccine is preferably 1 µg to 100 µg of the derivative per animal, and this dose may partially vary depending on the size of the animal. For pigs, for example, a very suitable dosage is between 20 μg and 80 μg. For pigs, for example, a very suitable dosage is between 10 μg and 100 μg.
상기 돼지의 괴사성장염 백신의 투여 방법은 근육내(intramuscular) 투여, 비강내(intranasal) 투여, 경구(oral) 투여, 복강내(intraperitoneal) 투여, 피하(subcutaneous) 투여, 국소(topical) 투여, 피내(intradermal) 투여, 경피(transdermal) 투여 등의 방법으로 투여될 수 있으나, 통상적인 투여 방법이라면 사용할 수 있다.The method of administering the pig's necrotizing vaccine is intramuscular, intranasal, oral, intraperitoneal, subcutaneous, topical, intradermal. It can be administered by methods such as (intradermal) administration or transdermal administration, but any conventional administration method may be used.
예를 들어, 본 출원의 상기 돼지의 괴사성장염 백신은 근육내 투여 방법을 사용할 수 있다.For example, the pig's necrotizing infection vaccine of the present application may be administered intramuscularly.
예를 들어, 본 출원의 상기 돼지의 괴사성장염 백신은 비강내 투여 방법을 사용할 수 있다.For example, the pig's necrotizing infection vaccine of the present application may use an intranasal administration method.
예를 들어, 본 출원의 상기 돼지의 괴사성장염 백신은 경구 투여 방법을 사용할 수 있다.For example, the pig's necrotizing infection vaccine of the present application may use an oral administration method.
예를 들어, 본 출원의 상기 돼지의 괴사성장염 백신은 복강내 투여 방법을 사용할 수 있다.For example, the pig's necrotizing infection vaccine of the present application may use an intraperitoneal administration method.
예를 들어, 본 출원의 상기 돼지의 괴사성장염 백신은 피하 투여 방법을 사용할 수 있다.For example, the pig's necrotizing infection vaccine of the present application may use a subcutaneous administration method.
예를 들어, 본 출원의 상기 돼지의 괴사성장염 백신은 국소 투여 방법을 사용할 수 있다.For example, the pig's necrotizing infection vaccine of the present application may use a topical administration method.
예를 들어, 본 출원의 상기 돼지의 괴사성장염 백신은 피내 투여 방법을 사용할 수 있다.For example, the pig's necrotizing infection vaccine of the present application may use an intradermal administration method.
예를 들어, 본 출원의 상기 돼지의 괴사성장염 백신은 경피 투여 방법을 사용할 수 있다.For example, the pig's necrotizing infection vaccine of the present application may use a transdermal administration method.
본 출원에 의해 개시되는 상기 조성물을 유효성분으로 포함하는 돼지의 괴사성장염 백신 조성물이 포유류에 투여될 때 농도가 1mg/kg 내지 100mg/kg으로 투여될 수 있다.When a pig's necrotizing growth infection vaccine composition comprising the composition disclosed by the present application as an active ingredient is administered to a mammal, the concentration may be administered at a concentration of 1 mg/kg to 100 mg/kg.
본 출원은 상기 조성물을 유효성분으로 포함하는 조성물을 포유류에 투여하여 돼지의 괴사성장염을 치료하는 방법을 제공할 수 있다.The present application may provide a method of treating a pig's necrotizing growthitis by administering a composition comprising the composition as an active ingredient to a mammal.
예를 들어, 본 출원은 상기 조성물을 유효성분으로 포함하는 조성물을 돼지에 투여하여 돼지의 괴사성장염을 치료하는 방법을 제공할 수 있다.For example, the present application may provide a method for treating a pig's necrotizing inflammatory disease by administering a composition comprising the composition as an active ingredient to a pig.
예를 들어, 상기 조성물을 유효성분으로 포함하는 조성물을 돼지에 1mg/kg 내지 100mg/kg 투여하면 돼지의 괴사성장염을 치료하는 방법을 제공할 수 있다.For example, if a composition containing the composition as an active ingredient is administered to a pig from 1 mg/kg to 100 mg/kg, a method of treating necrotizing inflammatory disease in pigs can be provided.
따라서, 본 출원에 의해 개시되는 조성물로 돼지의 괴사성장염을 치료하면 병원 원인체의 변이가 일어나더라도 신속하게 대응할 수 있을 뿐만 아니라 기존 돼지의 괴사성장염 백신 보다 효과가 더 좋을 수도 있다.Therefore, if the composition disclosed by the present application is used to treat a pig's necrotizing growth infection, even if a pathogen mutation occurs, not only can it respond quickly, but it may be more effective than the existing pig's necrotizing growth infection vaccine.
[출원의 실시를 위한 형태][Forms for enforcement of application]
이하, 실시예를 통하여 본 출원을 더욱 상세히 설명하고자 한다.Hereinafter, the present application will be described in more detail through examples.
본 출원의 하기 일 실시예는 돼지의 괴사성장염 백신을 위한 항원, 항체 및 백신 제조에 관한 것이나, 이들 실시예는 오로지 본 출원을 예시하기 위한 것으로 본 출원의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 출원이 속하는 기술분야에서 통상의 지식을 가진 자에 있어 자명할 것이다.The following examples of the present application relate to the preparation of antigens, antibodies, and vaccines for a porcine necrotizing disease vaccine, but these examples are for illustrative purposes only, and the scope of the present application is not limited by these examples. This will be apparent to those of ordinary skill in the art to which this application belongs.
실시예 1 : 바실러스 실험종과 벡터제작Example 1: Bacillus experimental species and vector production
i)바실러스 실험종i) Bacillus test species
실험에 사용한 바실러스 종은 Bacillus subtilis 168로 Bacillus Genetic Stock Center에서 분양받아 Luria-Bertani (LB) broth와 LB 평판배지를 이용하여 37°C에서 배양하였다. 분양받은 cell stock은 LB 고체배지에서 1차 스크리닝(18hs)을 수행하였고, 1개의 colony를 확보하여 2차 액체 배양(18hs)을 수행하였다.Bacillus species used in the experiment was Bacillus subtilis 168, which was pre-sold at the Bacillus Genetic Stock Center and cultured at 37°C using Luria-Bertani (LB) broth and LB plate medium. The pre-sold cell stock was first screened (18hs) in LB solid medium, and a second liquid culture (18hs) was performed by securing one colony.
ii)ii) B. subtilisB. subtilis 포자 형성 Spore formation
B. subtilis를 sporulation salt (1 M CaCl2 1ml/L, 0.1 M MnCl2 1 ml/L, 0.01 M FeSO4 1 ml/L)가 포함된 NB 배지 (nutrient broth 8 g/L, MgSO4 - 0.25 g/L, KCl - 1 g/L)를 사용하여 37℃ 에서 진탕 배양 (48 h) 후 8,000 rpm 15 min 원심분리, harvest를 수행하였다. A B. subtilis sporulation salt (1 M CaCl 2 1ml / L, 0.1
Cold water (D.W.)를 이용해 60% 농축하여 재현탁하고 4℃ overnight (18 h) 반응시켜 주었다. 그 후 80℃에서 30분 heat inactivation을 수행한다. 8,000 rpm 15 min 원심분리, harvest 후 1 X PBS로 재현탁 후 생성된 포자를 4℃ 보관하여 사용하였다.It was concentrated and resuspended at 60% using cold water (D.W.) and reacted at 4° C. overnight (18 h). After that, heat inactivation is performed at 80°C for 30 minutes. After centrifugation at 8,000 rpm 15 min, resuspended in 1 X PBS after harvesting, the resulting spores were stored and used at 4°C.
iii)벡터 제작iii) Vector production
(a) pHCas9 발현 벡터 (도 1)(a) pHCas9 expression vector (Fig. 1)
B. subtilis 내 S. pyogenes Cas9(SpCas9) 단백질 발현을 위한 pHCas9 벡터로 pHCas9 발현벡터는 한국생명공학연구원에서 분양받아 사용하였다. As a pHCas9 vector for the expression of S. pyogenes Cas9 (SpCas9) protein in B. subtilis , the pHCas9 expression vector was distributed and used by Korea Research Institute of Bioscience and Biotechnology.
(b) 항원결정기 벡터(b) epitope vector
B. subtilis coat protein (CotG)의 가이드 RNA 그리고 promoter를 포함하는 CotG CDS와 항원결정기를 포함하는 유전자복합체인 공여체 DNA를 포함하는 벡터를 제작하였다.A vector containing the guide RNA of B. subtilis coat protein (CotG), the CotG CDS containing the promoter, and the donor DNA, which is a gene complex containing the epitope, was constructed.
B. subtilis 유전체에서 가이드RNA 제작 프로그램 CCTOP (https://crispr.cos.uni-heidelberg.de)를 이용하여 CotG 영역의 가이드 RNA (SEQ ID NO. 3 : TACGTTCATCCTTAACATATTTTTAAAAGGA)를 제작하였고, 제한효소 NcoI 과 EcoRV를 이용하여 pHY300PLK 벡터에 도입하였고 pJB라 명명했다(도 2). Using the guide RNA production program CCTOP (https://crispr.cos.uni-heidelberg.de) in the B. subtilis genome, guide RNA (SEQ ID NO. 3: TACGTTCATCCTTAACATATTTTTAAAAGGA) of the CotG region was produced, and restriction enzyme Nco I And EcoR V were introduced into the pHY300PLK vector and named pJB (Fig. 2).
이 때, 항원결정기로 GFP, Clostridium perfringens toxin A (CPA)를 각각 포함하는 벡터를 제작하였다.At this time, a vector containing GFP and Clostridium perfringens toxin A (CPA) as epitopes were prepared.
● pJB-GFP (도 3)● pJB-GFP (Figure 3)
B. subtilis 포자 표면에 목적한 항원결정기가 위치하는지 확인하기 위해 녹색형광단백질 (eGFP)이 삽입된 발현벡터를 제작하였다. GFP 유전자는 MDH1-PGK-GFP_2.0 벡터에서 primer를 제작(표 1의 SEQ ID NO. 4, 5)하여 PCR을 통해 증폭하였고, 5'말단에 제한효소 PstI를, 3'말단에 BamHI을 제작하였다. 증폭된 GFP DNA는 제한효소 PstI과 BamHI을 이용하여 pJB009 벡터에서 CPA1 부위를 제거하고 도입하여 pJB-GFP를 제작하였다. In order to check whether the target epitope is located on the surface of B. subtilis spores, an expression vector containing a green fluorescent protein (eGFP) was constructed. The GFP gene was amplified through PCR by making a primer from the MDH1-PGK-GFP_2.0 vector (SEQ ID NOs. 4 and 5 in Table 1), and restriction enzyme Pst I at the 5'end and BamH I at the 3'end. Was produced. As for the amplified GFP DNA, pJB-GFP was prepared by removing and introducing the CPA1 site from the pJB009 vector using restriction enzymes Pst I and BamH I.
● pJB-CPA (pJB009 내지 pJB010) (도 5 내지 도 6)● pJB-CPA (pJB009 to pJB010) (Figs. 5 to 6)
B. subtilis 포자 표면에 항원결정부위를 올리기 위해 B. subtilis gDNA에서 CotG-Full_F와 CotG-Full_R 프라이머(표 1; SEQ ID NO. 6, 7; 서열에서 bold는 enzyme site)를 사용하여 coat protein (CotG)의 프로모터와 CDS부분을 증폭하였고, 5'말단에 제한효소 HindIII을, 3'말단에 15 bp의 링커를 포함한 제한효소 PstI을 제작하였다. 또한 또한 돼지 괴사성 장염 (Clostridium perfringens toxin A, CPA) 항원결정부위는 Clostridium perfringens에서 Toxin A의 2 부위의 항원 후보 영역을 확인하였다(도 4). 제한효소 PstI이 포함된 CPA_F, CPA2_F와 BamHI이 포함된 CPA1_R, CPA2_R을 이용하여 Clostridium perfringens toxin A 유전자들을 확보하였다. (표 1; SEQ ID NO. 8 내지 11; 서열에서 bold는 enzyme site)To raise the epitope on the surface of B. subtilis spores, coat protein (enzyme site in B. subtilis gDNA) using CotG-Full_F and CotG-Full_R primers (Table 1; SEQ ID NO. 6, 7; bold in the sequence). CotG) promoter and CDS portion were amplified, and restriction enzyme Pst I including a restriction enzyme Hind III at the 5'end and a 15 bp linker at the 3'end was prepared. In addition, the antigen-determining site of porcine necrotizing enteritis ( Clostridium perfringens toxin A, CPA) was confirmed to be an antigen candidate region of two sites of Toxin A in Clostridium perfringens (FIG. 4). Clostridium perfringens toxin A genes were obtained using CPA_F and CPA2_F containing restriction enzymes Pst I and CPA1_R and CPA2_R containing BamH I. (Table 1; SEQ ID NO. 8 to 11; bold in the sequence is an enzyme site)
확보된 coat protein 돼지 괴사성장염 항원 후보유전자들을 PstI 제한효소를 사용하여 절단하고 T4 Ligase를 이용하여 공여체 DNA를 제작하였다. 제작된 공여체 DNA는 제한효소 HindIII과 BamHI을 이용하여 pJB 벡터에 도입하여 CPA1 영역이 삽입된 pJB009, CPA2영역이 삽입된 pJB010를 각각 제작하였고 명명하였다.The obtained coat protein porcine necrotizing antigen candidate genes were digested with Pst I restriction enzyme and donor DNA was prepared using T4 Ligase. The prepared donor DNA was introduced into the pJB vector using the restriction enzymes Hind III and BamH I, and pJB009 into which the CPA1 region was inserted and pJB010 into which the CPA2 region was inserted were prepared and named.
(c) 항생제결손 벡터(pJB-sg02 내지 pJB-sg03) (도 7 내지 8)(c) antibiotic-deficient vector (pJB-sg02 to pJB-sg03) (Figs. 7 to 8)
항생제 저항성유전자의 결손을 위해 ampicillin 저항성유전자를 목적으로 하는 가이드 RNA (SEQ ID NO. 12 :CGATACGTGCTCCGGTTCCCAACGATCAAGGA)와 neomycin 저항성 유전자를 목적으로 하는 가이드 RNA (SEQ ID NO. 13 :GACGAGT TATTAATAGCTGAATAAGAACGGT)를 제작하였고, 제한효소 NcoI 과 EcoRV를 이용하여 pJB 벡터에 도입하였고, 항생제 저항성 유전자의 가운데의 염기서열을 결손시킨 공여체 DNA를 사용하여, pJB-sg02 (amp deletion), pJB-sg03 (neo deletion) 벡터를 제작하였다.For the deletion of the antibiotic resistance gene, a guide RNA (SEQ ID NO. 12: CGATACGTGCTCCGGTTCCCAACGATCAAGGA) for the purpose of the ampicillin resistance gene and a guide RNA (SEQ ID NO. 13: GACGAGT TATTAATAGCTGAATAAGAACGGT) for the neomycin resistance gene were prepared. The enzymes NcoI and EcoRV were used to introduce the pJB vector, and pJB-sg02 (amp deletion) and pJB-sg03 (neo deletion) vectors were constructed using the donor DNA in which the central nucleotide sequence of the antibiotic resistance gene was deleted.
실시예 2 : 바실러스 수용성 세포 제작 (Example 2: Preparation of Bacillus soluble cells ( B. subtilisB. subtilis 수용성 세포 (Competent cell) 제작) Production of Competent Cell)
B. subtilis 세포 내에 외래 물질(plasmid, phage DNA 등)을 도입할 수 있도록 다음과 같이 수행하였다. In order to introduce foreign substances (plasmid, phage DNA, etc.) into B. subtilis cells, it was performed as follows.
B. subtilis 수용성 세포의 제작은 하나의 B. subtilis colony를 Growth medium (LB broth + 0.5M sorbitol)를 이용하여 37°C 진탕배양기에서 1차 배양 (18hs) 후 Growth medium에 1/16 희석하여 O.D600 에서 0.85-0.95가 될 때까지 2차 배양하였다. For the production of B. subtilis soluble cells, one B. subtilis colony was first cultured (18 hs) in a shaking incubator at 37°C using Growth medium (LB broth + 0.5M sorbitol), and then diluted 1/16 in the growth medium. Second culture was performed until 0.85-0.95 at .D600.
배양액을 얼음상에서 10분간 반응하여 차갑게 해주고, 4°C, 5000 X g에서 5분간 원심분리를 수행하여 상층액을 버린고 차가운(ice-cold) Wash buffer (0.5 M sorbitol, 0.5 M mannitol, 10 % glycerol)에 반복하여 4회 세척하였다. 1 - 1.3 * 1010 cfu/mL이 되도록 electroporation solution (0.5 M sorbitol, 0.5 M mannitol, 10 % glycerol)희석하여 수용성 세포를 제작한 후 60 μl 식 분주하여 -80°C 에서 보관하였다.Cool the culture solution by reacting on ice for 10 minutes, centrifugation at 4 °C, 5000 X g for 5 minutes to discard the supernatant, and ice-cold Wash buffer (0.5 M sorbitol, 0.5 M mannitol, 10%) glycerol) repeatedly washed 4 times. Water-soluble cells were prepared by diluting electroporation solution (0.5 M sorbitol, 0.5 M mannitol, 10% glycerol) to 1-1.3 * 10 10 cfu/mL, and then aliquoted into 60 μl and stored at -80 °C.
실시예 3 : Example 3: B. subtilisB. subtilis 형질전환체 생성 Generating transformants
실시예 2에서 제작된 B. subtilis 수용성 세포 (Competent cell)에 실시예 1에서 제작된 벡터들을 각각 도입하여 형질전환 시키기 위해 다음과 같이 수행하였다.In order to transform the vector prepared in Example 1 into each of the B. subtilis soluble cells prepared in Example 2 (Competent cell), it was carried out as follows.
B. subtilis의 형질전환은 Gene Pulser System (BIO-RAD. USA)를 이용하여 Electroporation방법 (Xue. et al. 1999)으로 수행하였다. 제작된 B. subtilis 수용성 세포 (60 μl)에 형질전환 발현벡터 5μl (200 ng/μl)를 첨가하여 섞어주고 얼음에서 3분간 반응 후 electroporation cuvette (0.1 cm gap)에 넣어준다. voltage; 2,100 V, time constant; 5 ms, No. of pulses; 1 조건하에서 전기충격을 주어 형질전환 발현벡터를 세포 내 도입되도록 유도한다. 그 후 37°C에서 3시간 배양하며 형질전환 세포의 회복을 유도하고 항생제 선택배지에 도말하여 37°C에서 배양한다.Transformation of B. subtilis was performed by the Electroporation method (Xue. et al. 1999) using the Gene Pulser System (BIO-RAD. USA). To the prepared B. subtilis soluble cells (60 μl), 5 μl (200 ng/μl) of the transgenic expression vector was added and mixed, reacted on ice for 3 minutes, and then put in an electroporation cuvette (0.1 cm gap). voltage; 2,100 V, time constant; 5 ms, No. of pulses; Under 1 condition, electric shock is applied to induce the transduction expression vector to be introduced into the cell. Then, incubate at 37°C for 3 hours to induce recovery of the transformed cells, spread on an antibiotic selective medium, and incubate at 37°C.
(a) pHCas9 벡터가 도입된 B. subtilis 형질전환체(a) B. subtilis transformant into which pHCas9 vector was introduced
pHCas9 벡터가 도입된 B. subtilis 형질전환체는 Neomycin (10 μg/mL)을 첨가하여 배양하였다.The B. subtilis transformant into which the pHCas9 vector was introduced was cultured by adding Neomycin (10 μg/mL).
(b) pJB-GFP 벡터가 도입된 B. subtilis 형질전환체(b) B. subtilis transformant introduced with pJB-GFP vector
pJB-GFP 벡터가 도입된 B. subtilis 형질전환체는 Ampicillin (100 μg/mL)과 Neomycin (10 μg/mL)이 첨가된 LB 고체배지에 배양하였다. B. subtilis transformants into which the pJB-GFP vector was introduced were cultured in LB solid medium supplemented with Ampicillin (100 μg/mL) and Neomycin (10 μg/mL).
(c) pJB-CPA (pJB009 내지 pJB010)벡터가 도입된 B. subtilis 형질전환체(c) B. subtilis transformants into which the pJB-CPA (pJB009 to pJB010) vector was introduced
pJB009 내지 pJB010 벡터가 도입된 B. subtilis 형질전환체는 Ampicillin (100 μg/mL)과 Neomycin (10 μg/mL)이 첨가된 LB 고체배지에 배양하였다. B. subtilis transformants into which pJB009 to pJB010 vectors were introduced were cultured in LB solid medium to which Ampicillin (100 μg/mL) and Neomycin (10 μg/mL) were added.
(d) 항생제결손 벡터(pJB-sg02 내지 pJB-sg03)가 도입된 B. subtilis 형질전환체(d) B. subtilis transformants introduced with antibiotic-deficient vectors (pJB-sg02 to pJB-sg03)
항생제 저항성 유전자의 결손을 위해 pJB-sg02 또는 pJB-sg03 벡터가 도입된 B. subtilis 형질전환체는 항생제를 넣지 않은 LB 고체배지에 1차 배양 후 각 colony를 항생제 배지에 옮겨 확인하였고, 항생제 배지에서 자라지 않는 colony를 선별하였다.For the deletion of the antibiotic resistance gene, the B. subtilis transformants into which the pJB-sg02 or pJB-sg03 vector was introduced were first cultured in LB solid medium without antibiotics, and then each colony was transferred to the antibiotic medium. Colony that did not grow was selected.
실시예 4 : Example 4: B. subtilisB. subtilis 형질전환체 내의 벡터 도입여부 확인 Confirmation of vector introduction in transformants
B. subtilis의 포자에 GFP 발현벡터가 도입되어 포자의 표면에 GFP가 발현되는지 확인하기 위해, PCR 분석 및 유세포 분석을 통해 확인하였다. In order to confirm whether the GFP expression vector was introduced into the spores of B. subtilis and GFP was expressed on the surface of the spores, PCR analysis and flow cytometry were performed.
● PCR 분석● PCR analysis
형질전환체 B. subtilis의 colony를 LB broth에서 배양하여 gDNA를 분리하였다. Primer를 제작 (표 2의 SEQ ID NO. 14, 15; In-GFP_F, In-GFP_R)하여 PCR을 수행하여 형질전환체와 야생형의 DNA에서 도입유전자의 여부를 확인하였다.The colony of transformant B. subtilis was cultured in LB broth to isolate gDNA. Primer was prepared (SEQ ID NO. 14, 15 in Table 2; In-GFP_F, In-GFP_R) and PCR was performed to confirm the presence of a transgene in the transformant and wild-type DNA.
B. subtilis 세포의 게놈 내에 GFP 발현 벡터가 도입되어 B. subtilis 포자 표면에 GFP 의 발현을 확인하기 위해 수행한 PCR 결과는 도 9에 도시하였다. The result of PCR performed to confirm the expression of GFP on the surface of B. subtilis spores by introducing a GFP expression vector into the genome of B. subtilis cells is shown in FIG. 9.
도 9에서 GFP의 밴드가 확인되는 것으로 보아, B. subtilis 세포 포자의 표면에 GFP가 발현됨을 알 수 있었다.As the band of GFP was confirmed in FIG. 9, it could be seen that GFP was expressed on the surface of the spores of B. subtilis cells.
● 유세포 분석 (FACS)● Flow cytometry (FACS)
B. subtilis의 형질전환체 내의 도입된 유전자 단백질의 표면 발현 검증을 위해 pJB-GFP 벡터를 이용하여 유세포분석을 수행하여 확인하였다. To verify the surface expression of the introduced gene protein in the transformant of B. subtilis , it was confirmed by performing flow cytometry using the pJB-GFP vector.
유동세포 계측법에 의한 분석을 위해 pJB-GFP 벡터로 형질전환 한 B. subtilis를 0.22 ㎛의 여과된 1.5 x PBS로 세척하고, 희석하였다. 미소구의 농도는 106 beads-1 범위로 계산하였고, B. subtilis 세포는 재현탁 후 몇 분 이내에 유세포 분석기에 주입되었다. FACScalibur (Becton Dickinson, Oxford, UK) 계측기를 사용하여 분석을 수행하였다.For analysis by flow cytometry, B. subtilis transformed with the pJB-GFP vector was washed with 0.22 μm filtered 1.5×PBS and diluted. The concentration of microspheres was calculated in the range of 106 beads -1 , and B. subtilis cells were injected into the flow cytometer within a few minutes after resuspension. Analysis was performed using a FACScalibur (Becton Dickinson, Oxford, UK) instrument.
600V의 전압에서 설정된 형광검출기를 통해 515-545nm 범위의 형광을 검출하였다. 전방산란 (FS)은 증폭 계수가 10 인 다이오드로 수집하고 로그 값으로 계산하였다. 366V로 설정된 광전자 증 배관에 의해 로그 값에서 사이드 스캐터 (SS)가 검출되었다. 모든 출력 신호 [형광 (FL), FS 및 SS]에 대해 대수 채널수를 선형 강도로 변환하고 'G 평균'이 있는 기하 평균은 다음과 같이 정의됩니다. G 평균 = 10ΣlogX (i) / n; 각 측정에 대해 10,000 개의 신호를 측정하였다.Fluorescence in the range of 515-545nm was detected through a fluorescence detector set at a voltage of 600V. Forward scattering (FS) was collected with a diode with an amplification factor of 10 and calculated as a log value. Side scatter (SS) was detected at log values by photomultiplier pipe set to 366V. For all output signals [Fluorescence (FL), FS and SS], the number of logarithmic channels is converted to linear intensity and the geometric mean with'G mean' is defined as: G mean = 10ΣlogX (i) / n; 10,000 signals were measured for each measurement.
B. subtilis 세포내 pJB-GFP 발현 벡터 도입여부를 확인하기 위해 수행한 유세포분석 결과는 도 10에 도시하였다. The results of flow cytometry performed to confirm whether the pJB-GFP expression vector was introduced into B. subtilis cells are shown in FIG. 10.
도 10에서 pJB-GFP 발현 벡터가 도입되지 않은 wild type 그래프에 비해 pJB-GFP 발현 벡터가 도입된 pJB-GFP그래프에서 GFP 발현이 shifting된 것이 확인되는 것으로 보아, PCR 결과와 동일하게, B. subtilis 세포 포자의 표면에 GFP가 발현됨을 알 수 있었다.In FIG. 10, it was confirmed that GFP expression was shifted in the pJB-GFP graph into which the pJB-GFP expression vector was introduced compared to the wild type graph into which the pJB-GFP expression vector was not introduced, in the same way as the PCR result, B. subtilis It was found that GFP was expressed on the surface of cell spores.
실시예 5 : Example 5: B. subtilisB. subtilis 포자 표면에 목적한 항원결정기의 확인 Identification of the target epitope on the spore surface
실시예 4에서 B. subtilis의 포자에 GFP 발현벡터가 도입되어 포자의 표면에 GFP가 발현되는지 확인하였고, GFP 발현벡터 대신 목적하는 항원발현벡터가 포자의 표면에 발현되는지 확인하기 위해, 목적발현벡터(pJB009 내지 pJB010)의 발현여부를 PCR 분석을 통해 확인하였다.In Example 4, a GFP expression vector was introduced into the spores of B. subtilis to confirm that GFP was expressed on the surface of the spore, and to confirm whether the desired antigen expression vector was expressed on the surface of the spore instead of the GFP expression vector, the target expression vector Expression of (pJB009 to pJB010) was confirmed through PCR analysis.
● PCR 분석● PCR analysis
형질전환체 B. subtilis의 colony를 LB broth에서 배양하여 gDNA를 분리하였다. 도입된 Clostridium perfringens toxin A 영역의 2부위 안쪽에서 primer를 제작 (표 2의 SEQ ID NO. 18 내지 21; In-CPA1_F, In-CPA1_R, In-CPA2_F, In-CPA2_R)하여 PCR을 수행하였고, 형질전환체와 야생형의 DNA에서 도입유전자의 여부를 확인하였다.The colony of transformant B. subtilis was cultured in LB broth to isolate gDNA. A primer was prepared inside the 2 site of the introduced Clostridium perfringens toxin A region (SEQ ID NOs 18 to 21 in Table 2; In-CPA1_F, In-CPA1_R, In-CPA2_F, In-CPA2_R) and PCR was performed. Transgenes were confirmed in the transformant and wild-type DNA.
B. subtilis 포자 표면에 목적한 항원의 발현 벡터 발현여부를 확인하기 위해 수행한 PCR 결과는 도 11에 도시하였다. The results of PCR performed to confirm the expression of the expression vector of the target antigen on the surface of B. subtilis spores are shown in FIG. 11.
도 11에서 CPA1 및 CPA2의 증폭 밴드를 확인할 수 있었으며, 이를 통해 B. subtilis의 포자 표면에 목적하는 항원이 발현됨을 알 수 있었다.In FIG. 11, the amplification bands of CPA1 and CPA2 could be confirmed, through which it could be seen that the target antigen was expressed on the spore surface of B. subtilis .
실시예 6 : 항체형성 확인Example 6: Confirmation of antibody formation
B. subtilis 포자의 게놈내에 삽입되어진 항생제 저항성 유전자(예를 들어, neo, amp 등)를 제거하기 위하여, pJB-CPA 발현벡터가 도입된 B. subtilis 형질전환체를 pJB-sg02, 03 벡터로 형질전환을 수행하여 항생제 저항성 유전자의 결손을 유도하였다. 형질전환체를 항생제가 첨가되지 않은 LB 평판 배지에 도말 한 후 형성된 각각의 단일 colony를 항생제 LB 평판 배지에 음성 선택 배양하였고, 항생제 LB 평판 배지에서 자라지 않는 colony를 선별하여 항생제 유전자 결손 B. subtilis를 확보하였다. In order to remove the antibiotic resistance gene (eg, neo, amp, etc.) inserted into the genome of B. subtilis spores, the B. subtilis transformant into which the pJB-CPA expression vector was introduced was transformed with pJB-sg02, 03 vectors. Conversion was performed to induce deletion of the antibiotic resistance gene. The transformants were plated on LB plate medium to which antibiotics were not added, and then each single colony formed was negatively cultured on the antibiotic LB plate medium, and colonies that did not grow on the antibiotic LB plate medium were selected for antibiotic gene deletion B. subtilis . Secured.
● PCR 분석● PCR analysis
Primer를 제작 (표 3의 SEQ ID NO. 22 내지 25)하여 PCR을 수행하여 CPA 항원 유전자가 도입된 형질전환체 B. subtilis의 항생제 유전자 결손 여부를 확인하였다.Primer was prepared (SEQ ID NOs 22 to 25 in Table 3), and PCR was performed to confirm the deletion of the antibiotic gene of the transformant B. subtilis into which the CPA antigen gene was introduced.
pJB-CPA 발현벡터가 도입된 B. subtilis 형질전환체의 항생제 유전자가 결손된 것을 확인하기 위해 수행한 PCR 결과는 도 12 및 도13에 도시하였다. The results of PCR performed to confirm that the antibiotic gene of the transformant of B. subtilis into which the pJB-CPA expression vector was introduced is defective are shown in FIGS. 12 and 13.
도 12 및 도 13에서 AmpR 및 NeoR의 밴드가 확인되지 않는 것으로 보아, B. subtilis 형질전환체 내에 항생제 유전자가 결손되었음을 알 수 있었다.As the bands of AmpR and NeoR were not found in FIGS. 12 and 13, it could be seen that the antibiotic gene was deleted in the B. subtilis transformant.
항생제 유전자가 결손된 목적 항원이 발현되는 B. subtilis의 형질전환체를 이용한 면역형성을 확인하기 위하여 B. subtilis 포자는 80˚C에서 20분 동안 고온처리하여 불활화 단계를 거쳐 동물실험에 사용하였다. Mouse는 C57BL/6, 암컷, 8주령을 사용하였고, 5마리의 mouse를 한 그룹으로 설정하였다. B. subtilis spores were subjected to an inactivation step by high temperature treatment at 80˚C for 20 minutes to confirm immunity formation using a transformant of B. subtilis expressing the target antigen with a deficient antibiotic gene. . Mouse was C57BL/6, female, 8 weeks old, and 5 mice were set as one group.
투여 경로는 점막을 통한 면역형성을 확인하기 위해 mouse용 존데를 이용하여 위내 직접 투여하였고, dose는 5x10^10 spore/0.2ml로 하였다. 투여는 총 3회로 진행하였고, 1회 투여 시 3일 연속으로 투여하고 각 회 차의 간격은 2주로 하였다. The route of administration was to confirm the formation of immunity through the mucous membrane, and was administered directly into the stomach using a mouse sonde, and the dose was 5x10^10 spore/0.2ml. The administration was performed three times in total, and for one administration, it was administered for 3 consecutive days, and the interval between each dose was 2 weeks.
항체형성확인 실험은 동물실험을 이용한 ELISA와 western blot으로 분석하였다.The antibody formation confirmation experiment was analyzed by ELISA and western blot using animal experiments.
ELISA와 western blot에 필요한 혈청은 투여 하루 전 가벼운 마취 후 안와채혈하여 실온에서 30~60분간 비동화한 후 6000rpm, 7min, 4℃에서 원심분리하여 상층액만 분리하여 수행하였다.Serum required for ELISA and western blot was collected one day prior to administration, after light anesthesia, orbital blood was collected, immobilized at room temperature for 30-60 minutes, and then centrifuged at 6000 rpm, 7 minutes, and 4°C to separate the supernatant.
● Indirect ELISA 분석● Indirect ELISA analysis
Plate에 항원을 coating 하는 방법을 사용하였고 돼지의 괴사성장염 특이적 항체형성 검출을 위해 정제된 정제된 항원후보유전자 단백질을 100 ng/well의 농도로 코팅하였다. 코팅용액은 0.05M의 Carbonate/bicarbonate buffer (pH 9.6)을 사용하였다. A method of coating the antigen on the plate was used, and the purified antigen candidate gene protein was coated at a concentration of 100 ng/well to detect the formation of antibodies specific for necrotizing in pigs. As the coating solution, 0.05M Carbonate/bicarbonate buffer (pH 9.6) was used.
항체의 희석 배수 그리고 이차 항체의 희석배수를 결정하여 ELISA 분석 조건을 확립하기 위해 고정화 용액 (1% BSA)을 사용하여 분석하였다. 일차 항체의 희석배수를 1:10 부터 1:10,000까지, 이차 항체는 Goat-anti-mouse IgG-HRP를 사용하였으며, 희석 배수는 1:5,000부터 1:160,000까지의 범위로 정하여 분석 분석하였다. 반응 정도 (BT/B0)의 값이 50%를 유지하는 농도 (1:10,000)를 선택하여 분석 실험에 사용하는 최적 농도로 결정하였다.The dilution factor of the antibody and the dilution factor of the secondary antibody were determined and analyzed using an immobilization solution (1% BSA) to establish ELISA assay conditions. The dilution factor of the primary antibody was 1:10 to 1:10,000, the secondary antibody was Goat-anti-mouse IgG-HRP, and the dilution factor was set in the range of 1:5,000 to 1:160,000, and analyzed. The concentration (1:10,000) in which the value of the reaction degree (B T /B 0 ) is maintained at 50% was selected and determined as the optimum concentration used in the assay.
세척 용액은 0.05%의 Tween 20을 첨가한 PBS buffer를 사용하였고, 각 단계의 반응은 상온에서 2시간 배양하여 반응시켰다. 기질 용액은 TMB를 사용하였고, 반응의 종결은 0.16 M H2SO4 (stop solution) 100 ul을 주입하여 반응을 멈춘 후 ELISAreader (TECAN SUNRISE, BioSurplus)에서 450 nm의 파장에서 O.D값을 측정하였다(도 14).The washing solution was a PBS buffer to which 0.05
도 14에는 Indirect ELISA 분석 결과를 도시하였다.14 shows the results of Indirect ELISA analysis.
도 14의 ELISA 결과를 통해, 항원을 투여한 쥐의 혈액에서 돼지의 괴사성장염 항원 특이적 항체 중 CPA2는 4주차에 CPA1은 6주차에 생성됨(0.8 이상)을 도 14의 결과를 통해 알 수 있었다.Through the ELISA results of FIG. 14, it was found from the results of FIG. 14 that CPA2 was generated at
● Western blot 분석● Western blot analysis
항원 후보 단백질의 특성에 따라 GST 또는 6His가 tagging 된 재조합 단백질을 glutathione 또는 Ni-NTA resin에 항원 후보 단백질을 binding시킨 후, washing buffer로 wash하여 resin에 binding 하지 않은 단백질을 제거하였다. Elution buffer를 column에 loading하여 resin에 붙어 있던 타겟 단백질을 분리시켜 추출하였다. SDS-PAGE를 이용하여 추출한 단백질이 타겟단백질과 동일한 사이즈에 위치하는지 확인하여 항원 후보단백질을 정제하였다. Depending on the characteristics of the antigen candidate protein, the recombinant protein tagged with GST or 6 His was bound to glutathione or Ni-NTA resin, and then washed with a washing buffer to remove the protein that was not bound to the resin. The elution buffer was loaded onto the column, and the target protein attached to the resin was separated and extracted. The antigen candidate protein was purified by checking whether the extracted protein is located in the same size as the target protein by using SDS-PAGE.
정제된 돼지의 괴사성장염 후보유전자 단백질을 500 ng/ml를 10% SDS-PAGE gel에 loading하여 단백질을 분리하였다. 분리된 단백질은 4℃ cold room에서 polyvinylidene difluoride membrane (PVDF, Bio-rad)에 100 mA로 2시간 동안 전사시킨 후, 5% skim milk가 포함된 TBST (Tris buffered saline with Tween 20, pH 7.5) 용액으로 상온에서 1시간 동안 blocking하였다. Mouse에서 채취한 혈액의 혈청 (serum)을 5% skim milk에 1:10 또는 1:100으로 희석하여 사용하였다. 각각 4℃에서 18시간 동안 반응시킨 후 TBST로 5분씩 3회 세정하였다. 2차 항체로는 horse radish peroxidase (HRP)가 결합된 goat anti-mouse IgG H&L (abcam)를 1:20,000으로 5% skim milk에 희석하여 상온에서 1시간 반응시킨 후, TBST로 3회 세정하였다. ECL (Thermo Scientific, Rockford, IL, USA) 기질과 1~3분간 반응한 후 각각의 단백질 밴드는 LAS-3000으로 가시화하였다 (도 15). The protein was separated by loading 500 ng/ml of the purified porcine necrotizing candidate gene protein onto a 10% SDS-PAGE gel. The separated protein was transferred to a polyvinylidene difluoride membrane (PVDF, Bio-rad) for 2 hours at 100 mA in a cold room at 4°C, and then a TBST (Tris buffered saline with
도 15에는 Western blot 분석 결과를 도시하였다.15 shows the results of Western blot analysis.
도 15의 결과를 통해, 항원을 투여한 쥐의 혈액에서 괴사성장염 항원 특이적 항체 중 CPA2는 4주차에 CPA1은 6주차에 생성됨을 도 15를 통해 확인할 수 있었다.Through the results of FIG. 15, it was confirmed through FIG. 15 that CPA2 among the necrotizing antigen-specific antibodies in the blood of mice administered with the antigen was generated at 4 weeks and CPA1 at 6 weeks.
도 14 및 15의 Indirect ELISA 및 Western blot 분석을 통해 본 출원의 방법으로 만들어진 CRISPR/Cas9 기반의 Bacillus subtilis 포자는 목적하는 항원인 돼지의 괴사성장염 항원이 B. subtilis의 포자의 표면에 발현되어 항체를 형성할 수 있음을 확인할 수 있었다.In the CRISPR/Cas9-based Bacillus subtilis spores made by the method of the present application through the Indirect ELISA and Western blot analysis of FIGS. 14 and 15, the target antigen, the necrotic growth salt antigen of pig, is expressed on the surface of the spore of B. subtilis to obtain antibodies. It was confirmed that it can be formed.
<110> JBBiotech <120> Necrotic enteritis vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism <130> CP19-058 <160> 25 <170> KoPatentIn 3.0 <210> 1 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> CPA1 <400> 1 tatgcagcaa aggtaacttt agctaactct caaaaaggaa cagcaggata tatttataga 60 ttcttacacg atgtatcaga gggtaatgat ccatcagttg gaaataatgt aaaagaacta 120 gtagcttaca tatcaactag tggtgaaaaa gatgctggaa cagatgacta catgtatttt 180 ggaatcaaaa caaaggatgg aaaaactcaa gaatgggaaa tggacaaccc aggaaatgat 240 tttatggctg gaagcaaaga cacttatact ttcaaattaa aagatgaaaa tctaaaaatt 300 gatgatatac aaaatatgtg gattagaaaa agaaaatata cagcattccc agatgcttat 360 aagccagaaa ac 372 <210> 2 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> CPA2 <400> 2 aatgatccat cagttggaaa taatgtaaaa gaactagtag cttacatatc aactagtggt 60 gaaaaagatg ctggaacaga tgactacatg tattttggaa tcaaaacaaa ggatggaaaa 120 actcaagaat gggaaatgga caacccagga aatgatttta tggctggaag caaagacact 180 tatactttca aattaaaaga tgaaaatcta aaaattgatg atatacaaaa tatgtggatt 240 agaaaaagaa aatatacagc attcccagat gcttataagc cagaaaacat aaaggtaata 300 gcaaatggaa aagttgtagt tgacaaggat ataaatgagt ggatttcagg aaattcaact 360 tataatataa aataa 375 <210> 3 <211> 31 <212> RNA <213> Artificial Sequence <220> <223> CotG_gRNA <400> 3 tacgttcatc cttaacatat ttttaaaagg a 31 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GFP_F <400> 4 ataaagctta tggtgagcaa g 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GFP_R <400> 5 tatggatcct tacttgtaca g 21 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CotG-Full_F <400> 6 ataaagctta gtgtccctag ctccg 25 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> CotG-Full_R <400> 7 tatctgcagt gaacccccac ctcctttgta tttctttttg 40 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CPA1_F <400> 8 tcactgcaga atgatccatc agttg 25 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> CPA1_R <400> 9 gtcgactcta gaggatcctt attttatatt ataag 35 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CPA2_F <400> 10 tcactgcagt atgcagcaaa ggtaa 25 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> CPA2_R <400> 11 gtcgactcta gaggatccgt tttctggctt ataag 35 <210> 12 <211> 32 <212> RNA <213> Artificial Sequence <220> <223> Ampicillin_gRNA <400> 12 cgatacgtgc tccggttccc aacgatcaag ga 32 <210> 13 <211> 31 <212> RNA <213> Artificial Sequence <220> <223> Neomycin_gRNA <400> 13 gacgagttat taatagctga ataagaacgg t 31 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> In-GFP_F <400> 14 atcatggccg acaagcagaa 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> In-GFP_R <400> 15 tctcgttggg gtctttgctc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16S-F <400> 16 tcgcggtttc gctgcccttt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16S-R <400> 17 aagtcccgca acgagcgcaa 20 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> In-CPA1_F <400> 18 gtggtgaaaa agatgctgga aca 23 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> In-CPA1_R <400> 19 tccttgtcaa ctacaacttt tcca 24 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> In-CPA2_F <400> 20 actctcaaaa aggaacagca gga 23 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> In-CPA2_R <400> 21 agtgtctttg cttccagcca 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AmpR_F <400> 22 tgataacact gcggccaact 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AmpR_R <400> 23 tgactccccg tcgtgtagat 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NeoR_F <400> 24 acgggccagt ttgttgaaga 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NeoR_R <400> 25 aagcggccaa tctgattcca 20 <110> JBBiotech <120> Necrotic enteritis vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism <130> CP19-058 <160> 25 <170> KoPatentIn 3.0 <210> 1 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> CPA1 <400> 1 tatgcagcaa aggtaacttt agctaactct caaaaaggaa cagcaggata tatttataga 60 ttcttacacg atgtatcaga gggtaatgat ccatcagttg gaaataatgt aaaagaacta 120 gtagcttaca tatcaactag tggtgaaaaa gatgctggaa cagatgacta catgtatttt 180 ggaatcaaaa caaaggatgg aaaaactcaa gaatgggaaa tggacaaccc aggaaatgat 240 tttatggctg gaagcaaaga cacttatact ttcaaattaa aagatgaaaa tctaaaaatt 300 gatgatatac aaaatatgtg gattagaaaa agaaaatata cagcattccc agatgcttat 360 aagccagaaa ac 372 <210> 2 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> CPA2 <400> 2 aatgatccat cagttggaaa taatgtaaaa gaactagtag cttacatatc aactagtggt 60 gaaaaagatg ctggaacaga tgactacatg tattttggaa tcaaaacaaa ggatggaaaa 120 actcaagaat gggaaatgga caacccagga aatgatttta tggctggaag caaagacact 180 tatactttca aattaaaaga tgaaaatcta aaaattgatg atatacaaaa tatgtggatt 240 agaaaaagaa aatatacagc attcccagat gcttataagc cagaaaacat aaaggtaata 300 gcaaatggaa aagttgtagt tgacaaggat ataaatgagt ggatttcagg aaattcaact 360 tataatataa aataa 375 <210> 3 <211> 31 <212> RNA <213> Artificial Sequence <220> <223> CotG_gRNA <400> 3 tacgttcatc cttaacatat ttttaaaagg a 31 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GFP_F <400> 4 ataaagctta tggtgagcaa g 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GFP_R <400> 5 tatggatcct tacttgtaca g 21 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CotG-Full_F <400> 6 ataaagctta gtgtccctag ctccg 25 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> CotG-Full_R <400> 7 tatctgcagt gaacccccac ctcctttgta tttctttttg 40 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CPA1_F <400> 8 tcactgcaga atgatccatc agttg 25 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> CPA1_R <400> 9 gtcgactcta gaggatcctt attttatatt ataag 35 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CPA2_F <400> 10 tcactgcagt atgcagcaaa ggtaa 25 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> CPA2_R <400> 11 gtcgactcta gaggatccgt tttctggctt ataag 35 <210> 12 <211> 32 <212> RNA <213> Artificial Sequence <220> <223> Ampicillin_gRNA <400> 12 cgatacgtgc tccggttccc aacgatcaag ga 32 <210> 13 <211> 31 <212> RNA <213> Artificial Sequence <220> <223> Neomycin_gRNA <400> 13 gacgagttat taatagctga ataagaacgg t 31 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> In-GFP_F <400> 14 atcatggccg acaagcagaa 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> In-GFP_R <400> 15 tctcgttggg gtctttgctc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16S-F <400> 16 tcgcggtttc gctgcccttt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16S-R <400> 17 aagtcccgca acgagcgcaa 20 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> In-CPA1_F <400> 18 gtggtgaaaa agatgctgga aca 23 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> In-CPA1_R <400> 19 tccttgtcaa ctacaacttt tcca 24 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> In-CPA2_F <400> 20 actctcaaaa aggaacagca gga 23 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> In-CPA2_R <400> 21 agtgtctttg cttccagcca 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AmpR_F <400> 22 tgataacact gcggccaact 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AmpR_R <400> 23 tgactccccg tcgtgtagat 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NeoR_F <400> 24 acgggccagt ttgttgaaga 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NeoR_R <400> 25 aagcggccaa tctgattcca 20
Claims (19)
ii) 상기 바실러스 유래 포자의 표면에 존재하는 포자 코트 단백질인 CotG 단백질;
iii) 상기 포자 코트 단백질에 연결된 펩타이드성 링커(linker);
iv) 상기 링커에 연결되어 발현하는 SEQ ID NO. 1 또는 2 중 선택되는 어느 하나의 돼지의 괴사성장염 항원성 물질;
을 포함하고,
상기 바실러스 유래 포자의 지노믹 DNA의 내인성(endogenous) CotG 로커스(locus)에 외래성(exogenous) CotG를 코딩하는 서열, 링커를 코딩하는 서열, 돼지의 괴사성장염 항원성 물질을 코딩하는 서열이 순서대로 연결되어 있는 서열이 삽입되어 있는 지노믹 DNA를 가진 포자인 것을 특징으로 하는,
면역원성 조성물.
i) Spores from Bacillus;
ii) CotG protein, which is a spore coat protein present on the surface of the Bacillus-derived spores;
iii) a peptide linker linked to the spore coat protein;
iv) SEQ ID NO expressed by linking to the linker. Any one of 1 or 2 selected from pig necrotizing antigenic substance;
Including,
A sequence encoding an exogenous CotG, a sequence encoding a linker, and a sequence encoding an antigenic substance of pig necrotic growth are linked in sequence to the endogenous CotG locus of the genomic DNA of the Bacillus-derived spore. It is characterized in that it is a spore having a genomic DNA into which the sequence is inserted,
Immunogenic composition.
상기 바실러스는 바실러스 서브틸리스(Bacillus subtilis)인 것을 특징으로 하는 면역원성 조성물.
The method of claim 1,
The Bacillus is an immunogenic composition, characterized in that Bacillus subtilis (Bacillus subtilis).
상기 돼지의 괴사성장염 항원성 물질은 SEQ ID NO. 1 및 SEQ ID NO. 2의 공통서열 일부 또는 전체를 포함하는 것을 특징으로 하는 면역원성 조성물.
The method of claim 1,
The porcine necrotizing antigenic substance is SEQ ID NO. 1 and SEQ ID NO. Immunogenic composition comprising part or all of the consensus sequence of 2.
상기 조성물에서 돼지의 괴사성장염 항원성 물질의 농도는 상기 조성물 기준으로 1010 ~1015개/ml 농도인 것을 특징으로 하는 면역원성 조성물.
The method of claim 1,
Immunogenic composition, characterized in that the concentration of the antigenic substance of pig necrotic growth in the composition is 10 10 ~ 10 15 /ml concentration based on the composition.
상기 조성물은 경구 투여용, 복강내 투여용, 정맥내 투여용, 근육내 투여용, 피하 투여용, 내피 투여용, 비내 투여용, 폐내 투여용, 직장내 투여용, 강내 투여용, 복강내 투여용, 경막내 투여용 중 선택되는 어느 하나 이상인 것을 특징으로 하는 면역원성 조성물.
The method of claim 1,
The composition is for oral administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, endothelial administration, intranasal administration, pulmonary administration, rectal administration, intranasal administration, intraperitoneal administration Immunogenic composition, characterized in that any one or more selected from for, for intrathecal administration.
안정제, 유화제, 수산화알루미늄, 인산알루미늄, pH 조정제, 계면활성제, 리포솜, 이스콤 (iscom) 보조제, 합성 글리코펩티드, 증량제, 카복시폴리메틸렌, 세균 세포벽, 세균 세포벽의 유도체, 세균백신, 동물 폭스바이러스 단백질, 바이러스 일부 (subviral) 입자 보조제, 클로스트리디움 퍼프링겐스 독소, N, N-디옥타데실-N',N'-비스(2-하이드록시에틸)-프로판디아민, 모노포스포릴 지질 A, 디메틸디옥타데실-암모늄 브로마이드 중 선택되는 어느 하나 이상을 추가로 포함하는 것을 특징으로 하는 면역원성 조성물.
The method of claim 1,
Stabilizer, emulsifier, aluminum hydroxide, aluminum phosphate, pH adjuster, surfactant, liposome, iscom adjuvant, synthetic glycopeptide, extender, carboxypolymethylene, bacterial cell wall, derivative of bacterial cell wall, bacterial vaccine, animal poxvirus protein , Subviral particle adjuvant, Clostridium pufflingens toxin, N, N-dioctadecyl-N',N'-bis(2-hydroxyethyl)-propanediamine, monophosphoryl lipid A, dimethyl Immunogenic composition, characterized in that it further comprises any one or more selected from dioctadecyl-ammonium bromide.
i) Cas9 단백질 또는 이를 코딩하는 핵산;
ii) 서열번호 3으로 코딩되는 핵산 또는 이로부터 전사된 가이드 RNA(guide RNA);
iii) CotG를 코딩하는 핵산, 링커를 코딩하는 핵산, 돼지의 괴사성장염 항원성 물질인 SEQ ID NO. 1 또는 2 중 적어도 어느 하나를 코딩하는 핵산 및 항생제 저항성 유전자를 코딩하는 핵산을 포함하는 도너;
항생제를 처리하여 상기 바실러스의 게놈 DNA 서열 중 CotG를 코딩하는 서열 내에 상기 도너가 삽입된 게놈 DNA를 가지고 있는 바실러스를 선택하는 단계;
상기 선택되는 바실러스의 게놈 내에 삽입된 상기 항생제 저항성 유전자를 넉아웃 시키는 단계;
상기 항생제 저항성 유전자가 넉아웃된 바실러스로 포자를 형성시키는 단계;
를 포함하는 것을 특징으로 하는 제 1항의 조성물 제조방법.
Steps to introduce the following into Bacillus
i) Cas9 protein or nucleic acid encoding it;
ii) a nucleic acid encoded by SEQ ID NO: 3 or guide RNA transcribed therefrom;
iii) a nucleic acid encoding CotG, a nucleic acid encoding a linker, and SEQ ID NO, which is a porcine necrotizing antigenic substance. A donor comprising a nucleic acid encoding at least one of 1 or 2 and a nucleic acid encoding an antibiotic resistance gene;
Selecting a Bacillus having genomic DNA into which the donor is inserted into a sequence encoding CotG from among the genomic DNA sequences of Bacillus by treatment with antibiotics;
Knocking out the antibiotic resistance gene inserted into the genome of the selected Bacillus;
Forming spores with Bacillus knocked out of the antibiotic resistance gene;
The method for preparing the composition of claim 1, comprising a.
상기 도입은 벡터를 이용하는 것을 특징으로 하는 제조방법.
The method of claim 9,
The introduction method, characterized in that using a vector.
포자를 형성시키는 단계는 영양분이 고갈된 영양학적 조건을 이용하는 방법;및
고온 또는 저온의 온도적 조건을 이용하는 방법;
중 선택되는 어느 하나 이상으로 수행되는 것을 특징으로 하는 제조방법.
The method of claim 9,
The step of forming spores is a method of utilizing nutrient-depleted nutritional conditions; and
A method of using hot or cold temperature conditions;
A manufacturing method characterized in that it is carried out with any one or more selected from.
상기 항생제 저항성 유전자를 넉아웃 시키는 단계는,
항생제 저항성 유전자를 표적으로 하는 가이드 RNA를 포함하는 벡터를 추가로 도입하여 상기 항생제 저항성 유전자를 코딩하는 핵산 서열 내에 인델을 형성시키는 것이고,
상기 항생제 저항성 유전자를 표적으로 하는 가이드 RNA는 SEQ ID NO. 12 또는 SEQ ID NO. 13 중 선택되는 어느 하나이고, 이 때, 각각 암피실린(ampicillin) 저항성 유전자 또는 네오마이신(neomycin) 저항성 유전자를 표적으로 하는 것을 특징으로 하는 제조방법.The method of claim 9,
The step of knocking out the antibiotic resistance gene,
To form indels in the nucleic acid sequence encoding the antibiotic resistance gene by additionally introducing a vector containing a guide RNA targeting the antibiotic resistance gene,
The guide RNA targeting the antibiotic resistance gene is SEQ ID NO. 12 or SEQ ID NO. Any one selected from among 13, wherein each of the ampicillin resistance gene or neomycin resistance gene is targeted.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020190106048A KR102207353B1 (en) | 2019-08-28 | 2019-08-28 | Necrotic enteritis vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020190106048A KR102207353B1 (en) | 2019-08-28 | 2019-08-28 | Necrotic enteritis vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism |
Publications (1)
Publication Number | Publication Date |
---|---|
KR102207353B1 true KR102207353B1 (en) | 2021-01-27 |
Family
ID=74238670
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020190106048A KR102207353B1 (en) | 2019-08-28 | 2019-08-28 | Necrotic enteritis vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102207353B1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US12031128B2 (en) | 2022-04-07 | 2024-07-09 | Battelle Memorial Institute | Rapid design, build, test, and learn technologies for identifying and using non-viral carriers |
-
2019
- 2019-08-28 KR KR1020190106048A patent/KR102207353B1/en active IP Right Grant
Non-Patent Citations (2)
Title |
---|
Infection and Immunity, 제76권, 11호, 페이지 5257-5265(2008)* * |
J Microbiol Biotechnol, 제29권, 2호, 페이지 179-190(2019, 2018.12.14. 온라인 공개)* * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US12031128B2 (en) | 2022-04-07 | 2024-07-09 | Battelle Memorial Institute | Rapid design, build, test, and learn technologies for identifying and using non-viral carriers |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102131927B (en) | Adjustable type gene suicide mechanism combination thing and method | |
CN108779482B (en) | Engineered enterosymbiotic bacteria express heterologous proteins in their Outer Membrane Vesicles (OMVs) for delivery to the gastrointestinal tract | |
Sahoo et al. | A cross talk between the immunization and edible vaccine: Current challenges and future prospects | |
CN104837506A (en) | Immunomodulatory minicells and methods of use | |
JP2008521435A (en) | Mycobacterium electroporation and overexpression of antigens in mycobacteria | |
KR102157964B1 (en) | African swine fever vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism | |
KR20100065243A (en) | Electroporation of mycobacterium and overexpression of antigens in mycobacteria | |
Paccez et al. | Evaluation of different promoter sequences and antigen sorting signals on the immunogenicity of Bacillus subtilis vaccine vehicles | |
JP2017505615A (en) | Therapeutic phages and methods for nucleic acid delivery for therapeutic use | |
Alimolaei et al. | A recombinant probiotic, Lactobacillus casei, expressing the Clostridium perfringens α-toxoid, as an orally vaccine candidate against gas gangrene and necrotic enteritis | |
Kong et al. | Effects of recombinant Lactobacillus casei on growth performance, immune response and disease resistance in crucian carp, Carassius auratus | |
US20220088167A1 (en) | Vaccine composition for preventing tuberculosis, comprising glycosylated ag85a protein and method for preparing same | |
KR102207353B1 (en) | Necrotic enteritis vaccine of porcine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism | |
Zhao et al. | Recombinant Lactobacillus casei expressing Clostridium perfringens toxoids α, β2, ε and β1 gives protection against Clostridium perfringens in rabbits | |
KR102207354B1 (en) | Necrotic enteritis vaccine of chicken using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism | |
KR102212504B1 (en) | Kennel cough vaccine of canine using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism | |
Li et al. | Oral vaccination with recombinant Lactobacillus casei with surface displayed OmpK fused to CTB as an adjuvant against Vibrio mimicus infection in Carassius auratus | |
KR102212503B1 (en) | Scuticocillatosis vaccine of Olive flounder using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism | |
KR102212505B1 (en) | sacbrood vaccine of bees using CRISPR/Cas9 based Bacillus subtilis genome editing mechanism | |
US20050232947A1 (en) | Bacterial spores | |
US9610333B2 (en) | Methods, compositions and kits for vegetative cell-based vaccines and spore-based vaccines | |
KR102107332B1 (en) | Cholera vaccine using CRISPR/Cas9 based Bacillus subtillis genome editing mechanism | |
Wiedig et al. | Induction of CD8+ T cell responses by Yersinia vaccine carrier strains | |
US20050287168A1 (en) | Recombinant spores | |
US7700091B2 (en) | Modified bacteria and methods of use to transform eukaryotic cells |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |